COMPOSITION FOR PREVENTING OR TREATING RENAL DISEASES, COMPRISING EXOSOMES DERIVED FROM PRECURSOR CELLS OF INDUCED PLURIPOTENT STEM CELL-DERIVED MESENCHYMAL STEM CELLS
20220387509 · 2022-12-08
Inventors
Cpc classification
C12N5/0696
CHEMISTRY; METALLURGY
C12N2502/1388
CHEMISTRY; METALLURGY
A61K35/28
HUMAN NECESSITIES
C12N5/0668
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to a pharmaceutical composition for preventing or treating renal diseases, comprising, as an active ingredient, exosomes isolated from precursor cells of induced pluripotent stem cell-derived mesenchymal stem cells, the precursor cells having been treated or not having been treated with a pretreatment material. Exosomes of the present invention exhibit an effect of preventing or treating renal diseases that is more improved than that of exosomes isolated from conventional mesenchymal stem cells, thereby being effectively usable for relevant research and development and productization.
Claims
1.-9. (canceled)
10. An exosome, isolated from pretreatment material-pretreated progenitor cells of induced pluripotent stem cell (iPSC)-derived mesenchymal stem cells (MSCs).
11. The exosome of claim 10, wherein the pretreatment material is exendin-4.
12. The exosome of claim 10, wherein the pretreatment material is lanifibranor.
13. A method for treating a kidney disease in a subject in need thereof, wherein the method comprising administering to the subject a composition comprising exosomes isolated from progenitor cells of induced pluripotent stem cell (iPSC)-derived mesenchymal stem cell (MSC).
14. The method of claim 13, wherein the progenitor cells of mesenchymal stem cells express at least one gene selected from the group consisting of ANKRD1, CPE, NKAIN4, LCP1, CCDC3, MAMDC2, CLSTN2, SFTA1P, EPB41L3, PDE1C, EMILIN2, SULT1C4, TRIM58, DENND2A, CADM4, AIF1L, NTM, SHISA2, RASSF4, and ACKR3 at a higher level than an equal number of the mesenchymal stem cells.
15. The method of claim 13, wherein the progenitor cells of mesenchymal stem cells express at least one gene selected from the group consisting of DHRS3, BMPER, IFI6, PRSS12, RDH10, and KCNE4 at a lower level than an equal number of the mesenchymal stem cells.
16. The method of claim 13, wherein the kidney disease is selected from the group consisting of renal fibrosis, diabetic nephropathy, hypertensive nephropathy, glomerulitis, pyelonephritis, interstitial nephritis, lupus nephritis, polycystic kidney disease, kidney failure, glomerulosclerosis, acute rejection after transplantation, and drug-caused kidney damage.
17. A method for preventing or treating a kidney disease in a subject in need thereof, wherein the method comprising administering to the subject a composition comprising exosomes isolated from induced pluripotent stem cell (iPSC)-derived mesenchymal stem cell (MSC) progenitor cells treated with a pretreatment material.
18. The method of claim 17, wherein the pretreatment material is exendin-4.
19. The method of claim 17, wherein the pretreatment material is lanifibranor.
20. The method of claim 17, wherein the kidney disease is selected from the group consisting of renal fibrosis, diabetic nephropathy, hypertensive nephropathy, glomerulitis, pyelonephritis, interstitial nephritis, lupus nephritis, polycystic kidney disease, kidney failure, glomerulosclerosis, acute rejection after transplantation, and drug-caused kidney damage.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
BEST MODE FOR CARRYING OUT THE INVENTION
[0103] A pharmaceutical composition comprising induced pluripotent stem cell (iPSC)-derived mesenchymal stem cell (MSC) progenitor cells as an active ingredient for prevention or treatment of kidney disease.
DETAILED DESCRIPTION
[0104] A better understanding of the present disclosure may be obtained from the following Examples which are set forth to illustrate, but are not to be construed as limiting the present disclosure.
