HLA class I-expressing non-human animal
10278373 ยท 2019-05-07
Assignee
Inventors
Cpc classification
G01N33/5008
PHYSICS
A01K2267/0387
HUMAN NECESSITIES
A01K67/0278
HUMAN NECESSITIES
A01K2217/072
HUMAN NECESSITIES
International classification
G01N33/50
PHYSICS
Abstract
This invention provides an HLA class I-expressing non-human animal that can be prepared efficiently in a simple manner within a short period of time, in which the transgene copy number to be introduced thereinto and the integration site of transgene are regulated, and in which the expression level of the transgene and the site of expression thereof are regulated. The invention also provides a method for preparing such non-human animal. In such HLA class I gene knock-in non-human animal, an artificial chimeric gene encoding an artificial chimeric protein comprising a protein composed of 2 microglobulin, HLA class I 1 and 2 regions, and an MHC class I 3 region of a non-human animal ligated in such order from the N terminus is expressed under the control of a transcription regulatory region of 2 microglobulin gene of the non-human animal.
Claims
1. An HLA class I gene knock-in rodent comprising an artificial chimeric gene encoding an artificial chimeric protein comprising 2 microglobulin, HLA class I 1 and 2 regions, and a rodent MHC class I 3 region ligated in such order from the N terminus wherein the artificial chimeric gene (a) is knocked into at least one 2 microglobulin locus of the rodent and (b) is operably linked to an endogenous transcription regulatory region of 2 microglobulin gene of the at least one 2 microglobulin locus of the rodent, wherein the rodent is a mouse or a rat.
2. The HLA class I gene knock-in rodent according to claim 1, wherein the artificial chimeric gene is operably linked to the endogenous transcription regulatory region of 2 microglobulin gene in one 2 microglobulin locus.
3. The HLA class I gene knock-in rodent according to claim 1, wherein the HLA class I 1 and 2 regions are derived from HLA-A.
4. The HLA class I gene knock-in rodent according to claim 3, wherein the HLA-A is HLA-A24, HLA-A3, HLA-A2, or HLA-A31.
5. The HLA class I gene knock-in rodent according to claim 3, wherein the HLA-A is HLA-A2402, HLA-A0301, HLA-A0201, or HLA-A3101.
6. The HLA class I gene knock-in rodent according to claim 1, wherein the rodent comprises two chimeric genes, a first artificial chimeric gene encoding a first artificial chimeric protein comprising 2 microglobulin, HLA class I 1 and 2 regions, and a rodent MHC class I 3 region ligated in such order from the N terminus, wherein the first artificial chimeric gene (a) is knocked into a first 2 microglobulin locus of the rodent and (b) is operably linked to the endogenous transcription regulatory region of 2 microglobulin gene in the first 2 microglobulin locus of the rodent; and a second artificial chimeric gene encoding a second artificial chimeric protein comprising 2 microglobulin, HLA class I 1 and 2 regions, and a rodent MHC class I 3 region ligated in such order from the N terminus, wherein the second artificial chimeric gene (a) is knocked into a second 2 microglobulin locus of the rodent and (b) is operably linked to the endogenous transcription regulatory region of 2 microglobulin gene in the second 2 microglobulin locus of the rodent.
7. The HLA class I gene knock-in rodent according to claim 6, wherein the HLA class I 1 and 2 regions of the first artificial chimeric protein and the HLA class I 1 and 2 regions of the second artificial chimeric protein are derived from HLA of the same genotype.
8. The HLA class I gene knock-in rodent according to claim 6, wherein the HLA class I 1 and 2 regions of the first artificial chimeric protein and the HLA class I 1 and 2 regions of the second artificial chimeric protein are derived from HLA of different genotypes.
9. The HLA class I gene knock-in rodent according to claim 6, wherein the HLA class I 1 and 2 regions of the first artificial chimeric protein and the HLA class I 1 and 2 regions of the second artificial chimeric protein are derived from HLA-A.
10. The HLA class I gene knock-in rodent according to claim 9, wherein the HLA class I 1 and 2 regions of the first artificial chimeric protein and the HLA class I 1 and 2 regions of the second artificial chimeric protein are the same or different, and are derived from HLA-A24, HLA-A3, HLA-A2, or HLA-A31.
11. The HLA class I gene knock-in rodent according to claim 9, wherein the HLA class I 1 and 2 regions of the first artificial chimeric protein and the HLA class I 1 and 2 regions of the second artificial chimeric protein are the same or different, and are derived from HLA-A2402, HLA-A0301, HLA-A0201, or HLA-A3101.
12. The HLA class I gene knock-in rodent according to claim 1, wherein the rodent MHC class I 3 region is derived from H-2 class I.
13. The HLA class I gene knock-in rodent according to claim 12, wherein the rodent MHC class I 3 region is derived from mouse H-2D.sup.b.
14. The HLA class I gene knock-in rodent according to claim 1, wherein the 2 microglobulin is human 2 microglobulin.
15. The HLA class I gene knock-in rodent according to claim 1, wherein the rodent is a mouse.
16. The HLA class I gene knock-in rodent according to claim 15, which has a genotype represented as B2 m.sup.+/(HLA/H-2/B2M) or B2m.sup.(HLA/H-2/B2M)/(HLA/H-2/B2M).
17. A method for preparing an HLA class I gene knock-in rodent, comprising introducing an artificial chimeric gene encoding an artificial chimeric protein comprising 2 microglobulin, HLA class I 1 and 2 regions, and a rodent MHC class I 3 region ligated in such order from the N terminus into a site under the control of an endogenous transcription regulatory region of 2 microglobulin gene of the rodent, wherein the artificial chimeric gene is knocked into at least one 2 microglobulin locus of the rodent and wherein the rodent is a mouse or a rat.
18. The method according to claim 17 further comprising the following steps: (1) preparing a targeting vector comprising the artificial chimeric gene encoding the artificial chimeric protein comprising of 2 microglobulin, HLA class I 1 and 2 regions, and a rodent MHC class I 3 region ligated in such order from the N terminus; and (2) allowing the targeting vector to react with a pluripotent stem cell of the rodent, so as to introduce the targeting vector into a site under the control of the endogenous transcription regulatory region of 2 microglobulin gene of the pluripotent stem cell, wherein the artificial chimeric gene is knocked into at least one 12 microglobulin locus of the pluripotent stem cell.
19. The method according to claim 18, wherein the pluripotent stem cell is an ES cell, GS cell, or iPS cell.
20. The method according to claim 18, wherein the artificial chimeric gene is introduced into the site under the control of the endogenous transcription regulatory region of 2 microglobulin gene of the pluripotent stem cell via homologous recombination.
21. The method according to claim 17, wherein the 2 microglobulin is human 2 microglobulin.
22. A rodent cell that expresses an artificial chimeric gene encoding an artificial chimeric protein comprising 2 microglobulin, HLA class I 1 and 2 regions, and a rodent MHC class I 3 region ligated in such order from the N terminus, wherein the artificial chimeric gene is (a) operably linked to an endogenous transcription regulatory region of 2 microglobulin gene of the rodent cell and (b) is knocked into at least one 2 microglobulin locus of the rodent cell, wherein the rodent is a mouse or a rat.
23. The rodent cell according to claim 22, which is an ES cell, GS cell, or iPS cell.
24. An isolated tissue, isolated organ, isolated cell, primary cell culture, or established cell line that is obtained from the HLA class I gene knock-in rodent according to claim 1.
25. A method for screening for test-substance-specific CTL induction comprising (1) allowing a test substance to react with the HLA class I gene knock-in rodent according to claim 1, a rodent cell that expresses an artificial chimeric gene encoding an artificial chimeric protein comprising 2 microglobulin, HLA class I 1 and 2 regions, and a rodent MHC class I 3 region ligated in such order from the N terminus, wherein the artificial chimeric gene is (a) operably linked to an endogenous transcription regulatory region of 2 microglobulin gene of the rodent cell and (b) is knocked into at least one 2 microglobulin locus of the rodent cell, or an isolated tissue, isolated organ, isolated cell, primary cell culture, or established cell line that is obtained from the HLA class I gene knock-in rodent according to claim 1; and (2) determining whether test-substance-specific CTL is induced.
26. A method for determining the presence or absence of an HLA class I-restricted antigen, comprising (1) allowing a test substance to react with the HLA class I gene knock-in rodent according to claim 1, a rodent cell that expresses an artificial chimeric gene encoding an artificial chimeric protein comprising 2 microglobulin, HLA class I 1 and 2 regions, and a rodent MHC class I 3 region ligated in such order from the N terminus, wherein the artificial chimeric gene is (a) operably linked to an endogenous transcription regulatory region of 2 microglobulin gene of the rodent cell and (b) is knocked into at least one 2 microglobulin locus of the rodent cell, or an isolated tissue, isolated organ, isolated cell, primary cell culture, or established cell line that is obtained from the HLA class I gene knock-in rodent according to claim 1; and (2) determining whether test-substance-specific CTL is induced, wherein the presence of test-substance-specific CTL induction indicates that the test substance comprises an HLA class I-restricted antigen.
27. A method for screening a therapeutic or preventive agent of a disease, comprising (1) reacting a test substance with the HLA class I gene knock-in rodent according to claim 1, a rodent cell that expresses an artificial chimeric gene encoding an artificial chimeric protein comprising 2 microglobulin, HLA class I 1 and 2 regions, and a rodent MHC class I 3 region ligated in such order from the N terminus, wherein the artificial chimeric gene is (a) operably linked to an endogenous transcription regulatory region of 2 microglobulin gene of the rodent cell and (b) is knocked into at least one 2 microglobulin locus of the rodent cell, or an isolated tissue, isolated organ, isolated cell, primary cell culture, or established cell line that is obtained from the HLA class I gene knock-in rodent according to claim 1; and (2) determining whether test-substance-specific CTL is induced, wherein the presence of test-substance-specific CTL induction indicates that the test substance is a therapeutic or preventive agent of a disease.
28. The method according to claim 27, wherein the disease is a cancer or infection.
29. A method for comparing HLA-restricted specificity of CTL reactions induced by test substances, comprising (1) administering test substances to a plurality of different strains of the HLA class I gene knock-in rodent according to claim 1 that express different HLA class I genes and assaying the CTL reactions induced in the plurality of different strains of the HLA class I gene knock-in rodent; and (2) comparing the CTL reactions assayed in the plurality of different strains of the HLA class I gene knock-in rodent and evaluating the HLA-restriction of test substances inducing CTL reactions.
30. A method for evaluating effectiveness of CTL reactions induced by test substances, comprising (1) administering test substances to a plurality of different strains of the HLA class I gene knock-in rodent according to claim 1 that express different HLA class I genes and assaying the CTL reactions induced in the plurality of different strains of the HLA class I gene knock-in rodent; and (2) comparing the CTL reactions assayed in the plurality of different strains of the HLA class I gene knock-in rodent and evaluating the HLA-restriction of test substances inducing CTL reactions.
31. A method for evaluating the safety of a test substance, comprising (1) allowing a test substance to react with the HLA class I gene knock-in rodent according to claim 1; and (2) analyzing unfavorable reactions occurring in the rodent.
32. The method according to claim 31, wherein the unfavorable reactions are autoimmune reactions.
33. The method according to claim 25, wherein the test substances are one or more of peptides, one or more of polypeptides, one or more of oligonucleotides, one or more of polynucleotides, or one or more of proteins.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
MODE FOR CARRYING OUT THE INVENTION
(22) Hereafter, the present invention is described in detail.
(23) The term artificial chimeric protein used herein refers to a fusion protein comprising 2 microglobulin, HLA class I 1 and 2 regions, and an MHC class I 3 region of a non-human animal ligated in such order from the N terminus.
