RECOMBINANT MICROORGANISM FOR IMPROVED PRODUCTION OF FINE CHEMICALS

Abstract

The present invention relates to a recombinant nucleic acid molecule, a recombinant micro-organism, to a method for producing alanine and to the use of the recombinant nucleic acid molecule or the recombinant microorganism for the fermentative production of alanine.

Claims

1. A recombinant nucleic acid molecule having a sequence selected from the group of (I) a nucleic acid molecule comprising a sequence of SEQ ID NO: 56 or 57, (II) a nucleic acid molecule having at least 80% identity to a nucleic acid molecule of SEQ ID NO: 56 or 57, or (III) a nucleic acid molecule hybridizing to the complement of a nucleic acid molecule having SEQ ID NO: 56 or 57 under stringent conditions

2. (canceled)

3. (canceled)

4. (canceled)

5. (canceled)

6. (canceled)

7. (canceled)

8. (canceled)

9. A recombinant vector comprising at Ic\ast onc of the nucleic acid molecule of claim 1.

10. A recombinant microorganism comprising an introduced, increased, enhanced or altered activity and/or expression of a gcvA gene or a homolog or functional variant there.

11. (canceled)

12. (canceled)

13. The recombinant microorganism of claim 10, wherein the gcvA gene is selected from the group of (i) a nucleic acid molecule comprising a sequence of SEQ ID NO: 53, or (ii) a nucleic acid molecule having at least 80% identity to a nucleic acid molecule of SEQ ID NO: 53, or (iii) a nucleic acid molecule hybridizing to the complement of a nucleic acid molecule having SEQ ID NO: 53 under stringent conditions, or (iv) a nucleic acid molecule encoding a polypeptide of SEQ ID NO: 54, or (v) a nucleic acid molecule encoding a polypeptide having at least 60% homology to a polypeptide of SEQ ID NO: 54.

14. -34. (canceled)

35. The recombinant microorganism of claim 10, wherein the microorganism is selected from a genus of the group consisting of Corynebacterium, Bacillus, Erwinia, Escherichia, Pantoea, Streptomyces, Zymomonas and Rhodococcus.

36. A composition comprising one or more recombinant microorganisms according to claim 10.

37. The composition of claim 36 further comprising a medium and a carbon source.

38. A method for producing a recombinant microorganism with enhanced pyruvate, succinate, aspartate, malate, lactate, valine, leucine and/or alanine yield, which comprises the following steps: (I) introducing at least one of the nucleic acid molecules as defined in claim 1 into a microorganism; and (II) generating a recombinant microorganism with enhanced pyruvate, succinate, aspartate, malate, lactate, valine, leucine and/or alanine yield compared to a corresponding microorganism not comprising at least one of the nucleic acid molecules as defined in claim 1.

39. (canceled)

40. The method of claim 38, wherein the microorganism is selected from a genus of the group consisting of Corynebacterium, Bacillus, Erwinia, Escherichia, Pantoea, Streptomyces, Zymomonas and Rhodococcus.

41. A method of producing pyruvate, succinate, aspartate, malate, lactate, valine, leucine and/or alanine comprising culturing one or more recombinant microorganism according to any one of claim 10 under conditions that allow for the production of pyruvate, succinate, aspartate, malate, lactate, valine, leucine and/or alanine.

42. The method according to claim 41, wherein the microorganism is cultured in a medium comprising between 0.5% and 30% (w/v) of a sugar.

43. The method according to claim 41, wherein the yield of pyruvate, succinate, aspartate, malate, lactate, valine, leucine and/or alanine is at least 80%.

44. The method according to claim 41, wherein the chiral purity of L-alanine is at least 98%.

45. A method of culturing or growing a recombinant microorganism comprising inoculating a culture medium with the recombinant microorganism of claim 10 and culturing or growing said recombinant microorganism in said culture medium.

46. (canceled)

47. A process for fermentative production of pyruvate, succinate, aspartate, malate, lactate, valine, leucine and/or alanine comprising the steps of I) growing the microorganism of claim 10 in a fermenter and II) recovering pyruvate, succinate, aspartate, malate, lactate, valine, leucine and/or alanine from the fermentation broth obtained in I).

Description

[0395] FIG. 1

[0396] Clone validation after inactivation of the ackA-pta genes.

[0397] A: PCR amplicon obtained from genomic DNA of E. coli W ackA-pta::FRT with primers P395-ackA-pta-check2 and P395-ackA-pta-check5 (338 bp). M: DNA size marker. B: Sequencing of the PCR amplicon with P395-ackA-pta-check2 and P395-ackA-pta-check5 confirmed basepair-precise modification of the ackA-pta locus (nucleotide sequence: SEQ ID NO. 118, protein sequence: SEQ ID NO: 119). Nucleotides that were confirmed by sequencing are shown in italics. The remaining FRT site is shown in green, flanking primer binding sites are shown in red. upper case: coding sequence. lower case: intergenic regions.

[0398] FIG. 2

[0399] Clone validation after inactivation of the adhE gene.

[0400] A: PCR amplicon obtained from genomic DNA of E. coli W ackA-pta::FRT adhE::FRT with primers P395-adhE-check2 and P395-adhE-check5 (569 bp). M: DNA size marker. B: Sequencing of the PCR amplicon with P395-adhE-check2 and P395-adhE-check5 confirmed basepair-precise modification of the adhE locus (nucleotide sequence: SEQ ID NO: 120, protein sequence: SEQ ID NO: 121). Nucleotides that were confirmed by sequencing are shown in italics. The remaining FRT site is shown in green, flanking primer binding sites are shown in red. upper case: coding sequence. lower case: intergenic regions.

[0401] FIG. 3

[0402] Clone validation after inactivation of the frdABCD genes.

[0403] A: PCR amplicon obtained from genomic DNA of E. coli W ackA-pta::FRT adhE::FRT frdABCD::FRT with primers P395-frd-checkl and P395-frd-check4 (797 bp). M: DNA size marker. B: Sequencing of the PCR amplicon with P395-frd-checkl and P395-frd-check4 confirmed basepair-precise modification of the frd locus (nucleotide sequence: SEQ ID NO: 122, protein sequence: SEQ ID NO: 123). Nucleotides that were confirmed by sequencing are shown in italics. The remaining FRT site is shown in green, flanking primer binding sites are shown in red. upper case: coding sequence. lower case: intergenic regions.

[0404] FIG. 4

[0405] Clone validation after inactivation of the pflB gene.

[0406] A: PCR amplicon obtained from genomic DNA of E. coli W ackA-pta::FRT adhE::FRT frdABCD::FRT ApfIB::FRT with primers P395-pflB-checkl and P395-pflB-check3 (511 bp). M: DNA size marker. B: Sequencing of the PCR amplicon with P395-pflB-checkl and P395-pflB-check3 confirmed basepair-precise modification of the pflB locus (nucleotide sequence: SEQ ID NO: 124, protein sequence: SEQ ID NO:125). Nucleotides that were confirmed by sequencing are shown in italics. The remaining FRT site is shown in green, flanking primer binding sites are shown in red. upper case: coding sequence. lower case: intergenic regions.

[0407] FIG. 5

[0408] Clone validation after integration of the alaD-gstear gene.