[0105] Throughout the specification, the term “%” used to express the concentration of a specific material, unless otherwise particularly stated, refers to (wt/wt) % for solid/solid, (wt/vol) % for solid/liquid, and (vol/vol) % for liquid/liquid.
Preparation Example: Isolation and Culturing of Induced Pluripotent Stem Cell (iPSC)-Derived Mesenchymal Stem Cell Progenitor Cell (BxC)
[0106] First, induced pluripotent stem cells (iPSC) were cultured in DMEM supplemented with 10% FBS and 10 ng/ml bFGF for 7 days. Then, stage-specific embryonic antigen 4 (SSEA-4) (−) cells, which have no SSEA-4 protein expressed on the surface thereof, were isolated from the cultured induced pluripotent stem cells through FACS. The isolated SSEA-4 (−) cells were passaged, and further cultured in the same medium as above for 7 days, thereby preparing progenitor cells of induced pluripotent stem cell-derived mesenchymal stem cells of the present disclosure. The progenitor cells of induced pluripotent stem cell (iPSC)-derived mesenchymal stem cells (MSCs) were named BxC (brexogen stem cell).
[0107] The progenitor cells of iPSC-derived MSCs, named BxC, were further cultured in a culture medium [high glucose DMEM (Gibco, Cat no. 11995-065), 10% Fetal bovine Serum (HyClone), 1% MEM Non-Essential Amino Acids Solution (100×)(Gibco, Cat no. 11140-050)].
Example 1: Isolation of Exosomes from iPSC-Derived MSC Progenitor Cell (BxC)
[0108] The culture medium in which the induced pluripotent stem cell (iPSC)-derived mesenchymal stem cell (MSC) progenitor cells (hereinafter referred to as “BxC”) had been cultured was collected and centrifuged at 300×g for 10 min to remove the cells and cell debris as a pellet. The supernatant was filtered through a 0.22-μm filter and centrifuged at 10,000×g and 4° C. for 70 min using a high-speed centrifuge. The supernatant thus formed was again centrifuged at 100,000×g and 4° C. for 90 min using an ultracentrifuge. After removal of the supernatant, exosomes were obtained as a pellet, diluted in PBS (phosphate buffered saline), and used in subsequent experiments.
Experimental Example 1: Characterization of iPSC-MSC Progenitor Cell (BxC)-Derived Exosome
[0109] The exosomes (hereinafter referred to as “BxC-e”) isolated in Example 1 were measured for size distribution by nanoparticle tracking assay (NanoSight NS300, Malvern) and morphologically identified using an electron microscope.
[0110] As shown in
Experimental Example 2: Effect of Exosome Isolated from iPSC-Derived MSC Progenitor Cell on Regeneration of Renal Cell
[0111] Examination was made of the regenerative effect of the exosomes isolated in Example 1 on renal cells damaged by treatment with cisplatin or LPS (lipopolysaccharide).
[0112] 2-1. Cisplatin Damage
[0113] First, the epithelial cell line HK-2 (Korean Cell Line Bank) and the kidney epithelial cells RPTEC (Renal Proximal Tubule Epithelial Cells, Lonza, CC-2553) and GEC (Glomerular Endothelial Cells, Cell Systems, ACBRI 128) were each seeded at a density of 1×10.sup.4 cells/well into 96-well culture dishes.
[0114] At 16 hours after cell seeding, the cells were checked for the state thereof and treated for 24 hours with 25 μM cisplatin (Sigma P4394) in a serum-free growth medium. After 24 hours, the supernatant was discarded and the cells were washed with DPBS (HyClone SH30028.02) and incubated for 48 hours with 50 μg (low dose) or 100 μg (high dose) of the exosomes isolated in Example 1 in a fresh serum-free growth medium.
[0115] Finally, 10 μL of CCK-8 solution (cell counting kit-8, Enzo ALX-850-039-KI01) was added, followed by incubation at 37° C. for 2 hours in a CO.sub.2 incubator. A color change appeared and absorbance at 450 nm was read.
