TRANSCRIPTION REGULATORY ELEMENTS

Abstract

The present invention relates to transcription regulatory elements (TREs) such as promoters, which may be used to express a transgene within a cell such as a mammalian cell. The invention further relates to polynucleotides and vectors comprising such transcription regulatory elements, which may be operably linked to a transgene, as well as methods of gene therapy based on using such vectors.

Claims

1. A transcription regulatory element comprising a core nucleotide sequence which comprises or consists of a nucleotide sequence having at least 95% identity to SEQ ID NO: 2, or a nucleotide sequence which differs from SEQ ID NO: 2 by a single nucleotide; and wherein: a. the transcription regulatory element is between 80 and 280 nucleotides in length and: i) does not comprise a nucleotide sequence according to SEQ ID NO: 5, or does not comprise at least 20, at least 30 or at least 40 consecutive nucleotides of SEQ ID NO: 5; and/or ii) does not comprise a nucleotide sequence according to SEQ ID NO: 4, or does not comprise at least 20, at least 30 or at least 40 consecutive nucleotides of SEQ ID NO: 4; or b. the transcription regulatory element is between 80 and 280 nucleotides in length and further comprises a nucleotide sequence which is located 5′ to the core nucleotide sequence and which has less than 60% identity to a nucleotide sequence comprising at least 20, at least 25, at least 30, at least 35, at least 40 or 45 consecutive nucleotides of SEQ ID NO: 4.

2. The transcription regulatory element as claimed in claim 1, which comprises or consists of a nucleotide sequence which has at least 90% identity, optionally at least 95% identity or optionally at least 98% identity, to a nucleotide sequence according to SEQ ID NO: 29.

3. The transcription regulatory element as claimed in claim 1, further comprising a nucleotide sequence located 3′ to the core nucleotide sequence, and optionally wherein: a. the nucleotide sequence located 3′ to the core nucleotide sequence comprises one or more transcription start sites (TSS); optionally wherein the one or more TSS comprise or consist of a nucleotide sequence according to: i. SEQ ID NO: 6, or a nucleotide sequence which differs from SEQ ID NO: 6 by a single nucleotide; ii. SEQ ID NO: 7, or a nucleotide sequence which differs from SEQ ID NO: 7 by a single nucleotide; and/or iii. SEQ ID NO: 8, or a nucleotide sequence which differs from SEQ ID NO: 8 by a single nucleotide; and/or b. the nucleotide sequence located 3′ to the core nucleotide sequence comprises: i. a nucleotide sequence according to SEQ ID NO: 6, or a nucleotide sequence which differs from SEQ ID NO: 6 by a single nucleotide; or ii. a nucleotide sequence having at least 90% identity to SEQ ID NO: 9, or a nucleotide sequence which differs from SEQ ID NO: 9 by a single nucleotide; or iii. a nucleotide sequence having at least 90% identity to SEQ ID NO: 10, or a nucleotide sequence which differs from SEQ ID NO: 10 by a single nucleotide; and/or c. the nucleotide sequence located 3′ to the core nucleotide sequence further comprises a nucleotide sequence defined by SEQ ID NO: 11, or a nucleotide sequence which differs from SEQ ID NO: 11 by a single nucleotide; and/or d. the nucleotide sequence located 3′ to the core nucleotide sequence is shorter than 50 nucleotides; optionally is shorter than 40 nucleotides; and optionally is shorter than 30 nucleotides; and/or e. the nucleotide sequence located 3′ to the core nucleotide sequence comprises or consists of a nucleotide sequence selected from the group consisting of: i. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 10, or a nucleotide sequence which differs from SEQ ID NO: 10 by a single nucleotide; ii. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO:12, or a nucleotide sequence which differs from SEQ ID NO: 12 by a single nucleotide; and iii. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 13, or a nucleotide sequence which differs from SEQ ID NO: 13 by a single nucleotide.

4. The transcription regulatory element as claimed in claim 1 or claim 3, further comprising a nucleotide sequence located 5′ to the core nucleotide sequence, and optionally wherein: a. the nucleotide sequence located 5′ to the core nucleotide sequence comprises: i. a nucleotide sequence comprising at least 10, at least 15, or at least 20 consecutive nucleotides of SEQ ID NO: 14; ii. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 14, or a nucleotide sequence which differs from SEQ ID NO: 14 by a single nucleotide; iii. a nucleotide sequence comprising at least 10, at least 15, or at least 20 consecutive nucleotides of SEQ ID NO: 15; iv. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 15, or a nucleotide sequence which differs from SEQ ID NO: 15 by a single nucleotide; v. a nucleotide sequence comprising at least 10, at least 15, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80 or at least 90 consecutive nucleotides of SEQ ID NO: 16; vi. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 16, or a nucleotide sequence which differs from SEQ ID NO: 16 by a single nucleotide; and/or vii. a nucleotide sequence defined by SEQ ID NO: 17, or a nucleotide sequence which differs from SEQ ID NO: 17 by a single nucleotide; and/or b. the nucleotide sequence located 5′ to the core nucleotide sequence has less than 60% identity to a nucleotide sequence comprising at least 20, at least 25, at least 30, at least 35, at least 40 or 45 consecutive nucleotides of SEQ ID NO: 4; and optionally wherein the nucleotide sequence located 5′ to the core nucleotide sequence has less than 50% identity to a nucleotide sequence comprising at least 20, at least 25, at least 30, at least 35, at least 40 or 45 consecutive nucleotides of SEQ ID NO: 4; optionally wherein it has less than 45% identity; optionally wherein it has less than 40% identity; and optionally wherein it has less than 30% identity; and/or c. the nucleotide sequence located 5′ to the core nucleotide sequence is shorter than 110 nucleotides; optionally is shorter than 100 nucleotides; optionally is shorter than 50 nucleotides; and optionally is shorter than 10 nucleotides; and/or d. the nucleotide sequence located 5′ to the core nucleotide sequence is between 5 and 110 nucleotides in length; and/or e. the nucleotide sequence located 5′ to the core nucleotide sequence is at least 7 nucleotides in length; and/or f. the nucleotide sequence located 5′ to the core nucleotide sequence is 102 nucleotides or less in length; and/or g. the nucleotide sequence located 5′ to the core nucleotide sequence comprises a nucleotide sequence selected from the group consisting of: i. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 18, or a nucleotide sequence which differs from SEQ ID NO: 18 by a single nucleotide; ii. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 19, or a nucleotide sequence which differs from SEQ ID NO: 19 by a single nucleotide; iii. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 20, or a nucleotide sequence which differs from SEQ ID NO: 20 by a single nucleotide; iv. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 21, or a nucleotide sequence which differs from SEQ ID NO: 21 by a single nucleotide; v. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 22, or a nucleotide sequence which differs from SEQ ID NO: 22 by a single nucleotide; and vi. a nucleotide sequence according to SEQ ID NO: 23, or a nucleotide sequence which differs from SEQ ID NO: 23 by a single nucleotide.

5. The transcription regulatory element as claimed in claim 1, claim 3 or claim 4, which is shorter than 200 nucleotides; optionally which is shorter than 150 nucleotides; and optionally which is shorter than 125 nucleotides.

6. The transcription regulatory element as claimed in claim 1 or in any one of claims 3 to 5, which is at least 85 nucleotides in length, optionally which is at least 100 nucleotides in length, and optionally which is at least 110 nucleotides in length.

7. The transcription regulatory element as claimed in claim 1 or in any one of claims 3 to 6, wherein the transcription regulatory element terminates in a ten-nucleotide sequence selected from: a. acagtgaatc; or b. ctcctcagct.

8. The transcription regulatory element as claimed in claim 1 or in any one of claims 3 to 7, wherein: a. the core nucleotide sequence is 73-80 nucleotides in length; and/or b. the core nucleotide sequence comprises or consists of a nucleotide sequence which has at least 95% identity, and optionally at least 98% identity, to SEQ ID NO: 2; and/or c. the core nucleotide sequence is identical to SEQ ID NO: 2; and/or d. the core nucleotide sequence comprises or consists of a nucleotide sequence which has at least 95% identity, and optionally at least 98% identity, to SEQ ID NO: 3; and/or e. the core nucleotide sequence comprises or consists of a nucleotide sequence which has at least 95% identity, and optionally at least 98% identity, to SEQ ID NO: 3; and/or f. the core nucleotide sequence is identical to SEQ ID NO: 3.

9. The transcription regulatory element as claimed in claim 1 or in any one of claims 3 to 7, which comprises or consists of a nucleotide sequence which has a nucleotide sequence that has at least 90% identity, optionally at least 95% identity or optionally at least 98% identity to a nucleotide sequence selected from the group consisting of: a. SEQ ID NO: 24; b. SEQ ID NO: 25; c. SEQ ID NO: 26; d. SEQ ID NO: 27; e. SEQ ID NO: 28; and f. SEQ ID NO: 29.

10. The transcription regulatory element as claimed in any one of the preceding claims, wherein the transcription regulatory element comprises a promoter; optionally wherein the transcription regulatory element further comprises an enhancer; and optionally wherein the promoter is liver-specific.

11. A polynucleotide comprising a transcription regulatory element as claimed in any one of the preceding claims, wherein the transcription regulatory element is operably linked to a transgene, optionally wherein the transgene encodes a human protein.

12. The transcription regulatory element as claimed in any one of claims 1 to 10, wherein the transcription regulatory element is part of a vector comprising a transgene, optionally wherein the transgene encodes a human protein, and optionally wherein the vector is a viral particle such as an AAV vector.

13. The polynucleotide as claimed in claim 11 or the transcription regulatory element as claimed in claim 12, wherein: a. the transcription regulatory element expresses the transgene at 50% or better compared to a transcription regulatory element defined by SEQ ID NO: 1 or SEQ ID NO: 33; b. the transcription regulatory element expresses the transgene at 80% or better compared to a transcription regulatory element defined by SEQ ID NO: 1 or SEQ ID NO: 33; or c. the transcription regulatory element expresses the transgene at 100% or better compared to a transcription regulatory element defined by SEQ ID NO: 1 or SEQ ID NO: 33; or d. the transcription regulatory element expresses the transgene at 150% or better compared to a transcription regulatory element defined by SEQ ID NO: 1 or SEQ ID NO: 33; and optionally wherein expression of the transgene is determined in vitro in Huh7 cells.

14. The polynucleotide or transcription regulatory element as claimed in any one of claims 11 to 13, wherein: a. the transgene encodes a protein or a non-translated RNA which optionally is an siRNA, or an miRNA, or a snRNA, or an antisense RNA; and/or b. the transgene is longer than 4 k nucleotides; optionally wherein the transgene is longer than 4.2 nucleotides; and/or c. the transgene is shorter than 4.5 k nucleotides, optionally wherein the transgene is shorter than 4.4 k nucleotides; and/or d. the transgene encodes FVIII; optionally wherein the transgene encodes a truncated or modified FVIII; optionally wherein the transgene encodes a B-domain deleted FVIII.

15. A vector comprising a nucleotide sequence which comprises: (i) the transcription regulatory element as claimed in any one of claims 1 to 10; and (ii) a transgene; and optionally wherein: a. the vector nucleotide sequence further comprises a nucleotide sequence encoding a signal peptide; optionally wherein the nucleotide sequence encoding the signal peptide is 50 to 100 nucleotides in length; optionally wherein the nucleotide sequence encoding the signal peptide is shorter than 80 nucleotides; and/or b. the vector is a viral particle such as an AAV vector; and/or c. the transcription regulatory element expresses the transgene at 50% or better compared to a transcription regulatory element defined by SEQ ID NO: 1 or SEQ ID NO: 33; optionally wherein expression of the transgene is determined in vitro in Huh7 cells; and/or d. the transcription regulatory element expresses the transgene at 80% or better compared to a transcription regulatory element defined by SEQ ID NO: 1 or SEQ ID NO: 33; optionally wherein expression of the transgene is determined in vitro in Huh7 cells; and/or e. the transcription regulatory element expresses the transgene at 100% or better compared to a transcription regulatory element defined by SEQ ID NO: 1 or SEQ ID NO: 33; optionally wherein expression of the transgene is determined in vitro in Huh7 cells; and/or f. the transcription regulatory element expresses the transgene at 150% or better compared to a transcription regulatory element defined by SEQ ID NO: 1 or SEQ ID NO: 33; optionally wherein expression of the transgene is determined in vitro in Huh7 cells; and/or g. the transgene encodes a protein or a non-translated RNA which optionally is an siRNA, or an miRNA, or a snRNA, or an antisense RNA; and/or h. the transgene is longer than 4 k nucleotides; optionally wherein the transgene is longer than 4.2 nucleotides; and/or i. the transgene is shorter than 4.5 k nucleotides, optionally wherein the transgene is shorter than 4.4 k nucleotides; and/or j. the transgene encodes FVIII; optionally wherein the transgene encodes a truncated or modified FVIII; optionally wherein the transgene encodes a B-domain deleted FVIII; and/or k. the vector genome is shorter than 4.9 k nucleotides, and optionally wherein the vector genome is no shorter than 4.5 k nucleotides; and/or l. the vector genome is around 4.7 k nucleotides in length.