[0409] A: PCR amplicon obtained from genomic DNA of E. coli W ackA-pta::FRT adhE::FRT frdABCD::FRT pfIB::FRT AldhA::alaD-gstear with primers P395-IdhA-check1 and P395-IdhA-check2 (1833 bp). M: DNA size marker. B: Sequencing of the PCR amplicon with P395-IdhA-check1 and P395-IdhA-check2 confirmed basepair-precise modification of the

[0410] IdhA locus and integration of alaD-gstear (nucleotide sequence: SEQ ID NO: 126, protein sequence: SEQ ID NO: 16). Nucleotides that were confirmed by sequencing are shown in italics. The alaD-gstear ORF is shown in cyan, the remaining FRT site is shown in green, flanking primer binding sites are shown in red. upper case: coding sequence. lower case: intergenic regions.

[0411] FIG. 6

[0412] Metabolic Map of Alanine Synthesis in the Microorganism of the Invention

[0413] Red stars depict knockouts of enzyme activity

[0414] Green arrow depict introduced enzyme activity

[0415] J7 represents ldhlactate dehydrogenase, KO reduces the production of lactate.

[0416] J6 represents frdABCDfumarate reductase, KO reduces the production of succinate.

[0417] J8 represents pflpyruvate formate lyase, KO reduces the production of acetate and ethanol.

[0418] J10 represents ack-ptaphosphotransacetylase-acetate kinase, KO reduces the production of acetate.

[0419] J11 represents adhE-alcohol dehydrogenase, KO reduces the production of ethanol.

[0420] FIG. 7

[0421] Batch fermentation of E. coli QZ20 and E. coli QZ48 (ArgP A96E) in 500 mL AM 1 medium with 140 g/L glucose. The fermentation was controlled at 37 C, 400 rpm, at pH 6.8 with 5 N NH4OH without aeration. Formation of alanine correlated from alanine concentrations of samples and NH4OH consumption rate is shown.

[0422] FIG. 8

[0423] The volumetric alanine productivity (space-time-yield), defined as the amount of product generated divided by reactor volume and by time, of E. coli QZ20 and QZ48 (ArgP A96E) after 46 h of batch-fermentation in 500 mL AM 1 medium with 140 g/L glucose as carbon source.

[0424] FIG. 9

[0425] Batch fermentation of E. coli QZ20/pACYC184 plasmid control and and E. coli QZ20/pACYC184-argP in 500 mL AM 1 medium with 140 g/L glucose. The fermentation was controlled at 37 C, 400 rpm, at pH 6.8 with 5 N NH4OH without aeration. Formation of alanine correlated from alanine concentrations of samples and NH4OH consumption rate is shown.

[0426] FIG. 10

[0427] The volumetric alanine productivity (space-time-yield), defined as the amount of product generated divided by reactor volume and by time, of E. coli QZ20/pACYC184 plasmid control and and E. coli QZ20/pACYC184-argP after 20h of batch-fermentation in 500 mL AM 1 medium with 140 g/L glucose as carbon source.

[0428] FIG. 11

[0429] Batch fermentation of E. coli QZ20 and E. coli QZ58 (gcvA/B promoter SNP) in 500 mL AM 1 medium with 140 g/L glucose. The fermentation was controlled at 37 C, 400 rpm, at pH 6.8 with 5 N NH4OH without aeration. Formation of alanine correlated from alanine concentrations of samples and NH4OH consumption rate is shown.

[0430] FIG. 12

[0431] The volumetric alanine productivity (space-time-yield), defined as the amount of product generated divided by reactor volume and by time, of E. coli QZ20 and QZ58 (gcvA/B promoter SNP) after 46h of batch-fermentation in 500 mL AM 1 medium with 140 g/L glucose as carbon source.

[0432] FIG. 13

[0433] Batch fermentation of E. coli QZ48 (ArgP A96E) and E. coli QZ66 (Arg A96E, gcvA/B promoter SNP) in 500 mL AM 1 medium with 140 g/L glucose. The fermentation was controlled at 37 C, 400 rpm, at pH 6.8 with 5 N NH4OH without aeration. Formation of alanine correlated from alanine concentrations of samples and NH4OH consumption rate is shown.

[0434] FIG. 14

[0435] The volumetric alanine productivity (space-time-yield), defined as the amount of product generated divided by reactor volume and by time, of E. coli QZ48 (ArgP A96E) and E. coli QZ66 (ArgP A96E, gcvA/B promoter SNP) after 46h of batch-fermentation in 500 mL AM 1 medium with 140 g/L glucose as carbon source.

[0436] FIG. 15

[0437] Relative gene transcription analysis of (A) gcvA and (B) gcvB in E. coli QZ20 and QZ23 at 8h, 11h and 28h during batch-fermentation relative to E. coli QZ20 8h. All qPCR-derived data were normalized versus the rrsA gene as reference.

[0438] FIG. 16

[0439] Batch fermentation of E. coli QZ20/pACYC184 plasmid control, E. coli QZ20/pACYC184-gcvA and E. coli QZ20/pACYC184-gcvB in 500 mL AM 1 medium with 140 g/L glucose. The fermentation was controlled at 37 C, 400 rpm, at pH 6.8 with 5 N NH4OH without aeration. Formation of alanine correlated from alanine concentrations of samples and NH4OH consumption rate.

[0440] FIG. 17

[0441] The volumetric alanine productivity (space-time-yield), defined as the amount of product generated divided by reactor volume and by time, of E. coli QZ20 with plasmid control pACYC184, pACYC184-gcvA and pACYC184-gcvB after 46h of batch-fermentation in 500 mL AM 1 medium with 140 g/L glucose as carbon source.

[0442] FIG. 18

[0443] Batch fermentation of E. coli QZ20 and E. coli QZ71 (gcvB knock-out) in 500 mL AM 1 medium with 140 g/L glucose. The fermentation was controlled at 37 C, 400 rpm, at pH 6.8 with 5 N NH4OH without aeration. Formation of alanine correlated from alanine concentrations of samples and NH4OH consumption rate is shown.

[0444] FIG. 19

[0445] The volumetric alanine productivity (space-time-yield), defined as the amount of product generated divided by reactor volume and by time, of E. coli QZ20 and E. coli QZ71 (gcvB knock-out) after 46h of batch-fermentation in 500 mL AM 1 medium with 140 g/L glucose as carbon source.

[0446] FIG. 20

[0447] Batch fermentation of E. coli QZ20, E. coli QZ57 (brnQ667-764) and E. coli QZ69 (brnQ KO) in 500 mL AM 1 medium with 140 g/L glucose. The fermentation was controlled at 37 C, 400 rpm, at pH 6.8 with 5 N NH4OH without aeration. Formation of alanine correlated from alanine concentrations of samples and NH4OH consumption rate is shown.

[0448] FIG. 21

[0449] The volumetric alanine productivity (space-time-yield), defined as the amount of product generated divided by reactor volume and by time, of E. coli QZ20, E. coli QZ57 (brnQ667-764) and E. coli QZ69 (brnQ KO) after 46h of batch-fermentation in 500 mL AM 1 medium with 140 g/L glucose as carbon source.

[0450] FIG. 22

[0451] Batch fermentation of E. coli QZ20 and E. coli QZ56 (LpxD A15T) in 500 mL AM 1 medium with 140 g/L glucose. The fermentation was controlled at 37 C, 400 rpm, at pH 6.8 with 5 N NH4OH without aeration. Formation of alanine correlated from alanine concentrations of samples and NH4OH consumption rate is shown.