[0116] 2-2. LPS Damage
[0117] An experiment was carried out in the same manner as in Experimental Example 2-1 with the exception of treatment with 20 μg/mL LPS (Sigma L2880) instead of cisplatin.
[0118] As can be seen in
Example 2: Isolation of Exosome (BxC-G63e) from iPSC-Derived
[0119] MSC Progenitor Cell According to Treatment with Pretreatment Material
[0120] 2-1. Isolation of Exosomes (BxC-G63e) from iPSC-Derived MSC Progenitor Cell Treated with Exendin-4
[0121] The iPSC-derived MSC progenitor cells (BxC) prepared in the Preparation Example were cultured for 24 hours in a culture medium [high glucose DMEM (Gibco, Cat no. 11995-065); 10% Fetal bovine Serum (HyClone), 1% MEM Non-Essential Amino Acids Solution (100×) (Gibco, Cat no. 11140-050)] containing 20 nM exendin-4.
[0122] After completion of incubation, the exendin-4-pretreated BxC was washed and additionally cultured for 72 hours in a medium supplemented with exosome-depleted 10% fetal bovine serum (FBS). The reason why exosome-depleted FBS was used in the cell culture medium is to prevent the incorporation of FBS-derived exosomes except for exosomes secreted by stem cells since the ordinarily used FBS contains a large amount of exosomes.
[0123] After 72 hours of incubation, the BxC culture medium treated with the pretreatment material was collected and centrifuged at 300×g for 10 min to remove remaining cells and cell debris as a pellet. The supernatant was taken and filtered through a 0.22-μm filter, followed by centrifugation at 10,000×g and 4° C. for 70 min in a high-speed centrifuge. The supernatant thus formed was subjected to ultracentrifugation at 100,000×g and 4° C. for 90 min. Exosomes were obtained as a pellet, diluted in PBS (phosphate buffered saline), and used in subsequent experiments.
[0124] 2-2. Isolation of Exosomes (BxC-V37e) from iPSC-Derived MSC Progenitor Cell Treated with Lanifibranor
[0125] The iPSC-derived MSC progenitor cells (BxC) prepared in the Preparation Example were cultured for 24 hours in a culture medium [high glucose DMEM (Gibco, Cat no. 11995-065); 10% Fetal bovine Serum (HyClone), 1% MEM Non-Essential Amino Acids Solution (100×) (Gibco, Cat no. 11140-050)] containing 10 μM lanifibranor.
[0126] After completion of incubation, the lanifibranor-pretreated BxC was washed and additionally cultured for 72 hours in a medium supplemented with exosome-depleted 10% fetal bovine serum (FBS).
[0127] After 72 hours of incubation, the BxC culture medium treated with the pretreatment material was collected and centrifuged at 300×g for 10 min to remove remaining cells and cell debris as a pellet. The supernatant was taken and filtered through a 0.22-μm filter, followed by centrifugation at 10,000×g and 4° C. for 70 min in a high-speed centrifuge. The supernatant thus formed was subjected to ultracentrifugation at 100,000×g and 4° C. for 90 min. Exosomes were obtained as a pellet, diluted in PBS (phosphate buffered saline), and used in subsequent experiments.
Experimental Example 3: Characterization of Exosome Isolated from iPSC-Derived MSC Progenitor Cell Treated with Pretreatment Material
[0128] The exosomes isolated in Example 2 (BxC-G63e, BxC-V37e) were measured for size distribution by nanoparticle tracking assay (NanoSight NS300, Malvern) and morphologically identified using an electron microscope.
[0129] As shown in
EXPERIMENTAL EXAMPLE 4: Assay for Therapeutic Activity of Exosome (BxC-G63e) Isolated from iPSC-Derived MSC Progenitor Cell Treated with Exendin-4 for Kidney Disease
[0130] Exosomes isolated in Example 1 (BxC-e) and Example 2-1 (BxC-G63e) were assayed as follows.
