SiRNA in tandem expression and uses thereof in treating chronic lymphocytic leukemia
10273481 ยท 2019-04-30
Assignee
Inventors
- Chenyu Zhang (Beijing, CN)
- Ke Zeng (Beijing, CN)
- Hongwei Gu (Jiangsu Province, CN)
- Xueliang WANG (Jiangsu, CN)
Cpc classification
C12N15/111
CHEMISTRY; METALLURGY
C12Y207/10002
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Provided is an siRNA in tandem expression and uses thereof in treating chronic lymphocytic leukemia, and particularly, provided are a method of a tandem expression for siRNA of BTK, and an siRNA in tandem expression and uses thereof in treating chronic lymphocytic leukemia.
Claims
1. A recombinant nucleic acid molecule for inhibiting Bruton's agammaglobulinemia tyrosine kinase (BTK), wherein the recombinant nucleic acid molecule comprises Formula V:
A-(B-L)p-Z(V), wherein A is an optional sequence of 0-50 nucleotides (nts) at 5 end, B is either of (1) a BTK-targeted siRNA sequence selected from SEQ ID NO: 1, SEQ ID NO:2, and SEQ ID NO:3, or (2) a precursor RNA molecule of Formula II
Seq.sub.forward-X-Seq.sub.backward(II), wherein Seq.sub.forward or Seq.sub.backward comprises SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, Seq.sub.forward and Seq.sub.backward are capable of hybridizing to each other, and X is a loop sequence not complementary to Seq.sub.forward or Seq.sub.backward; L is an optional interval sequence of 0-50 nts; p is a positive integer of 2, 3, 4, or 5; Z is an optional sequence of 0-50 nts at 3 end.
2. The recombinant nucleic acid of claim 1, wherein each B is a different sequence.
3. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and an effective amount of one or more active agents selected from the group consisting of: (a) the recombinant nucleic acid molecule of claim 1, (b) a polynucleotide that encodes the nucleic acid molecule of claim 1, and (c) an expression vector comprising the polynucleotide of (b).
4. The pharmaceutical composition of claim 3, wherein each B is the same or different.
5. The pharmaceutical composition of claim 3, wherein B is selected from the group consisting of SEQ ID NOs:4-7.
6. A recombinant DNA molecule that encodes the recombinant nucleic acid molecule of claim 1.
7. The recombinant DNA molecule of claim 6 that comprises one or more of SEQ ID NOs:4-7.
8. The recombinant nucleic acid molecule of claim 1, wherein the length of A is 0-20 nts.
9. The recombinant nucleic acid molecule of claim 1, wherein the length of A is 0-10 nts.
10. The recombinant nucleic acid molecule of claim 1, wherein the length of L is 0-20 nts.
11. The recombinant nucleic acid molecule of claim 1, wherein the length of L is 0-10 nts.
12. The recombinant nucleic acid molecule of claim 1, wherein the length of Z is 0-20 nts.
13. The recombinant nucleic acid molecule of claim 1, wherein the length of Z is 0-10 nts.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11) In each figure, control represents the control, mock represents the blank control; nc represents being transfected with blank expression vectors (the negative control); plasmid-1 represents that the transfected P1 plasmid can express BTK-1, plasmid-2 represents that the transfected P2 plasmid can express BTK-2, plasmid-3 represents that the transfected P3 plasmid can express BTK-3, and plasmid-1-2-3 represents that the transfected P1-2-3 plasmid can express BTK1-2-3.
(12) Particular Embodiments
(13) The inventors discover through wide and in-depth researches and massive screening of nucleotide sequences that certain siRNAs possess rather strong BTK inhibition ability, and when they are tandem-expressed, the inhibition effect is even stronger. Therefore, the expression and activity of BTK can be effectively inhibited through importing the siRNAs that specifically inhibit BTK; thereby CLL can be prevented and treated. The present invention is completed on this basis.