16. The vector as claimed in claim 15 for use in a method of treatment, optionally wherein the method of treatment is a method of gene therapy and/or a method of treating Haemophilia A.

Description

DESCRIPTION OF THE FIGURES

[0227] The present invention will now be described by way of non-limitative example with reference to the following figures, in which:

[0228] FIG. 1 shows a schematic diagram of several transcription regulatory elements of the invention (allocated internal designations FRE43, FRE49, FRE56, FRE59, FRE63 and FRE72), indicating (shaded regions) the nucleotide regions of the HLP2 TRE which are retained. Arrows indicate insertion of a fragment of the core region into the 5′ region (*) and insertion of nucleotides 265-272 of HLP2 following deletion of nucleotides 243-283 (**).

[0229] FIG. 2 shows for comparative purposes a global sequence alignment of various transcription regulatory elements derived from the HLP2 TRE. The nucleotides that form part of the consensus or core region (i.e. nucleotides 170-242 of HLP2) are indicated (*).

[0230] FIG. 3 shows a transcription regulatory element (TRE) of the invention as part of an overall Factor VIII expression cassette for use in the experiments described below. Looped Inverted Terminal Repeats (ITRs) bracket the cassette, which includes a transcription regulatory element of the invention (P), a nucleotide sequence encoding a signal peptide (SP), a nucleotide sequence encoding a truncated Factor VIII (hFVIII-SQ) and a synthetic polyA sequence (SpA). Overall length (L) of the expression cassette clearly depends on the length of the various elements.

[0231] FIG. 4 shows the results of two (4A-C i and ii) in vitro studies conducted using the exemplified transcription regulatory elements of the invention in a Factor VIII expression cassette. HuH7 cells were transfected with FVIII-SQ constructs comprising a TRE of interest. The level of FVIII activity in culture supernatant was analysed at day 3 post-transfection. 4A)i) and 4 A)ii) show the FVIII levels (% FVIII:C, determined using the FVIII chromogenic activity assay described below); 4B)i) and 4B)ii) show luciferase activity level from the corresponding transfected well; 4C)i) and 4C)ii) show the FVIII level from 4A)i) and 4A)ii) normalised to the level of luciferase expression; thereby showing the relative efficacy of the transcription regulatory element. HLP2 is provided for comparison purposes. The bar charts represent mean values from triplicate experiments. RLU=relative luminescence units.

[0232] FIG. 5 shows the results of in vivo studies conducted using the exemplified transcription regulatory elements of the invention in a Factor VIII expression cassette. 6-8-week-old male C57BL/6 mice were intravenously injected with 2×10.sup.12 vg/kg viral vector. Six mice were injected per construct. On day 28 post injection the mice were culled and blood harvested intro citrate anticoagulant. Blood and murine liver were provided for analysis. Blood was used to carry out FVIII analysis while liver biopsies were used to calculate the vector genome. 5A)i), 5A)ii), 5A)iii) and 5A)iv) show Factor VIII antigen levels (determined using the FVIII sandwich ELISA antigen assay described below); 5B)i), 5B)ii), 5B)iii) and 5B)iv) show estimated vector genomes per liver cell; 5C)i), 5C)ii), 5C)iii) and 5C)iv) show FVIII antigen levels normalised to the vector genomes per cell thereby showing the relative efficacy of the transcription regulatory element. The bar charts represent mean values (n=6).

[0233] FIG. 6 shows the results of in vitro studies into the promoter fidelity of FRE72. FRE72 promoter fidelity was assessed in cell lines from a range of different tissues; Huh7: liver. HEK293T: kidney. PANC1: pancreas. BxPC-3: pancreas. MCF7: breast. 1643: neuroblastoma. MRC-9: lung. 697: early B cell. Cells were transduced with the control vector AAVS3.CAG.GFP or AAVS3.FRE72.GFP or untreated at MOI of 1×10.sup.5. FIG. 6 shows three columns for each cell type; the left hand column for each cell type (grey) relates to cells transduced with AAVS3.FRE72.GFP; the central column for each cell type (black) relates to cells transduced with the control vector; and the right hand column for each cell type (white) relates to untreated cells. For the HEK293T and MCF-7 cells the left hand (“grey”) column is so small that it is not visible in FIG. 6; similarly for the HEK293T, 1643 and 697 cells the right hand (“white”) columns is so small that it is not visible in FIG. 6.

[0234] FIG. 7 shows the results of an in vivo study conducted to confirm the longevity of the FRE72 promoter. An AAV8 construct comprising an FVIII-SQ transgene under the transcriptional control of the FRE72 promoter was prepared and administered to wild-type mice. Blood samples were taken by tail bleeding (at days 31, 56 and 104 post-injection) and finally via cardiac puncture (at day 230 post-injection). The FVIII antigen level in each sample was measured and the data points are shown on the graph. The bars represent median values.

[0235] FIG. 8 shows the results of an in vitro study comparing expression of a human protein following plasmid transfection in Huh7 cells. The plasmids used either the FRE72 promoter, or the known HCR-hAAT or HLP2 promoters. The level of protein in culture supernatant was measured at day 3 post-transfection using an ELISA. A CMV-luciferase control plasmid was used as co-transfection vector for normalisation of transfection efficiency. FIG. 8A shows the results prior to luciferase correction and FIG. 8B shows the results following luciferase correction. The bars represent median values.

EXAMPLES

[0236] Materials and Methods

[0237] FVIII Constructs

[0238] The cDNA of human FVIII-SQ (encoding FVIII containing a 14 amino acid linker region in place of the B domain, as discussed above) was cloned into a liver-specific promoter-driven adeno-associated virus (AAV) vector.

[0239] Two different codon optimised FVIII variants (termed “co02” and “co19”) were used. To reduce the AAV recombinant genome size, a number of small liver-specific promoters were designed as set out below.

[0240] Generation of AAV vectors

[0241] AAV particles were produced by triple plasmid transfection of HEK293T cells with plasmids encoding the AAV Rep and Cap functions; adenoviral helper functions; and the recombinant genome containing the FVIII expression cassette flanked by AAV2 ITRs. Cell pellet and supernatant were harvested 72 hours post-transfection and AAV particles purified by affinity chromatography using resins such as POROS Capture Select and AVB Sepharose. AAV was then dialysed into PBS overnight, stored at 4° C. and titred by qPCR.

[0242] Assays

[0243] FVIII Chromogenic Activity Assay

[0244] The Biophen FVIII:C chromogenic assay (Hyphen BioMed, ref 221406) measures the cofactor activity of FVIII FVIII:C.

[0245] Through thrombin activation, the FVIII:C polypeptide forms a complex with human Factor IXa, phospholipids and calcium. Under these conditions, Factor X, provided in this assay at a specific concentration and in excess, is converted into Factor Xa (activated). This Factor Xa produced is directly proportional to FVIII:C, the limiting factor. Factor Xa is directly measured by a chromogenic substrate, Sxa-11. Factor Xa cleaves the chromogenic substrate and releases pNA. Production of pNA is proportional to Factor Xa activity, which is directly related to FVIII:C activity. The level of pNA released can determined by measuring colour development at 405 nm, and this is relative to the amount of the Factor Xa polypeptide generated by Factor VIII:C in the sample, which is proportional to the activity of FVIII:C in the sample.

[0246] The assay is performed according to manufacturer's instructions. Briefly, to a microplate well, preincubated at 37° C., 50 μl of calibrator plasmas, diluted (in reagent R4) test plasmas or cell supernatants/lysates or controls, is added, followed by 50 μl each of reagent R1 and R2, which are reconstituted with 6 mL of distilled water and prewarmed to 37° C. After mixing, these components form a 150 μl reaction that is allowed to incubate for 5 min at 37° C. Subsequently, the reaction is supplemented with reagent R3, which is itself resuspended in 6 mL of distilled water and prewarmed to 37° C., and the 200 μL mix is allowed to incubate for a further 5 min at 37° C. The reaction is stopped by adding 50 μl of 20% acetic acid or citric acid (20 g/l), before measuring the absorbance of the resulting 250 μl mixture at 405 nm.

[0247] Reagents:

[0248] R1—Human Factor X, lyophilized in presence of a fibrin polymerization inhibitor.

[0249] R2—Activation Reagent—Factor IXa (human), at a constant and optimized concentration, containing human thrombin, calcium and synthetic phospholipids, lyophilized.

[0250] R3—SXa-11—Chromogenic substrate, specific for Factor Xa, lyophilized, with a thrombin inhibitor.

[0251] R4—Tris-BSA Buffer. Contains 1% BSA, PEG, FVIII:C Stabilizer and sodium azide (0.9 g/L).

[0252] In relation to the readout from the chromogenic activity assay, the “% FVIII activity” (also referred to as “% FVIII:C”) is the “% normal” which means, for example in the context of expressing a FVIII expression cassette in HuH-7 cells, that relative to a human plasma sample having 100% FVIII activity, the FVIII activity detected in a supernatant following expression of a FVIII expression cassette in HuH-7 cells is a specified % of the FVIII activity detected in said human plasma sample having 100% FVIII activity.

[0253] FVIII Sandwich ELISA Antigen Assay

[0254] The Asserachrom VIII:Ag kit (Stago Diagnostica, ref 00280) is an antigenic assay for quantification of FVIII in plasma by enzyme-linked immunosorbent assay (ELISA). FVIII in assayed samples is captured by a mouse-monoclonal anti-human VIII:Ag antibody, pre-coating the walls of a plastic microplate well. Following sufficient incubation and washing to reduce non-specific binding, mouse anti-human FVIII antibodies, coupled to peroxidase, bind to the remaining free antigenic determinants of the captured FVIII. The bound peroxidase is then revealed by TMB substrate. The colour development induced by TMB is halted by the addition of a strong acid. The intensity of the colour development is directly proportional to the FVIII concentration in the assayed sample, determined by measuring the absorbance at 450 nm.

[0255] The readout from this assay may be expressed as “% normal” which means, for example in the context of expressing FVIII constructs in mice, that relative to a human plasma sample having 100% FVIII activity, the number of FVIII molecules (strictly, epitopes) detected in a mouse plasma sample is a specified % of the number of FVIII molecules/epitopes detected in said human plasma sample having 100% FVIII activity.

[0256] In both the activity and antigen assays described above, FVIII (activity or antigen levels) is quantified in mouse, or human cell supernatant, samples using the manufacturer recommended or included lyophilized human plasma samples of known FVIII activity or antigen (as appropriate), calibrated against the WHO International Standard (NIBSC code 07/316).

Example 1—Design and Selection of Small Liver-Specific Transcription Regulatory Elements

[0257] A number of different TREs were designed based on the HLP2 TRE and selected based on overall length. Deletions to the TRE were applied, based on looking at conserved regions in the related alpha-1-antitrypsin TRE in various vertebrates. It was surprisingly found that TREs could be made which are significantly shorter than the HLP2 TRE but which retain a degree of functionality. In some cases the level of activity is at least comparable to the HLP2 TRE, as shown in the examples below.

[0258] FIG. 1 shows a schematic of the HLP2 TRE and a number of transcription regulatory elements of the invention. Shaded regions represent nucleotide sequences which the present inventors have found to be highly conserved in the alpha-1-antitrypsin TRE from which HLP2 is derived. Once regions were identified for deletion, the deletion itself was carried out using known techniques. Transcription regulatory elements can be made according to the sequences disclosed herein by using known DNA synthesis techniques. Thus transcription regulatory elements of the invention can be derived from the HLP2 TRE by using deletions to remove required portions of the HLP2 sequence; or the TREs of the invention can be synthesised via site-directed mutagenesis.