[0131] 4-1. Inflammation-Inhibiting Effect
[0132] The epithelial cell line HK-2 (Korean Cell Line Bank) and the kidney epithelial cells RPTEC and GEC were each seeded at a density of 1×10.sup.5 cells/well into 6-well culture dishes. At 16 hours after cell seeding, the cells were checked for the state thereof and treated for 24 hours with 25 μM cisplatin or 20 μg/mL LPS and 100 μg of the exosomes (BxC-e) isolated in Example 1 or the exosomes (BxC-G63e) isolated in Example 2. As a positive control, a group in which kidney failure had been induced by treatment with cisplatin or LPS alone was used.
[0133] After 24 hours, the supernatant was discarded and the cells were washed with DPBS and treated with Trizol to isolate total RNA. From the RNA, cDNA was synthesized, followed by qRT-PCR assay for TNFα gene expression.
[0134] As can be seen in
[0135] 4-2. Apoptosis-Inhibiting Effect
[0136] The epithelial cell line HK-2 (Korean Cell Line Bank) and the kidney epithelial cells RPTEC and GEC were each seeded at a density of 1×10.sup.5 cells/well into 6-well culture dishes. At 16 hours after cell seeding, the cells were checked for the state thereof and treated for 24 hours with 25 μM cisplatin or 20 μg/mL LPS and 100 μg of the exosomes (BxC-e) isolated in Example 1 or the exosomes (BxC-G63e) isolated in Example 2. As a positive control, a group in which kidney failure had been induced by treatment with cisplatin or LPS alone was used.
[0137] After 24 hours, the supernatant was discarded and the cells were washed with DPBS and treated with Trizol to isolate total RNA. From the RNA, cDNA was synthesized, followed by qRT-PCR assay for caspase-3 gene expression.
[0138] As can be seen in
[0139] 4-3. ER Stress-Inhibiting Effect
[0140] The epithelial cell line HK-2 (Korean Cell Line Bank) and the kidney epithelial cells RPTEC and GEC were each seeded at a density of 1×10.sup.5 cells/well into 6-well culture dishes. At 16 hours after cell seeding, the cells were checked for the state thereof and treated for 24 hours with 25 μM cisplatin or 20 μg/mL LPS and 100 μg of the exosomes (BxC-e) isolated in Example 1 or the exosomes (BxC-G63e) isolated in Example 2. As a positive control, a group in which kidney failure had been induced by treatment with cisplatin or LPS alone was used.
[0141] After 24 hours, the supernatant was discarded and the cells were washed with DPBS and treated with Trizol to isolate total RNA. From the RNA, cDNA was synthesized, followed by qRT-PCR assay for CHOP gene expression.
[0142] As can be seen in
[0143] 4.4 Function of Treating and Recovering from Renal Damage
[0144] The exosomes (BxC-G63e) isolated from iPSC-derived MSC progenitor cells pretreated with exendin-4 were examined for the function to treat and recover from renal damage in a mouse renal damage model in which kidney failure had been induced by cisplatin.
[0145] Cisplatin (15 mg/kg) was injected intraperitoneally into Balb/c male mice 8 weeks old to induce renal damage. After injection of cisplatin, the exosomes (BxC-G63e) isolated from iPSC-derived MSC progenitor cells treated with exendin-4 were administered IV. Three days later, a blood sample was taken and measured for creatinine and BUN levels to determine the ability of BxC-G63e to treat and recover from renal damage.