[0452] FIG. 23

[0453] The volumetric alanine productivity (space-time-yield), defined as the amount of product generated divided by reactor volume and by time, of E. coli QZ20 and QZ56 (LpxD A15T) after 46 h of batch-fermentation in 500 mL AM 1 medium with 140 g/L glucose as carbon source.

[0454] FIG. 24

[0455] Batch fermentation of E. coli QZ68 (argP A96E, gcvA/B promoter SNP, brna8,667-764) and E. coli QZ70 (argP A96E, gcvA/B promoter SNP, brnQ667-764, IpxD A15T) in 500 mL AM 1 medium with 140 g/L glucose. The fermentation was controlled at 37 C, 400 rpm, at pH 6.8 with 5 N NH4OH without aeration. Formation of alanine correlated from alanine concentrations of samples and NH4OH consumption rate is shown.

[0456] FIG. 25

[0457] The volumetric alanine productivity (space-time-yield), defined as the amount of product generated divided by reactor volume and by time, of E. coli QZ68 (argP A96E, gcvA/B promoter SNP, brnQ667-764) and E. coli QZ70 (argP A96E, gcvA/B promoter SNP, brnQ667-764, IpxD A15T) after 46 h of batch-fermentation in 500 mL AM 1 medium with 140 g/L glucose as carbon source.

EXAMPLES

[0458] Chemicals and Common Methods

[0459] Unless indicated otherwise, cloning procedures carried out for the purposes of the present invention including restriction digest, agarose gel electrophoresis, purification of nucleic acids, ligation of nucleic acids, transformation, selection and cultivation of bacterial cells are performed as described (Sambrook et al., 1989). Sequence analyses of recombinant DNA are performed with a laser fluorescence DNA sequencer (Applied Biosystems, Foster City, Calif., USA) using the Sanger technology (Sanger et al., 1977). Unless described otherwise, chemicals and reagents are obtained from Sigma Aldrich (Sigma Aldrich, St. Louis, USA), from Promega (Madison, Wis., USA), Duchefa (Haarlem, The Netherlands) or Invitrogen (Carlsbad, Calif., USA). Restriction endonucleases are from New England Biolabs (Ipswich, Mass., USA) or Roche Diagnostics GmbH (Penzberg, Germany). Oligonucleotides are synthesized by Eurofins MWG Operon (Ebersberg, Germany).

Example 1:

[0460] E. coli W (LU17032) was engineered for L-alanine production by inactivation of the ackA-pta, adhE, frdABCD and pflB ORFs and replacement of the IdhA ORF by a codon-optimized variant of the alaD gene (alaD-gstear).

[0461] The ackA-pta, adhE, frdABCD and pflB ORFs were inactivated by insertion of an FRT-flanked kanamycin resistance cassette, followed by removal of the antibiotic resistance cassette by FLP recombination.

[0462] The IdhA gene was replaced by alaD-gstear and a downstream FRT-flanked zeocin resistance cassette, which was finally removed by FLP recombination.

[0463] Materials and Methods

[0464] Bacterial Culture

[0465] E. coli W (LU17032) was cultured in Luria-Bertani (LB) liquid medium or on Luria-Bertani solid medium. Occasionally, clones were passaged over M9 minimal agar containing 10 mM Sucrose to confirm W strain identity. Antibiotics were added to the liquid and solid media as appropriate, to final concentrations of 15 g/ml (kanamycin, chloramphenicol), 25 g/ml (zeocin) or 3 g/ml (tetracyclin).

[0466] Red/ET Recombination

[0467] Red/ET recombination was performed using standard protocols of Gene Bridges GmbH (www.genebridges.com). Briefly, Red/ET-proficient E. coli W was aerobically grown at 30 C. to an OD600nm of -0.3. Expression of red genes was induced by adding 50 l of 10% (w/v) L-arabinose, followed by a temperature increase to 37 C. Arabinose was omitted from uninduced control cultures. After 35 min of incubation at 37 C. the cells were washed twice with ice cold 10% (v/v) glycerol and electroporated with 500 ng of PCR product at 1.35 kV, 10 F, 6000. The cells were then resuspended in 1 ml ice-cold LB medium and aerobically grown at 37 C. for approximately 1.5 h. Cultures were then plated on LB agar containing 15 g/ml kanamycin (knockouts) or 25 g/ml zeocin (knockin).

[0468] FLP Recombination

[0469] Flanking FRT sites allowed removal of antibiotic resistance markers by FLP recombination following modification of the E. coli chromosome. FLP recombination leaves a single FRT site (34 bp) as well as short flanking sequences (approx. 20 bp each) which are used as primer binding sites in the amplification of the cassettes.

[0470] To perform FLP recombination, plasmid 708-FLPe (Tab. 1) encoding FLP recombinase was introduced into the Red/ET recombinants by electroporation. KanR CmR or ZeoR CmR transformants were used to inoculate 0.2 ml LB cultures, which were incubated at 30 C. for 3 h. FLP activity was then induced by a temperature shift to 37 C., followed by a three-hour incubation at 37 C. Single colonies obtained from these cultures were subsequently screened for a CmS and KanS or ZeoS phenotype.

[0471] DNA Preparation and Analysis

[0472] E. coli genomic DNA (gDNA) was isolated from overnight cultures with the Gentra Puregene Yeast/Bact. Kit B (Qiagen, Hilden, Germany). PCR products harbouring knockout or knockin cassettes were amplified from template plasmids with PRECISOR high-fidelity DNA polymerase (BioCat, Heidelberg) and analytical PCR reactions were performed with the PCR Extender System (SPRIME GmbH, Hamburg, Germany), according to the manufacturer's recommendations. PCR amplicons were purified using the GeneJET PCR Purification Kit or the GeneJET Gel Extraction Kit (Fermentas, St. Leon-Rot, Germany) and sequencing was performed by GATC BioTech (Konstanz, Germany) or BioSpring (Frankfurt am Main, Germany).