(24) When adjacent protein domains are ligated to each other in the present invention, such adjacent protein domains may be directly bound to each other. Alternatively, adjacent protein domains may be indirectly bound to each other with the aid of an amino acid sequence serving as an adequate spacer therebetween. A conventionally known peptide linker can be used as a spacer, and the number and the type of amino acids constituting such peptide linker are not limited.
(25) The term artificial chimeric gene used herein refers to a gene encoding the artificial chimeric protein described above. More particularly, the term refers to an artificial fusion gene comprising a gene encoding 2 microglobulin, a gene encoding HLA class I 1 and 2 regions, and a gene encoding an MHC class I 3 region of a non-human animal ligated in such order from the N terminus. The genes may be directly bound to each other, or adjacent genes may be indirectly bound to each other with the aid of a nucleotide sequence encoding an amino acid sequence serving as the spacer. For example, a nucleotide sequence encoding a conventionally known peptide linker can be used as a nucleotide sequence encoding an amino acid sequence serving as such spacer. The nucleotide sequence encoding an amino acid sequence serving as the spacer can comprise a restriction enzyme recognition sequence, according to need.
(26) The aforementioned artificial chimeric gene preferably encodes an artificial chimeric protein comprising a protein composed of HLA class I 1 and 2 regions, and a region from MHC class I 3 region of a non-human animal to an intracellular domain bound through its N terminus to 2 microglobulin through its C terminus with the aid of a peptide linker. (While the number and the type of amino acids are not limited, the number of amino acids is preferably about 1 to 100, more preferably about 5 to 50, and particularly preferably about 10 to 30.) Such artificial chimeric gene may comprise HLA class I 1 and 2 regions, and a region from MHC class I 3 region of a non-human animal to an intracellular domain without particular limitation.
(27) The term 2 microglobulin used herein refers to a protein constituting MHC class I chain. The term 2 microglobulin gene used herein refers to a gene of 2 microglobulin constituting MHC class I chain.
(28) The term 2 microglobulin gene used herein may refer to an exogenous 2 microglobulin gene that is not derived from a non-human host animal or an endogenous 2 microglobulin gene that is derived from a non-human host animal. Accordingly, in the artificial chimeric gene of the present invention, the 2 microglobulin gene may be an exogenous 2 microglobulin gene that is not derived from a non-human host animal or an endogenous 2 microglobulin gene that is derived from a non-human animal.
(29) The term non-human animal used herein refers to a mammalian animal, such as a mouse, rat, hamster, guinea pig, rabbit, pig, cow, sheep, cat, or dog, or a bird, reptile, amphibian, or fish. The non-human animal according to the present invention is not particularly limited, provided that such animal comprises the 2 microglobulin loci and a foreign gene can be introduced thereinto. Rodents are preferable, mice or rats are more preferable, and mice are particularly preferable from the viewpoint of breeding and handling.
(30) In the present invention, the 2 microglobulin gene is preferably a human 2 microglobulin gene.
(31) An example of a human 2 microglobulin gene is a gene encoding human 2 microglobulin consisting of the amino acid sequence as shown in SEQ ID NO: 1. For example, a gene consisting of the nucleotide sequence registered at GenBank under Accession Number: NM_004048.2 can be used.
(32) In addition, a polypeptide consisting of an amino acid sequence having deletion, substitution, addition, or insertion of 1 to 10, and preferably 1 to 5 amino acids in the amino acid sequence as shown in SEQ ID NO: 1 and capable of forming a complex with an MHC class I molecule, so as to present the MHC-class-I-specific antigen and a polypeptide consisting of an amino acid sequence having 80% or higher, more preferably 90% or higher, further preferably 95% or higher, and most preferably 99% or higher sequence identity to the amino acid sequence as shown in SEQ ID NO: 1 and capable of forming a complex with an MHC class I molecule, so as to present the MHC-class-I-specific antigen, are within the scope of the human 2 microglobulin according to the present invention. Amino acid sequence comparison can be performed in accordance with a conventional technique. For example, amino acid sequence comparison can be performed with the use of BLAST (i.e., the basic local alignment search tool at the National Center for Biotechnology Information, U.S.A.) using the default settings.
(33) The term gene used herein refers to DNA, RNA, or a DNA/RNA hybrid. The form of the gene is not particularly limited, provided that it encodes a protein or polypeptide of interest.
(34) The term HLA class I used herein refers to human MHC class I, and examples thereof include HLA-A, HLA-B, and HLA-C. The term HLA class I gene used herein refers to a human MHC class I gene, and examples thereof include genes encoding HLA-A, HLA-B, and HLA-C. HLA class I is preferably HLA-A, and more preferably HLA-A24, HLA-A3, HLA-A2, or HLA-A31.
(35) Examples of HLA-A24 include HLA-A2402 consisting of the amino acid sequence as shown in SEQ ID NO: 2 and HLA-A2403 comprising the amino acid sequence as shown in SEQ ID NO: 3. For example, the genes consisting of the nucleotide sequences registered with GenBank under Accession Numbers M64740 and M64741 can be used as genes encoding HLA-A2402 and HLA-A2403, respectively. HLA-A24 is preferably HLA-A2402.
(36) Examples of HLA-A3 include HLA-A0301 consisting of the amino acid sequence as shown in SEQ ID NO: 4 and HLA-A0302 consisting of the amino acid sequence as shown in SEQ ID NO: 5. For example, the genes consisting of the nucleotide sequences registered with GenBank under Accession Numbers L77702.1 and AF217561.1 can be used as genes encoding HLA-A0301 and HLA-A0302, respectively. HLA-A3 is preferably HLA-A0301.
(37) Examples of HLA-A2 include HLA-A0201 consisting of the amino acid sequence as shown in SEQ ID NO: 6 and HLA-A0203 consisting of the amino acid sequence as shown in SEQ ID NO: 7. For example, the genes consisting of the nucleotide sequences registered with GenBank under Accession Numbers AY365426.1 and U03863.1 can be used as genes encoding HLA-A0201 and HLA-A0203, respectively. HLA-A2 is preferably HLA-A0201.
(38) Examples of HLA-A31 include HLA-A3101 consisting of the amino acid sequence as shown in SEQ ID NO: 8 and HLA-A3104 consisting of the amino acid sequence as shown in SEQ ID NO: 9. For example, the genes consisting of the nucleotide sequences registered with GenBank under Accession Numbers M84375.1 and AF148863.1 can be used as genes encoding HLA-A3101 and HLA-A3104, respectively. HLA-A31 is preferably HLA-A3101.
(39) In addition, a polypeptide consisting of an amino acid sequence having deletion, substitution, addition, or insertion of 1 to 10, and preferably 1 to 5 amino acids in the amino acid sequence as shown in any of SEQ ID NOs: 2 to 9 and capable of binding to an antigen peptide at the same or an equivalent level as a polypeptide consisting of the original amino acid sequence and a polypeptide consisting of an amino acid sequence having 80% or higher, more preferably 90% or higher, further preferably 95% or higher, and most preferably 99% or higher sequence identity to the amino acid sequence as shown in any of SEQ ID NOs: 2 to 9 and capable of binding to an antigen peptide at the same or an equivalent level as a polypeptide consisting of the original amino acid sequence are within the scope of the HLA class I in the present invention.
(40) The term HLA class I 1 and 2 regions used herein refers to 1 and 2 regions that are involved in the formation of an antigen peptide-holding groove among the 1, 2, and 3 regions of the HLA class I molecule. The amino acid sequence of the HLA class I 1 and 2 regions and nucleotide sequences encoding the same can be determined on the basis of the HLA class I sequence information registered in a known database, such as the GenBank database described above.
(41) The term MHC class I of a non-human animal used herein refers to MHC class I of an animal other than a human. The term MHC class I gene of a non-human animal used herein refers to a gene encoding an MHC class I of an animal other than a human.
(42) Examples of MHC class I of a non-human animal include mouse H-2, rat RT1, rabbit RLA, and chicken B-locus.
(43) Mouse H-2 class I includes H-2K, H-2D, and H-2L. Examples of H-2K include H-2K.sup.b consisting of the amino acid sequence as shown in SEQ ID NO: 10, H-2K.sup.d consisting of the amino acid sequence as shown in SEQ ID NO: 11, and H-2K.sup.k consisting of the amino acid sequence as shown in SEQ ID NO: 12. For example, genes consisting of the nucleotide sequences registered with GenBank under Accession Numbers U47328.1, U47329.1, and U47330.1 can be used as genes encoding H-2K.sup.b, H-2K.sup.d, and H-2K.sup.k, respectively. Examples of H-2D include H-2D.sup.d consisting of the amino acid sequence as shown in SEQ ID NO: 13 and H-2D.sup.b consisting of the amino acid sequence as shown in SEQ ID NO: 14. For example, genes comprising the nucleotide sequences registered with GenBank under Accession Numbers U47326.1 and U47325.1 can be used as genes encoding H-2D.sup.d and H-2D.sup.b, respectively. An example of H-2L is H-2L.sup.d consisting of the amino acid sequence as shown in SEQ ID NO: 15. For example, a gene consisting of the nucleotide sequence registered with GenBank under Accession Number NM_001267808.1 can be used as a gene encoding H-2L.sup.d.
(44) MHC class I of a non-human animal is preferably mouse H-2 class I, with H-2D.sup.b or H-2K.sup.d being particularly preferable.
(45) In addition, a polypeptide comprising an amino acid sequence having deletion, substitution, addition, or insertion of 1 to 10, and preferably 1 to 5, amino acids in the amino acid sequence as shown in any of SEQ ID NOs: 10 to 15 and capable of binding to a CD8 molecule at the same or an equivalent level as the polypeptide consisting of the original amino acid sequence and a polypeptide consisting of an amino acid sequence having 80% or higher, more preferably 90% or higher, further preferably 95% or higher, and most preferably 99% or higher sequence identity to the amino acid sequence as shown in any of SEQ ID NOs: 10 to 15 and capable of binding to a CD8 molecule at the same or an equivalent level as the polypeptide consisting of the original amino acid sequence are within the scope of the MHC class I of a non-human animal in the present invention.
(46) The term an MHC class I 3 region of a non-human animal used herein refers to an 3 region that is involved in the binding to a co-receptor CD8 molecule expressed on a CTL surface among the 1, 2, and 3 regions of the MHC class I molecule of a non-human animal and an intracellular domain of the MHC class I at the C terminus of such 3 region. When the term MHC class I 3 region of a non-human animal appears in this description without any particular limitation, the term refers to a region from the 3 region to the intracellular domain. The amino acid sequence of the MHC class I 3 region of a non-human animal and the nucleotide sequence encoding the same can be determined on the basis of sequence information concerning the MHC class I of a non-human animal registered in a known database, such as the GenBank database described above.
(47) In order for CTL of the non-human animal according to the present invention to effectively recognize an HLA-antigen complex, the MHC class I 3 region of a non-human animal is preferably substituted with the same MHC region of a non-human animal into which the artificial chimeric gene is to be introduced (Eur. J. Immunol., 26: 97, 1996; J. Immunol., 159: 4753, 1997).
(48) In the artificial chimeric protein of the present invention, genotype combinations of HLA class I 1 and 2 regions, and an MHC class I 3 region of a non-human animal are not particularly limited, provided that the artificial chimeric protein can express and function. When the HLA class I 1 and 2 regions are derived from HLA-A2, the MHC class I 3 region of a non-human animal is preferably derived from mouse H-2D.sup.b. When the 1 and 2 regions are derived from HLA-A24, the mouse 3 region is preferably derived from H-2D.sup.b. When the HLA class I at and 2 regions are derived from HLA-A3, the MHC class I 3 region of a non-human animal is preferably derived from mouse H-2D.sup.b. When the HLA class I 1 and 2 regions are derived from HLA-A31, the MHC class I 3 region of a non-human animal is preferably derived from mouse H-2D.sup.b.