TABLE-US-00001 TABLE 1 Normal control No treatment BxC-G63e BUN level (mg/dL) 21.2 316 157
TABLE-US-00002 TABLE 2 Normal control No treatment BxC-G63e Creatinine level (mg/dL) 0.1 1.5 0.9
[0146] As is understood therefrom, the data of
Experimental Example 5: Assay for Therapeutic Activity of Exosome (BxC-V37e) Isolated from iPSC-Derived MSC Progenitor Cell Treated with Lanifibranor for Kidney Disease
[0147] 5.1. Apoptosis-Inhibiting Effect
[0148] Kidney epithelial cells were seeded at a density of 1×10.sup.5 cells/well into 6-well culture dishes. At 16 hours after cell seeding, the cells were checked for the state thereof and treated for 24 hours with TGF-β (10 ng/mL), together with 100 μg of the exosomes (BxC-e) isolated in Example 1 or the exosomes (BxC-V37e) isolated from iPSC-derived MSC progenitor cells treated with lanifibranor, in a serum-free growth medium. As a positive control, a group in which kidney failure had been induced by treatment with cisplatin or TGF-β alone was used.
[0149] After 24 hours, the supernatant was discarded and the cells were washed with DPBS and treated with Trizol to isolate total RNA. From the RNA, cDNA was synthesized using the primers of Table 3, below, followed by qRT-PCR assay for caspase-3 gene expression.
TABLE-US-00003 TABLE 3 No. Name Sequence (5′.fwdarw.3′) Note 1 Human_Caspase- TCTGGTTTTCGGTGGGTGTG 3_Foward 2 Human_Caspase- CGCTTCCATGTATGATCTTTGGTT 3_Reverse
TABLE-US-00004 TABLE 4 TGFβ− TGFβ+ TGFβ + e TGFβ + V37e Casepase-3 1.2 5.2 1.1 0.9 mRNA (A.U.)
[0150] As can be seen in
[0151] 5.2. Fibrosis-Inhibiting Effect
[0152] 5.2.1. Inhibition Against Expression of Collagen I, CTGF, α-SMA, and Fibronectin
[0153] Kidney epithelial cells were seeded at a density of 1×10.sup.5 cells/well into 6-well culture dishes. At 16 hours after cell seeding, the cells were checked for the state thereof and treated for 24 hours with TGF-β (10 ng/mL), together with 100 μg of the exosomes (BxC-e) isolated in Example 1 or the exosomes (BxC-V37e) isolated from iPSC-derived MSC progenitor cells treated with lanifibranor, in a serum-free growth medium. As a positive control, a group in which kidney failure had been induced by treatment with TGF-β alone was used.
[0154] After 24 hours, the supernatant was discarded and the cells were washed with DPBS and treated with Trizol to isolate total RNA. From the RNA, cDNA was synthesized, followed by qRT-PCR assay for collagen I, CTGF, α-SMA, and fibronectin gene expression.
TABLE-US-00005 TABLE 5 No. Name Sequence (5′.fwdarw.3′) Note 3 Human_Collagen1_Foward CACAGAGGTTTCAGTGGTTT 4 Human_Collagen1_Reverse GCACCAGTAGCACCATCATT 5 Human_CTGF_Foward CAAGGGCCTCTTCTGTGACT 6 Human_CTGF_Reverse ACGTGCACTGGTACTTGCAG 7 Human_αSMA_Foward AGGTAACGAGTCAGAGCTTTGGC 8 Human_αSMA_Reverse CTCTCTGTCCACCTTCCAGCAG 9 Human_Fibronectin_Foward AAGATTGGAGAGAAGTGGGACC 10 Human_Fibronectin_Reverse GAGCAAATGGCACCGAGATA
TABLE-US-00006 TABLE 6 TGFβ− TGFβ+ TGFβ + e TGFβ + V37e Collagen I mRNA (A.U.) 1 98.2 63.8 4.2
TABLE-US-00007 TABLE 7 TGFβ− TGFβ+ TGFβ + e TGFβ + V37e CTGF mRNA (A.U.) 1.8 5.7 5.2 1.7
TABLE-US-00008 TABLE 8 TGFβ− TGFβ+ TGFβ + e TGFβ + V37e α-SMA mRNA (A.U.) 1.7 5.8 1.9 1.7
TABLE-US-00009 TABLE 9 TGFβ− TGFβ+ TGFβ + e TGFβ + V37e Fibronectin 1.4 13.6 6.7 1.2 mRNA (A.U.)