(14) Active Ingredients of the Present Invention
(15) As used herein, the active ingredients of the present invention refer to one or more kinds of active ingredients selected from the following group (including the combination thereof):
(16) (a) BTK-inhibiting siRNAs, the sequence of which comprises any of the siRNA sequences as said in SEQ ID NO.: 1-3 (including the combination thereof);
(17) (b) Precursor RNAs, which can be processed in the host into the BTK inhibiting-siRNAs as said in (a);
(18) (c) Polynucleotides, which can be transcribed in the host into the precursor RNAs as said in (b), and then processed into the siRNAs as said in (a);
(19) (d) Expression vectors, which contain the BTK inhibiting-siRNAs as said in (a), or the precursor RNAs as said in (b), or the polynucleotides as said in (c); and
(20) (e) Agonists of the siRNAs as said in (a).
(21) SiRNAs and Precursors Thereof
(22) The present invention provides a type of siRNA for the treatment of CLL. As used herein, the said siRNA refers to a type of RNA molecules, which can be processed with the transcription product that can form the siRNA precursors. Mature siRNAs usually comprise 18-26 nucleotides (nt) (more particularly, 19-22 nt), not excluding other numbers of nucleotides. The siRNAs can usually be detected with Northern blotting.
(23) As used herein, isolated refers to that a substance is isolated from its original environment (if the substance is a natural substance, its original environment is the natural environment). For example, the polynucleotides and polypeptides in a living cell are not isolated and purified in the natural state, but the same polynucleotides and polypeptides are isolated and purified when they are isolated from the other substances co-existing in the natural state.
(24) It shall be notified that siRNAs are usually produced through simulating the production mechanism of miRNAs. The siRNAs can be processed from precursor RNAs (pre-RNAs). The said pre-RNAs can fold into a stable stem-loop (hairpin) structure, of which the length is usually within 50-100 bp. The two sides of the stem part of the said stem-loop structure comprise two sequences that are substantially complementary. The said pre-RNA can be natural occurring or artificially synthesized.
(25) The pre-RNA can be cut to generate siRNA. And said siRNA may be substantially complementary to at least a portion of the sequence of the mRNA encoding the gene. As used herein, substantially complementary means that the nucleotide sequence is sufficiently complementary and can act upon each other in a predictable manner, e.g., forming a secondary structure (such as a stem-loop structure). Generally, at least 70% of nucleotides in two substantially complementary nucleotide sequences are complementary; preferably, at least 80% of nucleotides are complementary; more preferably, at least 90% of nucleotides are complementary; and further preferably, at least 95% of nucleotides are complementary, e.g., 98%, 99% or 100%. Generally, there are at most 40 non-matched nucleotides between two sufficiently complementary molecules; preferably, there are at most 30 non-matched nucleotides; more preferably, there are at most 20 non-matched nucleotides; and further preferably, there are at most 10 non-matched nucleotides, e.g., there are 1, 2, 3, 4, 5 or 8 non-matched nucleotides.
(26) As used herein, stem-loop structure is also named hairpin structure, referring to a type of nucleotide molecule that can form a secondary structure with a double-strand area (stem). The said double-strand area is formed by two parts of the nucleotide molecule (locating at the same molecule), and the said two parts are located respectively at two sides of the double-strand area; at least one loop structure is also included, which comprises non-complementary nucleotide molecules, i.e., the single-strand area. Even when the two parts of the nucleotide molecule is not completely complementary; the double-strand part thereof can keep the double-strand state. For example, insertion, absence, replacement in a small area can cause non-complement or formation of stem-loop structure or other kinds of secondary structures. However, the two areas can still complement with each other and react in a predictable manner, forming the double-strand area of the stem-loop structure. The stem-loop structure is commonly known by the skilled person in the art. Usually when being given a nucleic acid with nucleotide sequence of the first structure, a skilled person in the art can determine whether the nucleic acid can form the stem-loop structure.
(27) The siRNAs said in the present invention refer to: micro RNAs of the BTK-inhibiting family, which include BTK-inhibiting siRNAs or modified BTK-inhibiting siRNA derivatives.
(28) In one preferred example of the present invention, the nucleotide sequence of the BTK-inhibiting siRNAs is shown as SEQ ID NO.: 1, 2 and 3. Most preferably is SEQ ID NO.: 3.