(49) The artificial chimeric gene of the present invention comprises the gene encoding 2 microglobulin, the gene encoding HLA class I 1 and 2 regions, and the gene encoding the MHC class I 3 region of a non-human animal. In addition, such artificial chimeric gene can comprise any nucleotide sequence that enables regulation of expression and translation of the artificial chimeric gene. Examples of such nucleotide sequences include a leader sequence of the HLA class I gene (HLA-A24 gene, in particular) (SEQ ID NO: 40; ATGGCGCCCCGAACCCTCGTCCTGCTACTCTCGGGGGCCCTGACCCAGACCTGGGCG). Such leader sequence is located upstream of the 1 region of the HLA class I gene, and it is involved in localization of proteins expressed by the HLA class I gene on a cell membrane (J. Immunol., 134: 2727, 1985). The leader sequence can be added to the N terminus of the nucleotide sequence encoding 2 microglobulin.
(50) In the present invention, for example: (i) an artificial chimeric gene encoding an artificial chimeric protein comprising a protein composed of human 2 microglobulin, human HLA-A2402 1 and 2 regions, and a mouse H-2D.sup.b 3 region ligated in such order from the N terminus (consisting of the nucleotide sequence as shown in SEQ ID NO: 16); (ii) an artificial chimeric gene encoding an artificial chimeric protein comprising a protein composed of human 2 microglobulin, human HLA-A0301 1 and 2 regions, and a mouse H-2D.sup.b 3 region ligated in such order from the N terminus (consisting of the nucleotide sequence as shown in SEQ ID NO: 17); (iii) an artificial chimeric gene encoding an artificial chimeric protein comprising a protein composed of human 2 microglobulin, human HLA-A0201 1 and 2 regions, and a mouse H-2D.sup.b 3 region ligated in such order from the N terminus (consisting of the nucleotide sequence as shown in SEQ ID NO: 41); and/or (iv) an artificial chimeric gene encoding an artificial chimeric protein comprising a protein composed of human 2 microglobulin, human HLA-A3101 1 and 2 regions, and a mouse H-2D.sup.b 3 region ligated in such order from the N terminus (consisting of the nucleotide sequence as shown in SEQ ID NO: 42) can be used as such artificial chimeric gene.
(51) When the artificial chimeric gene is expressed under the control of a transcription regulatory region of 2 microglobulin gene of the non-human animal herein, an artificial chimeric gene is ligated to a region that regulates expression (transcription) of the endogenous 2 microglobulin gene in the non-human animal in an operable manner. Thus, the artificial chimeric gene expression is regulated by the transcription regulatory region of the 2 microglobulin gene of such non-human animal. The transcription regulatory region comprises a promoter region and an enhancer region of the 2 microglobulin gene of the non-human animal.
(52) When the artificial chimeric gene is ligated in an operable manner, such artificial chimeric gene may be ligated and positioned in any manner, provided that the gene expression is induced under the control of the transcription regulatory region of the 2 microglobulin gene of the non-human animal. When an artificial chimeric gene uses an endogenous 2 microglobulin gene derived from a non-human host animal as the 2 microglobulin gene, for example, a gene encoding HLA class I 1 and 2 regions, and a gene encoding an MHC class I 3 region of a non-human animal may be ligated in such order to the 3 terminus of the endogenous 2 microglobulin gene (excluding the termination codon). Thus, such artificial chimeric gene may be inserted (knocked in) and positioned.
(53) When an artificial chimeric gene uses an exogenous 2 microglobulin gene that is not derived from a non-human host animal as the 2 microglobulin gene, in contrast, an artificial chimeric gene encoding an artificial chimeric protein comprising a protein composed of human 2 microglobulin, HLA class I 1 and 2 regions, and an MHC class I 3 region of a non-human animal ligated in such order from the N terminus may be inserted into a position downstream of the first methionine of the endogenous 2 microglobulin gene of the non-human animal. Thus, the artificial chimeric gene may be knocked in and positioned in the 2 microglobulin locus of the non-human animal.
(54) When a gene is knocked in or knocked in into the 2 microglobulin locus in the present invention, a gene of interest is introduced via homologous recombination, so that the artificial chimeric gene is positioned under the control of the transcription regulatory region of the 2 microglobulin gene of a non-human animal, and the artificial chimeric protein is then expressed. When an artificial chimeric gene uses an endogenous 2 microglobulin gene derived from a non-human host animal as the 2 microglobulin gene, specifically, a gene encoding HLA class I 1 and 2 regions, and a gene encoding an MHC class I 3 region of a non-human animal are ligated in such order to the 3 terminus of the endogenous 2 microglobulin gene (excluding the termination codon), so as to construct the artificial chimeric gene. When an artificial chimeric gene uses an exogenous 2 microglobulin gene that is not derived from a non-human host animal (preferably the human 2 microglobulin gene) as the 2 microglobulin gene, an artificial chimeric gene encoding an artificial chimeric protein comprising a protein composed of human 2 microglobulin, HLA class I 1 and 2 regions, and an MHC class I 3 region of a non-human animal ligated in such order from the N terminus is inserted into and positioned downstream of the first methionine of the endogenous 2 microglobulin gene of a non-human animal.
(55) In the present invention, the artificial chimeric gene may be knocked in into either locus or both loci of a pair of 2 microglobulin loci of the non-human animal.
(56) When the artificial chimeric gene is knocked in into one of the 2 microglobulin loci, the non-human animal comprises a copy of the artificial chimeric gene in the 2 microglobulin locus.
(57) When the artificial chimeric genes are knocked in into both loci of the 2 microglobulin loci, the non-human animal occasionally comprises 2 copies of the artificial chimeric genes of the same genotype in the 2 microglobulin loci, or the non-human animal occasionally comprises a copy of the artificial chimeric genes of different genotypes in each 2 microglobulin locus.
(58) The artificial chimeric gene is occasionally knocked in into one of the 2 microglobulin loci of the non-human animal, and an artificial chimeric protein encoded by the artificial chimeric gene comprises HLA class I 1 and 2 regions. In such a case, HLA class I is preferably HLA-A, more preferably HLA-A24, HLA-A3, HLA-A2, or HLA-A31, and further preferably HLA-A2402, HLA-A0301, HLA-A0201, or HLA-A3101.
(59) The artificial chimeric genes are occasionally knocked in into both loci of the 2 microglobulin loci of the non-human animal, and artificial chimeric proteins encoded by the both artificial chimeric genes each comprise HLA class I 1 and 2 regions. In the case of the same HLA class I genotype, HLA class I is preferably HLA-A, more preferably HLA-A24, HLA-A3, HLA-A2, or HLA-A31, and further preferably HLA-A2402, HLA-A0301, HLA-A0201, or HLA-A3101.
(60) The artificial chimeric genes are occasionally knocked in into both loci of the 2 microglobulin loci of the non-human animal, and artificial chimeric proteins encoded by the both artificial chimeric genes each comprise HLA class I 1 and 2 regions. In the case of different HLA class I genotypes, HLA class I genes are preferably different HLA-A, more preferably two types of HLA-A selected from the group consisting of HLA-A24, HLA-A3, HLA-A2, and HLA-A31, further preferably two types of HLA-A selected from the group consisting of HLA-A2402, HLA-A0301, HLA-A0201, and HLA-A3101, and still further preferably HLA-A2402 or HLA-A0301.
(61) The HLA class I gene knock-in non-human animal according to the present invention may comprise other genetic mutations, in addition to the artificial chimeric genes. Examples of other genetic mutations include mutations of immunologically relevant genes, such as I12rg, Prkdc, Foxn1, and Rag1, cancer genes, such as Ras, Src, and Myc, and cancer suppressor genes, such as p53 and Apc.
(62) When a non-human animal is a mouse, in the present invention, an HLA class I-expressing non-human animal is an HLA class I-expressing mouse. A genotype of such mouse is preferably B2m.sup.+/(HLA-H-2/B2M) or B2m.sup.(HLA-H-2/B2M)(HLA/H-2/B2M), more preferably B2m.sup.(HLA-A24/H-2/B2M)(HLA-A24/H-2/B2M), B2m.sup.+/(HLA-A24/H-2/B2M), B2m.sup.(HLA-A3/H-2/B2M)/(HLA-A3/H-2/B2M), B2m.sup.+/(HLA-A3/H-2/B2M), B2m.sup.(HLA-A2/H-2/B2M)/(HLA-A2/H-2/B2M), B2m.sup.+/(HLA-A2/H-2/B2M), B2m.sup.(HLA-A31/H-2/B2M)/(HLA-A31/H-2/B2M), B2m.sup.+/(HLA-A31/H-2/B2M), B2m.sup.(HLA-A24/H-2/B2M)/(HLA-A3/H-2/B2M), B2m.sup.(HLA-A24/H-2/B2M)/(HLA-A2/H-2/B2M), B2m.sup.(HLA-A24/H-2/B2M)/(HLA-A31/H-2/B2M)B2m.sup.(HLA-A3/H-2/B2M/(HLA-A2/H-2/B2M), B2m.sup.(HLA-A3/H-2/B2M)/(HLA-A31/H-2/B2M), or B2m.sup.(HLA-A2/H-2/B2M)/(HLA-A31/H-2/B2M) and further preferably B2m.sup.(HLA-A2402/H-2/B2M)/(HLA-A2402/H-2/B2M), B2m.sup.+/(HLA-A2402/H-2/B2M), B2m.sup.(HLA-A0301/H-2/B2M)/(HLA-A0301/H-2/B2M), B2m.sup.(HLA-A0301/H-2/B2M), B2m.sup.(HLA-A0201/H-2/B2M)/(HLA-A0201/H-2/B2M), B2m.sup.(HLA-A0201/H-2/B2M), B2m.sup.(HLA-A3101/H-2/B2M)/(HLA-A3101/H-2/B2M), B2m.sup.+/(HLA-A3101/H-2/B2M), B2m.sup.(HLA-A2402/H-2/B2M)/(HLA-A0301/H-2/B2M), B2m.sup.(HLA-A2402/H-2/B2M)/(HLA-A0201/H-2/B2M), B2m.sup.(HLA-A2402/H-2/B2M)/(HLA-A3101/H-2/B2M), B2m.sup.(HLA-A0301/H-2/B2M)/(HLA-A0201/H-2/B2M), B2m.sup.(HLA-A0301/H-2/B2M)/(HLA-A3101/H-2/B2M), or B2m.sup.(HLA-0201/H-2/B2M)/(HLA-A3101/H-2/B2M).