[0155] As can be seen in
[0156] 5.2.2. Inhibition of Nodule Formation
[0157] Kidney epithelial cells were seeded at a density of 1×10.sup.5 cells/well into 6-well culture dishes. Upon cell seeding, the cells were checked for the state thereof and treated for 24 hours with TGF-β (10 ng/mL), together with 100 μg of the exosomes (BxC-e) isolated in Example 1 or the exosomes (BxC-V37e) isolated from iPSC-derived MSC progenitor cells treated with lanifibranor in a serum-free growth medium. As a positive control, a group in which kidney failure had been induced by treatment with TGF-β alone was used. After 24 hours, the supernatant was discarded and the cells were washed with DPBS. After fixation with methanol for 5 min at 4° C., the cells were treated with a picrosirius red solution and washed twice with an acetic acid solution (0.5%). The formation of nodules was observed under a microscope. The Picrosirius Red dye was dissolved with 0.1 N KOH and absorbance at 540 nm was read and compared to the positive control.
TABLE-US-00010 TABLE 10 TGFβ− TGFβ+ TGFβ + e TGFβ + v37e Ratio to control 1 1.71 1.28 1.14
[0158] As can be seen in
[0159] 5.2.3. Prevention of Smad2 Phosphorylation
[0160] Kidney epithelial cells were seeded at a density of 1×10.sup.5 cells/well into 6-well culture dishes. At 16 hours after cell seeding, the cells were checked for the state thereof and treated for 24 hours with TGF-β (10 ng/mL), together with 100 μg of the exosomes (BxC-e) isolated in Example 1 or the exosomes (BxC-V37e) isolated from iPSC-derived MSC progenitor cells treated with lanifibranor, in a serum-free growth medium. As a positive control, a group in which kidney failure had been induced by treatment with TGF-β alone was used.
[0161] After 24 hours, the supernatant was discarded and the cells were washed with DPBS. The cells were harvested and subjected to protein extraction with an NP40 buffer. The proteins were analyzed for total Smad2 protein and phosphorylated protein levels by western blotting. Phosphorylated Smad2 proteins were quantitatively analyzed relative to individual total proteins and compared to a negative control treated without TGF-β.
[0162] As can be seen in
[0163] 5.2.4. Regulation of Epithelial-Mesenchymal Transition (EMT) Pathway
[0164] Kidney epithelial cells were seeded at a density of 1×10.sup.5 cells/well into 6-well culture dishes. At 16 hours after cell seeding, the cells were checked for the state thereof and treated for 24 hours with TGF-β (10 ng/mL), together with 100 μg of the exosomes (BxC-e) isolated in Example 1 or the exosomes (BxC-V37e) isolated from iPSC-derived MSC progenitor cells treated with lanifibranor, in a serum-free growth medium. As a positive control, a group in which kidney failure had been induced by treatment with TGF-β alone was used.
[0165] After 24 hours, the supernatant was discarded and the cells were washed with DPBS and treated with Trizol to isolate total RNA. Then, cDNA was synthesized from the RNA, using the primers of Table 11, followed by qRT-PCR assay for E-cadherin, N-cadherin, and vimentin gene expression.
TABLE-US-00011 TABLE 11 No. Name Sequence (5′.fwdarw.3′) Note 11 Human_E-cadherin_Foward GCTGGACCGAGAGAGTTTCC 12 Human_E-cadherin_Reverse CGACGTTAGCCTCGTTCTCA 13 Human_N-cadherin_Foward GACAATGCCCCTCAAGTGTT 14 Human_N-cadherin_Reverse CCATTAAGCCGAGTGATGGT 15 Human_Vimentin_Foward CTCCCTGAACCTGAGGGAAAC 16 Human_Vimentin_Reverse TTGCGCTCCTGAAAAACTGC
TABLE-US-00012 TABLE 12 TGFβ− TGFβ+ TGFβ + e TGFβ + v37e E-cadherin 1.39 0.74 0.79 0.9 mRNA (A.U.)
