METHODS OF TREATMENT WITH CD8 T CELL-MEDIATED IMMUNE THERAPY
20220390433 · 2022-12-08
Assignee
Inventors
Cpc classification
A61K31/513
HUMAN NECESSITIES
A61K31/513
HUMAN NECESSITIES
A61K35/17
HUMAN NECESSITIES
A61K31/4709
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61K39/39
HUMAN NECESSITIES
A61K31/7068
HUMAN NECESSITIES
C07K2317/73
CHEMISTRY; METALLURGY
A61K35/17
HUMAN NECESSITIES
A61K31/4709
HUMAN NECESSITIES
A61K31/444
HUMAN NECESSITIES
A61K31/7068
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K31/444
HUMAN NECESSITIES
International classification
Abstract
Methods of treating a subject with cancer with CD8 T cell-mediated immune therapy are provided. The methods include measuring an amount of CXCR3-positive T cells in a peripheral blood sample or a tumor sample from a subject with cancer following treatment of the subject with at least one dose of the CD8 T cell-mediated therapy and comparing the amount of CXCR3-positive T cells in the sample to a control. Responsiveness of the cancer to the CD8 T cell-mediated therapy is predicted based on whether there is an increase or decrease in the amount of CXCR3-positive T cells in the sample. Methods further including treating the subject with at least one additional dose of the CD8 T cell-mediated immune therapy are also provided.
Claims
1. A method of assessing or predicting response of a cancer in a subject to treatment with an inhibitor of TGFβR1 signaling, comprising: measuring an amount of CXCR3-positive T cells in a peripheral blood sample from the subject following treatment of the subject with at least one dose of the inhibitor of TGFβR1 signaling; comparing the amount of CXCR3-positive T cells in the peripheral blood sample to a control; and predicting that the cancer will respond to the inhibitor of TGFβR1 signaling if the amount of CXCR3-positive T cells in the peripheral blood sample is decreased compared to the control or that the cancer will not respond to the inhibitor of TGFβR1 signaling if the amount of CXCR3-positive T cells in the peripheral blood sample is unchanged or increased compared to the control.
2. The method of claim 1, wherein the peripheral blood sample comprises whole blood, plasma, serum, or peripheral blood mononuclear cells.
3. A method of assessing or predicting response of a cancer in a subject to treatment with an inhibitor of TGFβR1 signaling, comprising: measuring an amount of CXCR3-positive T cells in a tumor sample from the subject following treatment of the subject with at least one dose of the inhibitor of TGFβR1 signaling; comparing the amount of CXCR3-positive T cells in the tumor sample to a control; and predicting that the cancer will respond to the inhibitor of TGFβR1 signaling if the amount of CXCR3-positive T cells is increased in the tumor sample compared to the control or that the cancer will not respond to the inhibitor of TGFβR1 signaling if the amount of CXCR3-positive T cells in the tumor sample is unchanged or decreased compared to the control.
4. The method of claim 1, wherein the inhibitor of TGFβR1 signaling is galunisertib (LY2157299) or LY3200882.
5. The method of claim 3, wherein the inhibitor of TGFβR1 signaling is galunisertib (LY2157299) or LY3200882.
6. The method of claim 5, wherein the subject is administered 1-14 daily doses of galunisertib (LY2157299) or LY3200882.
7. (canceled)
8. The method of claim 1, wherein the cancer is a solid tumor.
9. The method of claim 8, wherein the solid tumor is a colorectal tumor, lung tumor, head and neck squamous cell carcinoma, renal cell carcinoma, or melanoma.
10. The method of claim 1, further comprising selecting a subject with a decreased amount of CXCR3-positive T cells in the peripheral blood sample compared to the control.
11. The method of claim 3, further comprising selecting a subject with an increased amount of CXCR3-positive T cells in the tumor sample compared to the control.
12. The method of claim 1, further comprising administering at least one additional dose of the inhibitor of TGFβR1 signaling to the subject if the tumor is predicted to respond to the inhibitor of TGFβR1 signaling.
13. The method of claim 1, further comprising discontinuing treatment with the inhibitor of TGFβR1 signaling if the tumor is predicted not to respond to the inhibitor of TGFβR1 signaling.
14. The method of claim 1, further comprising administering a chemotherapy to the subject following or concurrently with the inhibitor of TGFβR1 signaling.
15. The method of claim 14, wherein the chemotherapy comprises an antimetabolite chemotherapy.
16. The method of claim 15, wherein the antimetabolite chemotherapy comprises one or more of 5-fluorouracil and capecitabine.
17. The method of claim 1, further comprising administering radiation therapy to the subject following or concurrently with the inhibitor of TGFβR1 signaling.
18. The method of claim 1, further comprising surgical resection of the cancer.
19. (canceled)
20. The method of claim 1, wherein measuring the amount of CXCR3-positive T cells comprises flow cytometry.
21. The method of claim 1, wherein the control comprises an amount of CXCR3-positive T cells in a sample from the subject prior to treatment with the inhibitor of TGFβR1 signaling.
22. The method of claim 4, wherein the subject is administered 1-14 daily doses of galunisertib (LY2157299) or LY3200882.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
*=p<0.05, **=p<0.01, ***=p<0.001.
[0022]
[0023]
[0024]
SEQUENCE LISTING
[0025] Any nucleic acid and amino acid sequences listed herein or in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases and amino acids, as defined in 37 C.F.R. § 1.822. In at least some cases, only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand.
[0026] SEQ ID NOs: 1 and 2 are human CXCR3 forward and reverse primers, respectively.
[0027] SEQ ID NOs: 3 and 4 are mouse CXCR3 forward and reverse primers, respectively.
[0028] SEQ ID NO: 5 is an ovalbumin peptide (SIINFEKL).