(63) Such genotype is still further preferably B2m.sup.+/(HLA/H-2D/B2M) or B2m.sup.(HLA/H-2D/B2M)/(HLA/H-2D/B2M), furthermore preferably B2m.sup.(HLA-A24/H-2D/B2M)/(HLA-A24/H-2D/B2M), B2m.sup.+/(HLA-A24/H-2D/B2M), B2m.sup.(HLA-A3/H-2D/B2M)/(HLA-A3/H-2D/B2M), B2m.sup.+/(HLA-A3/H-2D/B2M), B2m.sup.(HLA-A2/H-2D/B2M)/(HLA-A2/H-2D/B2M), B2m.sup.+/(HLA-A2/H-2D/B2M), B2m.sup.(HLA-A31/H-2D/B2M)/(HLA-A31/H-2D/B2M), B2m.sup.+/(HLA-A31/H-2D/B2M), B2m.sup.(HLA-A24/H-2D/B2M)/(HLA-A3/H-2D/B2M), B2m.sup.(HLA-A24/H-2D/B2M)/(HLA-A2/H-2D/B2M), B2m.sup.(HLA-A24/H-2D/B2M)/(HLA-A31/H-2D/B2M), B2m.sup.(HLA-A3/H-2D/B2M)/(HLA-A2/H-2D/B2M), B2m.sup.(HLA-A3/H-2D/B2M)/(HLA-A31/H-2D/B2M), or B2m.sup.(HLA-A2/H-2D/B2M)/(HLA-A31/H-2D/B2M), and still furthermore preferably B2m.sup.(HLA-A2402/H-2d/B2M)/(HLA-A2402/H-2D/B2M), B2m.sup.+/(HLA-A2402/H-2D/B2M), B2m.sup.(HLA-A0301/H-2D/B2M)/(HLA A0301/H-2D/B2M), B2m.sup.(HLA-A0301/H-2D/B2M), B2m.sup.(HLA-A0201/H-2D/B2M)/(HLA-A0201/H-2D/B2M), B2m.sup.+/(HLA-A0201/H-2D/B2M), B2m.sup.(HLA-A3101/H-2D/B2M)/(HLA-A3101/H-2D/B2M), B2m.sup.(HLA-A3101/H-2D/B2M), B2m.sup.(HLA-A2402/H-2D/B2M)/(HLA-A0301/H-2D B2M), B2m.sup.(HLA-A2402/H-2D/B2M)/(HLA-A0201/H-2D/B2M), B2m.sup.(HLA-A2402/H-2D/B2M)/(HLA-A3101/H-2D/B2M), B2m.sup.(HLA-A0301/H-2D/B2M)/(HLA-A0201/H-2D/B2M), B2m.sup.(HLA-A0301/H-2D/B2M)/(HLA-A3101/H-2D/B2M), or B2m.sup.(HLA-A0201/H-2D/B2M)/(HLA-A3101/H-2D/B2M).
(64) It is particularly preferable that such genotype be B2m.sup.+/(HLA/H-2Db/B2M), or B2m.sup.(HLA/H-2Db/B2M)/(HLA/H-2Db/B2M), and more preferably B2m.sup.(HLA-A24/H-2Db/B2M)/(HLA-A24/H-2Db/B2M), B2m.sup.+/(HLA-A24/H-2Db/B2M), B2m.sup.(HLA-A3/H-2Db/B2M)/(HLA-A3/H-2Db/B2M), B2m.sup.+/(HLA-A3/H-2Db/B2M), B2m.sup.(HLA-A2/H-2Db/B2M)/(HLA-A2/H-2Db/B2M), B2m.sup.+/(HLA-A-2/H-2Db/B2M), B2m.sup.(HLA-A31/H-2Db/B2M)/(HLA-A31/H-2Db/B2M), B2m.sup.+/(HLA-A31/H-2Db/B2M), B2m.sup.(HLA-A24/H-2Db/B2M)/(HLA-A3/H-2Db/B2M), B2m.sup.(HLA-A24/H-2Db/B2M)/(HLA-A2/H-2Db/B2M), B2m.sup.(HLA-A24/H-2Db/B2M)/(HLA-A31/H-2Db/B2M), B2m.sup.(HLA-A3/H-2Db/B2M)/(HLA-A2/H-2Db/B2M), B2m.sup.(HLA-A3/H-2Db/B2M)/(HLA-A31/H-2Db/B2M), or B2m.sup.(HLA-A2/H-2Db/B2M)/(HLA-A31/H-2Db/B2M). It is particularly preferable that such genotype be B2m.sup.(HLA-A2402/H-2Db/B2M)/(HLA-A2402/H-2Db/B2M), B2m.sup.+/(HLA-A2402/H-2Db/B2M), B2m.sup.(HLA-A0301/H-2Db/B2M)/(HLA-A0301/H-2Db/B2M), B2m.sup.+/(HLA-A0301/H-2Db/B2M), B2m.sup.(HLA-A0201/H-2Db/B2M)/(HLA-A0201/H-2Db/B2M), B2m.sup.+/(HLA-A0201/H-2Db/B2M), B2m.sup.(HLA-A3101/H-2Db/B2M)/(HLA-A3101/H-2Db/B2M), B2m.sup.+/(HLA-A3101/H-2Db/B2M), B2m.sup.(HLA-A2402/H-2Db/B2M)/(HLA-A0301/H-2Db/B2M), B2m.sup.(HLA-A2402/H-2Db/B2M)/(HLA-A0201/H-2Db/B2M), B2m.sup.(HLA-A2402/H-2Db/B2M)/(HLA-A3101/H-2Db/B2M), B2m.sup.(HLA-A0301/H-2Db/B2M)/(HLA-A0201/H-2Db/B2M), B2m.sup.(HLA-A0301/H-2Db/B2M)/(HLA-A3101/H-2Db/B2M), or B2m.sup.(HLA-A0201/H-2Db/B2M)/(HLA-A3101/H-2Db/B2M).
(65) The HLA class I gene knock-in non-human animal of the present invention can be prepared by, for example, the method described below, although the method of preparation is not limited thereto. A person skilled in the art can adequately modify a technique of genetic engineering, such as gene recombination, that is generally employed in the art.
(66) The HLA class I gene knock-in non-human animal of the present invention occasionally uses an exogenous 2 microglobulin gene that is not derived from a non-human host animal as the 2 microglobulin gene (hereafter, this method is referred to as Method I). In such a case, an artificial chimeric gene encoding an artificial chimeric protein comprising a protein composed of 2 microglobulin, HLA class I 1 and 2 regions, and an MHC class I 3 region of a non-human animal ligated in such order from the N terminus can be knocked in into 2 microglobulin loci of such non-human animal.
(67) More specifically, the HLA class I gene knock-in non-human animal of the present invention can be prepared by a method comprising the following steps:
(68) (1) preparing a targeting vector comprising an artificial chimeric gene encoding an artificial chimeric protein comprising a protein composed of 2 microglobulin, HLA class I 1 and 2 regions, and an MHC class I 3 region of a non-human animal ligated in such order from the N terminus; and
(69) (2) allowing the targeting vector to act on a pluripotent stem cell of the non-human animal, so as to introduce the artificial chimeric gene into 2 microglobulin locus in the pluripotent stem cell.
(70) The term pluripotent stein cell used herein refers to a cell that is capable of differentiating into a plurality of cell lines (i.e., pluripotency) and is also capable of maintaining pluripotency through successive cell divisions (i.e., auto-reproducibility). Examples thereof include embryonic stem (ES) cells, germline stem (GS) cells, and induced pluripotent stem (iPS) cells.
(71) The HLA class I gene knock-in non-human animal of the present invention occasionally uses an endogenous 2 microglobulin gene that is derived from a non-human host animal as the 2 microglobulin gene (hereafter, this method is referred to as Method II). In such a case, a transgene encoding a protein comprising HLA class I 1 and 2 regions, and an MHC class I 3 region of a non-human animal ligated in such order from the N terminus may be knocked in into the 3 terminus of the endogenous 2 microglobulin gene (excluding the termination codon) of the non-human animal.
(72) More specifically, the HLA class I gene knock-in non-human animal of the present invention can be prepared by a method comprising the following steps:
(73) (1) preparing a targeting vector comprising a transgene encoding a protein comprising HLA class I 1 and 2 regions, and an MHC class I 3 region of a non-human animal ligated in such order from the N terminus; and
(74) (2) allowing the targeting vector to act on a pluripotent stem cell of the non-human animal, and introducing the transgene into the 3 terminus of the 2 microglobulin gene of the pluripotent stem cell (excluding the termination codon), so as to construct the artificial chimeric gene with the endogenous 2 microglobulin gene.
(75) The artificial chimeric gene or the transgene can be introduced into a pluripotent stem cell in accordance with, for example, a method known in the art. For example, a method of gene introduction via homologous recombination can be employed. Specifically, the method described in Gene Targeting (Sedivy, J. M. and Joyner, A. L., 1992) or a method involving the use of artificial nucleases, such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALEN), or CRISPR/Cas systems can be employed.
(76) When the method described in Gene Targeting (Sedivy J. M. and Joyner, A. L., 1992) is employed, for example, the non-human animal according to the present invention can be prepared in the manner described below. Methods for preparing the non-human animal according to the present invention are not limited thereto.
(77) In accordance with Method I, the artificial chimeric gene is prepared via cloning of gene fragments each encoding human 2 microglobulin, HLA class I 1 and 2 regions, and an MHC class I 3 region of a non-human animal. A gene fragment can be a DNA fragment. A method of cloning is not particularly limited, as long as a target gene fragment can be obtained. For example, PCR can be employed. As a template, any cell or DNA library that carries a target gene may be used. For example, total RNA or genomic DNA prepared from a human cell can be used. As a human cell line, for example, a human tumor cell line (e.g., SW620 or HepG2) can be used. As described in the examples, the full-length gene sequence can be artificially synthesized.
(78) With the use of three types of DNA fragments obtained above, an artificial chimeric gene encoding an artificial chimeric protein comprising a protein composed of 2 microglobulin, HLA class I 1 and 2 regions, and an MHC class I 3 region of a non-human animal ligated in such order from the N terminus is prepared.
(79) A method of preparing such artificial chimeric gene is not particularly limited, provided that an artificial chimeric gene encoding an artificial chimeric protein comprising a protein composed of 2 microglobulin, HLA class I 1 and 2 regions, and an MHC class I 3 region of a non-human animal ligated in such order from the N terminus is constructed at the end. According to need, a restriction enzyme recognition sequence can be provided at the 5 terminus or 3 terminus of a gene fragment encoding 2 microglobulin, a gene fragment encoding HLA class I 1 and 2 regions, and a gene fragment encoding an MHC class I 3 region of a non-human animal.
(80) For example, a gene fragment comprising a sequence encoding human 2 microglobulin comprising a restriction enzyme (e.g., NcoI) recognition sequence at the 5 terminus and a restriction enzyme (e.g., BamHI) recognition sequence at the 3 terminus is ligated to a gene fragment comprising a sequence encoding an MHC class I 3 region of a non-human animal comprising a restriction enzyme (e.g., BamHI) recognition sequence at the 5 terminus and a restriction enzyme (e.g., SwaI) recognition sequence at the 3 terminus with the aid of the restriction enzyme (e.g., BamHI) recognition sequence. The resultant is then cloned into an adequate vector, such as pBluescript, that has been modified to carry a restriction enzyme (e.g., NcoI) recognition sequence and a restriction enzyme (e.g., SwaI) recognition sequence. The resulting vector is digested with a restriction enzyme (e.g., BamHI), and a gene fragment comprising sequences encoding HLA class I 1 and 2 regions to which a restriction enzyme (e.g., BamHI) recognition sequence and a restriction enzyme (e.g., BglII) recognition sequence are added to the 5 terminus and the 3 terminus, respectively, is inserted. In such a case, a target product can be obtained by selecting a clone comprising a restriction enzyme (e.g., BamHI) recognition sequence of a gene fragment comprising a sequence encoding human 2 microglobulin ligated to a restriction enzyme (e.g., BamHI) recognition sequence of a gene fragment comprising a sequence encoding HLA class I 1 and 2 regions and a restriction enzyme (e.g., BamHI) recognition sequence of a gene fragment comprising a sequence encoding an MHC class I 3 region of a non-human animal ligated to a restriction enzyme (e.g., BglII) recognition sequence of a gene fragment comprising a sequence encoding HLA class I 1 and 2 regions.