[0259] The following transcription regulatory elements were designed and tested (HLP2 was used as a comparator): [0260] FRE43 (SEQ ID NO: 24) [0261] FRE49 (SEQ ID NO: 25) [0262] FRE56 (SEQ ID NO: 26) [0263] FRE59 (SEQ ID NO: 27) [0264] FRE63 (SEQ ID NO: 28) [0265] FRE72 (SEQ ID NO: 29)

[0266] In order to determine the minimum length required to obtain a transcription regulatory element having at least a basic level of functionality, three further transcription regulatory elements were designed and tested: [0267] FRE46 consists of the “core nucleotide sequence” defined by SEQ ID NO: 2. FRE46 therefore corresponds to nucleotides 170-242 of SEQ ID NO:1 and is 73 nucleotides in length. [0268] FRE47 consists of the “core nucleotide sequence” defined by SEQ ID NO: 2 together with a TSS sequence defined by SEQ ID NO: 6 located 3′ to the “core nucleotide sequence”. FRE47 therefore corresponds to nucleotides 170-242 plus nucleotides 297-302 of SEQ ID NO: 1 and is 79 nucleotides in length. [0269] FRE48 consists of the “extended core nucleotide sequence” defined by SEQ ID NO: 3 together with a TSS sequence defined by SEQ ID NO: 6 located 3′ to the “extended core nucleotide sequence”. FRE48 therefore corresponds to nucleotides 163-242 plus nucleotides 297-302 of SEQ ID NO: 1 and is 86 nucleotides in length.

[0270] FIG. 2 shows the nucleotide sequences of the above transcription regulatory elements which were obtained using the methodology set out above. The nucleotide sequence of HLP2 is provided for comparative purposes.

Example 2—In Vitro Assessment

[0271] To evaluate the activity of the designed transcription regulatory elements in vitro, hepatocyte derived cellular carcinoma cell line HuH7 was transiently transfected with candidate plasmids comprising the respective TREs (either HLP2 (for comparison purposes) or one of those defined in Example 1 above) positioned upstream of a designated “co02” codon-optimised transgene for a human clotting factor VIII variant (FVIII-SQ; i.e. a FVIII containing a 14 bp linker region in place of the B domain, as described e.g. in Lind et al. 1995 supra). The “co02” sequence is provided as SEQ ID NO: 31. The transgene and transcription regulatory element were flanked by ITRs from AAV2. In total 2.5×10.sup.5 Huh7 cells were seeded per well of a 12 well plate in DMEM low glucose+10% FBS+glutamax (D10 medium). Experiments were performed in triplicate.

[0272] For plasmid transient transfection, following FuGENE® HD Transfection protocol, 24 hours post cell seeding, 1.8 μg of plasmid (designed as set out above) and 0.2 μg CMV-Luciferase plasmids were mixed and added to FuGENE HD Reagent (8 μL). CMV-Luciferase plasmid (10% of the total plasmid) was included in each transfection in order to monitor the transfection efficiency.

[0273] Post transfection (around 18 hours later), the medium was replaced with 500 μl fresh DMEM low glucose+10% FBS+glutamax (D10 medium). 24 h later, medium was replaced by fresh DMEM low glucose+glutamax (DO media). Cells and medium were harvested the following day, i.e. at day 3 post-transfection.

[0274] FVIII activity was assessed using the BIOPHEN FVIII:C(6) (ref. 221406) kit. The absorbance was measured on SpectraMax i3. In parallel, cells were lysed (Promega E397A lysis buffer) and subjected to a Luciferase assay (Promega E1501) to measure the Luciferase expression. Luciferase expression was used as an internal control to normalise the FVIII activity. Analysis was performed using the software Graphpad Prism v7.

[0275] The results of the in vitro experiments are shown in FIG. 4. The most relevant panels are 4(C i) and 4(C ii), which show the relative mean FVIII expression achieved by the various TREs when normalised to the level of transfection.

Example 3—In Vivo Assessment

[0276] AAV particles were produced as described above having a genome comprising a codon-optimised nucleotide sequence (designated “co19”) encoding a human FVIII-SQ encapsidated by an AAV8 capsid. The “co19” sequence is provided as SEQ ID NO: 32. AAV particles were produced as described above.

[0277] FIG. 3 provides a schematic showing the cassette obtained using the above methodology. The element P represents a transcription regulatory element such as a promoter/enhancer, which is either derived from HLP2 or is HLP2 (which was used for comparative purposes to assess utility of the TREs derived therefrom). The native FVIII signal peptide was replaced with a wild-type coding sequence for a heterologous signal peptide (termed “SP8”) which is 72 bp in length.

[0278] 6-8-week-old male C57BL/6 mice were intravenously injected with 2×10.sup.12 vg/kg viral vector. Six mice were injected per construct. On day 28 post-injection the mice were culled, and blood harvested into citrate anticoagulant. Blood and murine liver were provided for analysis.

[0279] Blood was used to carry out FVIII analysis while liver biopsies were used to calculate the vector genome.

[0280] To determine the number of vector genomes per liver cell post-AAV injection, DNA was isolated from frozen liver samples, approximately 40 mg, using QIAGEN DNeasy Blood and Tissue Kit (QIAGEN) following manufacturers' instructions. Quantitative real-time PCR (q-PCR) amplification was carried out using the PowerUp SYBR Green Master mix (Applied Biosystems) according to the manufacturer's instructions. q-PCR was performed on a QuantStudio™ instrument (Applied Biosystems). The primer sets are designed to quantify the transgene, allowing an estimation of AAV copy number. Genome copy number was calculated from the standard curve and after normalization to mouse GAPDH quantified by qPCR.

[0281] To determine the levels of FVIII protein post-AAV injection, FVIII antigen level from citrated plasma was measured by Asserachrom VIII:Ag ELISA kit (Diagnostica Stago) following manufacturer's instructions. Further dilutions were performed when deemed necessary.

[0282] Results are shown in FIG. 5. The most relevant panels are in FIGS. 5(C)(i)-5(C)(iv), which show the relative FVIII level, normalised to the viral genome level per cell.

Example 4—Assessing Tissue Specificity of FRE72

[0283] FIG. 6 shows the results of in vitro studies into the promoter fidelity of FRE72. FRE72 promoter fidelity was assessed in cell lines from a range of different tissues; Huh7: liver. HEK293T: kidney. PANC1: pancreas. BxPC-3: pancreas. MCF7: breast. 1643: neuroblastoma. MRC-9: lung. 697: early B cell. Cells were transduced with the control vector AAVS3.CAG.GFP or AAVS3.FRE72.GFP or untreated at MOI of 1×10.sup.5. FIG. 6 shows three columns for each cell type; the left hand column for each cell type (grey) relates to cells transduced with AAVS3.FRE72.GFP; the central column for each cell type (black) relates to cells transduced with the control vector; and the right hand column for each cell type (white) relates to untreated cells. For the HEK293T and MCF-7 cells the left hand (“grey”) column is so small that it is not visible in FIG. 6; similarly for the HEK293T, 1643 and 697 cells the right hand (“white”) columns is so small that it is not visible in FIG. 6.

Example 5—the FRE72 Promoter Provides Long-Term Expression In Vivo

[0284] An AAV vector comprising a FVIII-SQ transgene (designated FVIIIco19-SQ) under the transcriptional control of the FRE72 promotor was pseudotyped with AAV8 capsid. The overall vector genome, including ITRs, promoter and transgene, was 4845 bp long (SEQ ID NO: 34).

[0285] The resulting AAV8 vector was administered into the tail vein of C57BL6 wild type mice at 6-8 weeks of age. Vectors were stored at 4° C. prior to injection. Original viral suspensions were diluted in sterile X-vivo 10 (Lonza, BE04-380Q) in order to obtain an adequate inoculum yielding a dose of 2×10.sup.12 vg/kg.

[0286] At days 31, 56 and 104 post-injection, a blood sample of 100 μl was taken from the lateral tail vein of each of the mice. At day 230 post-injection, terminal bleeding was performed and maximum volume (approx. 1 ml) blood sample was taken via cardiac puncture from heavily anaesthetised animals which were culled following the blood sample. Collected blood was diluted with citrate anticoagulant (1:10 dilution) and centrifuged at 5000 rpm for 5 minutes.

[0287] Plasma samples were analysed for FVIII antigen level using an FVIII sandwich ELISA antigen assay as described above in Materials and Methods. The results are shown in FIG. 7. The bars represent median values.

Example 6—a Comparison of FRE72 Against the Known HLP2 and HCR-hAAT Promoters

[0288] Three separate test plasmid DNA constructs were prepared which incorporated a codon-optimised transgene sequence encoding a human protein under the control of either the FRE72 promoter or the known HLP2 or HCR-hAAT promoters.

[0289] To compare expression levels for each of the promoters, Huh7 cells (JCRB cell bank, no. JCRB0403) were seeded in a 96 well plate (30,000 cells per well) in DMEM low glucose, 10% FBS+Glutamax (D10 media) and cultured at 37° C. and 5% CO.sub.2 (day 1). The next day (approx. 24 hours after cell seeding; day 2), the plasmid DNA-transfection reagent mixture was prepared and transfected into Huh7 cells. 0.225 μg of test plasmid DNA and 0.025 μg CMV-Luciferase control plasmid (FLJ-PL282) were mixed with FuGENE at a ratio of 4 μl FuGENE per μg of DNA (or 1 μl FuGENE per 0.25 μg of plasmid DNA). For 96-well transfection experiments, 1 μl of the FuGENE mix was added per well. The plasmid DNA-transfection reagent mixture was incubated on the cells overnight at 37° C. and 5% CO.sub.2.

[0290] The next morning (day 3), approximately 18 hours after transfection, the media was replaced with fresh D10 media and cells incubated overnight at 37° C. and 5% CO.sub.2. The next morning (24 h later; day 4), media was replaced by fresh DMEM low glucose+Glutamax+Insulin-Transferrin-Selenium supplement (DO/ITS media). Cells and media were harvested the following day (on day 5).

[0291] Protein expression in culture media was assessed using an ELISA kit. In parallel to the ELISA, Huh7 cells were washed with Phosphate buffered saline (PBS) twice and cells treated with 100 μl of luciferase lysis buffer of the Luciferase assay kit (Promega cat# E1501/E4530). Cell lysates were stored at −80° C. On the day of luciferase assays, cell lysates were thawed and 20 μl of the sample was used to measure the luciferase expression by luminescence on a Molecular Devices SpectraMax i3x plate reader. The detailed protocol is published in the Promega Technical Bullitin #TB281. Luciferase expression was used as internal control to normalise the protein levels. Analysis were performed using the software Graphpad Prism v7.

[0292] The results are shown in FIG. 8A (before luciferase correction) and FIG. 8B (after luciferase correction).