DETAILED DESCRIPTION
[0029] Local radiation treatment can lead to activation of tumor-specific immunity, and provides an opportunity to combine with immunotherapy to expand and propagate anti-tumor immunity (Kaur et al., Front. Oncol. 2:191, 2012; Formenti et al., Nat. Med. 24:1845-1851, 2018). However, radiation simultaneously induces immunosuppressive pathways, most notably, transforming growth factor beta (TGFβ1). TGFβ1 is upregulated following radiation, and contributes to tumor progression via promotion of epithelial to mesenchymal transition (EMT; David et al., Cell 164:1015-1030, 2016), stimulation of neoangiogenesis (Sounni et al., Dis. Model. Mech. 3:317-332, 2010), enhanced tumor cell motility and metastasis (Friedl et al., Cell 147:992-1009, 2011), cancer associated fibroblast (CAF) proliferation (Calon et al., Cancer Cell 22:571-584, 2012), and suppression of T cell effector function (Thomas et al., Cancer Cell 8:369-380, 2005). Furthermore, high TGF13 gene signatures indicate a unique resistance to checkpoint blockade therapy in colorectal and breast cancer patients (Mariathasan et al., Nature 554:544-548, 2018) As has been previously shown, blockade of TGF13 receptor (TGFβR) signaling or neutralization of TGF13 can relieve resistance to cytotoxic therapies as well as synergize with ICB (Garrison et al., Cancer Immunol. Immunother. 61:511-521, 2012; Tauriello et al., Nature 554:538-543, 2018; Ravi et al., Nat. Commun. 9:741, 2018; Holmgaard et al., J. Immunother. Cancer 6:47, 2018; Young et al., Cancer Immunol. Res. 2:1011-1022, 2014). Although these studies have demonstrated the association of TGF13 blocking therapies with enhanced T cell infiltration and immunity, the precise mechanism for why these therapies are effective remains unknown.
[0030] The inventors have shown how TGFβ suppresses anti-tumor immunity through the use of clinical ALK5 small molecule inhibitors and cell-type conditional ALK5-deficient mice. Blockade of ALK5 phosphorylation prior to chemoradiation treatment significantly reduced tumor growth and extended survival. This was associated with and dependent upon increased CD8.sup.+ T cell tumor infiltration. The predominant therapeutic effect of ALK5 inhibition was directly on CD8.sup.+ T cells; CD8α-specific deletion of ALK5 enhanced CXCR3 expression on CD8.sup.+ T cells, resulting in increased CXCR3-dependent migration into tumors. The inventors show that CXCR3 was directly suppressed by TGFβ. Once in the tumor microenvironment, ALK5-deficient T cells exhibited a decreased threshold for T cell receptor (TCR) activation and cytotoxicity. These data demonstrate a novel mechanism by which TGFβ contributes to immunosuppression through downregulation of CD8.sup.+ T cell expression of CXCR3, limiting trafficking to the tumor. Data provided herein, that combines ALK5 inhibition with chemoradiation in locally advanced rectal cancer, confirms the preclinical observations; increased CXCR3.sup.+CD8.sup.+ T cells infiltrated tumors after ALK5 inhibition, and changes in peripheral blood CXCR3.sup.+ expression correlated with treatment response. These findings demonstrate a new mechanism by which TGFβ contributes to immune suppression, a mechanism that can be targeted in clinical trials, and translates these findings with clinical relevance.
I. Terms
[0031] Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology may be found in Lewin's Genes X, ed. Krebs et al., Jones and Bartlett Publishers, 2009 (ISBN 0763766321); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Publishers, 1994 (ISBN 0632021829); Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by Wiley, John & Sons, Inc., 1995 (ISBN 0471186341); and George P. Rédei, Encyclopedic Dictionary of Genetics, Genomics, Proteomics and Informatics, 3.sup.rd Edition, Springer, 2008 (ISBN: 1402067534), and other similar references.
[0032] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The singular terms “a,” “an,” and “the” include plural referents unless the context clearly indicates otherwise. Similarly, the word “or” is intended to include “and” unless the context clearly indicates otherwise. Hence “comprising A or B” means including A, or B, or A and B. It is further to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description.
[0033] Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety, as are the GenBank Accession numbers (for the sequence present on Sep. 12, 2019). In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
[0034] In order to facilitate review of the various embodiments of the disclosure, the following explanations of specific terms are provided:
[0035] Cancer: A malignant neoplasm that has undergone anaplasia with loss of differentiation, increased rate of growth, invasion of surrounding tissue, and/or is capable of metastasis. As used herein, cancer includes both solid tumors and hematological malignancies. Residual cancer is cancer that remains in a subject after any form of treatment is given to the subject to reduce or eradicate cancer. Metastatic cancer is a cancer at one or more sites in the body other than the original site of the cancer from which the metastatic cancer is derived. Local recurrence is a reoccurrence of the cancer at or near the same site as the original cancer, for example, in the same tissue as the original cancer.
[0036] Control: A sample or standard used for comparison with an experimental sample, such as a sample from a healthy subject, for example, a subject who does not have cancer. In some embodiments, the control is a historical control or standard reference value or range of values (e.g., a previously tested control sample, such as a group of healthy subjects, or group of samples that represent baseline or normal values,). In further examples, a control may be one or more samples from a subject prior to a treatment (such as administration of one or more doses of an inhibitor of
[0037] TGFβR1 signaling or ICB). Laboratory standards and values can be set based on a known or determined population value and can be supplied in the format of a graph or table that permits comparison of measured, experimentally determined values. C-X-C motif chemokine receptor 3 (CXCR3): A G protein-coupled chemokine receptor that binds the chemokines CXCL4, CXCL9, CXCL10, and CXCL11. Effects of chemokine binding to CXCR3 include integrin activation, cytoskeletal changes, and chemotaxis. CXCR3 nucleic acid and amino acid sequences are publicly available. Nucleic acid sequences include GenBank Accession Nos. XM_017029436, XM_005262257, XM_005262256, XM_017029435, NM_001504, and NM_001142797 (human) and NM_009910 (mouse), all of which are incorporated here by reference as present in GenBank on Sep. 12, 2019 Amino acid sequences include GenBank Accession Nos. XP_016884925, XP_005262314, XP_005262313, XP_016884924, NP_001495, and NP_001136269 (human) and NP_034040 (mouse), all of which are incorporated here by reference as present in GenBank on Sep. 12, 2019. Additional CXCR3 sequences can be identified by one of ordinary skill in the art, for example, based on sequence similarity.
[0038] LY2157299 (LY): Also known as galunisertib. A small molecule inhibitor of transforming growth factor β receptor type 1 (TGFβR1), having the structure:
##STR00001##
[0039] T cell: A white blood cell involved in the immune response. T cells include, but are not limited to, CD4.sup.+ T cells and CD8.sup.+ T cells. A CD4.sup.+ T lymphocyte is an immune cell that carries a marker on its surface known as “cluster of differentiation 4” (CD4). These cells, also known as helper T cells, are involved in antibody responses as well as killer T cell responses. In one embodiment, a CD4.sup.+ T cell is a CD4.sup.+ regulatory T cell. CD8.sup.+ T cells carry the “cluster of differentiation 8” (CD8) marker. In one embodiment, a CD8.sup.+ T cell is a cytotoxic T lymphocyte (CTL). In another embodiment, a CD8.sup.+ T cell is a suppressor T cell.