(81) Subsequently, a genome fragment comprising upstream and downstream regions of the first methionine of the 2 microglobulin gene of a non-human animal is cloned. Such genome fragment can be derived from a non-human animal into which an artificial chimeric gene is to be introduced. The non-human animal can be a mouse. The method of cloning is not particularly limited, as long as a target genome fragment can be obtained. For example, PCR can be employed. As a template, any cell or DNA library that carries a target sequence may be used. For example, a BAC clone comprising a target sequence, genomic DNA prepared from a cell, or a genomic DNA library can be used. A BAC clone, genomic DNA prepared from a cell, or a genomic DNA library may be derived from a mouse.
(82) The genome fragment is not particularly limited, provided that it is long enough to cause homologous recombination in a pluripotent stem cell, such as an ES cell. It is preferable that a sequence be designed to have a disruption of a functional mouse 2 microglobulin gene as a result of homologous recombination and that artificial chimeric gene expression be controlled by a mouse 2 microglobulin gene promoter/enhancer.
(83) The mouse DNA fragment obtained above, the artificial chimeric gene, a positive selection marker, and a negative selection marker are ligated to each other, so as to construct a targeting vector (hereafter, it is referred to as Targeting Vector I). Examples of positive selection markers that can be used include a neomycin resistant gene, a hygromycin resistant gene, and a puromycin resistant gene. Examples of negative selection markers that can be used include a diphteria toxin A fragment and a thymidine kinase gene of the simple herpes virus.
(84) A nucleotide sequence encoding a peptide linker and/or a restriction enzyme recognition sequence that are suitable for ligation can be adequately prepared, so as to ligate fragments.
(85) In accordance with Method II, gene fragments each encoding HLA class I 1 and 2 regions, and an MHC class I 3 region of a non-human animal are cloned in the same manner as in Method I in order to prepare a transgene.
(86) A transgene encoding a protein comprising HLA class I 1 and 2 regions, and an MHC class I 3 region of a non-human animal ligated in such order from the N terminus is prepared using the resulting DNA fragment. A transgene can be prepared in accordance with the method for preparing an artificial chimeric gene of Method I.
(87) Subsequently, a genome fragment comprising the 3 terminus of the 2 microglobulin gene of a non-human animal (excluding a termination codon) and a region downstream thereof is cloned in accordance with Method I.
(88) The genome fragment is not particularly limited, provided that it is long enough to cause homologous recombination in a pluripotent stem cell, such as an ES cell. It is preferable that a sequence be designed to constitute an artificial chimeric gene comprising a gene encoding HLA class I 1 and 2 regions, and a gene encoding an MHC class I 3 region of a non-human animal ligated in such order from the 3 terminus of a mouse endogenous 2 microglobulin gene (excluding a termination codon) as a result of homologous recombination. In addition, it is preferable that artificial chimeric gene expression be controlled by a mouse 2 microglobulin gene promoter/enhancer.
(89) The mouse DNA fragment obtained above, the transgene, the positive selection marker, and the negative selection marker are ligated to each other, so as to construct a targeting vector (hereafter, it is referred to as Targeting Vector II).
(90) Subsequently, Targeting Vector I comprising the artificial chimeric gene or Targeting Vector II comprising the transgene is introduced into a non-human animal cell. A non-human animal cell can be a pluripotent stem cell of a non-human animal. A pluripotent stem cell of a non-human animal can be, for example, a mouse ES cell. Examples of mouse ES cells include ES cells derived from the mouse line 129 and those derived from the mouse line C57BL/6, with ES cells derived from the mouse line 129 being preferable.
(91) Targeting Vector I or II can be introduced into a non-human animal in accordance with various techniques, provided that a gene can be introduced into a cell. For example, electroporation, calcium phosphate co-precipitation, or lipofection can be employed. Such a technique can be employed in combination with a method involving the use of artificial nucleases such as zinc finger nucleases (ZFNs) or transcription activator-like effector nucleases (TALEN) that are designed to be knocked in into a target gene locus. Thus, a gene of interest can be knocked in with high efficiency.
(92) Pluripotent stem cells, such as ES cells, into which the targeting vector has been introduced are sowed on feeder cells exhibiting resistance to specific antibiotics, and culture is conducted in the presence of such specific antibiotics. Resistant colonies surviving 6 to 8 days after the initiation of selection culture are selected, some of the selected colonies are subjected to subculture, and remaining cells are analyzed via PCR to determine whether or not homologous recombination took place. The PCR-positive clones are subjected to Southern hybridization to detect random integration, and clones in which random integration is not detected are subjected to the following process.
(93) Blastocyst-stage embryos are extracted from a pregnant mouse exhibiting a hair color different from that of the ES cells used, and about 10 homologously recombined ES cells described above are injected into the segmentation cavity via micromanipulation. Alternatively, ES cells may be implanted into the 8-cell-stage embryos by the aggregation method. The embryos are implanted into the uterus of the pseudopregnant female mouse, and the mouse is induced to become pregnant and give birth. Thus, a chimeric mouse can be prepared.
(94) When the resulting chimeric male mouse is subjected to crossing with a female mouse exhibiting a hair color different from that of the ES cells used and the resulting offspring exhibits a hair color derived from the ES cells, transfer of the ES cells into the germ lines can be confirmed in addition, an offspring genotype may be analyzed via PCR, and heterozygous knock-in mice carrying an artificial chimeric gene in the 2 microglobulin loci (i.e., mice comprising an artificial chimeric gene knocked in into one of the pair of the mouse 2 microglobulin genes under the control of the transcription regulatory region) can be identified.
(95) The resulting heterozygous mice are subjected to crossing with each other, so that homozygous knock-in mice carrying artificial chimeric genes (i.e., mice comprising artificial chimeric genes knocked in into both loci of the pair of the mouse 2 microglobulin genes under the control of the transcription regulatory region) can be identified.
(96) Two different knock-in mouse lines carrying artificial chimeric genes that contain different HLA class I genes are subjected to crossing with each other such that heterozygous humanized mice can be prepared. The heterozygous humanized mice would comprise a copy of the artificial chimeric gene containing the HLA class I gene inserted into each site of the pair of the 2 microglobulin loci. The HLA class I genes contained in the artificial chimeric genes differ from one another at each sites.
(97) Whether or not artificial chimeric genes are expressed on the cell surface in the prepared knock-in mice can be investigated by, for example, recovering blood cells or spleen cells from knock-in mice and analyzing the recovered blood cells or spleen cells via flow cytometry. Since heterozygous mice retain the wild-type 2 microglobulin loci, mouse H-2 class I genes are also expressed. In contrast, homozygous mice can be identified as MHC class I humanized mouse in which mouse H-2 class I gene expression is lost and expression of the introduced artificial chimeric genes is selectively observed.
(98) Whether or not the non-human animals of the present invention can be used as human models can be examined by any technique known in the art. For example, antigens restricted by HLA class I contained in the introduced artificial chimeric genes are allowed to act on the HLA class I gene knock-in non-human animals of the present invention, and the induction of antigen-specific CTL is inspected. An example of a representative method for inspection when non-human animals are mice is described below.
(99) For example, the known HLA class I-restricted antigen peptides that have been introduced are mixed with the Freund's incomplete adjuvant in accordance with a conventional technique, so as to prepare an emulsion. The emulsion is administered subcutaneously to the HLA class I gene knock-in mice of the present invention at a site in the vicinity of the tail head. Alternatively, the emulsion may be administered subcutaneously into the back or intraperitoneally. Lymph nodes are extracted from the groin of the mouse 1 week after the final administration, and lymph node cells are prepared in accordance with a conventional technique. Cells prepared from other tissues such as spleen cells can also be used.
(100) The prepared cells are cultured for about a week in the presence of antigen peptides and cytokines (e.g., interleukins 2, 15, or 21), and the release of cytokines such as interleukin 2 or interferon from T cells is analyzed via ELISPOT assays based on the Sandwich ELISA principles or other techniques. Thus, CTL induction can be investigated. In this case, spleen cells obtained from un-immunized knock-in mice may be irradiated with X-rays and can be used as antigen-presenting cells, and cultured in the presence of lymph node cells. For example, a significant increase in the amounts of various cytokines produced by CTL induced upon antigen stimulation, in comparison with the case of negative control administration, is confirmed. Thus, whether or not the non-human animals of the present invention can be used as human models can be confirmed.
(101) In such case, target cells that express the same HLA class I genes as the non-human animal according to the present invention are further added, and cytotoxic activity on the target cells is evaluated. Thus, whether or not the non-human animals of the present invention can be used as human models can be determined. Examples of target cells that can be used include cells isolated from the non-human animal according to the present invention, cells into which the artificial chimeric genes have been introduced, and cells that naturally express the HLA class I gene. In such a case, .sup.51Cr-release assays (Int. J. Cancer, 58: 317, 1994) or other techniques can be employed. Specifically, the target cells are labeled with .sup.51Cr, the labeled target cells are pulsed with the target antigens, samples derived from the non-human animal according to the present invention (e.g., spleen cells) are added thereto, and the amount of .sup.51Cr released when the target cells are damaged by CTL is assayed. If antigen-specific CTL induction is observed as a result of such assays, it can be determined that the non-human animal according to the present invention can be used as a human model.
(102) The present invention also provides an isolated tissue, isolated organ, isolated cell, primary cultured cell, or established cell line obtained from the HLA class I gene knock-in non-human animal according to the present invention. Tissues or organs are preferably the thymic gland, the spleen, the bone marrow, hematopoietic tissue, or lymph tissue. Preferable cells are antigen presenting cells, T cells, B cells, or hematopoietic stem cells.
(103) The present invention also provides a cell that expresses an artificial chimeric gene encoding an artificial chimeric protein comprising a protein composed of 2 microglobulin, HLA class I 1 and 2 regions, and an MHC class I 3 region of a non-human animal ligated in such order from the N terminus under the control of a transcription regulatory region of 2 microglobulin gene of the non-human animal. In artificial chimeric genes expressed in such cell, the 2 microglobulin gene may be an exogenous 2 microglobulin gene that is not derived from a non-human host animal cell or an endogenous 2 microglobulin gene that is derived from a non-human animal cell. Such cell can be prepared by introducing Targeting Vector I or II into a non-human animal cell in accordance with the technique described above. A non-human animal cell is preferably a pluripotent stem cell derived from a non-human animal, and more preferably an ES cell or iPS cell derived from a non-human animal. Such cell may be isolated or induced from an HLA class I gene knock-in non-human animal.
(104) Hereafter, methods of the use of the HLA class I gene knock-in non-human animal of the present invention, derivatives thereof (e.g., cells and organs), cells that express the artificial chimeric gene of the present invention, and derivatives thereof (e.g., organs prepared from iPS cells when cells that express artificial chimeric genes are iPS cells) are described, although methods are not limited thereto.
(105) The HLA class I gene knock-in non-human animal of the present invention, derivatives thereof (e.g., cells and organs), cells that express the artificial chimeric gene of the present invention, and derivatives thereof (e.g., organs prepared from iPS cells when cells that express artificial chimeric genes are iPS cells) can be used for screening for a test-substance-specific CTL inducer, determination of the presence or absence of the HLA class I-restricted antigen, screening for a therapeutic or preventive agent for a disease (e.g., cancer), comparison of HLA-restricted specificity of CTL reactions induced by a test substance, evaluation of effectiveness of CTL reactions induced by a test substance, evaluation of the safety of a test substance (e.g., the risk that test substance poses for induction of an autoimmune reaction), or other purposes.