(29) The present invention also includes siRNA variants and derivatives. Meanwhile, siRNA derivatives in the broader sense can also include siRNA variants. The ordinary skilled person in the art can modify the BTK-inhibiting siRNAs using conventional methods, including (but not being limited to): methylation modification, alkyl modification, glycosylation modification (such as 2-methoxy-glycosyl modification, alkyl-glycosyl modification, glycoconjugate modification and etc.), nucleination modification, peptide modification, lipid modification, nuclein modification (such as TT modification).
(30) Polynucleotide Construct
(31) Basing on the siRNA sequence provided in the present invention, polynucleotide constructs can be designed, which can be processed into siRNAs that, being imported, can affect the expression of related mRNAs. Therefore, the present invention provides a type of isolated polynucleotide (construct), which can be transcribed in the human cell into precursor RNAs that can be cut in the human cell and expressed as the said siRNAs.
(32) As one preferable embodiment of the present invention, the said polynucleotide construct comprises one or more structure units as shown in Formula II:
Seq.sub.forward-X-Seq.sub.backwardFormula II
(33) In Formula II,
(34) Seq.sub.forward is a nucleotide sequence that can be expressed in cells into the said BTK-inhibiting siRNA, Seq.sub.backward is a nucleotide sequence that is substantially complementary with Seq.sub.forward; or, Seq.sub.backward is the nucleotide sequence that can be expressed in cells into the said BTK-inhibiting siRNA, Seq.sub.forward is the nucleotide sequence that is substantially complementary with Seq.sub.backward; X is a spacer sequence between Seq.sub.forward and Seq.sub.backward. The said spacer sequence is complementary to neither Seq.sub.forward nor Seq.sub.backward.
(35) In which, each structure unit can express the same or different siRNAs;
(36) Being transferred into cells, the structure shown in Formula I will form a secondary structure as shown in Formula III:
(37) ##STR00002##
(38) In Formula III, the Seq.sub.forward and Seq.sub.backward and X are defined as above;
(39) represents the base complementary relationship between the Seq.sub.forward and Seq.sub.backward;
(40) The said polynucleotide construct is usually placed in an expression vector. Therefore, the present invention also includes an expression vector that contains the said siRNA or the said polynucleotide construct. The said expression vector usually comprises of a promoter, origin of replication and/or marker genes, and etc. Methods commonly known by the skilled persons in the art can be used to construct the expression vector needed in the present invention. These methods include DNA in vitro reconstruct, DNA synthesis and DNA in vivo reconstruct techniques, and etc. The said expression vector comprises preferably of one or several marker genes, such as resistance against kalamycin, gentamycin, hygromycin, ampicillin, so as to enable the selection of phenotypic characteristics of transformed host cells.
(41) Bruton's Agammaglobulinemia Tyrosine Kinase (Btk)
(42) Bruton's agammaglobulinemia tyrosine kinase, Btk, is a member of the non-receptor tyrosine family. It comprises of 5 domains: the Pleckstr inhomology domaIn (PH domain), Tec homology domain (TH domain), Src homology3 domain (SH3 domain), Src homology2 domain (SH2 domain) and Tyrosine kinase domain (catalytic domain).
(43) Tyrosine kinases can be classified according to their location in cells two kinds, receptor tyrosine kinases and non-receptor tyrosine kinases. The receptor tyrosine kinases locate on the cell membrane, being the receptor and enzyme at the same time. The non-receptor tyrosine kinases locate in the cytoplasma or nucleus. They are divided according to their homology into 11 families including Tec, AB1 and Ack, and etc. Btk belongs to the Tec family of non-receptor tyrosine kinases. The domains can identify and combine with various signal molecules, providing structural foundation for the participation of Btk in multiple signal pathways.
(44) The protein encoded by Btk is a cytoplasmic protein, so that the Btk protein is expressed by, except for T lymphocytes and phlogocytes from the development end of B lymphocytes, all other myeloid cells, including B lymphocytes, basophile granulocytes and monocytes, and etc., and is stably expressed during the whole development process of B lymphocytes. The survival and migration of malignant tumor cells mainly depends on the antigen receptor signal of B lymphocytes. In the signal pathway, Btk is an essential signal.