TABLE-US-00002 TABLE1 Plasmidsandprimers Relevantcharacteristics/ plasmids oligosequences(5.fwdarw.3) Source pRed/ET redexpressionplasmid, Gene pSC101-based,Tc.sup.R Bridges 708-FLPe FLPrecombinaseexpression Gene plasmid, Bridges pSC101-based,Cm.sup.R pQZ11 pUC57-basedplasmidwith Genescript chloramphenicol acetyltransferase(cat)- levansucrase (sacB)cassette,ampR pACYC184 E.colicloningvector, NEB p15AorCm.sup.R,TC.sup.R primers(BioSpring) Sequence SEQIDNO P395-ackA-pta-check1 5-ACTGCGGTAGTTCTTCACTG-3 SEQIDNO:17 P395-ackA-pta-check2 5-AGTACCTTTCTGGTTTAGCCG-3 SEQIDNO:18 P395-ackA-pta-check3 5-GATAGCAGAAACGGAACCAC-3 SEQIDNO:19 P395-ackA-pta-check4 5-GGTGCTGTTCACACTACCGC-3 SEQIDNO:20 P395-ackA-pta-check5 5-TGACGAGATTACTGCTGCTG-3 SEQIDNO:21 P395-ackA-pta-check6 5-ATTTCCGGTTCAGATATCCGC-3 SEQIDNO:22 P395-adhE-check1 5-GGGTTGACCAGCGCAAATAAC-3 SEQIDNO:23 P395-adhE-check2 5-CAGAAGTGAGTAATCTTGCTTAC-3 SEQIDNO:24 P395-adhE-check3 5-GATCACTTTATCTTCGACGATAC-3 SEQIDNO:25 P395-adhE-check4 5-GCGAACGTGGATAAACTGTCTG-3 SEQIDNO:26 P395-adhE-check5 5-GCTCTTAAGCACCGACGTTGAC-3 SEQIDNO:27 P395-adhE-check6 5-GTCGGCTCATTAACGGCTATTC-3 SEQIDNO:28 P395-frd-check1 5-GACGGATCTCCGCCATAATC-3 SEQIDNO:29 P395-frd-check2 5-TCGCCACCCGCTACTGTATC-3 SEQIDNO:30 P395-frd-check3 5-CAAAGCGTTCTGACGAACCGG-3 SEQIDNO:31 P395-frd-check4 5-TGTGCGATGCACAATATCGTTG-3 SEQIDNO:32 P395-pflB-check1 5-TTGGTTGGGTTGACATACTGG-3 SEQIDNO:33 P395-pflB-check2 5-TGAACTTCATCACTGATAACC-3 SEQIDNO:34 P395-pflB-check3 5-TTCAAAGGAGTGAATGCGACC-3 SEQIDNO:35 P395-pflB-check4 5-GTCGCGGTTATGACAATACAGG-3 SEQIDNO:36 P395-ldhA-check1 5-TACCGTGCCGACGTTCAATAAC-3 SEQIDNO:37 P395-ldhA-check2 5-CATCAGCAGGCTTAGCGCAAC-3 SEQIDNO:38 P395-ldhA-check3 5-ACCTTTACGCGTAATGCGTG-3 SEQIDNO:39 P395-ldhA-check4 5-ACCGTTTACGCTTTCCAGCAC-3 SEQIDNO:40 P395-csc-check1 5-CGAATTATCGATCTCGCTCAAC-3 SEQIDNO:41 P395-csc-check2 5-CGTCTATATTGCTGAAGGTACAG-3 SEQIDNO:42 P395-csc-check3 5-TCGAAGGTCCATTCACGCAAC-3 SEQIDNO:43 P395-csc-check4 5-GATTCCCACCGCAACGTTAG-3 SEQIDNO:44 PargP_1_F 5-ttgctggaagaagagtggctgggcgatgaaca SEQIDNO:62 aaccggttcgactccgctgatatcggaagccct gggccaac-3 PargP_1_R 5tcagccaacacaggagccagtgcaggaagca SEQIDNO:63 accacgtcgccagactgtccacctgagacaacttg ttacagctc-3 PargP_2_F 5-actggatgcggtgatacgtgaacg-3 SEQIDNO:64 PargP_2_R 5-accactggcgctttcagtaatgcc-3 SEQIDNO:65 PargP_seq_F 5-ttaccaggagcagacaacagc-3 SEQIDNO:66 PargP_seq_R 5-ggcagatcgaagttttgctgc-3 SEQIDNO:67 PargP-pACYC_F 5-tatcatcgataagcttatgttacccgccgacgg SEQIDNO:68 cttcg-3 PargP-pACYC_R 5-aagggcatcggtcgacgtgaggataacgcctg SEQIDNO:69 atatgtgc-3 PgcvA_1_F 5-taataggttacacagtgtgatctaattgttaaa SEQIDNO:70 ttcatttaacatcaaaggatatcggaagccctg ggccaac-3 PgcvA_1_R 5-aaactcgtaaggcatttagcggtggtaatcg SEQIDNO:71 tttagacatggcttttaaacacctgagacaa cttgttacagctc-3 PgcvA_2_F 5-cgcagaccaattgcaaacac-3 SEQIDNO:72 PgcvA_2_R 5-ctcgcgcagcagaagagctt-3 SEQIDNO:73 PgcvA_seq_F 5-agcagatcaaccgtactgac-3 SEQIDNO:74 PgcvA_seq_R 5-agtttacgcgtcgcttcggt-3 SEQIDNO:75 PgcvA-pACYC_F 5-tatcatcgataagcttaagtgccgccactata SEQIDNO:76 ggtatttgc-3 PgcvA-pACYC_R 5-aagggcatcggtcgactggtcatggtcgtac SEQIDNO:77 cctacg-3 PgcvB_1_F 5-tgacgtgaaagagatggtcgaactggat SEQIDNO:78 cagtaattcgcgatcgcaaggtgatatc ggaagccctgggccaac-3 PgcvB_1_R 5-attataaattgtccgttgagcttctaccagc SEQIDNO:79 aaatacctatagtggcggccacctgag acaacttgttacagctc-3 PgcvB_seq_F 5-gccgcaattatttctgcctgtatgc-3 SEQIDNO:80 PgcvB_seq_R 5-cacaaaaagctcttctgctgcgcg-3 SEQIDNO:81 PgcvB-pACYC_F 5-tatcatcgataagcttggtcgaactggatc SEQIDNO:82 agtaattcgc-3 PgcvB-pACYC_R 5-aagggcatcggtcgaccggtggtaatcg SEQIDNO:83 tttagacatggc-3 PbrnQ_1_F 5-tatcgttattgttaacgcggcgcgttctcgt SEQIDNO:84 ggcgttaccgaagcgcgtcgatatcgg aagccctgggccaac-3 PbrnQ_1_R 5-gaacgtaagcatgcagaatagcagcg SEQIDNO:85 ccgtttgcagactgatcgaccagccac ctgagacaacttgttacagctc-3 PbrnQ_2_F 5-ggataccgtgggcaacttccttgc-3 SEQIDNO:86 PbrnQ_2_R 5-gttagaaaccaccatcgagaagccg-3 SEQIDNO:87 PbrnQ_seq_F 5-cgctgtttatctacagcctgg-3 SEQIDNO:88 PbrnQ_seq_R 5-ggataaatagcggtcagcacc-3 SEQIDNO:89 PlpxD_1C_F 5-catcggtaaaacctggtaagtgttctcca SEQIDNO:90 caaaggaatgtagtggtagtgtagcga tatcggaagccctgggccaac-3 PlpxD_1C_R 5-ggtgcagttctttgcgtggcccggcgatc SEQIDNO:91 ttatattgatcgcctaaagtcatccacctg agacaacttgttacagctc-3 PlpxD_fix_F 5-cgatcaacgaatataactcgctgcg-3 SEQIDNO:92 PlpxD_fix_R 5-ataataacacggcctgccgcaatcg-3 SEQIDNO:93 PlpxD_flank_F 5-atgctgtaggcggtaacgccat-3 SEQIDNO:94 PlpxD_flank_R 5-atacgttgttacccagcttcgc-3 SEQIDNO:95 PlpxD-pACYC_F 5-tatcatcgataagcttaaatccgttgcca SEQIDNO:96 acagccagg-3 PlpxD-pACYC_R 5-aagggcatcggtcgacaacacggcctg SEQIDNO:97 ccgcaatcg-3 PargP_RT_F 5-gcccggactacagaacattacagg-3 SEQIDNO:99 PargP_RT_R 5-tgagacggctgattgtgtaatgc-3 SEQIDNO:100 PgcvA_RT_F 5-ccatttaagtttcactcgcgcagc-3 SEQIDNO:101 PgcvA_RT_R 5-ggcggcggaacagttttagc-3 SEQIDNO:102 PgcvB_RT_F 5-taggcggtgctacattaatcactatgg-3 SEQIDNO:103 PgcvB_RT_R 5-tgttgtgtttgcaattggtctgc-3 SEQIDNO:104 PlpxD_RT_F 5-gatatcgtcatcaccggcgttgc-3 SEQIDNO:105 PlpxD_RT_R 5-gcacaagcctaaatgctcacgg-3 SEQIDNO:106 PrrsA_RT_F 5-ctcttgccatcggatgtgcccag-3 SEQIDNO:107 PrrsA_RT_R 5-ccagtgtggctggtcatcctctca-3 SEQIDNO:108