[0040] TGFβR1: TGF-β receptors are serine/threonine protein kinases. The type I and type II TGF-β receptors form a heterodimeric complex when bound to TGF-β, transducing the TGF-β signal from the cell surface to the cytoplasm. TGFBR1 is also known as AATS; ALK5; SKR4; ALK-5; LDS1A; LDS2A; TGFR-1; ACVRLK4; and transforming growth factor beta, receptor 1. Human TGFβR1 nucleic acid sequences include GenBank Accession Nos. XM_011518949, XM_017015063, NM_001306210, NM_004612, NM_001130916, XM_011518950, XM_024447658, and XM_011518948, all of which are incorporated here by reference as present in GenBank on Sep. 12, 2019. Human TGFβR1 amino acid sequences include GenBank Accession Nos. XP_011517251, XP_016870552, NP_001293139, NP_004603, NP_001124388, XP_011517252, XP_011517252, XP_024303426, and XP_011517250, all of which are incorporated here by reference as present in GenBank on Sep. 12, 2019. Additional TGFβR1 sequences can be identified by one of ordinary skill in the art, for example, based on sequence similarity.
[0041] Subject: A living multi-cellular vertebrate organism, a category that includes both human and veterinary subjects, including human and non-human mammals.
[0042] Tumor: All neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues. In particular, non-limiting examples, a tumor is a colorectal tumor, rectal tumor, lung tumor, head and neck squamous cell carcinoma, or melanoma.
II. Methods of Treatment with CD8 T Cell-Mediated Immune Therapy
[0043] Disclosed herein are methods of treating a subject with cancer with CD8 T cell-mediated immune therapy. In particular embodiments, the methods include assessing and/or predicting response of a cancer in a subject to treatment with a CD8 T cell-mediated immune therapy (for example, an inhibitor of TGFβR1 signaling or an immune checkpoint inhibitor). The methods permit improved treatment decisions for patients, including continuing a treatment that is effective in treating and/or predicted to be effective in treating the cancer. In addition, if the treatment is not effective and/or is not predicted to be effective in treating the cancer, the treatment can be discontinued and one or more different treatments can be administered.
[0044] In some embodiments, the methods include measuring an amount of CXCR3-positive T cells in a peripheral blood sample (e.g. whole blood, plasma, or serum) from a subject following treatment of the subject with at least one dose of a CD8 T cell-mediated immune therapy, comparing the amount of CXCR3-positive T cells in the peripheral blood sample to a control, and predicting that the cancer will respond to the CD8 T cell-mediated immune therapy if the amount of CXCR3-positive T cells in the peripheral blood sample is decreased compared to the control or that the cancer will not respond to the CD8 T cell-mediated immune therapy if the amount of CXCR3-positive T cells in the peripheral blood sample is unchanged or increased compared to the control. In some embodiments, one or more samples is collected from a subject who has been administered one or more doses (e.g., 1-14 doses, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 doses) of an CD8 T cell-mediated immune therapy. In some examples, the methods include administering at least one additional dose of the CD8 T cell-mediated immune therapy to a subject having a cancer predicted to respond to the therapy. In other examples, the methods include administering a treatment other than the CD8 T cell-mediated immune therapy to a subject having a cancer predicted not to respond to the CD8 T cell-mediated immune therapy. In some examples, the CXCR3-positive T cells are CD3.sup.+CD4.sup.− T cells. In other examples, the CXCR3-positive T cells are CD3.sup.+CD8.sup.+ T cells.
[0045] In other embodiments, the methods include measuring an amount of CXCR3-positive T cells in a tumor sample from the subject following treatment of a subject with at least one dose of a CD8 T cell-mediated immune therapy, comparing the amount of CXCR3-positive T cells in the tumor sample to a control, and predicting that the cancer will respond to the CD8 T cell-mediated immune therapy if the amount of CXCR3-positive T cells is increased in the tumor sample compared to the control or that the cancer will not respond to the CD8 T cell-mediated immune therapy if the amount of CXCR3-positive T cells in the tumor sample is unchanged or increased compared to the control. In some embodiments, one or more samples is collected from a subject who has been administered one or more doses (e.g., 1-14 doses, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 doses) of an CD8 T cell-mediated immune therapy. In some examples, the methods include administering at least one additional dose of the CD8 T cell-mediated immune therapy to a subject having a cancer predicted to respond to the therapy. In other examples, the methods include administering a treatment other than the CD8 T cell-mediated immune therapy to a subject having a cancer predicted not to respond to the CD8 T cell-mediated immune therapy. In some examples, the CXCR3-positive T cells are CD3.sup.+CD4.sup.− T cells. In other examples, the CXCR3-positive T cells are CD3.sup.+CD8.sup.+ T cells.
[0046] In some examples, the CD8 T cell-mediated immune therapy administered to the subject (e.g., before and/or after measuring the amount of CXCR3-positive T cells in the sample) is a composition that inhibits TGFβR1 activity directly, such as LY2157299 (galunisertib), LY3200882, or derivatives or prodrugs thereof. Additional small molecule TGFRβR1 inhibitors include, but are not limited to GW788388, LY2109761, SB431542, SB525334, AZ12601011, and AZ12799734, or derivatives or prodrugs thereof. In other non-limiting examples, the CD8 T cell-mediated immune therapy is an immune checkpoint inhibitor, such as an anti-CTLA-4 antibody (e.g., ipilimumab), an anti-PD-L1 antibody (e.g., atezolizumab, avelumab, durvalumab, or spartalizumab), or an anti-PD-1 antibody (e.g., nivolumab, pembrolizumab, or cemiplimab). In further examples, the CD8 T cell-mediated immune therapy is a neutralizing TGFβ antibody (e.g., fresolimumab), a TGFβ trap (e.g., extracellular domain of TGFβR2) fused to a PD-L1 antibody (e.g., M7824, EMD Serono), or CAR-T cells expressing a dominant-negative TGFβRII. In still further examples, the CD8 T cell-mediated immune therapy is a TGFβ2 antisense nucleic acid (e.g., Trabedersen) or a vaccine that inhibits endogenous TGFβ, directly or indirectly (e.g., belagenpumatucel-L or gemogenovatucel-L).
[0047] In some examples the method includes selecting a subject that will benefit from the disclosed therapies, such as selecting a subject having decreased CXCR3-positive T cells in peripheral blood following treatment of a subject with at least one dose of a CD8 T cell-mediated immune therapy. For example, if the subject is determined to have decreased CXCR3-positive T cells in peripheral blood, the subject can be selected to be treated with at least one additional dose of the CD8 T cell-mediated immune therapy. Alternatively, if the subject is determined to have increased CXCR3-positive T cells in a tumor sample, the subject can be selected to be treated with a therapy other than CD8 T cell-mediated immune therapy.