TABLE-US-00001 Sequence listing table SEQ ID NO. Sequence description/derivation 1 Known HLP2 TRE as disclosed e.g. in WO16/181122 2 The “core nucleotide sequence” i.e. a nucleotide sequence from the HLP2 TRE which the present inventors have discovered is common to all TREs of the invention. Corresponds to nucleotides 170-242 of SEQ ID NO: 1. 3 An extended “core nucleotide sequence” which is common to a subset of TREs of the invention. Corresponds to nucleotides 163-242 of SEQ ID NO: 1. 4 A part of the HLP2 TRE (located 5′ to the “core nucleotide sequence”) which the present inventors have discovered can be deleted, truncated or modified while retaining functionality. Corresponds to nucleotides 118-162 of SEQ ID NO: 1. 5 A part of the HLP2 TRE (located 3′ to the “core nucleotide sequence”) which the present inventors have discovered can be deleted, truncated or modified while retaining functionality. Corresponds to nucleotides 243-283 of SEQ ID NO: 1. 6 A transcription start site (“TSS”) found in the HLP2 TRE (located 3′ to the “core nucleotide sequence”). Corresponds to nucleotides 297-302 of SEQ ID NO: 1. 7 A transcription start site (“TSS”) found in the HLP2 TRE (located 3′ to the “core nucleotide sequence”). Corresponds to nucleotides 303-308 of SEQ ID NO: 1. 8 A transcription start site (“TSS”) found in the HLP2 TRE (located 3′ to the “core nucleotide sequence”). Corresponds to nucleotides 314-319 of SEQ ID NO: 1. 9 A part of the HLP2 TRE (located 3′ to the “core nucleotide sequence”) which the present inventors have discovered can be retained in some TREs of the invention. Corresponds to nucleotides 284-302 of SEQ ID NO: 1. 10 A part of the HLP2 TRE (located 3′ to the “core nucleotide sequence”) which the present inventors have discovered can be retained in some TREs of the invention. Corresponds to nucleotides 297-335 of SEQ ID NO: 1. 11 A part of the HLP2 TRE (located 3′ to the “core nucleotide sequence”) which the present inventors have discovered can be retained in some TREs of the invention. Corresponds to nucleotides 265-272 of SEQ ID NO: 1. May be considered to be a truncation of SEQ ID NO: 5 (q.v.). 12 Part of an exemplified TRE of the invention (designated ″FRE43″) located 3' to the “core nucleotide sequence”. 13 Part of several exemplified TREs of the invention (designated “FRE56”, “FRE59” and “FRE63”) located 3′ to the “core nucleotide sequence”. 14 A part of the HLP2 TRE (located 5′ to the “core nucleotide sequence”) which the present inventors have discovered can be retained in some TREs of the invention. Corresponds to nucleotides 12-33 of SEQ ID NO: 1. 15 A part of the HLP2 TRE (located 5′ to the “core nucleotide sequence”) which the present inventors have discovered can be retained in some TREs of the invention. Corresponds to nucleotides 12-41 of SEQ ID NO: 1. 16 A part of the HLP2 TRE (located 5′ to the “core nucleotide sequence”) which the present inventors have discovered can be retained in some TREs of the invention. Corresponds to nucleotides 1-98 of SEQ ID NO: 1. 17 A part of the HLP2 TRE (located 5′ to the “core nucleotide sequence”) which the present inventors have discovered can be retained in some TREs of the invention. Corresponds to nucleotides 163-169 of SEQ ID NO: 1. Comprised within the “extended core nucleotide sequence” defined by SEQ. ID NO: 3 (q.v.). 18 Part of an exemplified TRE of the invention (designated “FRE43”) located 5′ to the “core nucleotide sequence”. 19 Part of an exemplified TRE of the invention (designated “FRE49”) located 5′ to the “core nucleotide sequence”. 20 Part of an exemplified TRE of the invention (designated “FRE56”) located 5′ to the “core nucleotide sequence”. 21 Part of an exemplified TRE of the invention (designated “FRE59”) located 5′ to the “extended core nucleotide sequence”. 22 Part of an exemplified TRE of the invention (designated “FRE63”) located 5′ to the “core nucleotide sequence”. 23 Part of an exemplified TRE of the invention (designated “FRE72”) located 5′ to the “core nucleotide sequence”. 24 An exemplified TRE of the invention (designated “FRE43”). 25 An exemplified TRE of the invention (designated “FRE49”). 26 An exemplified TRE of the invention (designated “FRE56”). 27 An exemplified TRE of the invention (designated “FRE59”). 28 An exemplified TRE of the invention (designated “FRE63”). 29 An exemplified TRE of the invention (designated “FRE72”). 30 A possible enhancer region located 5′ to the “core nucleotide sequence” 31 A codon-optimised nucleotide sequence (designated “co02”) which encodes a FVIII-SQ peptide 32 A codon-optimised nucleotide sequence (designated “col9”) which encodes a FVIIl-SQ peptide 33 Known HCR-hAAT TRE 34 An AAV vector genome as used in Example 5 incorporating the FRE72 promoter with a FVIII-SQ transgene (designated FVIIIco19-SQ) 35 FRE75TRE 36 FRE46TRE 37 FRE47TRE