[0473] 1.1. ackA-pta locusTargeting of ackA-pta

[0474] Approximately 500 ng of the ackA-pta PCR construct (1737 bp) were electroporated into Red/ET-proficient E. coli W cells. Eight KanR transformants were analysed for correct integration of the resistance marker cassette by PCR with genome-specific primers. Three clones were subjected to FLP recombination, which was performed as described in Material and Methods (data not shown).

[0475] Clone validation. Inactivation of the ackA-pta locus and removal of the kanamycin resistance cassette were confirmed by PCR across the remaining FRT scar. One clone that yielded the correct PCR signal was also confirmed by sequencing (FIG. 1).

[0476] 1.2 adhE locusTargeting of adhE

[0477] Approximately 500 ng of the adhE PCR construct (1093 bp) were electroporated into Red/ET-proficient E. coli W cells harbouring the ackA-pta::FRT modification. Eight KanR transformants were analysed for correct integration of the resistance marker cassette by PCR with genome-specific primers. Two clones were subjected to FLP recombination, which was performed as described in Material and Methods (data not shown). Clone validation. Inactivation of the adhE locus and removal of the kanamycin resistance cassette were confirmed by PCR across the remaining FRT scar. One clone that yielded the correct PCR signal was also confirmed by sequencing (FIG. 2).

[0478] 1.3 frd locusTargeting of frdABCD

[0479] Approximately 500 ng of the frdABCD PCR construct (1093 bp) were electroporated into Red/ET-proficient E. coli W cells harbouring the ackA-pta::FRT and adhE::FRT modifications. Eight KanR transformants were analysed for correct integration of the resistance marker cassette by PCR with genome-specific primers. One clone was subjected to FLP recombination, which was performed as described in material and Methods (data not shown).

[0480] Clone validation. Inactivation of the frd locus and removal of the kanamycin resistance cassette were confirmed by PCR across the remaining FRT scar. One clone that yielded the correct PCR signal was also confirmed by sequencing (FIG. 3).

[0481] 1.4 pflB locusTargeting of pflB

[0482] Approximately 500 ng of the pflB PCR construct (1093 bp) were electroporated into Red/ET-proficient E. coli W cells harbouring the ackA-pta::FRT, adhE::FRT and frdABCD::FRT modifications. Eight KanR transformants were analysed for correct integration of the resistance marker cassette by PCR with genome-specific primers. Four clones were subjected to FLP recombination, which was performed as described in Material and Methods (data not shown).

[0483] Clone validation. Inactivation of the pflB locus and removal of the kanamycin resistance cassette were confirmed by PCR across the remaining FRT scar. One clone that yielded the correct PCR signal was also confirmed by sequencing (FIG. 4).

[0484] 1.5 IdhA locusKnockin of alaD-gstear

[0485] Approximately 500 ng of the ldhA::alaD-gstear PCR construct (1783 bp) were electroporated into Red/ET-proficient E. coli W cells harbouring the ackA-pta::FRT, adhE::FRT, frdABCD::FRT and pfIB::FRT modifications. Four ZeoR transformants were analysed for correct integration of the resistance marker cassette by PCR with genome-specific primers. One clone was subjected to FLP recombination, which was performed as described in material and Methods (data not shown).

[0486] Clone validation. Integration of alaD-gstear and removal of the zeocin resistance cassette were confirmed by PCR across the remaining FRT scar. One clone that yielded the correct PCR signal was also confirmed by sequencing (FIG. 5).

Example 2

HPLC Detection and Quantification of alanine

[0487] The following HPLC method for the alanine detection in the cell culture media was used:

[0488] Column: Aminex HPX-87C column (Bio-Rad), 3007.8 mm, i.d. particle size 9 m

[0489] Mobile phase: Ca(NO3)2 at 0.1mol/L 90%, Acetonitrile 10%

[0490] Flow rate : 0.6 mL/min

[0491] Column temperature: 60 C.

[0492] Detection: Refractive index detector

[0493] Under above method, major estimated components in the cell culture sample matrix can be well separated from alanine, without interfering alanine's quantitation.

[0494] The amount of the alanine in the sample was determined by external standard calibration method. Standard samples containing alanine from 0.5 to 10.0 g/L were injected and the peak areas were used for calibration. Linear regression coefficient of the calibration curve was 0.9995.

[0495] Samples are injected once at 20 L. Peak areas are used to calculate the amount presenting in the sample by Waters LC Millenium software.

Example 3

HPLC detection and Quantification of of glucose, succinate, lactate, formate, acetate and ethanol

[0496] HPLC method used

[0497] Column: Aminex HPX-87H column (Bio-Rad), 3007.8 mm, i.d. particle size 9 m

[0498] Mobile phase: H.sub.2SO.sub.4 4 mM

[0499] Flow rate : 0.4 mL/min

[0500] Column temperature: 45 C.

[0501] Detection: Refractive index detector

[0502] The amount of the analytes was determined by external standard calibration method. Standard samples containing glucose from 0.1 to 38.0 g/L, succinate, lactate, formate, acetate and ethanol from 0.05 to 10.0 g/L were injected and the peak areas were used for calibration. Linear regression coefficients for all six calibration curves were better than 0.999.

[0503] Samples are injected once at 20 L. Peak areas are used to calculate the amount presenting in the sample by Waters LC Millenium software.

Example 4

Metabolic Evolution of the E. coli W stem Derived from Example 1 for Improved Alanine Yield

[0504] The E. coli stem comprising all mutations as described in Example 1, named E. coli Ex1 or QZ16, was used for a metabolic evolution procedure in order to improve the alanine yield of the E. coli Ex1 stem.

[0505] The metabolic evolution was performed as follows: In a first and second evolution round continuous evolution was performed for 500 hours and 750 hours respectively in NBS medium 5% glucose.

[0506] NBS medium:

[0507] 3.5 g KH2PO4

[0508] 5.0 g K2HPO4

[0509] 3.5 g (NH.sub.4)2HPO.sub.4

[0510] 0.25 g MgSO4-7H2O

[0511] 15 mg CaCL2-2H2O

[0512] 0.5 mg Thiamine

[0513] 1ml trace metal stock

[0514] The trace metal stock was prepared in 0.1 M HCL, 1.6 g FeCL.sub.3-6H.sub.2O; 0.2 g CoCl.sub.2-6H.sub.2O; 0.1 g CuCl.sub.2-2H.sub.2O; 0.2 g ZnCl.sub.2; 0.2 g NaMoO.sub.4-2H.sub.2O; 0.05 g H.sub.3BO.sub.3.