[0048] In some examples, the methods include treating the subject by administering at least one additional dose of the CD8 T cell-mediated immune therapy (e.g., 1-14 additional doses) to the subject if the tumor is predicted to respond to the therapy. Dosages of the CD8 T cell-mediated immune therapy administered to the subject (e.g., before and/or after measuring amount of CXCR3-positive T cells in the sample) can be determined by a skilled clinician, depending on the compound, type of the tumor, the condition of the subject, and other factors. In some non-limiting examples, the subject is administered 300 mg of LY2157299 daily (e.g., in a divided dose). In other non-limiting examples, the subject is administered 240 mg of an anti-PD-1 antibody (such as nivolumab) every other week or 480 mg of an anti-PD-1 antibody once a month. In other examples, the subject is also administered chemotherapy and/or radiation treatment, which may be prior to, concurrent with, or after administering the at least one additional dose of the CD8 T cell-mediated immune therapy.
[0049] If treatment with the CD8 T cell-mediated immune therapy is discontinued, in some examples, the subject is administered an alternative treatment, including but not limited to, one or more of chemotherapy, radiation treatment, and surgery. In some examples, the chemotherapy is folinic acid, fluorouracil, and oxaliplatin (FOLFOX) chemotherapy, cetuximab, platinum-based chemotherapy (such as cisplatin, oxaloplatin, or carboplatin), 5-fluorouracil, gemcitabine, capecitabine, paclitaxel, docetaxel, irinotecan, or combinations of two or more thereof. A skilled clinician can select appropriate alternative treatment(s) based on the cancer being treated, the condition of the subject, and other clinical factors.
[0050] In some embodiments, the sample is peripheral blood from a subject with cancer, such as a subject with cancer who has been administered one or more doses of a CD8 T cell-mediated immune therapy. In some examples, the sample is whole blood, plasma, serum, or peripheral blood mononuclear cells. The sample may be utilized with minimal pre-treatment, or may undergo one or more pre-treatment steps, including one or more purification steps.
[0051] In other embodiments, the sample is a tumor sample from a subject with cancer, such as a subject with cancer who has been administered one or more doses of a CD8 T cell-mediated immune therapy. The tumor sample may be collected by any method, including biopsy or surgery. The sample may be utilized with minimal pre-treatment, or may undergo one or more pre-treatment steps, including one or more purification steps.
[0052] In some embodiments, measuring an amount of CXCR3-positive T cells in the sample is by positive and/or negative selection methods utilizing antibodies for CXCR3 and one or more T cell specific surface markers. Such methods include flow cytometry methods (such as fluorescence activated cell sorting, FACS) and immunomagnetic separation. In some examples, the methods include flow cytometry that includes detection of one or more T cells markers (such as CD3, CD4, and/or CD8) and detection of CXCR3. In one non-limiting example, CD45.sup.+CD3.sup.+CD4.sup.−CD8.sup.+CXCR3.sup.+ T cells are evaluated by flow cytometry at baseline, and then after one cycle of the CD8 T cell-mediated immune therapy. In some examples, the amount of CXCR3-positive T cells is measured in a sample collected at least 3 days after administration of a CD8 T cell-mediated immune therapy, such as at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 days after administration of the CD8 T cell-mediated immune therapy. In other examples, the amount of CXCR3-positive T cells is measured in a sample collected 3-28 days after administration of a CD8 T cell-mediated immune therapy, such as 3-7, 5-10, 7-14, 10-21, 15-24, or 21-28 days after administration of the CD8 T cell-mediated immune therapy.
[0053] The control can be any suitable control against which to compare an amount of CXCR3 expressing (e.g., CXCR3-positive) T cells in a sample from a subject (such as a peripheral blood sample and/or a tumor sample). In some embodiments, the control is a sample, or a plurality of samples, from the same subject prior to treatment with at least one dose of a CD8 T cell-mediated immune therapy (e.g., LY2157299). In other embodiments, the control sample is a sample, or plurality of samples, from a subject(s) known to respond, or known not to respond, to a CD8 T cell-mediated immune therapy (such as LY2157299). In further embodiments, the control is a reference value. For example, the reference value can be derived from the average CXCR3-positive T cells in peripheral blood or tumor samples obtained from a group of subjects known to respond, or known not to respond, to a CD8 T cell-mediated immune therapy (such as LY2157299).
[0054] A change in an amount of CXCR3 expressing T cells in a sample includes an increase or decrease compared to a control. An increase an amount of CXCR3 expressing T cells includes any detectable increase in an amount of CXCR3 expressing T cells, for example, compared to a control. In certain examples, an amount of CXCR3 expressing T cells increases by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 2-fold, at least 3-fold or at least 4-fold, as compared to a control. A decrease an amount of CXCR3 expressing T cells includes any detectable decrease in an amount of CXCR3 expressing T cells, for example, compared to a control. In certain examples, an amount of CXCR3 expressing T cells decreases by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 2-fold, at least 3-fold or at least 4-fold, as compared to a control).
[0055] In the methods described herein the subject may be administered at least one dose of a chemotherapeutic agent (a “chemotherapy”) sequentially with (e.g., following) or concurrently with the CD8 T cell-mediated immune therapy (such as a TGFβR1 inhibitor or immune checkpoint inhibitor). Chemotherapeutic agents are selected based on the type of tumor being treated, and include alkylating agents, such as nitrogen mustards (such as mechlorethamine, cyclophosphamide, melphalan, uracil mustard or chlorambucil), alkyl sulfonates (such as busulfan), nitrosoureas (such as carmustine, lomustine, semustine, streptozocin, or dacarbazine); antimetabolites such as folic acid analogs (such as methotrexate), pyrimidine analogs (such as 5-fluorouracil, floxuridine, cytarabine, gemcitabine, capecitabine, azcitidine, and decitabine), and purine analogs (such as mercaptopurine, thioguanine, cladribine, clofarabine, fludarabine, or nelarabine); or natural products, for example vinca alkaloids (such as vinblastine, vincristine, or vindesine), epipodophyllotoxins (such as etoposide or teniposide), antibiotics (such as dactinomycin, daunorubicin, doxorubicin, bleomycin, plicamycin, or mitocycin C), and enzymes (such as L-asparaginase). Additional agents include platinum coordination complexes (such as carboplatin and cis-diamine-dichloroplatinum II, also known as cisplatin), substituted ureas (such as hydroxyurea), methyl hydrazine derivatives (such as procarbazine), and adrenocrotical suppressants (such as mitotane and aminoglutethimide); hormones and antagonists, such as adrenocorticosteroids (such as prednisone), progestins (such as hydroxyprogesterone caproate, medroxyprogesterone acetate, and magestrol acetate), estrogens (such as diethylstilbestrol and ethinyl estradiol), antiestrogens (such as tamoxifen), and androgens (such as testosterone proprionate and fluoxymesterone). Examples of the most commonly used chemotherapy drugs include adriamycin, melphalan (Alkeran®) Ara-C (cytarabine), carmustine, busulfan, lomustine, carboplatinum, cisplatinum, cyclophosphamide (Cytoxan®), daunorubicin, dacarbazine, 5-fluorouracil, fludarabine, hydroxyurea, idarubicin, ifosfamide, methotrexate, mithramycin, mitomycin, mitoxantrone, nitrogen mustard, paclitaxel (or other taxanes, such as docetaxel), vinblastine, vincristine, VP-16, gemcitabine (Gemzar®), irinotecan (CPT-11), leustatin, vinorelbine, imatinib (STI-571), Topotecan (Hycamtin®), capecitabine, and calcitriol.
