COMPOSITION FOR ENHANCING OR IMPROVING IMMUNE SYSTEM COMPRISING BIFIDOBACTERIUM BIFIDUM

20220387522 · 2022-12-08

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a composition for enhancing or improving immunity comprising a Bifidobacterium bifidum. In addition, it can be used to prevent, treat, or improve immune diseases caused by immunodeficiency, immunosuppression, or immune system damage. It can be provided as a food composition or a pharmaceutical composition, and the food composition can be provided in various forms such as probiotic products, health functional supplements, animal feed, and the like.

Claims

1. A composition for enhancing or improving immunity comprising a Bifidobacterium bifidum MG731.

2. The composition for enhancing or improving immunity of claim 1, wherein the Bifidobacterium bifidum MG731 is a strain, a culture of the strain, a lysate of the strain or an extract of the strain.

3. The composition for enhancing or improving immunity of claim 1, wherein the composition increases an expression or activity of one or more of IL-7, IL-15 and IFN-γ.

4. The composition for enhancing or improving immunity of claim 1, wherein the composition inhibits an expression or activity of TGF-β.

5. The composition for enhancing or improving immunity of claim 1, wherein the composition is a food composition.

6. The composition for enhancing or improving immunity of claim 5, wherein the composition is for improving or preventing immune diseases.

7. The composition for enhancing or improving immunity of claim 1, wherein the composition is a pharmaceutical composition.

8. The composition for enhancing or improving immunity of claim 7, wherein the composition is for treating or preventing immune diseases.

9. A method for enhancing or improving immunity, the method comprising administering an effective amount of the composition of claim 1 to a subject in need thereof.

Description

BRIEF DESCRIPTION OF FIGURES

[0044] FIG. 1 is a graph showing the relative expression levels of IL-7, IL-15, IFN-γ and TGF-β in THP-1 cells treated with or not treated with Bifidobacterium bifidum MG731, respectively.

[0045] FIG. 2 is a graph showing the relative expression levels of IL-7, IL-15, IFN-γ and TGF-β in Jurkat cells treated with or not treated with Bifidobacterium bifidum MG731, respectively.

[0046] FIG. 3 is a graph showing the relative expression levels of IL-7, IL-15, IFN-γ and TGF-β in human monocyte cells treated with or not treated with Bifidobacterium bifidum MG731, respectively.

EXAMPLES

[0047] Hereinafter, the present invention will be described in more detail by Examples. However, these examples are only for illustrative purposes, and the scope of the present invention is not limited thereto.

Example 1. Preparation of Bifidobacterium Bifidum

[0048] MG731 strains (Accession No. KCTC13452BP) were subcultured with two passages in BL broth. Then, it was incubated in RPMI 90% BL 10% medium for 24 hours. After collecting the MG731 strain and measuring the absorbance at O.D 600, a strain diluent was prepared so as to have a final concentration of 1×10.sup.7 CFU/ml.

Example 2. Evaluation of Immunomodulatory Efficacy

[0049] MG731 was cultured in BL broth under anaerobic conditions at 37° C. Human blood used in the test was put into a 10 mL tube coated with EDTA (or heparin) and mixed with PBS at a ratio of 1:1. Then, Ficoll-Paque PLUS was placed in a 50 mL tube, and the blood sample was added. After centrifugation, PBMCs (peripheral blood mononuclear cells) were harvested.

[0050] Human monocytes were isolated from the PBMCs collected above using a human monocyte isolation kit. The Jurkat cell line, which is a human T cell, was cultured in a 75T flask at 37° C. and 5% CO.sub.2 condition using RPMI 1640 medium containing 10% fetal bovine serum (FBS). In addition, the THP-1 cell line, which is a human monocyte cell, was cultured in a 75T flask at 37° C. and 5% CO.sub.2 condition using RPMI 1640 medium containing 10% FBS and 0.1% 2-mercaptoethanol.

[0051] THP-1 cells, Jurkat cells, and human monocyte cells were counted, respectively, and then diluted in a cell culture without antibiotics and seeded in lower wells of the transwell to be 1×10.sup.6 cells/well/0.8mL. MG731 was diluted in the same cell culture and seeded in insert wells to be 1×10.sup.7 CFU/well/0.2mL.

[0052] After culturing for 24 hours, the insert well containing the Bifidobacterium bifidum MG731 strain was removed. Then, RNA of cells in each well was extracted with Trizol, and cDNA was synthesized.

[0053] After that, the expression levels of IL-7, IL-15, IFN-γ and TGF-β were measured through real-time PCR using the cDNA.

[0054] IL-7 and IL-15 are known as factors inducing proliferation, differentiation, and survival of T cells in early immune response. In addition, IFN-γ is an immune factor secreted by cytotoxic T cells and is known as a representative cytokine to enhance an immune function. On the other hand, TGF-β is known as one of the factors having an immunosuppressive function. Accordingly, increasing the expression of IL-7, IL-15 and IFN-γ and/or inhibiting the expression of TGF-β indicates that there is an immune enhancing effect.

[0055] Primer sequences for real-time PCR are shown in Table 1 below.

TABLE-US-00001 TABLE 1 Primer Sequence IL-7 F CTCCCCTGATCCTTGTTCTG R TCATTATTCAGGCAATTGCTACC IL-15 F CCAACTGGGTGAATGTAATAAGTGA R TGCAACTGGGGTGAACATCA IFN-γ F GTCCAACGCAAAGCAATACA R CTCTTCGACCTCGAAACAGC TGF-β F GGGACTATCCACCTGCAAGA R CCTCCTTGGCGTAGTAGTCG

[0056] As seen in FIG. 1 showing the relative expression levels of IL-7, IL-15, IFN-γ and TGF-β in THP-1 cells treated with or not treated with Bifidobacterium bifidum MG731, the expression levels of IL-7, IL-15 and INF-γ were increased by 1.44-fold, 1.68-fold, and 4.19-fold, respectively, compared to that of the control group. On the contrary, the expression level of TGF-β was decreased by 0.88-fold.

[0057] In addition, as seen in FIG. 2 showing the relative expression levels of IL-7, IL-15, IFN-γ and TGF-β in Jurkat cells treated with or not treated with Bifidobacterium bifidum MG731, the expression levels of IL-15 and INF-γ were increased by 9.61-fold and 2.01-fold, respectively, compared to that of the control group. On the contrary, the expression level of TGF-β was decreased by 0.7-fold.

[0058] In addition, as seen in FIG. 3 showing the relative expression levels of IL-7, IL-15, IFN-γ and TGF-β in human monocyte cells treated with or not treated with Bifidobacterium bifidum MG731, the expression level of IL-7 was increased by 7.55-fold compared to that of the control group, whereas the expression level of TGF-β hardly appeared.

[0059] This means that in all of THP-1, Jurkat and human monocyte cells which are human immune cells, the expression of IL-7 and IL-15 is increased by Bifidobacterium bifidum MG731, thereby activating the proliferation and differentiation of T cells, and the expression of IFN-γ is increased while the expression of TGF-β is decreased, thereby enhancing or improving the immune function.