(106) More specifically, for example, a test substance is administered to the HLA class I gene knock-in non-human animal of the present invention, and the capacity of the test substance for CTL induction is assayed and evaluated. Thus, a CTL inducer can be screened for, the presence or absence of the HLA class I-restricted antigen can be determined, and/or a therapeutic or preventive agent for a disease can be screened for. Examples of test substances include known tumor antigen proteins, partial peptides thereof, viruses, virus-derived antigen proteins, partial peptides thereof, bacteria-derived antigen proteins, antigen peptides thereof, proteins and peptides with unknown activity, and polynucleotides or oligonucleotides encoding such substances. The capacity for CTL induction can be assayed and evaluated in accordance with the above-mentioned method of evaluation used for the HLA class I gene knock-in non-human animal (e.g., .sup.51Cr-release assays (Int. J. Cancer, 58: 317, 1994)). When the test substance is found to be capable of CTL induction, it becomes apparent that such test substance contains an HLA class I-restricted antigen and that the test substance is capable of serving as a CTL inducer. The CTL inducer thus obtained can be used as a therapeutic and/or preventive agent for a tumor or a virus or bacteria infection. Through administration of a test substance to the HLA class I gene knock-in non-human animal of the present invention and assays and evaluation of the capacity of the test substance for CTL induction, the effects of CTL reactions induced by a test substance and safety thereof (e.g., the risk that test substance poses for induction of an autoimmune disease) can be evaluated.
(107) In addition, the copy number of artificial chimeric genes and the sites of gene introduction are regulated in the HLA class I gene knock-in non-human animal of the present invention. Thus, the expression levels of such artificial chimeric genes can be maintained at equivalent levels between different mouse lines expressing different HLA class I genes. The test substances are administered to a plurality of different HLA class I gene knock-in non-human animals in the same manner, and the capacity of the non-human animals for CTL induction in response to the test substances is assayed, compared, and then evaluated. Thus, the specificity and the effectiveness of CTL reactions induced by test substances can be evaluated.
(108) According to the present invention, CTL cells prepared from the HLA class I gene knock-in non-human animals of the present invention that have been immunized with peptide vaccines may be implanted into the immunodeficient non-human animals resulting from xenografting of human-cancer-derived cell lines. Thus, anti-tumor effects of such peptide vaccines can be evaluated.
EXAMPLES
(109) Hereafter, the present invention is described in greater detail with reference to the examples; however, these examples are provided for illustrative purposes only, and the present invention is not limited to these examples.
Example 1: Cloning of Partial Sequence of HLA-A2402 Gene
(110) In order to prepare artificial chimeric genes, at the outset, a gene fragment containing 1 and 2 regions was cloned via PCR using genomic DNA of the SW620 human tumor cell line as a template on the basis of the sequence information for HLA-A2402 (GenBank Accession No. L47206.1). In such a case, a sequence encoding a peptide of 10 amino acids including a BamHI recognition sequence was added to the N terminus, and the BglII recognition sequence was added to the intron 3 sequence at the C terminus, so as to bind the gene fragment to human 2 microglobulin gene and mouse H-2 3 region. Specifically, PCR was carried out using the primers shown below, and a 867-bp DNA fragment modified as described above was obtained.
(111) TABLE-US-00001 Bam-10AA-A24-F1: (SEQIDNO:18) 5-GGATCCGGCGGAGGCGGCTCGGGTGGCGGCGGCGGCTCTGGATCTCC CACTCCATGAGGTATTTCTCC-3 Bgl-A24-R1: (SEQIDNO:19) 5-AGATCTACAGGCGATCAGGTAGGCGCCCC-3
Example 2: Cloning of cDNA of Human 2 Microglobulin
(112) Subsequently, cDNA of human 2 microglobulin was cloned via RT-PCR using total RNA prepared from the HepG2 human tumor cell line as a template on the basis of the sequence information for cDNA of human 2 microglobulin (GenBank Accession No. NM_004048.2). In such a case, a sequence encoding a peptide of 5 amino acids including a BamHI recognition sequence was added to the C terminus, so as to bind the cDNA fragment to HLA 1 and 2 regions. In order to knock-in the artificial chimeric gene into a site corresponding to the first methionine of mouse 2 microglobulin and express the artificial chimeric gene on a cell membrane upon normal processing, a leader sequence of HLA-A24 comprising an NcoI recognition sequence was added to the N terminus. Specifically, PCR was carried out using the primers shown below, and a 386-bp DNA fragment modified as described above was obtained.
(113) TABLE-US-00002 Nco-A24L-hB2m-F1: (SEQIDNO:20) 5-CCATGGCCGTCATGGCGCCCCGAACCCTCGTCCTGCTACTCTCGGGG GCCCTGACCCAGACCTGGGCGATCCAGCGTACTCCAAAGATTCAGGT-3 Bam-5AA-hB2m-R1: (SEQIDNO:21) 5-GGATCCGCCACCTCCACTGTCTCGATCCCACTTAACTATC-3
Example 3: Cloning of Partial Sequence of Mouse H-2Db Gene
(114) On the basis of sequence information for mouse H-2D.sup.b (GenBank Accession No. M37681.1), regions downstream of 3 region including the intracellular domain (i.e., exons 4 to 8 and introns 3 to 7) were cloned via PCR using genomic DNA of the C57BL6/N mouse as a template. In order to bind the sequence to the HLA 1 and 2 regions and to facilitate vector construction, the BamHI recognition sequence was added to intron 3 at the N terminus and, for example, the SwaI recognition sequence was added to the C terminus. Specifically, PCR was carried out using the primers shown below, and a 2494-bp DNA fragment modified as described above was obtained.
(115) TABLE-US-00003 Bam-H2Db-F1: (SEQIDNO:22) 5-GGATCCTGTGTGACATACCTGTACCTTGTC-3 Swa-H2Db-R1: (SEQIDNO:23) 5-ATTTAAATCTAGTTGAGTCTCTGATCTTTAGCCCTAGG-3
Example 4: Construction of Artificial Chimeric Gene (HHD-A2402)
(116) The cDNA fragment of human 2 microglobulin, the human HLA-A2402 genome fragment, and the mouse H-2D.sup.b genome fragment obtained in the manner described above were ligated to each other, so as to construct an artificial chimeric gene of interest (full length: 3,735 bp, HHD-A2402) (FIG. 1).
Example 5: Preparation of Targeting Vector
(117) Subsequently, a targeting vector used to knock-in the artificial chimeric gene (HHD-A2402) prepared above into mouse 2 microglobulin gene as shown in
(118) On the basis of the sequence information for mouse 2 microglobulin cDNA (GenBank Accession No. NM_009735.3), at the outset, a genome sequence necessary for homologous recombination in an ES cell was cloned from the genome region including the mouse 2 microglobulin gene (GenBank Accession No. NC_000068.7). Specifically, PCR was carried out with the use of genomic DNA of the C57BL6/N mouse as a template, so as to clone a region of about 1.2 kb upstream of the first methionine of the mouse 2 microglobulin gene. In order to bind the fragment to the artificial chimeric gene (HHD-A2402) and to facilitate vector construction, the SalI recognition sequence and the NcoI recognition sequence were added to the 5 terminus and the 3 terminus, respectively. Specifically, PCR was carried out using the primers shown below, and a 1,198-bp DNA fragment modified as described above was obtained.
(119) TABLE-US-00004 B2m-SHA-F1: (SEQIDNO:24) 5-GTCGACCTGGGTAGACACTGTAGGATTGGGTCTCTG-3 B2m-SHA-R1: (SEQIDNO:25) 5-CCATGGTGACGACTGAAGCGACCGCGACTG-3
(120) Subsequently, a full-length 8,462-bp genome fragment from the NheI recognition sequence of intron 2 to the SacII recognition sequence of intron 4 was cloned from the BAC clone (RP23-34E24) comprising the genomic DNA sequence of the mouse 2 microglobulin gene.
(121) The genome fragment of the mouse 2 microglobulin gene obtained in the manner described above and the artificial chimeric gene (HHD-A2402) were cloned into the pBluescript II KS+ plasmid together with the PGK-DT-A cassette and the PGK-neo-bpA cassette. Thus, a targeting vector of interest (full length: about 19.2 kb) was prepared (
Example 6: Introduction of Targeting Vector into ES Cell
(122) Subsequently, the targeting vector prepared in Example 5 was introduced into ES cells.
(123) CMTI-1 cells purchased from Millipore (Passage 11) were used as ES cells. The cells described in the examples below were cultured with the use of the Dulbecco's modified Eagle's medium (DMEM) (Life Technologies) supplemented with 20% FBS (ES cell-qualified fetal bovine serum) (Life Technologies) and 10.sup.3 units/ml of leukocyte inhibitory factors (LIF) (Millipore) in an incubator at 37 C. in the presence of 5% CO.sub.2.
(124) The targeting vector prepared in Example 5 (50 g) was cleaved with NotI, dissolved in 0.2 ml of an electroporation buffer for ES cells (Millipore), and mixed with 210.sup.7 CMTI-1 cells suspended in 0.3 ml of an electroporation buffer in an electroporation cuvette (Bio-Rad). Thereafter, electric pulses were applied using the Gene Pulser II (Bio-Rad) at 250 V and 500 F, and the resultant was added in amounts of 0.1 ml/dish to five 10-cm dishes in which neomycin resistant feeder cells (DS Pharma) had been sowed in advance. G418 (titer: 250 g/ml, Nacalai Tesque) was added thereto 12 to 18 hours thereafter, and culture was conducted for 1 week.
Example 7: Selection and Confirmation of Homologously Recombined ES Cell
(125) ES cell colonies (384 colonies) developed as a result of culture for 1 week after the addition of G418 in Example 6 were sampled. The colonies were divided into two, and one of them was continuously cultured. The other was washed with PBS, treated with proteinase K, and subjected to PCR using the primers shown below. Three homologously recombined clones were selected.
(126) TABLE-US-00005 HHD-HRES-F1: (SEQIDNO:26) 5-AGCATTTCCTAGTACAGTTCAACACAGTGTTTAGT-3 HHD-HRES-R1: (SEQIDNO:27) 5-GAGTAGCAGGACGAGGGTTCGGGGCGCCAT-3
(127) A PCR cycle of 94 C. for 30 seconds, 60 C. for 1 minute, and 72 C. for 2 minutes was repeated 35 times. The PCR product was subjected to 1% agarose gel electrophoresis, so as to detect a PCR product (about 1.4 kb) that was deduced to develop upon proper homologous recombination. It was determined that clones in which such PCR product was detected were positive clones.
(128) In order to confirm homologous recombination with higher accuracy, genomic DNA was extracted from the ES cell clones determined to be the positive clones above and analyzed via Southern blotting in the manner described below.
(129) Genomic DNA (10 g) was cleaved with the EcoRI restriction enzyme, subjected to 1% agarose gel electrophoresis, and then transferred onto a nylon membrane (Hybond-N+, Pharmacia) with the use of a 10SSC solution by the capillary method. Further, a DNA fragment of about 0.5 kb in a 5-upstream region of the 1,198-bp DNA fragment cloned in Example 5 was prepared. Southern hybridization was carried out using the DNA fragment labeled with [-.sup.32P]-dCTP (Perkin Elmer) as a probe. As a result, a band of about 2.1 kb resulting from proper homologous recombination and a 2.5-kb band derived from a wild type were detected at 1:1 (
Example 8: Preparation of Artificial Chimeric Gene (HHD-A2402) Knock-In Transgenic Animal
(130) Homologously recombined ES cells were separately dispersed via trypsin treatment. A male mouse of the C57BL/6 strain was subjected to crossing with a female mouse of the same strain, the blastocysts were took out from the female mouse, and about 10 ES cells described above were injected into the segmentation cavity per blastocyst using a microinjection apparatus (Narishige). The resultants were transplanted into the uterus of the pseudopregnant female mouse, and fetal development was continued. Thus, a chimeric mouse was obtained.