[0056] In the methods disclosed herein the subject may be administered at least one dose of radiation therapy sequentially with (e.g., following) or concurrently with the CD8 T cell-mediated immune therapy (such as a TGFβR1 inhibitor or immune checkpoint inhibitor). In particular examples, the radiation therapy includes external beam therapy (for example, delivery of a beam of high-energy x-rays to the location of the tumor). In other examples, the radiation therapy includes intensity-modulated radiation therapy (IMRT), which is able to focus more precisely so that fewer healthy cells are destroyed than is the case with external beam therapy. IMRT reduces incidental damage to the structures near the tumor that may not be involved. Methods and dosages of radiation therapy can be determined by a skilled clinician, depending on the type and location of the tumor, the condition of the subject, and other factors. In one non-limiting example, the subject is administered about 50-55 Gy of radiation in 1.8 Gy daily doses, for a total of 28-30 fractions. In other examples, the subject is administered five daily doses of 8 Gy or three doses of 8 Gy every other day.
[0057] In some examples, the subject has cancer, such as a solid tumor or a metastasis of a solid tumor. Examples of solid tumors, such as sarcomas and carcinomas, include fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, and other sarcomas, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, lymphoid malignancy, pancreatic cancer, breast cancer (including basal breast carcinoma, ductal carcinoma and lobular breast carcinoma), lung cancers, ovarian cancer, prostate cancer, hepatocellular carcinoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, medullary thyroid carcinoma, papillary thyroid carcinoma, pheochromocytoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, Wilms' tumor, cervical cancer, testicular tumor, seminoma, bladder carcinoma, and CNS tumors (such as a glioma, astrocytoma, medulloblastoma, craniopharyrgioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, and retinoblastoma). In non-limiting examples, solid tumors that can be treated or inhibited by the methods disclosed herein include colorectal cancer, rectal cancer, lung cancer, head and neck squamous cell carcinoma, renal cell carcinoma, and melanoma. In other examples, the subject has a lymphoma, for example, T-cell large granular lymphocyte leukemia, polycythemia vera, lymphoma, diffuse large B-cell lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma (indolent and high grade forms), mantle cell lymphoma, or follicular cell lymphoma.
EXAMPLES
[0058] The following examples are provided to illustrate certain particular features and/or embodiments. These examples should not be construed to limit the disclosure to the particular features or embodiments described.
Example 1
Materials and Methods
[0059] Animal Studies and Cell Culture:
[0060] C57BL/6, BALB/c, CD8Cre, Lyz2Cre, and Foxp3-eGFP-CreERT2 mice were purchased from the Jackson Laboratories (Bar Harbor, Me.). ALK5flox/flox mice were a generous gift from Andrew Weinberg (Providence Cancer Center). All transgenic mice were on C57BL/6 background. CT26, MC38, 4T1 and MCA205-OVA tumor cells were grown in DMEM medium supplemented with 10% heat-inactivated fetal bovine serum and 1% penicillin-streptomycin to 60-90% confluence prior to tumor implantation. All cells were washed 2× with 1×PBS and implanted subcutaneously in a 100 μl volume of 1×PBS in the lower flanks. 1×10.sup.5 MC38 cells, 2×10.sup.5 CT26 cells, 5×10.sup.4 4 T1 cells, and 5×10.sup.6 MCA205-OVA cells were used for tumor induction. Tumors were measured 3×/week until they reached the survival end-point of 144 mm.sup.2. Mice were dosed with LY2157299 and LY3200882 via twice daily oral gavage at 105-150 mg/kg with doses spaced 12 hours apart for the indicated durations. 5-fluoruracil (5-FU) chemotherapy was administered at 25 mg/kg i.p. three times per week for one week. Radiation was delivered with a small animal radiation research platform (Xstrahl, Atlanta, Ga.) with cone beam-CT image guidance as previously described (Gunderson et al., PLoS One 14:e0211117, 2019). Anti-CD4 (GK1.5), anti-CD8α (2.43) and anti-CD8b (53-5.8) depleting antibodies were purchased from BioXcell and injected i.p. at 200 μg/mouse at the indicated time-points in the figures. Spleen, lymph nodes and tumors were harvested from animals and single cell suspensions were prepared using mechanical disaggregation for spleen and lymph nodes only or mincing and enzymatic digestion for 30 min. at 37° C. for tumors and lymph nodes for dendritic cell evaluation. Enzyme digest buffer included 1 mg/ml Collagenase A (Roche), 1 mg/ml Hyaluronidase (Sigma) and 50 U/ml DNase (Roche) in DMEM serum free base medium. Following single cell preparation, cells were washed and resuspended in FACS buffer (1×PBS, 1% BSA, 2 mM EDTA) and counted prior to FACS staining using a Guava EasyCyte cytometer (Millipore). Primary T cells were cultured in complete RPMI media (10% heat-inactivated FBS, 1% Na-P, 1% NEAA, 10 mM HEPES, 55 μM β-mercaptoethanol, and 1% Pen/Strep).