TABLE-US-00002 SEQUENCES - HLP2 TRE >SEQ ID NO: 1 ccctaaaatgggcaaacattgcaagcagcaaacagcaaacacacagccctccctgcctgctgaccttggagct ggggcagaggtcagacacctctctgggcccatgccacctccaactggacacaggacgctgtggtttctgagcc agggggcgactcagatcccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggtt aatattcaccagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggc cctgtctcctcagcttcaggcaccaccactgacctgggacagtgaatc - Core nucleotide sequence >SEQ ID NO: 2 agtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattcaccagcagcctccccc - Extended core nucleotide sequence >SEQ ID NO: 3 cccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattcaccagcagc ctccccc - 5′ section of HLP2 (118-162 of SEQ ID 1) >SEQ ID NO: 4 tggacacaggacgctgtggtttctgagccagggggcgactcagat - 3′ section of HLP2 (243-283 of SEQ ID 1) > >SEQ ID NO: 5 gttgcccctctggatccactgcttaaatacggacgaggaca - TSS > >SEQ ID NO: 6 tcagct - TSS > >SEQ ID NO: 7 tcaggc - TSS >SEQ ID NO: 8 cactga - 3′ section (284-302 of SEQ ID NO: 1) >SEQ ID NO: 9 gggccctgtc tcctcagct - 3′ section of FRE49, FRE72 and FRE75 (297-335 of SEQ ID NO: 1) >SEQ ID NO: 10 tcagcttcaggcaccaccactgacctgggacagtgaatc - 3′ section 265-272 of SEQ ID NO: 1 >SEQ ID NO: 11 ttaaatac - 3′ section of FRE43 >SEQ ID NO: 12 gttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctcagcttcaggcaccacca ctgacctgggacagtgaatc - 3′ section of FRE56, FRE59 and FRE63 >SEQ ID NO: 13 ttaaatacgg gccctgtctc ctcagct - HLP2 5′ section (12-33 of SEQ ID NO: 1) >SEQ ID NO: 14 gcaaacattg caagcagcaa ac - HLP2 5′ section (12-41 of SEQ ID NO: 1) >SEQ ID NO: 15 gcaaacattg caagcagcaa acagcaaaca - HLP2 5′ section (1-98 of SEQ ID NO: 1) >SEQ ID NO: 16 ccctaaaatgggcaaacattgcaagcagcaaacagcaaacacacagccctccctgcctgctgaccttggagct ggggcagaggtcagacacctctctg - HLP2 5′ section (163-169 of SEQ ID NO: 1) >SEQ ID NO: 17 cccagcc - FRE43 5′ section >SEQ ID NO: 18 ccctaaaatgggcaaacattgcaagcagcaaacagcaaacacacagccctccctgcctgctgaccttggagct ggggcagaggtcagacacctctctg - FRE49 5′ section >SEQ ID NO: 19 gcaaacattgcaagcagcaaacagcaaaca - FRE56 5′ section >SEQ ID NO: 20 cgtgttcctgctctttgtccctctgtcctacttagactaatatttgccttgggtactgcaaacaggaaatggg ggagggac - FRE59 5′ section >SEQ ID NO: 21 gcaaacattgcaagcagcaaacagtggacttagcccctgtttgctcctccgataactggggtgaccttggtta atattcaccagcagcctccccc - FRE63 5′ section >SEQ ID NO: 22 gcaaacattgcaagcagcaaacagtggcgtggacttagcccctgtttgctcctccgataactggggtgacctt ggttaatattcaccagcagcctccccc - FRE72 5′ section >SEQ ID NO: 23 cccagcc - FRE43 TRE >SEQ ID NO: 24 ccctaaaatgggcaaacattgcaagcagcaaacagcaaacacacagccctccctgcctgctgaccttggagct ggggcagaggtcagacacctctctgagtggacttagcccctgtttgctcctccgataactggggtgaccttgg ttaatattcaccagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccct gtctcctcagcttcaggcaccaccactgacctgggacagtgaatc - FRE49 TRE >SEQ ID NO: 25 gcaaacattgcaagcagcaaacagcaaacacccagccagtggacttagcccctgtttgctcctccgataactg gggtgaccttggttaatattcaccagcagcctccccctcagcttcaggcaccaccactgacctgggacagtga atc - FRE56 TRE >SEQ ID NO: 26 cgtgttcctgctctttgtccctctgtcctacttagactaatatttgccttgggtactgcaaacaggaaatggg ggagggacagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattcaccagcag cctcccccttaaatacgggccctgtctcctcagct - FRE59 TRE >SEQ ID NO: 27 gcaaacattgcaagcagcaaacagtggacttagcccctgtttgctcctccgataactggggtgaccttggtta atattcaccagcagcctccccccccagccagtggacttagcccctgtttgctcctccgataactggggtgacc ttggttaatattcaccagcagcctcccccttaaatacgggccctgtctcctcagct - FRE63 TRE >SEQ ID NO: 28  gcaaacattgcaagcagcaaacagtggcgtggacttagcccctgtttgctcctccgataactggggtgacctt ggttaatattcaccagcagcctccccccccagccagtggacttagcccctgtttgctcctccgataactgggg tgaccttggttaatattcaccagcagcctcccccttaaatacgggccctgtctcctcagct - FRE72 TRE >SEQ ID NO: 29  cccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattcaccagcagc ctccccctcagcttcaggcaccaccactgacctgggacagtgaatc - apoE enhancer, HNF5 >SEQ ID NO: 30 gcaaaca - co02 codop FVIII-SQ >SEQ ID NO: 31 atgcagattgagctgtctacctgcttctttctgtgcctgctgagattctgctttagtgctacaaggcgttact atctgggagctgtggagctgtcttgggattacatgcagtcagacctgggagagctgccagtggatgccagatt tccccctcgagtgcccaagagcttcccttttaatacctctgtggtgtataagaaaaccctgtttgtggagttt accgatcacctgttcaacattgctaagccaaggccaccctggatgggcctgctgggaccaacaatccaggctg aggtgtatgatacagtggtcatcaccctgaagaacatggcttcccaccctgtgtcactgcatgctgtgggagt gagctactggaaggccagtgagggagctgagtatgatgatcagaccagccagagagagaaggaggatgacaag gtgtttcctggaggctctcatacctatgtgtggcaggtgctgaaggagaatggcccaatggctagtgatcccc tgtgcctgacctacagctatctgtctcatgtggacctggtgaaggatctgaacagtggcctgattggagccct gcttgtgtgtcgtgaaggctctctggccaaggaaaagacccagacactgcataagttcatcctgctttttgct gtgtttgatgagggcaagtcctggcacagtgagacaaagaactccctgatgcaggacagggatgctgccagtg ccagggcctggcccaagatgcatacagtgaatggctatgtgaataggtccctgcctggcctgattggatgtca cagaaagagtgtgtattggcatgtgattggcatgggcaccacacctgaggttcactccatcttcctggagggc catacctttcttgtgagaaaccacaggcaggccagtctggagatcagtcctatcaccttcctgacagcccaga ccctgcttatggatctgggccagttcctgcttttttgccacatctccagtcaccagcatgatggcatggaggc ttatgtgaaggtggactcctgtcctgaggaacctcagctgagaatgaagaacaatgaggaagctgaggactat gatgatgacctgacagactctgagatggatgtggttagatttgatgatgacaactctccttcctttattcaaa tccgatcagtggccaagaaacacccaaagacatgggtgcattacattgctgcagaggaggaggactgggatta tgctcctctggtgctggcccctgatgacaggtcctacaagtcccagtatctgaacaatggccctcagaggatt ggcagaaagtacaagaaagtgaggttcatggcttatacagatgagacattcaagacaagggaggccatccagc atgagagtggcatcctgggaccactgctttatggagaagtgggagacaccctgcttatcatttttaaaaacca ggcttccaggccctacaatatctatcctcatggcatcacggatgtgagacccctgtacagtaggagactgcct aagggagtgaagcacctgaaggacttcccaatcctgcctggagagattttcaagtataagtggacagtgacag tggaggatggcccaaccaagagtgaccccaggtgcctgacaagatactattcttcctttgtgaatatggagag ggacctggcctctggcctgattggacctctgcttatctgttacaaggagtctgtggatcagagaggcaaccag atcatgagtgacaagaggaatgtgatcctgttcagtgtgtttgatgagaacaggtcttggtatctgacagaga acatccagagattcctgcccaatcctgctggagtgcaactggaggaccctgagtttcaggcctccaacatcat gcatagcatcaatggctatgtgtttgactccctccaactgagtgtgtgcctgcatgaggtggcttattggtac attctgagcattggagcccagacagatttcctgagtgtgttctttagtggctacaccttcaagcataagatgg tgtatgaggacaccctgacactgttccccttttctggagagacagtgttcatgtccatggagaatcctggcct gtggattctgggctgccacaactctgatttccgtaatcgtggcatgacagcccttctgaaggtgtcttcctgt gacaagaacacaggagactactatgaggattcttatgaggacatcagtgcttatctgcttagcaagaacaatg ccattgagccaaggagcttttctcagaatcctccagtgctgaagagacaccagagagagatcacgcgtaccac actccagagtgatcaggaggaaattgactatgatgacacaatcagtgtggagatgaaaaaggaggactttgac atctatgatgaggatgagaaccagagccccaggtctttccagaagaaaaccagacattactttattgctgcag tggagagactgtgggattatggcatgtccagctctccacatgtgctgagaaatagagcccagagtggcagtgt gccccagttcaagaaagtggttttccaggagtttacagatggatcatttacacagcctctgtacagaggagag ctgaatgagcatctgggcctgcttggcccatatatcagagctgaggtggaggataacatcatggtgaccttcc gtaatcaggccagcaggccctactccttttattcatccctgatctcctatgaggaagaccagagacagggagc tgagccaagaaagaactttgtgaagcccaatgagacaaagacctacttttggaaggtgcagcaccatatggcc cctaccaaggatgagtttgattgcaaggcttgggcttacttcagtgatgtggatctggagaaggatgtgcatt ctggcctgattggaccactgcttgtgtgccataccaacacactgaatcctgctcatggcagacaagtgacagt gcaggagtttgccctgttctttaccatctttgatgagacaaagagctggtacttcacagagaacatggagagg aattgcagggctccttgtaacatccagatggaggacccaaccttcaaggagaactacagatttcatgctatca atggctatatcatggatacactgcctggcctggtcatggctcaggaccagaggatcaggtggtatctgcttag catgggctccaatgagaatatccacagcatccatttctctggccatgtgtttaccgtgagaaaaaaggaggaa tataagatggccctgtacaacctgtatcctggagtgtttgagacagtggagatgctgccatctaaggctggca tctggagggtggagtgcctgattggagagcacctgcatgctggcatgtctaccctgtttctggtgtactccaa taagtgtcagacaccactgggcatggccagtggccatatcagagatttccagatcacagcctctggacagtat ggacagtgggctccaaagctggctagactgcactattctggctccatcaatgcctggtccaccaaggagccct tctcctggatcaaggtggacctgcttgctcccatgatcattcatggcatcaagacacagggagccaggcagaa gttctcttccctgtacatcagccagtttatcatcatgtattctctggatggcaagaaatggcagacctacaga ggcaattctacaggcacactgatggtgttctttggcaatgtggacagctctggcatcaagcacaacatcttca atccccctatcattgctagatacatcagactgcaccctacccattattctatccgatccacactgagaatgga gctgatgggctgtgatctgaacagctgttctatgccactgggcatggagtccaaggccatcagtgatgctcag atcacagcctccagctacttcaccaatatgtttgctacatggtcccctagcaaggccaggctgcacctccagg gcagatccaatgcttggagacctcaagttaacaatccaaaggagtggctccaggtggattttcagaaaaccat gaaggtgacaggagtgaccacccagggagtgaagtctctgcttaccagcatgtatgtgaaggagttcctgatc tcttcgagtcaagatggacaccagtggacactgttctttcagaatggcaaggtgaaggtgttccagggcaatc aggattcctttaccccagtggtgaacagcctggacccaccactgcttacaagatacctgagaatccaccctca gtcctgggtgcatcagattgctctgaggatggaggtgctgggatgtgaggctcaggacctgtattga - co19 codop FVIII-SQ >SEQ ID NO: 32 atgcagattgagctctccacctgcttcttcctctgcctcttgagattctgtttctctgctactagaagatatt atcttggggcagtggagctgagctgggactacatgcagtctgacctgggagaactgcctgtggatgccagatt tccccctcgagtgcccaagagcttcccctttaacacctcagtggtgtacaagaagaccctgtttgtggagttt acagaccatctcttcaacattgctaagcccagacctccctggatgggcctgctgggccctaccatccaagctg aagtgtatgacactgttgtgatcacactcaagaacatggcctcccatcctgtgtccctgcatgcagtgggagt ctcctactggaaggcctcagaaggagcagagtatgatgaccagaccagccagagagagaaggaggatgacaag gtgtttcctggagggagccacacctatgtgtggcaggtgctgaaggagaatggacctatggccagtgaccctc tgtgtcttacctattcctacctgtcacatgtggatctggtgaaggacctgaacagtggcctgattggggctct gctggtttgcagagaaggcagcttggccaaggagaagacccaaaccctgcacaagttcatcctgctgtttgct gtgtttgatgaggggaaatcatggcactcagagaccaagaacagcctcatgcaggatagggatgctgccagtg ccagggcttggcccaagatgcacactgtgaatggctatgtgaatagaagcctgcctgggctgataggctgtca cagaaaatctgtgtactggcatgtgattggcatgggcaccacacctgaggtgcactccattttcctggagggc cacaccttccttgtgagaaaccacagacaagcttccctggagatcagcccaatcacctttctgactgctcaaa ccctcctgatggatctgggccagttcctgctgttctgtcatatctcctcacaccagcatgatggaatggaagc ttatgtcaaggtggactcctgcccagaggaaccacagctcagaatgaagaacaatgaggaggctgaggactat gatgatgacctgacagactctgaaatggatgtggtcagatttgatgatgacaacagcccttcattcatccaaa