TABLE-US-00013 TABLE 13 TGFβ− TGFβ+ TGFβ + e TGFβ + v37e N-cadherin 1.30 21.2 18.07 1.63 mRNA (A.U.)
TABLE-US-00014 TABLE 14 TGFβ− TGFβ+ TGFβ + e TGFβ + v37e Vimentin mRNA (A.U.) 1.56 26.77 9.9 0.90
[0166] As can be seen in
[0167] 5.2.5. Inhibition of mRNA Expression of Snail1 and Slug
[0168] Kidney epithelial cells were seeded at a density of 1×10.sup.5 cells/well into 6-well culture dishes. At 16 hours after cell seeding, the cells were checked for the state thereof and treated for 24 hours with TGF-β (10 ng/mL), together with 100 μg of the exosomes (BxC-e) isolated in Example 1 or the exosomes (BxC-V37e) isolated from iPSC-derived MSC progenitor cells treated with lanifibranor, in a serum-free growth medium. As a positive control, a group in which kidney failure had been induced by treatment with TGF-β alone was used.
[0169] After 24 hours, the supernatant was discarded and the cells were washed with DPBS and treated with Trizol to isolate total RNA. Then, cDNA was synthesized from the RNA, using the primers of Table 15, followed by qRT-PCR assay for snail and slug gene expression.
TABLE-US-00015 TABLE 15 No. Name Sequence (5′.fwdarw.3′) Note 17 Human_Snail1_Foward CCTGTCTGCGTGGGTTTTTG 18 Human_Snail1_Reverse ACCTGGGGGTGGATTATTGC 19 Human_Slug_Foward ACTGGACACACATACAGTGATT 20 Human_Slug_Reverse ACTCACTCGCCCCAAAGATG
TABLE-US-00016 TABLE 16 TGFβ− TGFβ+ TGFβ + e TGFβ + v37e Snail1 mRNA (A.U.) 1.3 104.2 101.7 6.8
TABLE-US-00017 TABLE 17 TGFβ− TGFβ+ TGFβ + e TGFβ + v37e Slug mRNA (A.U.) 1.07 6.38 3.48 0.62
[0170] As can be seen in
[0171] 5.3 Function of Treating and Recovering from Renal Damage
[0172] The exosomes (BxC-V37e) isolated from iPSC-derived MSC progenitor cells pretreated with lanifibranor were examined for the function to treat and recover from renal damage in a mouse renal damage model in which kidney failure had been induced by cisplatin.
[0173] Cisplatin (15 mg/kg) was injected intraperitoneally into Balb/c male mice 8 weeks old to induce renal damage. After injection of cisplatin, the exosomes (BxC-V63e) isolated from iPSC-derived MSC progenitor cells treated with lanifibranor were administered IV. Three days later, a blood sample was taken and measured for creatinine and BUN levels to determine the ability of BxC-G63e to treat and recover from renal damage.
TABLE-US-00018 TABLE 18 Normal control No treatment BxC-V37e BUN level (mg/dL) 21.2 316 212
TABLE-US-00019 TABLE 19 Normal control No treatment BxC-V37e Creatinine level (mg/dL) 0.1 1.5 0.3
[0174] As is understood therefrom, the data of
[0175] Conclusion
[0176] Taken together, the data obtained above imply that BxC-e, BxC-G63e, and BxC-V37e according to the present disclosure have excellent prophylactic or therapeutic efficacy as they are inhibitory of inflammation and apoptosis of kidney failure-induced renal cells as well as endoplasmic reticulum stress.
INDUSTRIAL APPLICABILITY
[0177] The present disclosure is concerned with a composition comprising exosomes isolated from iPSC-derived MSC progenitor cells treated with or without a pretreatment material as an active ingredient for preventing or treating kidney disease.