[0515] Cells were streaked on LB plates and tested for alanine yield. The best E. coli stem (E. coli Ev1 or QZ17) resulted in fermentation with NBS medium comprising 5% glucose for 24 and 48 h at 37 C. in alanine yield between 84%-86% compared to the alanine yield of the starting stem E. coli Ex1 resulting in 80%-83%.

[0516] E. coli Ev1 was used for further evolution steps which were performed as batch evolution for 20 days. 5% of the cells were reinoculated in fresh medium every 24 h, 48 h, 72 h and so forth in AM1 medium comprising 14% glucose at 37 C. AM1 medium:

[0517] 19.92 mm (NH4)2HPO4=2.6 g/L MW: 132.07

[0518] 7.56 mm NH4H2PO4=0.87g/L MW : 115

[0519] 2.0 mm KCI=0.15g/L MW: 74.55

[0520] 1.5 mm MgSO4-7H20=0.37g/L MW: 246.5

[0521] 15 g/L Ammonium sulfate was added in the last step

[0522] 1 mm betain

[0523] 1 ml Trace metal stock

[0524] To make 1 L trace metal stock:

[0525] The trace metal stock was prepared in 0.12 M HCL, 2.4 g FeCL.sub.3-6H.sub.2O; 0.3 g CoCl.sub.2-6H.sub.2O; 0.21 g CuCl.sub.2-2H.sub.2O; 0.3 g ZnCl.sub.2; 0.27 g NaMoO4-2H.sub.2O; 0.068 g H.sub.3BO.sub.3; 0.5 g MnCl.sub.2-4H.sub.2O

[0526] From this evolution the stem E. coli Ev2, also named QZ18 was isolated. This stem was tested in fermentation which was performed in a fermenter with AM1 medium 14% glucose. The stem E. coli Ev2 had an alanine yield between 92%-94% compared to an alanine yield of E. coli Ev1 of 91%-92% under same conditions.

[0527] After further batch evolution steps for 300 h in AM1 medium comprising 12% glucose and subsequent 10 batch evolution steps in the AM1 comprising 12% glucose, the stem E. coli Ev3, also named QZ20 was isolated.

[0528] Testing for alanine yield revealed that the stem E. coli Ev3 had an alanine yield between 94%-96% in AM1 medium comprising 12% glucose compared to an alanine yield of E. coli Ev2 of 92%-93% under same conditions.

[0529] Further sequential batch evolution as described before for a period of 1000 h in AM1 medium with 14% glucose was performed with E. coli Ev3 and stem E. coli Ev4, also named QZ23, was isolated. E. coli Ev4 was tested in comparison with E. coli Ev3 in AM1 medium with 14% glucose. The stem E. coli Ev4 showed an increased alanine productivity (space-time-yield), defined as the amount of product generated divided by reactor volume and by time, of 2.0-2.4 g/(Lh) compared to 1.0-1.3 g(/Lh) of stem E. coli Ev3 after 46 h of fermentation.

Example 5

Determination of Mutations in the stem E. coli Ev4 compared to E. coli Ev3

[0530] The genome of the E. coli stems E. coli Ev4 and E. coli Ev3 were sequenced and the results compared in order to determine the mutations that lead to the increased alanine productivity of stem E. coli Ev4.

[0531] A mutation in the brnQ gene was identified which changed the sequence of the brnQ gene from SEQ ID NO: 1, encoding the protein having SEQ ID NO: 2 in stem E. coli Ev3 to SEQ ID NO: 3, encoding the protein having SEQ ID NO: 4 in stem E. coli Ev4.

[0532] Further, a mutation in the argP gene was identified which changed the sequence of the argP gene from SEQ ID NO: 45, encoding the protein having SEQ ID NO: 46 in stem E. coli Ev3 to SEQ ID NO: 47, encoding the protein having SEQ ID NO: 48 in stem E. coli Ev4. Further, a mutation in the promoter of the gcvA gene was identified which changed the sequence of the promoter of the gcvA gene from SEQ ID NO: 55 in stem E. coli Ev3 to SEQ ID NO: 56 in stem E. coli Ev4. In an independent strain also exhibiting enhanced alanine yield, another mutation was identified changing the sequence of the promoter of the gcvA gene from SEQ ID NO: 55 to SEQ ID NO: 57.

[0533] Further, a mutation in the promoter of the gcvB gene was identified which changed the sequence of the promoter of the gcvB gene from SEQ ID NO: 59 in stem E. coli Ex1 to SEQ ID NO: 60 in stem E. coli Ev1. In another independent strain exhibiting increased alanine yield another mutation in the promoter of the gcvB gene was identified changing the promoter sequence from SEQ ID NO: 59 to SEQ ID NO: 61.

[0534] Further, a mutation in the IpxD gene was identified which changed the sequence of the IpxD gene from SEQ ID NO: 49, encoding the protein having SEQ ID NO: 50 in stem E. coli Ev3 to SEQ ID NO: 51, encoding the protein having SEQ ID NO: 52 in stem E. coli Ev4.

[0535] In order to determine the importance of the identified mutations for alanine yield and productivity, mutations were sequentially introduced into an E. coli strain comprising the mutations as described in Example 1 and the mutations as described in PCT/IB2014/064426 comprising mutations in the ygaW gene, the zipA gene, the lpd gene and a mutation in the promoter controlling expression of the alaD gene as also described above. These mutations were evaluated for their effect on alanine productivity. Expression levels of mutated genes or genes under the control of mutated promoter regions were monitored by qPCR.

Example 6

Confirming the Effect of a SNP in the argP (iciA) Gene

[0536] ArgP (or iciA) is a transcriptional regulator. It controls genes involved in the arginine transport system and genes involved in DNA replication. A SNP leading to a A96E mutation in the ArgP protein was identified in E. coli QZ23 and was evaluated for its effect on alanine productivity.

[0537] Strain Construction of E. coli QZ48

[0538] An argP-cat-sacB cassette with selectable chloramphenicol resistance marker and counter-selectable sacB marker (confers sucrose sensitivity) was amplified from template vector pQZ11 (Genescript) with primers argP_1_F and argP_1_R (see Table 1) with Phusion Hot Start High-Fidelity DNA Polymerase (Thermo). The PCR product was Dpnl (NEB) digested at 37 C for 1 h to reduce plasmid template background and gel extracted from a 1% agarose gel with the QIAquick Gel Extraction Kit (Qiagen). The argP SNP cassette (543 bp) was amplified from QZ23 genomic DNA with primers argP_2_F and argP_2_R (see Table 1) with Phusion Hot Start High-Fidelity DNA Polymerase (Thermo) and purified with the QlAquick PCR Purification Kit (Qiagen).