[0061] Clinical trial analysis: Patients enrolled in clinical trial NCT02688712 provided consent prior to tissue collection as designed and approved in PHS IRB #15-050. Whole blood from patients was collected at the indicated time-points in heparin coated tubes and stained for flow cytometry analysis by the Immune Monitoring Lab (Earle A. Chiles Research Institute, Providence Cancer Center) as previously described (Koguchi et al., J. Vis. Exp. 8:e53485, 2016). Pathological assessment for neoadjuvant treatment response was evaluated in the surgical resection specimen including excised lymph nodes. Neoadjuvant rectal (NAR) score was calculated by the published, validated formula (George et al, Curr. Colorectal Cancer Rep. 11: 275-280): [5*ypN−3(cT−ypT)+12].sup.2/9.61.
[0062] Immunofluorescence:
[0063] Human rectal cancer biopsies were fixed in 10% NBF overnight and mouse tumors were fixed in zinc fixative overnight prior to tissue processing and paraffin embedding followed by sectioning cut at 5 microns for immunofluorescent staining. All primary antibodies were sequentially stained for 1 hour at RT diluted in a blocking/diluent buffer (Perkin Elmer) at the following concentrations: anti-CXCR3 (1:2000, MAB160), anti-human CD8 (1:400, SP16), anti-mouse CD8 (1:200, 4SM15), and anti-phosphoSMAD2 (1:10,000, EPR2856) followed by MACH-2 anti-Rabbit or Mouse HRP-conjugated polymer (Biocare Medical) or for 10 min at RT or anti-Rat/HRP polymer (Vector labs) for 30 min. at RT. Fluorescent signal was produced by staining with TSA-conjugated Opal dyes (Perkin Elmer) for 10 min at RT using OPAL-520, OPAL-540, and OPAL-620. Sections were then counterstained in DAPI and mounted. Images were acquired on a Vectra 3.0 automated pathology imaging system (Perkin Elmer).
[0064] Flow Cytometry:
[0065] For ex vivo cytokine analysis, cells were first treated with a 1× cell activation cocktail of PMA/ionomycin/Brefeldin A (Biolegend) for 5 hours in complete RPMI media. One million cells from single cell suspensions were stained with anti-CD16/CD32 Fc block (1:200, BD Biosciences) and fixable viability 700 dye (1:10,000, BD Biosciences) in 1×PBS for 15 min. at 37° C. prior to surface and intracellular staining with primary antibodies. Surface staining commenced in 200 μl FACS buffer supplemented with a 1:4 dilution of Brilliant Violet stain buffer (BD Biosciences) and fluorescently conjugated antibodies (Table 1) for 30 min at 4° C. in the dark; all are mouse reactive antibodies unless otherwise indicated. Following surface staining cells were washed and fixed in either 2% PFA or Fix/Perm buffer (eBioscience) for 20 min at 4° C. for intracellular stain. Fix/perm buffer was washed with 1× perm wash buffer (eBioscience) and intracellular proteins were stained with fluorescently conjugated ICS antibodies in perm wash buffer for 30 min. at 4° C. in the dark. Cells were washed and resuspended in 1×PBS prior to acquisition on a BD Fortessa or LSRII flow cytometer (BD Biosciences).
TABLE-US-00001 TABLE 1 Antibodies for Flow Cytometry Fluorescent Antigen conjugate Dilution Vendor CD4 BV605 1:400 BD Biosciences CD8a APC-Cy7 1:400 BD Biosciences CD3e PerCP-EF710 1:200 eBioscience CD45 BV510 1:400 BD Biosciences CD11b PE-Cy7, BV605 1:5000, 1:1000 BD Biosciences MHCII (IA-IE) EF450 1:1000 eBioscience CD11c APC-Cy7, PE- 1:400 BD Biosciences Cy7 IFNγ APC 1:400 BD Biosciences Ki67 APC 1:400 eBioscience GnzB FITC 1:200 BD Bioscience P15E tetramer PE 1:2000 NIH tetramer core TNFα PE-Cy7 1:400 BD Bioscience CD103 PE, APC 1:400 BD Biosciences F4/80 APC 1:400 BD Biosciences CD44 BV711 1:800 BD Biosciences CD62L PE-Cy7 1:800 eBioscience Ly6C PerCP-Cy5.5 1:400 eBioscience Ly6G FITC 1:500 BD Biosciences PD1 BV786 1:200 BD Biosciences Tbet BV650 1:200 BD Biosciences EOMES PE 1:200 eBioscience CD80 PE-CF594 1:400 eBioscience CD40 FITC 1:200 BD Biosciences Foxp3 EF450 1:200 eBioscience GATA3 EF660 1:200 eBioscience CXCR3 BV421 1:200 BD Biosciences CXCR6 BV711 1:200 Biolegend KLRG1 PE-DAZZLE 594 1:200 Biolegend CD4 (human) PerCP-Cy5.5 1:50 BD Biosciences CD3 (human) AF700 1:75 BD Biosciences CXCR3 (human) PE-CF594 1:150 BD Biosciences CD45 (human) FITC 1:100 BD Biosciences
[0066] Chromatin Immunoprecipitation:
[0067] Mouse primary CD8.sup.+ T cells were isolated and purified from spleens by magnetic negative selection using a mouse CD8α.sup.+ T cell isolation kit (Miltneyi Biotec). Cells were then plated in complete media on αCD3/αCD28 (1 μg/ml) coated 6 well plates at 2×10.sup.6 cells/well to initiate rapid expansion. Seventy-two hours later, cells were harvested and plated in T-75 flasks in fresh RPMI complete supplemented with 60 units/ml hIL-2. Media was exchanged with new IL-2 media every 48 hours thereafter until cultures reached >180×10.sup.6 cells. Cells were harvested and exchanged with serum starvation media (RPMI complete+0.2% FBS) overnight and then stimulated with or without 2 ng/ml mouse recombinant TGFβ1 (R&D systems) for 1.5 hours. Jurkat cells were cultured and serum starved with 0.2% FBS RPMI media for overnight and stimulated with or without 10 ng/ml human recombinant TGFβ1 (PeproTech) for 1.5 hours. Four million Jurkat cells were used for each immunoprecipitation and 1.5×10.sup.7 mouse CD8.sup.+ T cells were used for one immunoprecipitation. ChIP was performed following SimpleChIP Enzymatic Chromatin IP Kit (Cell Signaling Technology) per manufacturer's instructions. Briefly, chromatin from fixed cells was sonicated by Vibra-cell VC130 (Sonics&Materials) for 2 cycles of 6 sec ON and 30 sec OFF at 6-9 output watt. Chromatin was incubated with anti-rabbit IgG (1:500), anti-Smad2 (1:50), or anti-Smad3 (1:50) (Cell Signaling Technology) at 4° C. overnight with rotation Immunoprecipitated samples were eluted and the DNA cross-links were reversed at 65° C. for 5 hours or overnight. Sheared chromosomal DNA was subjected to quantitative RT-PCR using FastStart Universal SYBR Green Master (Roche) and StepOnePlus Real-Time PCR system (Thermo Scientific). Primer sequences (5′ to 3′) used were as follows: human CXCR3 FOR: AAGCTGGGCCTGATTCTGTC (SEQ ID NO): 1), REV: AAGTCTGTGGTGGGCTTCTG SEQ ID NO: 2). mouse CXCR3 FOR: GGCTCCTCCTGACAACAGAC (SEQ ID NO: 3), REV: TGCCCAGGCTGACTTCATAC (SEQ ID NO: 4).