(45) The amino acid and nucleotide sequence of human Btk is registered in Genbank under the number of NM_000061.
(46) Pharmaceutical Compositions
(47) The present invention provides a pharmaceutical composition that comprises of a pharmaceutically acceptable carrier and one or several active ingredients of the present invention with effective dose.
(48) In another preferred example, the said modified siRNA derivative contains the monomer or the polymer of the compound with structure as shown in Formula I:
(X)n-(Y)mFormula I
(49) In Formula I, each X is a siRNA said in (a); each Y is an independent modifier promoting the administration stability of small RNAs; n is a positive integer in 1-100 (preferably 1-20), (n is preferably 1, 2, 3, 4 or 5); m is a positive integer in 1-1000 (preferably 1-200); each - represents a connector, chemical bond or covalent bond; in another preferred example, the said connector is a nucleotide sequence with a length of 1-10 bases. The said Y includes (but is not limited to) cholesterol, steroid, sterol, alcohol, organic acid, aliphatic acid, ester, monosaccharide, polysaccharide, amino acid, polypeptide, mononucleotide, polynucleotide.
(50) In another preferred example of the present invention, the polynucleotide said in (c) comprises one or several structure units as shown in Formula II:
Seq.sub.forward-X-Seq.sub.backwardFormula II
(51) In Formula II, Seq.sub.forward is a nucleotide sequence that can be expressed in cells into the said BTK-inhibiting siRNA, Seq.sub.backward is a nucleotide sequence that is substantially complementary with Seq.sub.forward; or, Seq.sub.backward is the nucleotide sequence that can be expressed in cells into the said BTK-inhibiting siRNA, Seq.sub.forward is the nucleotide sequence that is substantially complementary with Seq.sub.backward; X is a spacer sequence between Seq.sub.forward and Seq.sub.backward. The said spacer sequence is complementary to neither Seq.sub.forward nor Seq.sub.backward. And being transferred into the host cell, the structure shown in Formula II can transform into a secondary structure as shown in Formula III:
(52) ##STR00003##
(53) In Formula III, Seq.sub.forward, Seq.sub.backward and X are defined as said above, II represents the base complementary relationship between the Seq.sub.forward and Seq.sub.backward;
(54) In another preferred example of the present invention, the corresponding DNA sequence of encoding primer RNA is shown as SEQ ID NO. 7 and 4-6:
(55) TABLE-US-00006 (SEQIDNO.:7) TTCACTGGACTCTTCACCTCTGTTTTGGCCACTGACTGACAGAGGTG AAGTCCAGTGAACAGGACACAAGGCCTGTTACTAGCACTCACATGGAAC AAATGGCCCAGATCCTGGAGGCTTGCTGAAGGCTGTATGCTGTTAGCAGT TGCTCAGCCTGACGTTTTGGCCACTGACTGACGTCAGGCTGCAACTGCTA ACAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAG ATCCTGGAGGCTTGCTGAAGGCTGTATGCTGAACAGTTTCGAGCTGCCAG GTGTTTTGGCCACTGACTGACACCTGGCATCGAAACTGTT
(56) In which, the sequence of SEQ ID NO.: 7 is a polynucleotide sequence with tandem-connected BTK-1-2-3, in which:
(57) The sequence of the polynucleotide relating to BTK-1 (i.e., DNA sequence that encodes the precursor RNA) is:
(58) TABLE-US-00007 (SEQIDNO.:4) TTCACTGGACTCTTCACCTCTGTTTTGGCCACTGACTGACAGAGGTGA AGTCCAGTGAA;
(59) The sequence of the polynucleotide relating to BTK-2 (i.e., DNA sequence that encodes the precursor RNA) is:
(60) TABLE-US-00008 (SEQIDNO.:5) TTAGCAGTTGCTCAGCCTGACGTTTTGGCCACTGACTGACGTCAGGCT GCAACTGCTAA;
(61) The sequence of the polynucleotide relating to BTK-3 (i.e., DNA sequence that encodes the precursor RNA) is:
(62) TABLE-US-00009 (SEQIDNO.:6) AACAGTTTCGAGCTGCCAGGTGTTTTGGCCACTGACTGACACCTGGCAT CGAAACTGTT.