(131) The male chimeric mouse was subjected to crossing with a female mouse of the C57BL/6 strain, those exhibiting the color of the wild type (agouti) were selected from among the resulting offspring mice, and parts of the tails were cut to prepare samples. Genomic DNA was extracted from the samples and subjected to PCR using the primers shown below.
(132) TABLE-US-00006 HHD-F1: (SEQIDNO:28) 5-CTAGAAGCAAGGTCAGAAATCCTCT-3 HHD-WT-R3: (SEQIDNO:29) 5-CCGTCAGCACACTCGCAAACAGGCG-3 HHD-HRES-R1: (SEQIDNO:30) 5-GAGTAGCAGGACGAGGGTTCGGGGCGCCAT-3
(133) A PCR cycle of 94 C. for 30 seconds, 60 C. for 1 minute, and 72 C. for 1 minute was repeated 35 times, and the PCR product was analyzed via 1% agarose gel electrophoresis. When a 510-bp PCR product deduced to develop upon proper homologous recombination was detected in addition to the 804-bp PCR product derived from the wild-type gene locus, it was determined that the examined mice were heterozygous knock-in mice.
(134) Heterozygous knock-in mice were subjected to crossing with each other, genomic DNA was extracted from the samples obtained by cutting parts of the tails from the offspring mice, and genotypes thereof were analyzed via PCR described above. When a 804-bp PCR product derived from the wild-type gene locus was not detected and only a 510-bp PCR product deduced to develop upon proper homologous recombination was detected, it was determined that the examined mice were homozygous knock-in mice.
(135) Genomic DNAs prepared from parts of the tails of homozygous mice, heterozygous mice, and wild-type mice (3 individuals each) identified via PCR were analyzed via Southern hybridization described in Example 7. As a result, a band of about 2.1 kb alone, bands of about 2.1 kb and about 2.5 kb, and a band of about 2.5 bp alone were detected for homozygous mice, heterozygous mice, and wild-type mice, respectively (
(136) Homozygous mice, heterozygous mice, and wild-type mice (3 individuals each) were euthanized, total RNAs were prepared from the livers using Isogen (Wako Pure Chemical Industries, Ltd.) and the RNeasy kit (QIAGEN), followed by treatment with DNaseI, and cDNAs were then synthesized using the SuperScript III First-Strand Synthesized System (Life Technologies). After the addition of the TaqMan Assay Mix (Applied Biosystems) and the 2 TaqMan Universal Master Mix (Applied Biosystems) for the detection of mouse 2 microglobulin and ribosomal RNA, quantitative RT-PCR was carried out using the PRISM 7900 HT Sequence Detection System (Applied Biosystems). The results of analysis demonstrate that expression of mouse 2 microglobulin mRNA was substantially completely lost in homozygous mice and such expression in the heterozygous mice was decreased to a level that was about a half the expression level observed in wild-type mice (
Example 9: Preparation of Artificial Chimeric Gene (HHD-A0301) Knock-In Transgenic Animal
(137) On the basis of the sequence information for human HLA-A0301 (GenBank Accession No. AJ748743.1), a gene fragment comprising the 1 and 2 regions was fully synthesized. Specifically, a sequence encoding a peptide of 10 amino acids including the BamHI recognition sequence was added to the N terminus, and the BglII recognition sequence was added within the intron 3 sequence on the C terminus side, so as to synthesize the 867-bp DNA fragment described below.
(138) TABLE-US-00007 (SEQIDNO:31) 5-ggatccggcggaggcggctcgggtggcggcggctctgGATCTCACTC CATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCC GCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGAC AGCGACGCCGCGAGCCAGAGGATGGAGCCGCGGGCGCCGTGGATAGAGCA GGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATGTGAAGGCCCAGT CACAGACTGACCGAGTGGACCTGGGGACCCTGCGCGGCTACTACAACCAG AGCGAGGCCGgtgagtgaccccggccggtggcgcaggtcaggacccctca tcccccacggacgggccaggtcgcccacagtctccgggtccgagatccac cccgaagccgcgggaccccgagacccttgccccgggagaggcccaggcgc ctttacccggtttcattttcagtttaggccaaaaatccccccgggttggt cggggctgggcggggctcgggggactgggctgaccgcggggtcggggcca gGTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGTCGGACGG GCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACA TCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCGGCT CAGATCACCAAGCGCAAGTGGGAGGCGGCCCATGAGGCGGAGCAGTTGAG AGCCTACCTGGATGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAGA ACGGGAAGGAGACGCTGCAGCGCACGGgtaccaggggccacggggcgcct ccctgatcgcctgtagatet-3 (uppercaselettersindicateexonregionsand lowercaselettersindicateintronregions)
(139) In accordance with the methods described in Examples 2 to 8, HHD-A0301 heterozygous knock-in mice and HHD-A0301 homozygous knock-in mice were prepared.
Example 10: Preparation of Artificial Chimeric Gene (HHD-A0201) Knock-In Transgenic Animal
(140) On the basis of the sequence information for human HLA-A0201 (GenBank Accession No. AY365426.1), a gene fragment comprising the 1 and 2 regions was fully synthesized. Specifically, a sequence encoding a peptide of 10 amino acids including the BamHI recognition sequence was added to the N terminus, and the BglII recognition sequence was added within the intron 3 sequence on the C terminus side, so as to synthesize the 867-bp DNA fragment described below.
(141) TABLE-US-00008 (SEQIDNO:43) 5-ggatccggcggaggcggctcgggtggcggcggctctgGATCTCACTC CATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCC GCTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGAC AGCGACGCCGCGAGCCAGAGGATGGAGCCGCGGGCGCCGTGGATAGAGCA GGAGGGTCCGGAGTATTGGGACGGGGAGACACGGAAAGTGAAGGCCCACT CACAGACTCACCGAGTGGACCTGGGGACCCTGCGCGGCTACTACAACCAG AGCGAGGCCGgtgagtgaccccggccggtggcgcaggtcaggacccctca tcccccacggacgggccaggtcgcccacagtctccgggtccgagatccac cccgaagccgcgggaccccgagacccttgccccgggagaggcccaggcgc ctttcccggtttcattttcagtttaggccaaaaatccccccgggttggtc ggggctgggcggggctcgggggactgggctgaccgcggggtcggggccag GTTCTCACACCGTCCAGAGGATGTATGGCTGCGACGTGGGGTCGGACTGG CGCTTCCTCCGCGGGTACCACCAGTACGCCTACGACGGCAAGGATTACAT CGCCCTGAAAGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTC AGACCACCAAGCACAAGTGGGAGGCGGCCCATGTGGCGGAGCAGTTGAGA GCCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAA CGGGAAGGAGACGCTGCAGCGCACGGgtaccaggggccacggggcgcctc cctgatcgcctgtagatct-3 (uppercaselettersindicateexonregionsand lowercaselettersindicateintronregions)
(142) In accordance with the methods described in Examples 2 to 8, HHD-A0201 heterozygous knock-in mice and HHD-A0201 homozygous knock-in mice were prepared.
Example 11: Preparation of Artificial Chimeric Gene (HHD-A3101) Knock-In Transgenic Animal
(143) On the basis of the sequence information for human HLA-A3101 (GenBank Accession No. M84375.1), a gene fragment comprising the 1 and 2 regions was fully synthesized. Specifically, a sequence encoding a peptide of 10 amino acids including the BamHI recognition sequence was added to the N terminus, and the BglII recognition sequence was added within the intron 3 sequence on the C terminus side, so as to synthesize the 867-bp DNA fragment described below.
(144) TABLE-US-00009 (SEQIDNO:44) 5-ggatccggcggaggcggctcgggtggcggcggctctgGATCTCACTC CATGAGGTATTTCACCACATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCC GCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGAC AGCGACGCCGCGAGCCAGAGGATGGAGCCGCGGGCGCCGTGGATAGAGCA GGAGAGGCCTGAGTATTGGGACCAGGAGACACGGAATGTGAAGGCCCACT CACAGATTGACCGAGTGGACCTGGGGACCCTGCGCGGCTACTACAACCAG AGCGAGGCCGgtgagtgaccccggccggtggcgcaggtcaggacccctca tcccccacggacgggccaggtcgcccacagtctccgggtocgagatccac cccgaagccgcgggaccccgagacccttgccccgggagaggcccaggcgc ctttacccggtttcattttcagtttaggccaaaaatccccccgggttggt cggggctgggcggggctcgggggactgggctgaccgcggggtcggggcca gGTTCTCACACCATCGAGATGATGTATGGCTGCGACGTGGGGTCGGACGG GCGCTTCCTCCGCGGGTACCAGCAGGACGCCTACGACGGCAAGGATTACA TCGCCTTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCGGCT CAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGTGGCGGAGCAGTTGAG AGCCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAGA ACGGGAAGGAGACGCTGCAGCGCACGGgtaccaggggccacggggcgcct ccctgatcgcctgtagatct-3 (uppercaselettersindicateexonregionsand lowercaselettersindicateintronregions)
(145) In accordance with the methods described in Examples 2 to 8, HHD-A3101 heterozygous knock-in mice and HHD-A3101 homozygous knock-in mice were prepared.
Example 12: Preparation of HHD-A2402 and HHD-A0301 Knock-In Transgenic Animal
(146) HHD-A2402 homozygous knock-in mice were subjected to crossing with HHD-A0301 homozygous knock-in mice to prepare double knock-in mice carrying one copy each of the HHD-A2402 and the HHD-A0301 genes.
Example 13: Confirmation of Human and Mouse MHC Class I Gene Expression in Knock-In Mice
(147) HHD-A2402 homozygous knock-in mice, HHD-A0301 homozygous knock-in mice, HHD-A2402 heterozygous knock-in mice, HHD-A0301 heterozygous knock-in mice, wild-type mice as control littermates, and HHD-A2402/HHD-A0301 double knock-in mice were euthanized, and human MHC class I gene expression on the surface of blood cells or spleen cells collected from the extracted spleens was analyzed via flow cytometry. Specifically, 110.sup.6 spleen cells or blood cells were stained with monoclonal PE-labeled anti-HLA antibody 17A10 (MBL) or the biotinylated antibody 4il53 (Abeam) as the primary antibody and the PE-labeled anti-biotin antibody Bio3-18E7 (Miltenyi Biotec) as the secondary antibody.
(148) As a result, HLA-A24 expression was detected in HHD-A2402 homozygous knock-in mice and HHD-A2402 heterozygous knock-in mice, and HLA-A3 expression was detected in HHD-A0301 homozygous knock-in mice and HHD-A0301 heterozygous knock-in mice. In addition, expression of both HLA-A24 and HLA-A3 was detected in HHD-A2402/HHD-A0301 double knock-in mice (
(149) Further, endogenous mouse MHC class I gene expression on the spleen cell surface was analyzed using the PE-labeled anti-H-2K.sup.b antibody AF6-88.5 (BD Bioscience). As a result, H-2K.sup.b expression was detected in wild-type mice, HHD-A2402 heterozygous knock-in mice, and HHD-A0301 heterozygous knock-in mice. In contrast, H-2K.sup.b expression was almost completely lost in HHD-A2402 homozygous knock-in mice, HHD-A0301 homozygous knock-in mice, and HHD-A2402/HHD-A0301 double knock-in mice (
(150) With the use of the monoclonal PE-labeled anti-HLA-A2 antibody BB7.2 (MBL) and the monoclonal FITC-labeled anti-human 2 microglobulin antibody TU99 (BD Bioscience), HLA-A2 and human 2 microglobulin expression on the blood cell surface of HHD-A0201 homozygous knock-in mice, HHD-A0201 heterozygous knock-in mice, and wild-type mice as control littermates was inspected in the same manner. Also, human 2 microglobulin expression on the blood cell surface of HHD-A3101 homozygous knock-in mice, HHD-A3101 heterozygous knock-in mice, and wild-type mice as control littermates was inspected with the use of the monoclonal FITC-labeled anti-human 2 microglobulin antibody TU99.