[0068] T Cell Adoptive Transfer Experiments:
[0069] CD8.sup.+ T cells were purified from spleens of naïve CD45.1 C57BL/6 and CD45.2 ALK5.sup.ΔCD8 mice, mixed in equal ratios, and labeled with 1 μM CFSE (Molecular Probes) prior to adoptive transfer into C57BL/6 mice bearing MC38 tumors 14 days post-implant. Seven days following transfer, tumors, spleens, and draining lymph nodes were harvested for FACS analysis.
[0070] Cytotoxicity assay: C57BL/6 and ALK5.sup.ΔCD8 mice were vaccinated with a replication deficient Listeria monocytogenes vaccine vector engineered to express ovalbumin (ΔActA-OVA). Mice were primed with 10.sup.7 bacteria intravenously followed by a boost 3 weeks later. Seven days following the vaccine boost CD8.sup.+ T cells were purified from spleens via magnetic negative selection and labeled with 10 μM CFSE prior to co-culture with various ratios of unlabeled MCA205-OVA or Panc02 tumor cells. Realtime co-cultures were monitored with the IncuCyte S3 Live-Cell Analysis system (Sartorius) in the presence of Cytotox Red reagent (Essen Biosciences) for the detection of dead cells. The percent specific tumor cell cytotoxicity was calculated as follows [(total dead cells−dead CFSE+ T cells)/total # of tumor cells plated]×100.
[0071] In Vitro T Cell Activation:
[0072] CD8.sup.+ T cells were purified from spleens of naïve C57BL/6 and ALK5.sup.ΔCD8 mice via magnetic negative selection and labeled with 1 μM CFSE prior to culture. Cells were cultured at 1×10.sup.5 cells/well on αCD3/αCD28 (1 μg/ml, 10 μg/ml) coated 96 well plate in RPMI complete medium. Following 72 hours of culture, cells were harvested for FACS analysis of CFSE dye dilution and analyzed using the proliferation plug-in on FlowJo software (BD Biosciences). Supernatants were also collected from these cultures for cytokine analysis by cytokine bead array using the mouse inflammation kit (BD Biosciences) per manufacturer's instructions. In some assays, certain groups received recombinant mouse TGFβ1 (R&D systems) at 1 ng/ml at the initiation of the experiment.
[0073] T cell migration assay: CD8.sup.+ T cells were purified from spleens of naïve CD45.1 C57BL/6 and CD45.2 ALK5.sup.ΔCD8 mice and mixed in equal ratios of 1×10.sup.5 cells/genotype prior to plating in the top well of a 96 well transwell plate with a 3 micron pore size. Complete RPMI media with or without increasing concentrations of CXCL10 or CXCL16 was placed in the bottom chamber of the transwell plate. Cells were collected from the bottom portion of the well following 24 hours culture and analyzed by FACS for the number of WT or KO T cells.
[0074] PCR for Cre Excision of ALK5:
[0075] CD4.sup.+ T cells, B cells, CD8.sup.+ T cells, Foxp3.sup.+ Tregs, and macrophages were FACS sorted with an Aria II (BD Biosciences) and collected directly into cell lysis solution for genomic DNA isolation. gDNA was subsequently isolated using a DNeasy blood and tissue kit (Qiagen). PCR was performed with a 3-primer system as originally described (Larsson et al., The EMBO Journal 20:1663-1673, 2001) using Terra PCR direct polymerase mix (Clontech). PCR products were electrophoresed on a 1.5% agarose gel stained with GelRed DNA stain.
[0076] TCGA Data:
[0077] RNAseq data was mined from TCGA—colorectal PanCancer Atlas data set on the cBioPortal for cancer genomics (cbioportal.org). SMAD2 and CXCR3 normalized mRNA expression levels were compared by linear regression analysis.
[0078] Statistics and Data Analysis:
[0079] Graphpad Prism 7.0 software was used to construct all graphs and calculate statistical significance. FlowJo software was used to analyze FACS data and generate tSNE plots. When comparing two groups within an experiment the student's T test was used to determine statistical significance. When more than two biological or treatment groups were compared, one-way Anova was used to calculate p values. Significance from Kaplan-Meier survival curves were calculated with the Log-Rank test.