(63) As used herein, the term effective amount or effective dose refers to the amount, with which a composition can take effect on and be accepted by humans and/or animals.
(64) As used herein, pharmaceutically acceptable ingredient refers to an ingredient that is applicable on humans and/or mammals without excessive adverse side effects (such as toxicity, stimulation and allergic reaction), i.e., ingredient with sensible benefit/risk ratio. The term pharmaceutically acceptable carrier refers to the carrier for the effect ingredient, including all sorts of excipients and diluents.
(65) The pharmaceutical composition of the present invention comprises the active ingredient of the present invention of the safe effect amount and a pharmaceutically acceptable carrier. The carriers include (but are not limited to): saline water, buffer, glucose, water, glycerol, ethanol, and a combination thereof. Generally, a pharmaceutical preparation shall match with the form of administration, and the dosage form of the pharmaceutical composition of the present invention can be injection, oral preparation (tablet, capsule, or oral liquid), transdermal agent, or sustained release agent. For example, preparation is performed with a conventional method using physiological saline or an aqueous solution containing glucose and other adjuvants. Said pharmaceutical composition is preferably produced under sterile conditions.
(66) The effective amount of the active ingredient of the present invention may vary depending on the mode of administration and the severity of the disease to be treated. A person skilled in the art could determine the selection of the preferred effective amount depending on various factors (e.g., by clinical trials). Said factors include, but are not limited to, the pharmacokinetic parameters of said active ingredient, e.g., bioavailability, metabolism, half-life, etc.; and the severity of the patient's disease to be treated, the patient's weight, the patient's immune state, the administration route, etc. Generally, when the active ingredient of the present invention is administered at a dose of about 0.00001-50 mg/kg body weight (preferably 0.0001-10 mg/kg body weight) per day, satisfactory results can be achieved. For example, due to the urgent requirements of the treatment status, several separate doses can be administered on one day, or the dosage can be proportionally reduced.
(67) In the present invention, the said pharmaceutically acceptable carriers include but are not limited to: water, saline solution, liposomes, lipids, proteins, protein-antibody complex, peptides, cellulose, nanogel, or the combination thereof. The choice of carriers should match the mode of administration, which is well known to an ordinary person skilled in the art.
(68) The said active ingredient is used to prepare pharmaceutical compositions for the inhibition of BTKs, or the prevention or treatment of CLL.
(69) Prevention or Treatment Method
(70) The present invention provides a method to prevent or treat CLL.
(71) In one preferred example, the said method includes administrating to subjects in need the pharmaceutical composition of the present invention with safe and effective dose; or administrating the active ingredient of the present invention with safe and effective dose.
(72) The main advantages of the present invention include:
(73) 1) Validates an essential type of siRNA sequences specific to BTK;
(74) 2) tandem-expresses BTK-specific siRNAs;
(75) 3) Provides a method to treat CLL targeting BTK, while validates that BTK-siRNA can be expressed in the cell using the generation mechanism of miRNAs.
(76) The present invention is further illustrated in connection with particular embodiments as follows. It should be understood that these embodiments are merely illustrative of the invention and are not intended to limit the scope of the present invention. In the case of specific conditions for the experimental method being not specified in the following examples, generally conventional conditions are followed, such as the conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbour Laboratory Press, 1989), or the conditions recommended by the manufacturer are followed. All percentages and portions are of weight unless otherwise indicated.
EXAMPLE 1
(77) Tandem-expression of BTK-specific siRNAs
(78) 1. Experiment method
(79) 1.1 Construction of interference plasmid
(80) In this example, 3 siRNAs are designed targeting the BTK gene, i.e., BTK-1, BTK-2 and BTK-3, of which the sequences are:
(81) TABLE-US-00010 (SEQIDNO.:1) BTK-1:UUCACUGGACUCUUCACCUCU; (SEQIDNO.:2) BTK-2:UUAGCAGUUGCUCAGCCUGAC; (SEQIDNO.:3) BTK-3:AACAGUUUCGAGCUGCCAGGU.