tcagatctgtggccaagaagcatcccaagacctgggtgcactacatagctgctgaggaggaggactgggacta tgcccctctggtcctggcccctgatgacagaagctataaaagccagtacctgaataatggcccccagagaatt ggcagaaagtacaagaaagtcagattcatggcttacactgatgagaccttcaaaaccagggaagccatccagc atgagtcaggcatcctgggccccctgctgtatggggaggttggagataccctgctgattatcttcaaaaacca ggcaagcaggccctacaatatctaccctcatggcatcactgatgtcaggccactgtattccagaagactgcct aagggggtgaagcacctgaaggacttcccaatcctgccaggggagattttcaaatacaagtggacagtgactg tggaggatggaccaaccaagtcagatcctagatgtctgaccagatactactccagctttgtgaacatggagag agacctggcctctggcctgattggccctctgctgatctgctataaagagtcagtggaccagagaggcaaccag atcatgagtgacaaaagaaatgtgatcttgttctcagtgtttgatgagaatagatcttggtacctcacagaaa acatccagaggttcctgcccaatccagctggggtgcagctggaagatccagaattccaggccagcaacatcat gcatagcatcaatggttatgtctttgacagcctgcagctgtcagtgtgtctgcatgaagttgcttactggtat attctgtccattggagcccagacagacttcctgtctgtcttcttctctggctacacctttaaacacaagatgg tgtatgaggacaccctgaccctgttccctttctctggggaaacagtgttcatgtccatggaaaaccctggact gtggatcctgggctgccataacagtgacttcagaaacagaggcatgacagccctgctcaaggtgtccagctgt gataagaacacaggagactactatgaggatagctatgaggacatcagtgcttacctgctgagcaagaataatg ccattgaacccaggtcattttcccaaaatccccctgtgctgaaaaggcaccagagggagatcacgcgtaccac cctgcagagtgaccaggaggaaattgattatgatgacaccatctctgtggaaatgaaaaaggaggattttgac atctatgatgaggatgagaaccagagccctagaagcttccagaaaaagactagacactacttcattgctgcag tggagagactctgggattatggcatgagctccagcccccatgtgctgagaaatagagctcagagtggcagtgt gccacagttcaagaaggtggtgtttcaggagttcactgatggctccttcacacaaccactttacagaggagaa ctgaatgagcacctgggcctcctgggcccctacatcagggctgaagtggaggataacattatggtcacattta ggaatcaggcttccagaccctactccttttattcctcactcatttcctatgaggaggaccagaggcagggagc tgagcccagaaaaaattttgtgaaacccaatgaaaccaagacctacttctggaaggtgcagcaccatatggcc cctaccaaggatgaatttgactgcaaggcttgggcttacttttctgatgtggaccttgagaaagatgtgcatt caggcctcattgggccactgctggtgtgccacaccaatacactgaaccctgctcatgggagacaggtcacagt gcaggagtttgcactcttctttaccatctttgatgagaccaagtcctggtatttcactgagaacatggagagg aactgcagggccccttgtaacatccagatggaggatcccaccttcaaggaaaactacagattccatgccatca atggctacatcatggacaccctgccaggcctggtgatggcccaggaccagaggatcaggtggtacctcctgtc tatgggcagcaatgaaaatatccacagcattcacttctctggacatgtgtttactgtgaggaagaaggaggaa tacaagatggctctgtacaacctctaccctggggtgtttgaaacagtggagatgctgccctccaaggctggca tctggagagtggaatgtctgattggggagcatctgcatgctggcatgagcacactgttcctggtgtattccaa caagtgccagaccccactgggcatggcctcaggacatatcagggacttccagatcactgctagtggacaatat ggacagtgggcacccaagctggccagactgcactactcaggctccatcaatgcctggagtaccaaggagccct tcagctggatcaaggtggacctgctggcccccatgattatacatggcatcaagacccagggagctagacagaa gttcagctccctgtacatctcccaattcatcatcatgtactctctggatggcaagaaatggcagacctacaga ggcaatagcactggcaccctgatggtgttttttggaaatgttgactcttctggcatcaagcacaacatcttca acccccccatcattgccagatatatcaggctccaccccacccactactccataaggagcaccctgagaatgga gctgatgggctgtgacctgaattcctgctccatgcccctgggcatggaatccaaggcaatctctgatgcacag atcacagcctcctcctacttcaccaacatgtttgcaacctggagcccctccaaggccagactgcacctgcagg gcaggtccaatgcttggagaccacaagtgaacaacccaaaggagtggctgcaggtggacttccagaagaccat gaaagtgactggagtgaccacccagggagtgaaatccctgctcactagcatgtatgtgaaggaattcctgatc agtagctctcaagatggccaccagtggaccctgttcttccagaatggcaaggtgaaggtgtttcagggcaacc aggattccttcacccctgtggtgaatagcctggatcccccactgctgaccagatacctgagaatccaccccca gtcctgggttcaccagattgccctgagaatggaggtgctgggctgtgaggcccaggacctgtactga - known hAAT TRE >SEQ ID NO: 33  aggctcagaggcacacaggagtttctgggctcaccctgcccccttccaacccctcagttcccatcctccagca gctgtttgtgtgctgcctctgaagtccacactgaacaaacttcagcctactcatgtccctaaaatgggcaaac attgcaagcagcaaacagcaaacacacagccctccctgcctgctgaccttggagctggggcagaggtcagaga cctctctgggcccatgccacctccaacatccactcgaccccttggaatttcggtggagaggagcagaggttgt cctggcgtggtttaggtagtgtgagaggggtacccggggatcttgctaccagtggaacagccactaaggattc tgcagtgagagcagagggccagctaagtggtactctcccagagactgtctgactcacgccaccccctccacct tggacacaggacgctgtggtttctgagccaggtacaatgactcctttcggtaagtgcagtggaagctgtacac tgcccaggcaaagcgtccgggcagcgtaggcgggcgactcagatcccagccagtggacttagcccctgtttgc tcctccgataactggggtgaccttggttaatattcaccagcagcctcccccgttgcccctctggatccactgc ttaaatacggacgaggacagggccctgtctcctcagcttcaggcaccaccactgacctgggacagtgaatgat ccccctgatctgcggcc - FVIIIco19SQ AAV construct sequence >SEQ ID NO: 34 TTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCT TTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCC TTTAATtaacccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattc accagcagcctccccctcagcttcaggcaccaccactgacctgggacagtgaatcgcgccaccatgaagctgc tcgcagcaactgtgctactcctcaccatctgcagccttgaaggagctactagaagatattatcttggggcagt ggagctgagctgggactacatgcagtctgacctgggagaactgcctgtggatgccagatttccccctcgagtg cccaagagcttcccctttaacacctcagtggtgtacaagaagaccctgtttgtggagtttacagaccatctct tcaacattgctaagcccagacctccctggatgggcctgctgggccctaccatccaagctgaagtgtatgacac tgttgtgatcacactcaagaacatggcctcccatcctgtgtccctgcatgcagtgggagtctcctactggaag gcctcagaaggagcagagtatgatgaccagaccagccagagagagaaggaggatgacaaggtgtttcctggag ggagccacacctatgtgtggcaggtgctgaaggagaatggacctatggccagtgaccctctgtgtcttaccta ttcctacctgtcacatgtggatctggtgaaggacctgaacagtggcctgattggggctctgctggtttgcaga gaaggcagcttggccaaggagaagacccaaaccctgcacaagttcatcctgctgtttgctgtgtttgatgagg ggaaatcatggcactcagagaccaagaacagcctcatgcaggatagggatgctgccagtgccagggcttggcc caagatgcacactgtgaatggctatgtgaatagaagcctgcctgggctgataggctgtcacagaaaatctgtg tactggcatgtgattggcatgggcaccacacctgaggtgcactccattttcctggagggccacaccttccttg tgagaaaccacagacaagcttccctggagatcagcccaatcacctttctgactgctcaaaccctcctgatgga tctgggccagttcctgctgttctgtcatatctcctcacaccagcatgatggaatggaagcttatgtcaaggtg gactcctgcccagaggaaccacagctcagaatgaagaacaatgaggaggctgaggactatgatgatgacctga cagactctgaaatggatgtggtcagatttgatgatgacaacagcccttcattcatccaaatcagatctgtggc caagaagcatcccaagacctgggtgcactacatagctgctgaggaggaggactgggactatgcccctctggtc ctggcccctgatgacagaagctataaaagccagtacctgaataatggcccccagagaattggcagaaagtaca agaaagtcagattcatggcttacactgatgagaccttcaaaaccagggaagccatccagcatgagtcaggcat cctgggccccctgctgtatggggaggttggagataccctgctgattatcttcaaaaaccaggcaagcaggccc tacaatatctaccctcatggcatcactgatgtcaggccactgtattccagaagactgcctaagggggtgaagc acctgaaggacttcccaatcctgccaggggagattttcaaatacaagtggacagtgactgtggaggatggacc aaccaagtcagatcctagatgtctgaccagatactactccagctttgtgaacatggagagagacctggcctct ggcctgattggccctctgctgatctgctataaagagtcagtggaccagagaggcaaccagatcatgagtgaca aaagaaatgtgatcttgttctcagtgtttgatgagaatagatcttggtacctcacagaaaacatccagaggtt cctgcccaatccagctggggtgcagctggaagatccagaattccaggccagcaacatcatgcatagcatcaat ggttatgtctttgacagcctgcagctgtcagtgtgtctgcatgaagttgcttactggtatattctgtccattg gagcccagacagacttcctgtctgtcttcttctctggctacacctttaaacacaagatggtgtatgaggacac cctgaccctgttccctttctctggggaaacagtgttcatgtccatggaaaaccctggactgtggatcctgggc tgccataacagtgacttcagaaacagaggcatgacagccctgctcaaggtgtccagctgtgataagaacacag gagactactatgaggatagctatgaggacatcagtgcttacctgctgagcaagaataatgccattgaacccag gtcattttcccaaaatccccctgtgctgaaaaggcaccagagggagatcacgcgtaccaccctgcagagtgac caggaggaaattgattatgatgacaccatctctgtggaaatgaaaaaggaggattttgacatctatgatgagg atgagaaccagagccctagaagcttccagaaaaagactagacactacttcattgctgcagtggagagactctg ggattatggcatgagctccagcccccatgtgctgagaaatagagctcagagtggcagtgtgccacagttcaag aaggtggtgtttcaggagttcactgatggctccttcacacaaccactttacagaggagaactgaatgagcacc tgggcctcctgggcccctacatcagggctgaagtggaggataacattatggtcacatttaggaatcaggcttc cagaccctactccttttattcctcactcatttcctatgaggaggaccagaggcagggagctgagcccagaaaa aattttgtgaaacccaatgaaaccaagacctacttctggaaggtgcagcaccatatggcccctaccaaggatg aatttgactgcaaggcttgggcttacttttctgatgtggaccttgagaaagatgtgcattcaggcctcattgg gccactgctggtgtgccacaccaatacactgaaccctgctcatgggagacaggtcacagtgcaggagtttgca ctcttctttaccatctttgatgagaccaagtcctggtatttcactgagaacatggagaggaactgcagggccc cttgtaacatccagatggaggatcccaccttcaaggaaaactacagattccatgccatcaatggctacatcat ggacaccctgccaggcctggtgatggcccaggaccagaggatcaggtggtacctcctgtctatgggcagcaat gaaaatatccacagcattcacttctctggacatgtgtttactgtgaggaagaaggaggaatacaagatggctc tgtacaacctctaccctggggtgtttgaaacagtggagatgctgccctccaaggctggcatctggagagtgga atgtctgattggggagcatctgcatgctggcatgagcacactgttcctggtgtattccaacaagtgccagacc ccactgggcatggcctcaggacatatcagggacttccagatcactgctagtggacaatatggacagtgggcac ccaagctggccagactgcactactcaggctccatcaatgcctggagtaccaaggagcccttcagctggatcaa ggtggacctgctggcccccatgattatacatggcatcaagacccagggagctagacagaagttcagctccctg tacatctcccaattcatcatcatgtactctctggatggcaagaaatggcagacctacagaggcaatagcactg gcaccctgatggtgttttttggaaatgttgactcttctggcatcaagcacaacatcttcaacccccccatcat tgccagatatatcaggctccaccccacccactactccataaggagcaccctgagaatggagctgatgggctgt gacctgaattcctgctccatgcccctgggcatggaatccaaggcaatctctgatgcacagatcacagcctcct cctacttcaccaacatgtttgcaacctggagcccctccaaggccagactgcacctgcaGGGCAGGTCCAATGC CTTGGAGACACAAGTGAACAACCCAAAGGAGTGGCTGCAGGTGGACTTCCAGAAGACCATGAAAGTGACTGGA GTGACCACCCAGGGAGTGAAATCCCTGCTCACTAGCATGTATGTGAAGGAATTCCTGATCAGTAGCTCTCAAG ATGGCCACCAGTGGACCCTGTTCTTCCAGAATGGCAAGGTGAAGGTGTTTCAGGGCAACCAGGATTCCTTCAC CCCTGTGGTGAATAGCCTGGATCCCCCACTGCTGACCAGATACCTGAGAATCCACCCCCAGTCCTGGGTTCAC CAGATTGCCCTGAGAATGGAGGTGCTGGGCTGTGAGGCCCAGGACCTGTACTGAAATAAAAGATCTTTATTTT CATTAGATCTGTGTGTTGGTTTTTTGTGTGAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGC TCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGC GAGCGAGCGCGCAGAGAGGGAGTGGCCAA FRE75 TRE >SEQ ID NO: 35 gcaaacattgcaagcagcaaacagtggacttagcccctgtttgctcctccgataactggggtgaccttggtta atattcaccagcagcctccccccccagccagtggacttagcccctgtttgctcctccgataactggggtgacc ttggttaatattcaccagcagcctccccctcagcttcaggcaccaccactgacctgggacagtgaatc FRE46 TRE >SEQ ID NO: 36 agtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattcaccagcagcctccccc FRE47 TRE >SEQ ID NO: 37 agtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattcaccagcagcctccccc tcagct