(151) As a result, HLA-A2 and human 2 microglobulin expression was detected in HHD-A0201 homozygous knock-in mice and HHD-A0201 heterozygous knock-in mice (
(152) In addition, endogenous mouse MHC class I expression on the blood cell surface was analyzed using the PE-labeled anti-H-2K.sup.b/H-2D.sup.b antibody 28-8-6 (Biolegend). As a result, H-2K.sup.b and/or H-2D.sup.b expression was detected in wild-type mice, HHD-A0201 heterozygous knock-in mice, and HHD-A3101 heterozygous knock-in mice; however, H-2K.sup.b and H-2D.sup.b expression was almost completely lost in HHD-A0201 homozygous knock-in mice and HHD-A3101 homozygous knock-in mice (
Example 14: Confirmation of CTL Induction Capacity in A24 Knock-In Mice
(153) The virus-derived antigen peptides or negative control peptides described below were dissolved at 2 mg/ml in Otsuka distilled water (Otsuka Pharmaceutical Factory, Inc.) and filled into a B Braun Injekt syringe.
(154) TABLE-US-00010 A24V6: (SEQIDNO:32) EYLVSFGVW(A24-restrictedHBV-derivedantigen) A24V8: (SEQIDNO:33) SFHSLHLLF(A24-restrictedHTLV-derivedantigen) A24V9: (SEQIDNO:34) DYCNVLNKEF(A24-restrictedEBV-derivedantigen) A24V10: (SEQIDNO:35) RYLRDQQLL(A24-restrictedHIV-derivedantigen)
(155) After another syringe was filled with an equivalent amount of Incomplete Freund's adjuvant (IFA), these syringes were connected together with the aid of a GP syringe connector, and the solution of virus-derived antigen peptides was thoroughly mixed with IFA to prepare an emulsion. The emulsion was administered subcutaneously to A24 homozygous knock-in mice, A24 heterozygous knock-in mice, and wild-type littermate mice through the tail heads in amounts of 100 l/mouse once per week, and administration was carried out twice in total. Lymph nodes of groins were recovered from the mice 1 week after the final administration. A suspension of lymph node cells was prepared by adjusting the cell concentration to 510.sup.6 cell/ml with the aid of a complete medium (RPMI-1640, 10% heat-inactivated FBS, 100 U/ml penicillin, 100 g/ml streptomycin, 50 M 2-mercaptoethanol), the target CTL epitope peptide (final concentration: 10 g/ml), the recombinant mouse IL-15 (final concentration: 100 ng/ml), and the recombinant mouse IL-21 (final concentration: 100 ng/ml) were added thereto, the resulting suspension was sowed into a 24-well plate at 1 ml/well, and culture was conducted in an incubator at 37 C. in the presence of 5% CO.sub.2 for 8 days. Thereafter, the cells were recovered and sowed onto an anti-IFN-antibody-immobilized plate included in the Murine IFN- ELISpot Kit (GEN-PROBE) at 110.sup.5 cells/well. Subsequently, the spleen cells obtained from the spleen of the mouse of the same strain and irradiated with X-rays at 30 Gy were sowed onto the same well as the antigen presenting cells at 110.sup.5 cells/well, the target CTL epitope peptides or negative control peptides (final concentration: 10 g/ml) were added, and culture was conducted in an incubator at 37 C. in the presence of 5% CO.sub.2 overnight. The IFN--producing cell spots were allowed to develop color in accordance with the instructions of the kit on the following day. The number of IFN--producing cell spots was determined using the ELISPOT analyzer (Immunospot S6, Cellular Technology Ltd.). As a result, the number of IFN--producing cell spots in the wells to which the virus-derived antigen peptides had been added was found to be significantly larger than that in the wells to which the negative control peptides had been added in both the A24 homozygous knock-in mice and the A24 heterozygous knock-in mice (Student's t-test, p<0.001), and the induction of epitope-specific CTL was observed, as shown in
Example 15: Confirmation of CTL Induction Capacity in A3 Knock-In Mice
(156) The virus-derived antigen peptides described below were dissolved at 2 mg/ml in Otsuka distilled water (Otsuka Pharmaceutical Factory, Inc.) and filled into a B Braun Injekt syringe.
(157) TABLE-US-00011 A3V3: (SEQIDNO:36) RLRPGGKKK(A3-restrictedHIV-derivedantigen) A3V4: (SEQIDNO:37) QVPLRPMTYK(A3-restrictedHW-derivedantigen) A3V7: (SEQIDNO:38) RLRAEAQVK(A3-restrictedEBV-derivedantigen) A3V10: (SEQIDNO:39) SIIPGPLK(A3-restrictedinfluenzavirus-derived antigen)
(158) After another syringe was filled with an equivalent amount of Incomplete Freund's adjuvant (IFA), these syringes were connected together with the aid of a GP syringe connector, and the solution of virus-derived antigen peptides was thoroughly mixed with IFA to prepare an emulsion. The emulsion was administered subcutaneously to A3 homozygous knock-in mice, A3 heterozygous knock-in mice, and wild-type littermate mice through the tail heads in amounts of 100 l/mouse once per week, and administration was carried out twice in total. The induction of virus-derived antigen peptide-specific CTL was then evaluated in accordance with the method described in Example 14. As a result, the number of IFN--producing cell spots in the wells to which the virus-derived antigen peptides had been added was found to be significantly larger than that in the wells to which the negative control peptides had been added in both the A3 homozygous knock-in mice and the A3 heterozygous knock-in mice (Student's t-test, p<0.01 or p<0.001), and the induction of epitope-specific CTL was observed, as shown in
Example 16: Confirmation of CTL Induction Capacity in A24/A3 Double Knock-In Mice
(159) The virus-derived antigen peptides (A3V7 and A24V8) were administered to A24/A3 double knock-in mice and wild-type mice in the manner described above, and induction of virus-derived antigen peptide-specific CTL was evaluated in accordance with the method described in Example 14. As a result, the number of IFN--producing cell spots in the wells to which the virus-derived antigen peptides had been added was found to be significantly larger than that in the wells to which the negative control peptides had been added in A24/A3 double knock-in mice (Student's t-test, p<0.001), and the induction of epitope-specific CTL was observed, as shown in
Example 17: Confirmation of CTL Induction Capacity in A2 Knock-In Mice
(160) The virus-derived antigen peptides described below were dissolved at 1 mg/ml in Otsuka distilled water (Otsuka Pharmaceutical Factory, Inc.) and filled into a B Braun Injekt syringe.
(161) TABLE-US-00012 A2V1: (SEQIDNO:45) CLGGLLTMV A2V2: (SEQIDNO:46) GLCTLVAML A2V3: (SEQIDNO:47) NLVPMVATV A2V4: (SEQIDNO:48) VLAELVKQI A2V7: (SEQIDNO:49) VLSDFKTWL A2V8: (SEQIDNO:50) FLPSDFFPSV A2V9: (SEQIDNO:51) FLLTRILTI A2V10: (SEQIDNO:52) GLSPTVWLS
(162) After another syringe was filled with an equivalent amount of Incomplete Freund's adjuvant (IFA), these syringes were connected together with the aid of a GP syringe connector, and the solution of virus-derived antigen peptides was thoroughly mixed with IFA to prepare an emulsion. The emulsion was administered subcutaneously to A2 homozygous knock-in mice, A2 heterozygous knock-in mice, and wild-type littermate mice through the tail heads in amounts of 100 l/mouse once per week, and administration was carried out twice in total. The induction of virus-derived antigen peptide-specific CTL was then evaluated in accordance with the method described in Example 14. As a result, the number of IFN--producing cell spots in the wells to which the virus-derived antigen peptides had been added was found to be significantly larger than that in the wells to which the negative control peptides had been added in both the A2 homozygous knock-in mice and the A2 heterozygous knock-in mice (Student's t-test, p<0.001), and the induction of epitope-specific CTL was observed, as shown in
Example 18: Confirmation of CTL Induction Capacity in A31 Knock-In Mice
(163) The virus-derived antigen peptides described below were dissolved at 1 mg/ml in Otsuka distilled water (Otsuka Pharmaceutical Factory, Inc.) and filled into a B Braun Injekt syringe.
(164) TABLE-US-00013 A31V3: (SEQIDNO:53) ASCMGLIYNR A31V5: (SEQIDNO:54) SVQPTFSVQR A31V6: (SEQIDNO:55) KFLPDLYDYK A31V8: (SEQIDNO:56) SFSFGGFTFK A31V10: (SEQIDNO:57) RVIDPRRCMK
(165) After another syringe was filled with an equivalent amount of Incomplete Freund's adjuvant (IFA), these syringes were connected together with the aid of a GP syringe connector, and the solution of virus-derived antigen peptides was thoroughly mixed with IFA to prepare an emulsion. The emulsion was administered subcutaneously to A31 homozygously knocked in mice, A31 heterozygous knock-in mice, and wild-type littermate mice through the tail heads in amounts of 100 l/mouse once per week, and administration was carried out twice in total. The induction of virus-derived antigen peptide-specific CTL was then evaluated in accordance with the method described in Example 14. As a result, the number of IFN--producing cell spots in the wells to which the virus-derived antigen peptides had been added was found to be significantly larger than that in the wells to which the negative control peptides had been added in both the A31 homozygous knock-in mice and the A31 heterozygous knock-in mice (Students t-test, p<0.01 or p<0.001), and the induction of epitope-specific CTL was observed, as shown in
Example 19: Analysis of CD4CD8+T Cell Population in Knock-In Mice
(166) HHD-A2402 homozygous knock-in mice, HHD-A0301 homozygous knock-in mice, HHD-A0201 homozygous knock-in mice, HHD-A3101 homozygous knock-in mice, HHD-A2402 heterozygous knock-in mice, HHD-A0301 heterozygous knock-in mice, HHD-A0201 heterozygous knock-in mice, HHD-A3101 heterozygous knock-in mice, wild-type mice as control littermates, and HHD-A2402/HHD-A0301 double knock-in mice were euthanized, and CD4 and CD8 expressions on the blood cell surface were analyzed via flow cytometry. Specifically, 110.sup.6 blood cells were stained with the monoclonal PE-Cy7-labeled anti-CD4 antibody GK1.5 (eBioscience) and the FITC- or APC-labeled anti-CD8 antibody 53-6.7 (eBioscience).
(167) As a result, the proportions of CD4.sup.CD8.sup.+T cells in HHD-A2402 heterozygous knock-in mice, HHD-A0301 heterozygous knock-in mice, HHD-A0201 heterozygous knock-in mice, and HHD-A3101 heterozygous knock-in mice were found to be equivalent to those in wild-type mice. In contrast, the proportions of CD4.sup.CD8.sup.+T cells in HHD-A2402 homozygous knock-in mice, HHD-A0301 homozygous knock-in mice, HHD-A0201 homozygous knock-in mice, HHD-A3101 homozygous knock-in mice, and HHD-A2402/HHD-A0301 double knock-in mice were found to have significantly decreased in comparison with those in wild-type mice (
(168) All publications, patents, and patent applications cited herein are incorporated herein by reference in their entirety.