(82) The expression precursors of the above-said 3 siRNAs are capsuled in the miRNA expression vector, so as to express the siRNAs in the form of miRNAs, constructing plasmids: P1, P2 and P3 respectively.
(83) Meanwhile, 3 BTK siRNAs are tandem-expressed (comprising of 3 hairpin structures), so as to avoid adverse situations such as accidental off-target effect, constructing tandem-plasmid P1-2-3.
(84) In which, the structure of polynucleotide sequence to express BTK-1, BTK-2, BTK-3 is shown as
(85) TABLE-US-00011 (SEQIDNO.:7) TTCACTGGACTCTTCACCTCTGTTTTGGCCACTGACTGACAGAGGTG AAGTCCAGTGAACAGGACACAAGGCCTGTTACTAGCACTCACATGGAAC AAATGGCCCAGATCCTGGAGGCTTGCTGAAGGCTGTATGCTGTTAGCAGT TGCTCAGCCTGACGTTTTGGCCACTGACTGACGTCAGGCTGCAACTGCTA ACAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAG ATCCTGGAGGCTTGCTGAAGGCTGTATGCTGAACAGTTTCGAGCTGCCAG GTGTTTTGGCCACTGACTGACACCTGGCATCGAAACTGTT
(86) In which,
(87) The sequence of the polynucleotide relating to BTK-1 is:
(88) TABLE-US-00012 (SEQIDNO.:4) TTCACTGGACTCTTCACCTCTGTTTTGGCCACTGACTGACAGAGGTG AAGTCCAGTGAA;
(89) The sequence of the polynucleotide relating to BTK-2 is:
(90) TABLE-US-00013 (SEQIDNO.:5) TTAGCAGTTGCTCAGCCTGACGTTTTGGCCACTGACTGACGTCAGGC TGCAACTGCTAA;
(91) The sequence of the polynucleotide relating to BTK-3 is:
(92) TABLE-US-00014 (SEQIDNO.:6) AACAGTTTCGAGCTGCCAGGTGTTTTGGCCACTGACTGACACCTGGC ATCGAAACTGTT.
(93) 1.2 Cells
(94) Peripheral blood of CLL patients and normal persons is extracted under sterile conditions and then given with anti-coagulants. Lymphocytes in the peripheral blood are isolated with lymphocyte separation solution on a super clean bench and then rinsed twice with PBS so as to leave the lymphocyte separation solution completely. The remaining red blood cells are lysated with red blood cell lysis buffer. The lymphocytes are finally re-suspended with RPMI-1640+15% FBS. Detecting with a flow cytometry determines that B lymphocytes take more than 95% of all. The cells from CLL patients are cultured at 37 C. 5% CO.sub.2 for future use.
(95) 1.3 Transfection
(96) Cells are processed 1 hour before transfection with exsuction and centrifugation, so as to remove the serum. After re-suspension with serum-free RPMI-1640, the cells are placed on a 12-hole plate and transfected with lipofection 2000 following the methods recommended by the instruction. After 48 h of transfection, the cells are collected.
(97) 1.4 Extraction of RNA and Synthesis of cDNA
(98) Total RNA of cells is extracted with TRIzol reagent with the standard method, and then reverse-transcribed into cDNA using oligo dT primer and AMV transcriptase, and -actin as internal reference.
(99) 1.5 Quantitative PCR Detection
(100) Quantitative PCR detection is performed with the primer of BTK and -actin respectively.
(101) TABLE-US-00015 (SEQIDNO.:8) BTK-P1:5-GAAGGAGGTTTCATTGTCA-3 (SEQIDNO.:9) BTK-P2:5-TAATACTGGCTCTGAGGTGT-3
(102) Annealing temperature: 53 C.