[0539] For Red/ET recombination the Genebridges Red/ET Recombination Kit was used according to manufacturer's protocol. Approximately 200 ng of the argP-cat-sacB were electroporated into Red/ET-proficient E. coli QZ20 cells. Cultures were plated on LB agar plates with 10 ug/mL chloramphenicol for selection of positive transformants after electroporation. Several colonies were screened for integration of the marker cassette by PCR with the genome-specific primers argP_seq_F and argP_seq_R (see Table 1). A PCR confirmed clone was used for a second Red/ET recombination with the argP SNP cassette to replace the cat-sacB marker cassette. Cultures were plated on LB agar plates with 6% sucrose without

[0540] NaCl for selection of positive transformants after electroporation. Several clones were tested with the genome-specific primers argP_seq_F and argP_seq_R (see Table 1) for loss of the cat-sacB marker cassette. At least one clone that yielded a PCR product of the correct size was also confirmed by sequencing (Genewiz). The heat-sensitive recombineering plasmid pRedET (amp) was cured from strains at 42 C overnight on LB plates before strains were tested in the bioreactor. The SNP leading to the ArgP A96E mutation was introduced into strain E. coli QZ20. The resulting strain was designated as QZ48.

[0541] Fermentation Trial of E. coli QZ20 in Comparison to E. coli QZ48

[0542] E. coli strain QZ48 was tested for its performance during fermentation in a lab-scale bioreactor. Cell growth and alanine formation were monitored in comparison to E. coli strain QZ20.

[0543] Precultures were grown in shake flasks with LB medium, 20% filling volume at 37 C and 200 rpm overnight. The fermentation was performed in the DASGIP 1.5 L parallel bioreactor system (Eppendorf) in 500 mL AM 1 medium (2.6 g/L (NH.sub.4)2HPO4, 0.87 g/L NH4H2PO4, 0.15 g/L Kill, 0.37 g/L MgSO4-7 H.sub.2O, 15 g/L (NH4)2HPO4, 1 mM betaine, 1 ml/L trace metal stock solution). The trace metal stock comprised 1.6 g/L FeCL3-6 H.sub.2O; 0.2 g/L CoCl2-6 H.sub.2O; 0.1 g/L CuCl2-2 H.sub.2O; 0.2g/L ZnCl2; 0.2g/L NaMoO4-2 H.sub.2O; 0.05 g/L H3BO3, 0.1 M HCL. 140 g/L Glucose were used as the carbon source in the fermentation medium. E. coli cells equivalent to an OD600-mL of 7 were harvested via centrifugation and resuspended in 5 mL AM 1 medium. # OD600-mL=(0D600 of undiluted culture)(culture volume in mL). The 5 mL resuspended cells were used to inoculate the 500 mL fermentation medium in the 1.5 L DASGIP bioreactor. Each strain was run in duplicates at 37C and 400 rpm stirrer speed. 5N NH4OH was used to control the pH to 6.8 and provide the culture with ammonium as an alanine precursor throughout the fermentation. No air was sparged during the fermentation and the vessel was not pressurized so that after the initial consumption of dissolved oxygen in the medium by the cells the fermentation was run under microaerobic conditions. Samples were taken throughout the fermentation and analyzed by HPLC for alanine and glucose concentrations.

[0544] The ArgP A96E mutation in QZ48 had a strong influence on alanine formation (FIG. 7).

[0545] The volumetric alanine productivity (space-time-yield), defined as the amount of product generated divided by reactor volume and by time, of QZ20 after 46 h was 1.150.06 g/(Lh).E. coli QZ48 showed an increased volumetric alanine productivity of 1.510.01 g/(Lh) after 46 h (FIG. 8).

[0546] Construction of pACYC184-argP Plasmid

[0547] To test the influence of argP overexpression, plasmid pACYC184-argP (p15 ori, CmR, 15 copies per cell) was constructed via commercial InFusion cloning technology (Clontech, Mountain View, Calif., USA). First the vector pACYC184 (Table 1) was obtained via NEB (Ipswich, Mass., USA) and linearized with HindIII and SaII restriction endonucleases, also from NEB. This digest removed most of the tetracycline-resistance gene. Separately, the argP ORF was PCR amplified from wild-type E. coli W DNA with Phusion polymerase (Thermo Scientific, Waltham, Mass.) with the primers argP-pACYC_F and argP-pACYC_R (Table 1). The primers contained additional 15 bp overhangs homologous to the linearized vector ends to facilitate seamless cloning. The InFusion reaction was then performed as according to the manufacturer's protocol with both purified linearized vector backbone and argP insert. The resulting InFusion products were then used to transform QZ20 via electroporation and selection on LB chloramphenicol plates. Positive clones were PCR identified, confirmed by DNA sequencing, and used in the fermentations for the overexpression studies.

[0548] Fermentation Comparison Between QZ20/pACYC184 and QZ20/pACYC184-argP

[0549] Precultures were grown in shake flasks with LB medium, 20% filling volume at 37 C and 200 rpm overnight. The fermentation was performed in the DASGIP 1.5 L parallel bioreactor system with 14% glucose in AM 1 medium. All fermentation conditions were as described before.

[0550] argP overexpression led to an accelerated alanine formation rate and higher alanine titer after 20 h of fermentation (FIG. 9). The volumetric alanine productivity (space-time-yield), defined as the amount of product generated divided by reactor volume and by time, of QZ20/pACYC-argP after 20 h was 0.690.04 g/(Lh) compared to 0.610.02 g/(Lh) of the strain with the pACYC184 plasmid control (FIG. 10).

Example 7

Confirming the Effect of a SNP in the gcvA/gcvB Promoter Region

[0551] Strain Construction of QZ58 and QZ66

[0552] The gcvA-cat-sacB cassette was amplified from vector pQZ11 (Genescript) with primers gcvA_1_F/R (Table 1). The gcvA/B SNP cassette (320 bp) was amplified from the genomic DNA of strain QZ23 with primers gcvA_2_F/R (Table 1). Red/ET was conducted as described previously. Clones were tested by colony PCR with gcvA_seq_F/R sequencing primers. The SNP in the gcvA/B promoter region was introduced into E. coli QZ20 and the resulting strain designated as QZ58. The SNP was also introduced into QZ48 (argP SNP) and the resulting strain designated as QZ66.

[0553] Fermentation Trial of QZ58 and QZ66

[0554] Strain QZ58 (gcvA/B promoter SNP) was tested for its performance during fermentation as described before. Alanine formation was monitored in comparison to strain QZ20.

[0555] The gcvA/B promoter SNP had a significant influence on alanine formation resulting in a higher alanine formation rate and an alanine titer of ca 76 g/L alanine compared to ca 54 g/L produced by QZ20 after 46 h (FIG. 11). The volumetric alanine productivity of QZ58 was 1.660.02 g/(Lh) compared to 1.150.06 g/(Lh) in QZ20 after 46 h (FIG. 12). The gcvA/B promoter SNP was also added on top of the argP SNP in QZ48 and the resulting strain QZ66 was tested during alanine fermentation in comparison to QZ48. The additional gcvA/B promoter mutation on top of the argP mutation in QZ66 led to an faster alanine formation rate compared to QZ48 and a higher alanine yield after 46 h of ca 76 g/L compared to ca 70 g/L in QZ48 (FIG. 13). The volumetric alanine productivity of QZ66 was 1.650.08 g/(Lh) compared to 1.510.01 g/(Lh) of QZ48 after 46 h (FIG. 14).