[0293] Numbered Aspects of the Invention [0294] 1. A transcription regulatory element comprising a core nucleotide sequence which comprises or consists of a nucleotide sequence having at least 95% identity to SEQ ID NO: 2, or a nucleotide sequence which differs from SEQ ID NO: 2 by a single nucleotide, and wherein the transcription regulatory element is between 80 and 280 nucleotides in length; optionally wherein the transcription regulatory element is between 80 and 225 nucleotides in length. [0295] 2. The transcription regulatory element of aspect 1, further comprising a nucleotide sequence located 3′ to the core nucleotide sequence. [0296] 3. The transcription regulatory element of aspect 2, wherein the nucleotide sequence located 3′ to the core nucleotide sequence comprises one or more transcription start sites (TSS). [0297] 4. The transcription regulatory element of aspect 3, wherein the one or more TSS comprise or consist of a nucleotide sequence according to: [0298] a. SEQ ID NO: 6, or a nucleotide sequence which differs from SEQ ID NO: 6 by a single nucleotide; [0299] b. SEQ ID NO: 7, or a nucleotide sequence which differs from SEQ ID NO: 7 by a single nucleotide; and/or [0300] c. SEQ ID NO: 8, or a nucleotide sequence which differs from SEQ ID NO: 8 by a single nucleotide. [0301] 5. The transcription regulatory element of any one of aspects 2 to 4, wherein the nucleotide sequence located 3′ to the core nucleotide sequence comprises: [0302] a. a nucleotide sequence according to SEQ ID NO: 6, or a nucleotide sequence which differs from SEQ ID NO: 6 by a single nucleotide; or [0303] b. a nucleotide sequence having at least 90% identity to SEQ ID NO: 9, or a nucleotide sequence which differs from SEQ ID NO: 9 by a single nucleotide; or [0304] c. a nucleotide sequence having at least 90% identity to SEQ ID NO: 10, or a nucleotide sequence which differs from SEQ ID NO: 10 by a single nucleotide. [0305] 6. The transcription regulatory element of any one of aspects 2 to 5, wherein the nucleotide sequence located 3′ to the core nucleotide sequence further comprises a nucleotide sequence defined by SEQ ID NO: 11, or a nucleotide sequence which differs from SEQ ID NO: 11 by a single nucleotide. [0306] 7. The transcription regulatory element of any one of aspects 2 to 6, wherein the nucleotide sequence located 3′ to the core nucleotide sequence is shorter than 50 nucleotides; optionally is shorter than 40 nucleotides; and optionally is shorter than 30 nucleotides. [0307] 8. The transcription regulatory element of any one of aspects 2 to 7, wherein the nucleotide sequence located 3′ to the core nucleotide sequence comprises or consists of a nucleotide sequence selected from the group consisting of: [0308] a. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 10, or a nucleotide sequence which differs from SEQ ID NO: 10 by a single nucleotide; [0309] b. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 12, or a nucleotide sequence which differs from SEQ ID NO: 12 by a single nucleotide; and [0310] c. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 13, or a nucleotide sequence which differs from SEQ ID NO: 13 by a single nucleotide. [0311] 9. The transcription regulatory element of any one of the preceding aspects, further comprising a nucleotide sequence located 5′ to the core nucleotide sequence. [0312] 10. The transcription regulatory element of aspect 9, wherein the nucleotide sequence located 5′ to the core nucleotide sequence comprises: [0313] a. a nucleotide sequence comprising at least 10, at least 15, or at least 20 consecutive nucleotides of SEQ ID NO: 14; [0314] b. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 14, or a nucleotide sequence which differs from SEQ ID NO: 14 by a single nucleotide; [0315] c. a nucleotide sequence comprising at least 10, at least 15, or at least 20 consecutive nucleotides of SEQ ID NO: 15; [0316] d. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 15, or a nucleotide sequence which differs from SEQ ID NO: 15 by a single nucleotide; [0317] e. a nucleotide sequence comprising at least 10, at least 15, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80 or at least 90 consecutive nucleotides of SEQ ID NO: 16; [0318] f. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 16, or a nucleotide sequence which differs from SEQ ID NO: 16 by a single nucleotide; [0319] and/or [0320] g. a nucleotide sequence defined by SEQ ID NO: 17, or a nucleotide sequence which differs from SEQ ID NO: 17 by a single nucleotide. [0321] 11. The transcription regulatory element of aspect 9 or aspect 10, wherein the nucleotide sequence located 5′ to the core nucleotide sequence has less than 60% identity to a nucleotide sequence comprising at least 20, at least 25, at least 30, at least 35, at least 40 or 45 consecutive nucleotides of SEQ ID NO: 4. [0322] 12. The transcription regulatory element of aspect 11, wherein the nucleotide sequence located 5′ to the core nucleotide sequence has less than 50% identity to a nucleotide sequence comprising at least 20, at least 25, at least 30, at least 35, at least 40 or 45 consecutive nucleotides of SEQ ID NO: 4; optionally wherein it has less than 45% identity; optionally wherein it has less than 40% identity; and optionally wherein it has less than 30% identity. [0323] 13. The transcription regulatory element of any one of aspects 9 to 12, wherein the nucleotide sequence located 5′ to the core nucleotide sequence is shorter than 110 nucleotides; optionally is shorter than 100 nucleotides; optionally is shorter than 50 nucleotides; and optionally is shorter than 10 nucleotides. [0324] 14. The transcription regulatory element of any one of aspects 9 to 13, wherein the nucleotide sequence located 5′ to the core nucleotide sequence is between 5 and 110 nucleotides in length. [0325] 15. The transcription regulatory element of any one of aspects 9 to 14, wherein the nucleotide sequence located 5′ to the core nucleotide sequence is at least 7 nucleotides in length. [0326] 16. The transcription regulatory element of any one of aspects 9 to 15, wherein the nucleotide sequence located 5′ to the core nucleotide sequence is 102 nucleotides or less in length. [0327] 17. The transcription regulatory element of any one of aspects 9 to 16, wherein the nucleotide sequence located 5′ to the core nucleotide sequence comprises a nucleotide sequence selected from the group consisting of: [0328] a. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 18, or a nucleotide sequence which differs from SEQ ID NO: 18 by a single nucleotide; [0329] b. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 19, or a nucleotide sequence which differs from SEQ ID NO: 19 by a single nucleotide; [0330] c. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 20, or a nucleotide sequence which differs from 90% or SEQ ID NO: 20 by a single nucleotide [0331] d. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 21, or a nucleotide sequence which differs from SEQ ID NO: 21 by a single nucleotide; [0332] e. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 22, or a nucleotide sequence which differs from SEQ ID NO: 22 by a single nucleotide; and [0333] f. a nucleotide sequence according to SEQ ID NO: 23, or which differs from SEQ ID NO: 23 by a single nucleotide. [0334] 18. The transcription regulatory element of any one of the preceding aspects, wherein the transcription regulatory element: [0335] a. does not comprise a nucleotide sequence according to SEQ ID NO: 4, or does not comprise at least 20, at least 30 or at least 40 consecutive nucleotides of SEQ ID NO: 4; [0336] and/or [0337] b. does not comprise a nucleotide sequence according to SEQ ID NO: 5, or does not comprise at least 20, at least 30 or at least 40 consecutive nucleotides of SEQ ID NO: 5. [0338] 19. The transcription regulatory element of aspect 18, which: [0339] a. does not comprise a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 4; [0340] and/or [0341] b. does not comprise a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 5. [0342] 20. The transcription regulatory element of any one of the preceding aspects, which is shorter than 200 nucleotides; optionally which is shorter than 150 nucleotides; and optionally which is shorter than 125 nucleotides. [0343] 21. The transcription regulatory element of any one of the preceding aspects, which is at least 85 nucleotides in length, optionally which is at least 100 nucleotides in length, optionally which is at least 110 nucleotides in length. [0344] 22. A transcription regulatory element comprising a core nucleotide sequence which comprises or consists of a nucleotide sequence having at least 95% identity to SEQ ID NO: 2, or a nucleotide sequence which differs from SEQ ID NO: 2 by a single nucleotide, wherein the transcription regulatory element: [0345] a. does not comprise at least 20, at least 30 or at least 40 consecutive nucleotides of SEQ ID NO: 4; [0346] and/or [0347] b. does not comprise at least 20, at least 30 or at least 40 consecutive nucleotides of SEQ ID NO: 5; [0348] and wherein the transcription regulatory element is between 80 and 280 nucleotides in length. [0349] 23. The transcription regulatory element of aspect 22, which: [0350] a. does not comprise a nucleotide sequence having at least 90%, or at least 95% or 100% identity to SEQ ID NO: 4; [0351] and/or [0352] b. does not comprise a nucleotide sequence having at least 90%, or at least 95% or 100% identity to SEQ ID NO: 5. [0353] 24. The transcription regulatory element of aspect 22 or aspect 23, further comprising a nucleotide sequence located 3′ to the core nucleotide sequence. [0354] 25. The transcription regulatory element of aspect 24, wherein the nucleotide sequence located 3′ to the core nucleotide sequence comprises one or more transcription stop sites (TSS). [0355] 26. The transcription regulatory element of aspect 25, wherein the one or more TSS comprise a nucleotide sequence according to: [0356] a. SEQ ID NO: 6, or a nucleotide sequence which differs from SEQ ID NO: 6 by a single nucleotide; [0357] b. SEQ ID NO: 7, or a nucleotide sequence which differs from SEQ ID NO: 7 by a single nucleotide; and/or [0358] c. SEQ ID NO: 8, or a nucleotide sequence which differs from SEQ ID NO: 8 by a single nucleotide. [0359] 27. The transcription regulatory element of aspect 24, aspect 25 or aspect 26, wherein the nucleotide sequence located 3′ to the core nucleotide sequence comprises: [0360] a. a nucleotide sequence according to SEQ ID NO: 6, or a nucleotide sequence which differs from SEQ ID NO: 6 by a single nucleotide; or [0361] b. a nucleotide sequence having at least 90% identity to SEQ ID NO: 9, or a nucleotide sequence which differs from SEQ ID NO: 9 by a single nucleotide; or [0362] c. a nucleotide sequence having at least 90% identity to SEQ ID NO: 10, or a nucleotide sequence which differs from SEQ ID NO: 10 by a single nucleotide. [0363] 28. The transcription regulatory element of any one of aspects 24 to 27, wherein the nucleotide sequence located 3′ to the core nucleotide sequence further comprises a nucleotide sequence defined by SEQ ID NO: 11, or a nucleotide sequence which differs from SEQ ID NO: 11 by a single nucleotide. [0364] 29. The transcription regulatory element of any one of aspects 24 to 28, wherein the nucleotide sequence located 3′ to the core nucleotide sequence is shorter than 50 nucleotides; optionally is shorter than 40 nucleotides; and optionally is shorter than 30 nucleotides. [0365] 30. The transcription regulatory element of any one of aspects 24 to 29, wherein the nucleotide sequence located 3′ to the core nucleotide sequence comprises or consists of a nucleotide sequence selected from the group consisting of: [0366] a. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 10, or a nucleotide sequence which differs from SEQ ID NO: 10 by a single nucleotide; [0367] b. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO:12, or a nucleotide sequence which differs from SEQ ID NO: 12 by a single nucleotide; and [0368] c. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 13, or a nucleotide sequence which differs from SEQ ID NO: 13 by a single nucleotide. [0369] 31. The transcription regulatory element of any one of aspects 22 to 30, further comprising a nucleotide sequence located 5′ to the core nucleotide sequence. [0370] 32. The transcription regulatory element of aspect 31, wherein the nucleotide sequence located 5′ to the core nucleotide sequence comprises: [0371] a. a nucleotide sequence comprising at least 10, at least 15, or at least 20 consecutive nucleotides of SEQ ID NO: 14; [0372] b. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 14, or a nucleotide sequence which differs from SEQ ID NO: 14 by a single nucleotide; [0373] c. a nucleotide sequence comprising at least 10, at least 15, or at least 20 consecutive nucleotides of SEQ ID NO: 15; [0374] d. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 15, or a nucleotide sequence which differs from SEQ ID NO: 15 by a single nucleotide; [0375] e. a nucleotide sequence comprising at least 10, at least 15, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80 or at least 90 consecutive nucleotides of SEQ ID NO: 16; [0376] f. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 16, or a nucleotide sequence which differs from SEQ ID NO: 16 by a single nucleotide; [0377] and/or [0378] g. a nucleotide sequence defined by SEQ ID NO: 17, or a nucleotide sequence which differs from SEQ ID NO: 17 by a single nucleotide. [0379] 33. The transcription regulatory element of aspect 31 or 32, wherein the nucleotide sequence located 5′ to the core nucleotide sequence has less than 60% identity to a nucleotide sequence comprising at least 20, at least 25, at least 30, at least 35, at least 40 or 45 consecutive nucleotides of SEQ ID NO: 4. [0380] 34. The transcription regulatory element of aspect 33, wherein the nucleotide sequence located 5′ to the core nucleotide sequence has less than 50% identity to a nucleotide sequence comprising at least 20, at least 25, at least 30, at least 35, at least 40 or 45 consecutive nucleotides of SEQ ID NO: 4; optionally wherein it has less than 45% identity; optionally wherein it has less than 40% identity; and optionally wherein it has less than 30% identity. [0381] 35. The transcription regulatory element of any one of aspects 31 to 34, wherein the nucleotide sequence located 5′ to the core nucleotide sequence is shorter than 110 nucleotides; optionally is shorter than 100 nucleotides; optionally is shorter than 50 nucleotides; and optionally is shorter than 10 nucleotides. [0382] 36. The transcription regulatory element of any one of aspects 31 to 35, wherein the nucleotide sequence located 5′ to the core nucleotide sequence is between 5 and 110 nucleotides in length. [0383] 37. The transcription regulatory element of any one of aspects 31 to 36, wherein the nucleotide sequence located 5′ to the core nucleotide sequence is at least 7 nucleotides in length. [0384] 38. The transcription regulatory element of any one of aspects 31 to 37, wherein the nucleotide sequence located 5′ to the core nucleotide sequence is 102 nucleotides or less in length. [0385] 39. The transcription regulatory element of any one of aspects 31 to 38, wherein the nucleotide sequence located 5′ to the core nucleotide sequence comprises a nucleotide sequence selected from the group consisting of: [0386] a. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 18, or a nucleotide sequence which differs from SEQ ID NO: 18 by a single nucleotide; [0387] b. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 19, or a nucleotide sequence which differs from SEQ ID NO: 19 by a single nucleotide; [0388] c. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 20, or a nucleotide sequence which differs from SEQ ID NO: 20 by a single nucleotide; [0389] d. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 21, or a nucleotide sequence which differs from SEQ ID NO: 21 by a single nucleotide; [0390] e. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 22, or a nucleotide sequence which differs from SEQ ID NO: 22 by a single nucleotide; and [0391] f. a nucleotide sequence according to SEQ ID NO: 23, or which differs from SEQ ID NO: 23 by a single nucleotide. [0392] 40. The transcription regulatory element of any one of aspects 22 to 39, which is shorter than 200 nucleotides; optionally which is shorter than 150 nucleotides; and optionally which is shorter than 125 nucleotides. [0393] 41. The transcription regulatory element of any one of aspects 22 to 40, which is at least 85 nucleotides in length, optionally which is at least 100 nucleotides in length, and optionally which is at least 110 nucleotides in length. [0394] 42. A transcription regulatory element comprising: [0395] a. a core nucleotide sequence which comprises or consists of a nucleotide sequence having at least 95% identity to SEQ ID NO: 2, or a nucleotide sequence which differs from SEQ ID NO: 2 by a single nucleotide; and [0396] b. a nucleotide sequence which is located 5′ to the core nucleotide sequence and which has less than 60% identity to a nucleotide sequence comprising at least 20, at least 25, at least 30, at least 35, at least 40 or 45 consecutive nucleotides of SEQ ID NO: 4; [0397] wherein the transcription regulatory element is between 80 and 280 nucleotides in length. [0398] 43. The transcription regulatory element of aspect 42, wherein the nucleotide sequence located 5′ to the core nucleotide sequence comprises: [0399] a. a nucleotide sequence comprising at least 10, at least 15, or at least 20 consecutive nucleotides of SEQ ID NO: 14; [0400] b. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 14, or a nucleotide sequence which differs from SEQ ID NO: 14 by a single nucleotide; [0401] c. a nucleotide sequence comprising at least 10, at least 15, or at least 20 consecutive nucleotides of SEQ ID NO: 15; [0402] d. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 15, or a nucleotide sequence which differs from SEQ ID NO: 15 by a single nucleotide; [0403] e. a nucleotide sequence comprising at least 10, at least 15, at least 20, at least 30, at least 40, at least 50, at least 60 at least 70, at least 80, or at least 90 consecutive nucleotides of SEQ ID NO: 16; [0404] f. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 16, or a nucleotide sequence which differs from SEQ ID NO: 16 by a single nucleotide; [0405] and/or [0406] g. a nucleotide sequence defined by SEQ ID NO: 17, or a nucleotide sequence which differs from SEQ ID NO: 17 by a single nucleotide. [0407] 44. The transcription regulatory element of aspect 42 or aspect 43, wherein the nucleotide sequence located 5′ to the core nucleotide sequence has less than 50% identity to a nucleotide sequence comprising at least 20, at least 25, at least 30, at least 35, at least 40 or 45 consecutive nucleotides of SEQ ID NO: 4; optionally wherein it has less than 45% identity; optionally wherein it has less than 40% identity; and optionally wherein it has less than 30% identity. [0408] 45. The transcription regulatory element of any one of aspects 42 to 44, wherein the nucleotide sequence located 5′ to the core nucleotide sequence is shorter than 110 nucleotides; optionally is shorter than 100 nucleotides; optionally is shorter than 50 nucleotides; and optionally is shorter than 10 nucleotides. [0409] 46. The transcription regulatory element of any one of aspects 42 to 45, wherein the nucleotide sequence located 5′ to the core nucleotide sequence is between 5 and 110 nucleotides in length. [0410] 47. The transcription regulatory element of any one of aspects 42 to 46, wherein the nucleotide sequence located 5′ to the core nucleotide sequence is at least 7 nucleotides in length. [0411] 48. The transcription regulatory element of any one of aspects 42 to 47, wherein the nucleotide sequence located 5′ to the core nucleotide sequence is 102 nucleotides or less in length. [0412] 49. The transcription regulatory element of any one of aspects 42 to 48, wherein the nucleotide sequence located 5′ to the core nucleotide sequence comprises a nucleotide sequence selected from the group consisting of: [0413] a. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 18, or a nucleotide sequence which differs from SEQ ID NO: 18 by a single nucleotide; [0414] b. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 19, or a nucleotide sequence which differs from SEQ ID NO: 19 by a single nucleotide; [0415] c. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 20, or a nucleotide sequence which differs from SEQ ID NO: 20 by a single nucleotide; [0416] d. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 21, or a nucleotide sequence which differs from SEQ ID NO: 21 by a single nucleotide; [0417] e. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 22, or a nucleotide sequence which differs from SEQ ID NO: 22 by a single nucleotide; and [0418] f. a nucleotide sequence according to SEQ ID NO: 23, or which differs from SEQ ID NO: 23 by a single nucleotide. [0419] 50. The transcription regulatory element of any one of aspects 42 to 49, further comprising a nucleotide sequence which is located 3′ to the core nucleotide sequence. [0420] 51. The transcription regulatory element of aspect 50, wherein the nucleotide sequence which is located 3′ to the core nucleotide sequence comprises a nucleotide sequence according to SEQ ID NO: 6, or a nucleotide sequence which differs from SEQ ID NO: 6 by a single nucleotide. [0421] 52. The transcription regulatory element of aspect 51, wherein the nucleotide sequence located 3′ to the core nucleotide sequence comprises: [0422] a. a nucleotide sequence according to SEQ ID NO: 6, or a nucleotide sequence which differs from SEQ ID NO: 6 by a single nucleotide; or [0423] b. a nucleotide sequence having at least 90% identity to SEQ ID NO: 9, or a nucleotide sequence which differs from SEQ ID NO: 9 by a single nucleotide; or [0424] c. a nucleotide sequence having at least 90% identity to SEQ ID NO: 10, or a nucleotide sequence which differs from SEQ ID NO: 10 by a single nucleotide. [0425] 53. The transcription regulatory element of any one of aspects 50 to 52, wherein the nucleotide sequence located 3′ to the core nucleotide sequence further comprises a nucleotide sequence defined by SEQ ID NO: 11, or a nucleotide sequence which differs from SEQ ID NO: 11 by a single nucleotide. [0426] 54. The transcription regulatory element of any one of aspects 50 to 53, wherein the nucleotide sequence located 3′ to the core nucleotide sequence is shorter than 50 nucleotides; optionally is shorter than 40 nucleotides; and optionally is shorter than 30 nucleotides. [0427] 55. The transcription regulatory element of any one of aspects 50 to 54, wherein the nucleotide sequence located 3′ to the core nucleotide sequence comprises one or more transcription start sites (TSS). [0428] 56. The transcription regulatory element of aspect 55, wherein the one or more TSS comprise a nucleotide sequence according to: [0429] a. SEQ ID NO: 6, or a nucleotide sequence which differs from SEQ ID NO: 6 by a single nucleotide; [0430] b. SEQ ID NO: 7, or a nucleotide sequence which differs from SEQ ID NO: 7 by a single nucleotide; and/or [0431] c. SEQ ID NO: 8, or a nucleotide sequence which differs from SEQ ID NO: 8 by a single nucleotide. [0432] 57. The transcription regulatory element of any one of aspects 50 to 56, wherein the nucleotide sequence located 3′ to the core nucleotide sequence comprises or consists of a nucleotide sequence selected from the group consisting of: [0433] a. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 10, or a nucleotide sequence which differs from SEQ ID NO: 10 by a single nucleotide; [0434] b. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO:12, or a nucleotide sequence which differs from SEQ ID NO: 12 by a single nucleotide; and [0435] c. a nucleotide sequence having at least 90% or at least 95% identity to SEQ ID NO: 13, or a nucleotide sequence which differs from SEQ ID NO: 13 by a single nucleotide. [0436] 58. The transcription regulatory element of any one of aspects 42 to 57, wherein the transcription regulatory element: [0437] a. does not comprise a nucleotide sequence according to SEQ ID NO: 4, or does not comprise at least 20, at least 30 or at least 40 consecutive nucleotides of SEQ ID NO: 4; [0438] and/or [0439] b. does not comprise a nucleotide sequence according to SEQ ID NO: 5, or does not comprise at least 20, at least 30 or at least 40 consecutive nucleotides of SEQ ID NO: 5. [0440] 59. The transcription regulatory element of aspect 58, which: [0441] a. does not comprise a nucleotide sequence having at least 90%, or at least 95% identity to SEQ ID NO: 4; [0442] and/or [0443] b. does not comprise a nucleotide sequence having at least 90%, or at least 95% identity to SEQ ID NO: 5. [0444] 60. The transcription regulatory element of any one of aspects 42 to 59, which is shorter than 200 nucleotides; optionally which is shorter than 150 nucleotides; and optionally which is shorter than 125 nucleotides. [0445] 61. The transcription regulatory element of any one of aspects 42 to 60, which is at least 85 nucleotides in length, optionally which is at least 100 nucleotides in length, and optionally which is at least 110 nucleotides in length. [0446] 62. The transcription regulatory element of any one of the preceding aspects, wherein the transcription regulatory element terminates in a ten-nucleotide sequence selected from: [0447] a. acagtgaatc; or [0448] b. ctcctcagct. [0449] 63. The transcription regulatory element of any one the preceding aspects, wherein the core nucleotide sequence is 73-80 nucleotides in length. [0450] 64. The transcription regulatory element of any one of the preceding aspects, wherein the core nucleotide sequence comprises or consists of a nucleotide sequence having at least 95% identity, and optionally at least 98% identity, to SEQ ID NO: 2. [0451] 65. The transcription regulatory element of any one of the preceding aspects, wherein the core nucleotide sequence is identical to SEQ ID NO: 2. [0452] 66. The transcription regulatory element of any one of aspects 1 to 65 wherein the core nucleotide sequence comprises or consists of a nucleotide sequence which has at least 95% identity, and optionally at least 98% identity, to SEQ ID NO: 3. [0453] 67. The transcription regulatory element of aspect 66, wherein the core nucleotide sequence has at least 95% identity, and optionally at least 98% identity, to SEQ ID NO: 3. [0454] 68. The transcription regulatory element of aspect 67, wherein the core nucleotide sequence is identical to SEQ ID NO: 3. [0455] 69. The transcription regulatory element of any one of aspects 1 to 68, which has a nucleotide sequence that has at least 90% identity, optionally at least 95% identity or optionally at least 98% identity to a nucleotide sequence selected from the group consisting of: [0456] a. SEQ ID NO: 24; [0457] b. SEQ ID NO: 25; [0458] c. SEQ ID NO: 26; [0459] d. SEQ ID NO: 27; [0460] e. SEQ ID NO: 28; and [0461] f. SEQ ID NO: 29. [0462] 70. The transcription regulatory element of any one of aspects 1 to 63, which has a nucleotide sequence selected from the group consisting of: [0463] a. SEQ ID NO: 24; [0464] b. SEQ ID NO: 25; [0465] c. SEQ ID NO: 26; [0466] d. SEQ ID NO: 27; [0467] e. SEQ ID NO: 28; and [0468] f. SEQ ID NO: 29. [0469] 71. The transcription regulatory element of any one of the preceding aspects, wherein the transcription regulatory element comprises a promoter; optionally wherein the transcription regulatory element further comprises an enhancer. [0470] 72. The transcription regulatory element of aspect 71, wherein the promoter is liver-specific. [0471] 73. A polynucleotide comprising a transcription regulatory element of any one of the preceding aspects, wherein the transcription regulatory element is operably linked to a transgene optionally wherein the transgene encodes a human protein. [0472] 74. The transcription regulatory element of any one of aspects 1 to 72, wherein the transcription regulatory element is part of a vector comprising a transgene, optionally wherein the vector is a viral particle such as an AAV vector. [0473] 75. The polynucleotide of aspect 73 or the transcription regulatory element of aspect 74, wherein the transcription regulatory element expresses the transgene at 50% or better compared to a transcription regulatory element defined by SEQ ID NO: 1 or SEQ ID NO: 33. [0474] 76. The polynucleotide of aspect 73 or the transcription regulatory element of aspect 74, wherein the transcription regulatory element expresses the transgene at 80% or better compared to a transcription regulatory element defined by SEQ ID NO: 1 or SEQ ID NO: 33. [0475] 77. The polynucleotide of aspect 73 or the transcription regulatory element of aspect 74, wherein the transcription regulatory element expresses the transgene at 100% or better compared to a transcription regulatory element defined by SEQ ID NO: 1 or SEQ ID NO: 33; optionally wherein the transcription regulatory element expresses the transgene at 110% or better, 120% or better, 140% or better, or 150% or better compared to a transcription regulatory element defined by SEQ ID NO: 1 or SEQ ID NO: 33. [0476] 78. The polynucleotide or the transcription regulatory element of any one of aspects 75 to 77, wherein expression of the transgene is determined in vitro in Huh7 cells. [0477] 79. The polynucleotide or transcription regulatory element of any one of aspects 73 to 78, wherein the transgene encodes a protein or a non-translated RNA which optionally is an siRNA, or an miRNA, or a snRNA or an antisense RNA. [0478] 80. The polynucleotide or transcription regulatory element of any one of aspects 73 to 79, wherein the transgene is longer than 4 k nucleotides; and optionally wherein the transgene is longer than 4.2 k nucleotides. [0479] 81. The polynucleotide or transcription regulatory element of aspect 80, wherein the transgene is shorter than 4.5 k nucleotides, optionally wherein the transgene is shorter than 4.4 k nucleotides. [0480] 82. The polynucleotide or transcription regulatory element of any one of aspects 73 to 81, wherein the transgene encodes FVIII; optionally wherein the transgene encodes a truncated or modified FVIII; optionally wherein the transgene encodes a B-domain deleted FVIII. [0481] 83. A vector comprising a nucleotide sequence which comprises: (i) the transcription regulatory element of any one of aspects 1 to 72; and (ii) a transgene. [0482] 84. The vector of aspect 83, wherein the vector nucleotide sequence further comprises a nucleotide sequence encoding a signal peptide. [0483] 85. The vector of aspect 84, wherein the nucleotide sequence encoding the signal peptide is 50 to 100 nucleotides in length. [0484] 86. The vector of aspect 85, wherein the nucleotide sequence encoding the signal peptide is shorter than 80 nucleotides. [0485] 87. The vector of any one of aspects 83 to 86, which is a viral particle such as an AAV vector. [0486] 88. The vector of any one of aspects 83 to 87, wherein the transcription regulatory element expresses the transgene at 50% or better compared to a transcription regulatory element defined by SEQ ID NO: 1 or SEQ ID NO: 33. [0487] 89. The vector of any one of aspects 83 to 87, wherein the transcription regulatory element expresses the transgene at 80% or better compared to a transcription regulatory element defined by SEQ ID NO: 1 or SEQ ID NO: 33. [0488] 90. The vector of any one of aspects 83 to 87, wherein the transcription regulatory element expresses the transgene at 100% or better compared to a transcription regulatory element defined by SEQ ID NO: 1 or SEQ ID NO: 33; and optionally wherein the transcription regulatory element expresses the transgene at 110% or better, 120% or better, 140% or better, or 150% or better compared to a transcription regulatory element defined by SEQ ID NO: 1 or SEQ ID NO: 33. [0489] 91. The vector of any one of aspects 89 to 90, wherein expression of the transgene is determined in vitro in Huh7 cells. [0490] 92. The vector of any one of aspects 83 to 91, wherein the transgene encodes a protein or a non-translated RNA which optionally is an siRNA, or an miRNA, or a snRNA or an antisense RNA. [0491] 93. The vector of any one of aspects 83 to 92, wherein the transgene is longer than 4 k nucleotides; and optionally wherein the transgene is longer than 4.2 nucleotides. [0492] 94. The vector of aspect 93, wherein the transgene is shorter than 4.5 k nucleotides, optionally wherein the transgene is shorter than 4.4 k nucleotides. [0493] 95. The vector of any one of aspects 83 to 94, wherein the transgene encodes FVIII; optionally wherein the transgene encodes a truncated or modified FVIII; optionally wherein the transgene encodes a B-domain deleted FVIII. [0494] 96. The vector of any one of aspects 83 to 95 wherein the vector genome is shorter than 4.9 k nucleotides, and optionally wherein the vector genome is no shorter than 4.5 k nucleotides. [0495] 97. The vector of aspect 96, wherein the vector genome is around 4.7 k nucleotides in length. [0496] 98. The vector of any one of aspects 83 to 97 for use in a method of treatment, optionally wherein the method of treatment is a method of gene therapy and/or a method of treating Haemophilia A. [0497] 99. A method of treatment comprising administering an effective amount of the vector of any one of aspects 83 to 97 to a patient, optionally wherein the method of treatment is a method of gene therapy and/or a method of treating Haemophilia A. [0498] 100. Use of the vector of any one of aspects 83 to 97 in a method of treatment, optionally wherein the method of treatment is a method of gene therapy and/or a method of treating Haemophilia A.