(103) TABLE-US-00016 (SEQIDNO.:10) ACT-P1:5-CTCCATCCTGGCCTCGCTGT-3 (SEQIDNO.:11) ACT-P1:5-GCTGTCACCTTCACCGTTCC-3
(104) Annealing temperature: 52 C., product=268 bp.
(105) 1.6 Western Blotting
(106) Centrifugation at 1000 rpm is performed for 5 min, and then the cells are collected and lysated with cell lysis solution, followed by ice bath for 30 min. Then cell debris is removed by centrifugation at 10000 rpm for 10 min. The extract total protein is then quantified, processed with 10% SDS-PAGE and then transferred on PVDV film, so as to be incubated with anti-BTK-specific antibodies. Enzyme-labeled rabbit anti-mouse second antibodies are added, and the protein is detected with the chemiluminescence method.
(107) 2. Results
(108) 2.1 DETECtion of BTK mRNA expression change with QRT-PCR
(109) TABLE-US-00017 TABLE 1 Control 1.0000 P1 0.7899 P2 0.7072 P3 0.5743 P1-2-3 0.4064
(110) According to the results of QRT-PCR detection for BTK mRNA expression (as shown in Table 1 and
(111) It is proved that single siRNA or multiple siRNAs can inhibit the expression of BTK, in which these in the form of tandem-expression functions at the best, followed by BTK-3.
(112) 2.2 Detection of BTK protein expression change with western blotting
(113) As shown in
(114) 2.3 Western blotting validates that a single siRNA or multiple siRNAs can inhibit the expression of BTK.
(115) The detection result of BTK protein expression with Western blotting is as shown in
EXAMPLE 2
Effect of BTK siRNA on B Lymphocytes
(116) 1.1 Preparation of B lymphocytes
(117) In this example, normal Daudi cells (lymphocytes) are resuscitated, cultured with RPMI-1640+10% FBS, at 37 C. 5% CO.sub.2 for future use.
(118) 1.2 Transfection
(119) The method is as said in part 1.3 of Example 1.
(120) 1.3 Extraction of RNA and synthesis of cDNA
(121) The method is as said in part 1.4 of Example 1.
(122) Figure 1.4 Analysis with the Western Blotting Method on the Effect of BTK siRNA on BTK Protein.
(123) The method is as said in part 1.6 of Example 1.
(124) The detailed results are shown in
(125) 1.5 Detection for the effect of BTK siRNA on BTK mRNA with QRT-PCR
(126) Quantitative PCR detection is performed with the primer of BTK and -actin respectively. The method is as said in part 1.5 of Example 1, but with different primers shown as follows:
(127) TABLE-US-00018 (SEQIDNO.:12) BTKprimerF15:5-TGCTCCCACTCAATACAAA-3 (SEQIDNO.:13) BTKprimerR15-GCTCTACCAAATGCCTACTC-3
(128) Annealing temperature: 53 C.
(129) TABLE-US-00019 (SEQIDNO.:10) ACT-P1:5-CTCCATCCTGGCCTCGCTGT-3 (SEQIDNO.:11) ACT-P1:5-GCTGTCACCTTCACCGTTCC-3
(130) Annealing temperature: 52 C., product=268 bp.
(131) The detailed results are shown in
(132) It can be seen in
(133) It can be seen in
(134) It can be seen in
(135) It can be seen in
(136) In summary, being transfected with BTK siRNA plasmids P1, P2, P3 and P1-2-3, the expression of BTK-1, BTK-2 and BTK-3 siRNA is all increased; the expression of BTK mRNA and BTK protein is decreased. All of BTK-1, BTK-2, BTK-3 and tandem-expressed P1-2-3 can inhibit the BTK gene and protein in B lymphocytes. And the inhibition on the BTK gene and protein in B lymphocytes of the tandem-expressed P1-2-3 is stronger and with better effect.
(137) All the documents mentioned in the present invention are incorporatedly referred to, as well as each alone. In addition, it should be understood that after reading the teachings of the present invention described above, a skilled person in the art can make various changes or modifications of the invention, and these equivalent forms shall also fall into the scope of the present application as defined by the appended claims.