Example 2
TGFβ Inhibition Sensitizes Mouse Rectal Tumors to Chemoradiation
[0080] As previously shown (Bouquet et al., Clin. Cancer Res., 2011; Garrison et al., Cancer Immunol. Immunother., 2012; Young et al., Cancer Immunol. Res., 2014; Vanpouille-Box et al., Cancer Res., 2015), TGFβ blockade combined with radiation reduces tumor growth in various murine models. This therapeutic strategy was tested using a clinically relevant small molecule inhibitor of ALK5, LY2157299 (LY, also known as Galunisertib), administered prior to chemo-radiation in mice bearing established colorectal tumors. LY was evaluated in combination with 5-FU chemotherapy and radiation (RT), either 2 Gy×15 (BED.sub.10 36) or 5 Gy daily for 5 consecutive days (BED.sub.10 37.5), mirroring standard of care clinical dosing schedules for neoadjuvant treatment of rectal cancer patients. As no difference was seen between 2 Gy×15 and 5 Gy×5 (data not shown), for practicality, 5 Gy×5 was used for the remainder of the preclinical modeling (
[0081] Evaluation of tumor sections harvested from mice at day 14 (one day post-LY treatment) demonstrated reduced phosphorylation and nuclear translocation of the TGFβ signaling mediator, Smad2, indicating ALK5 signaling was attenuated in tumor tissue, specifically in the CD8α.sup.+ cells (
Example 3
CD8α.SUP.+ T Cells are the Direct Target of TGFβ Inhibitor
[0082] To clarify further the primary target of LY2157299, the Cre-Lox system was utilized to generate double transgenic mice via cell-type specific Cre expression. Lyz2-Cre (Clausen et al., Transgenic Res. 8:265-277, 1999) (monocytes/macrophages), Foxp3-CreERT2-eGFP (Rubtsov et al., Science 329:1667-1671, 2010) (regulatory T cells), and CD8α-Cre (Maekawa et al., Nat. Immunol. 9:1140-1147, 2008) (CD8α.sup.+ T cells) animals were crossed with ALK5.sup.flox/flox mice (Larsson et al., EMBO J. 20:1663-1673, 2001) to excise exon 3 of the ALK5 gene. Double transgenic mice demonstrated specific ALK5 excision by PCR evaluation of flow cytometry isolated immune cells from tumors and spleens (
[0083] Surprisingly, there was more rapid tumor growth in ALK5.sup.ΔFoxp3 animals (31 vs 55 mm.sup.2 at day 16, p<0.05,
[0084] MC38 tumors grew to comparable sizes by 10-14 days post implant in ALK5.sup.ΔCD8 and wildtype (WT) animals (
[0085] Whether the improved survival and radiosensitivity observed in ALK5.sup.ΔCD8 mice was dependent on CD8.sup.+ T cells was next evaluated. MC38 tumor-bearing mice were treated with an anti-CD8β antibody on day 4 (
[0086] In order to evaluate whether the improved efficacy of RT+5FU+LY (
Example 4
TGFβR1 Loss in CD8.SUP.+ T Cells Improves Cytotoxicity and Reduces Threshold for TCR Activation
[0087] Next, the mechanism by which CD8 T cell-specific ALK5 loss improved anti-tumor immunity was evaluated. First, differences in immune cell populations in the periphery and the tumor microenvironment of ALK5.sup.ΔCD8 mice was evaluated. Flow cytometric evaluation of MC38 tumors derived from ALK5.sup.ΔCD8 or WT mice at day 14 post implant (prior to rejection) was performed. An increase in total CD8.sup.+ T cells in tumors and a corresponding decrease in CD8.sup.+ T cells in tumor draining lymph nodes from ALK5.sup.ΔCD8 mice (
[0088] The function of infiltrating CD8.sup.+ T cells in WT and ALK5.sup.ΔCD8 animals was then evaluated. The percent of tumor infiltrating CD8.sup.+ cells that expressed IFN-γ or TNF-α were similar in ALK5.sup.ΔCD8 and WT mice (
[0089] LY2157299, which inhibits TGFβ signaling, altered CD8 T cell function and tumor infiltrating immune cells similar to what was observed in tumors from ALK5.sup.ΔCD8 animals. There were more CD8.sup.+ T cells and fewer macrophages and Tregs infiltrating tumors from LY-treated animals (
Example 5
TGFβ Inhibits Tumor Infiltration by CD8.SUP.+ T Cells Via Suppression of CXCR3 Expression
[0090] Based on the detection of increased tumor-infiltrating CD8.sup.+ T cells in ALK5.sup.ΔCD8 and LY-treated mice, it was hypothesized that TGFβ may inhibit either in situ proliferation or tumor trafficking of CD8.sup.+ T cells, or both. To evaluate these possibilities simultaneously, we adoptively co-transferred CFSE-labeled congenic WT and ALK5.sup.ΔCD8 CD8.sup.+ T cells, at a 50:50 ratio, into WT mice with established day 14 MC38 tumors. Seven days following transfer, spleens, tumor draining lymph nodes, and tumors were harvested for flow cytometric analysis (
[0091] Therefore, mechanisms of increased tumor trafficking that could be attributed to changes in the CD8.sup.+ T cells harboring ALK5 deletion were evaluated. Given the enhanced cytotoxicity of ALK5.sup.ΔCD8 CD8.sup.+ T cells and diminished macrophage infiltrate into tumors, differences in cytokines and chemokines from digested tumors grown in WT and ALK5.sup.ΔCD8 animals was assessed by multiplex cytokine bead array. Minimal differences in tumor cytokines were observed (data not shown). To determine whether the expression of chemokine receptors on CD8 T cells could explain the differential infiltration of WT and ALK5.sup.ΔCD8 T cells, expression of CXCR3 and CXCR6 were evaluated, which are dominant chemokine receptors for CD8.sup.+ T cell trafficking into tumors (Vignali & Kallikourdis, Cytokine Growth Factor Rev. 36:107-116, 2017), particularly following radiation (Matsumura et al., J. Immunol. 181:3099-3107, 2008; Marciscano et al., Clin. Cancer Res. 24:5058-5071, 2018). An increase in CXCR3 expression in transferred ALK5.sup.ΔCD8 CD8.sup.+ T cells in the co-transfer assay (
[0092] In order to assess whether CXCR3 was a direct transcriptional target of TGFβ in T cells, chromatin immunoprecipitation for the TGFβ signaling mediators Smad2 and Smad3, and qPCR of the CXCR3 promoter region identified to contain Smad-binding elements, up to 5000 bp upstream of the transcriptional start site were performed. The human CXCR3 promoter in the human Jurkat cell line exhibited a significant increase in Smad2 and Smad3 binding approximately 4000 bp upstream of the transcriptional start site, 1.5 hours after TGFβ treatment (
[0093] To test whether enhanced CXCR3 expression is necessary for the rejection of MC38 tumors and extended survival observed in tumor-bearing ALK5.sup.ΔCD8 mice, CXCR3 was blocked in vivo with an anti-CXCR3 blocking antibody delivered on days 4, 8, and 12 after tumor challenge (
[0094] Whether CXCR3-dependent chemotaxis could be increased by utilizing an ALK5 inhibitor was then tested. In preclinical modeling, an increase in CXCR3.sup.+CD8.sup.+ T cells following treatment with LY2157299 was observed (
Example 6
TGFβ Inhibition Increases CXCR3.SUP.+.CD8.SUP.+ T Cell Infiltration into Human Rectal Cancers and is Associated with Neoadjuvant Treatment Response
[0095] To determine the clinical relevance of our data, the expression of CXCR3 in human patients was interrogated. Analysis of the TCGA colorectal database revealed an inverse correlation between SMAD2 and CXCR3 expression (
Example 7
Checkpoint Inhibition Decreases Peripheral Blood CXCR3.SUP.+ T Cells in Head and Neck Squamous Cell Carcinoma Patients
[0096] The effect of checkpoint inhibition on CXCR3+ T cells was assessed using the treatment schema shown in
[0097] In view of the many possible embodiments to which the principles of the disclosure may be applied, it should be recognized that the illustrated embodiments are only examples and should not be taken as limiting the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.