[0556] RT-qPCR Analysis of gcvA and gcvB Transcription Levels

[0557] Transcription levels of gcvA and gcvB were determined via quantitative reverse transcription PCR (RT-qPCR). The iTaq Universal One-Step Kit from Biorad was used for SYBR Green-based one-step reverse transcription (RT)-qPCR reactions. From a parallel batch-fermentation of E. coli QZ20 and E. coli QZ23 that was conducted as described previously, culture samples were taken at 8 h, 11 h and 28 h. Samples were immediately treated with RNAprotect Bacteria Reagent (Qiagen) to stabilize the RNA. RNA was extracted from the samples with the AurumTotal RNA Mini Kit (Biorad) according to the manufacturer's manual. The isolated RNA was further treated with the DNA-free DNA Removal Kit (lifetechnologies) to remove contaminating genomic DNA and reduce background during qPCR. The RNA was quantified spectrophotometrically at =260 nm. A 7-step 10-fold dilution series of 100 ng E. coli QZ20 RNA was tested with the RT-qPCR primers (Table 1) gcvA_RT_F/R for the gcvA gene, gcvB_RT_F/R for the gcvB regulatory RNA and rrsA_RT_F and rrsA_RT_R, specific for the ribosomal 16 S RNA coding rrsA gene, which served as a reference gene during qPCR trials. The suitable linear dynamic range of RNA dilutions that led to signal amplification efficiencies 90% <E <110% and a linear regression factor R2>0.985 were determined for each RT-qPCR primer set. rrsA was tested for its suitability as an internal reference gene for normalization and found to be expressed stable among all the tested samples (data not shown). RT-qPCR reactions were carried out with the CFX96 Touch Real-Time PCR Detection System (Biorad) according to the manufacturer's protocol. Relative quantification of gene expression was calculated with E. coli QZ20 8h RNA as the internal calibrator according to the Ct method (Livak and Schmittgen 2001).

[0558] The qPCR results confirmed the overexpression of gcvA in QZ23 compared to QZ20 during exponential phase after 8 h and 11 h of fermentation. Down-regulation of gcvA was observed in 28 h samples when cell densities were declining (FIG. 15A). The gcvB regulatory protein was down-regulated in QZ23 compared to QZ20 during exponential phase after 8 h and 11 h of fermentation. An overall down-regulation of gcvB transcription was observed in 28 h samples when cell densities were declining (FIG. 15B).

[0559] Construction of pACYC184-gcvA and pACYC184-gcvB Plasmid

[0560] Since the gcvA/B promoter SNP led to overexpression of gcvA, it needed to be confirmed that it was in fact the gcvA overexpression that resulted in increased alanine productivity. Therefore plasmid pACYC184-gcvA was constructed via commercial InFusion cloning technology (Clontech, Mountain View, Calif., USA). First the vector pACYC184 (Table 1) was obtained via NEB (Ipswich, Mass., USA) and linearized with HindIII and SaII restriction endonucleases, also from NEB. This digest removed most of the tetracycline-resistance gene. Separately, the gcvA ORF was PCR amplified from wild-type E. coli W DNA with Phusion polymerase (Thermo Scientific, Waltham, Mass.) with the primers gcvA-pACYC_F and gcvA-pACYC_R (Table 1). Likewise to test the effect of gcvB overexpression plasmid pACYC184-gcvB was constructed. The gcvB transcription unit was PCR amplified with the primers gcvB-pACYC_F and gcvB-pACYC_R (Table 1).

[0561] The primers contained additional 15 bp overhangs homologous to the linearized vector ends to facilitate seamless cloning. The InFusion reaction was then performed as according to the manufacturer's protocol with both purified linearized vector backbone and gcvA and gcvB insert, respectively. The resulting InFusion products were then used to transform QZ20 via electroporation and selection on LB chloramphenicol plates. Positive clones were PCR identified, confirmed by DNA sequencing, and used in the fermentations for the over-expression studies.

[0562] Fermentation Comparison Between QZ20/pACYC184, QZ20/pACYC184-gcvA and QZ20/pACYC-gcvB

[0563] Precultures were grown in shake flasks with LB medium, 20% filling volume at 37 C and 200 rpm overnight. The fermentation was performed in the DASGIP 1.5 L parallel bioreactor system with 14% glucose in AM 1 medium. All fermentation conditions were as described before.

[0564] The fermentation trial confirmed that overexpression of gcvA from plasmid pACYC184-gcvA resulted in a higher alanine formation rate and titer compared to the empty plasmid control (FIG. 16). In contrast overexpression of the gcvB small regulatory RNA from plasmid pACYC184-gcvB led to a significant reduction of alanine formation rate and titer. E. coli QZ20/pACYC184-gcvA showed a volumetric alanine productivity of 1.500.09 g/(Lh) compared to 1.180.08 g/(Lh) of QZ20 with the plasmid control. E. coli QZ20/pACYC184-gcvB showed a reduced volumetric alanine productivity of 0.89 0.01 g/(Lh) compared to the plasmid control (FIG. 17).

[0565] Strain Construction of QZ20 gcvB Knock-Out QZ71

[0566] Since overexpression of the regulatory RNA gcvB from plasmid pACYC184-gcvB led to significant reduction of alanine productivity, gcvB was knocked out in QZ20 and tested for performance. The gcvB-cat-sacB cassette was amplified from vector pQZ11 (Genescript) with primers gcvB_1_F/R (Table 1). The gcvB deletion cassette (400 bp) was ordered as dsDNA gBlock from IDT (SEQ ID NO: 98). Red/ET was conducted as described previously. Clones were tested by colony PCR with gcvB_seq_F/R sequencing primers. The gcvB deletion was introduced into E. coli QZ20 and the resulting strain designated as QZ71.

[0567] Fermentation Trial of QZ71

[0568] Strain QZ71 (gcvB knock-out) was tested for its performance during fermentation as described before. Alanine formation was monitored in comparison to strain QZ20.

[0569] Deletion of the gcvB regulatory RNA from QZ20 resulted in a slight increase in alanine titer compared to QZ20 (FIG. 18). The volumetric alanine productivity of QZ71 was 1.280.05 g/(Lh) compared to 1.150.06 g/(Lh) of QZ20 after 46 h (FIG. 19).

Example 8

Confirming the Effect of a Deletion in the bmQ gene (667-764)

[0570] BrnQ is a putative 439 AA branched chain amino acid transporter that transports leucine, valine, and isoleucine into the cell as a sodium/branched chain amino acid symporter. In QZ23 a 97 bp deletion (667-764) was identified that causes a reading frame shift. While the first 222 amino acids of the 439 AA protein are unaltered, 31 AAs are changed due to the frame-shift and the residual C-terminal chain is truncated due to an occurring stop codon. Since it was assumed that the 97 bp partial deletion found in the brnQ gene in QZ23 leads to an abolished BrnQ activity, a complete deletion of the brnQ gene (knock-out) was tested in addition to the partial brnQ deletion.

[0571] Strain Construction of QZ57 and QZ69

[0572] The brnQ-cat-sacB cassette was amplified from vector pQZ11 (Genescript) with primers brnQ_1_F/R (Table 1). The brnQ partial deletion cassette (462 bp) was amplified from the genomic DNA of strain QZ23 with primers brnQ_2_F/R (Table 1). The brnQ KO cassette (500 bp) was ordered as dsDNA gBlock from IDT (SEQ ID NO: 117). Red/ET was conducted as described previously. Clones were tested by colony PCR with brnQ_seq_F/R sequencing primers. The brnQ partial deletion was introduced into E. coli QZ20 and the resulting strain designated as QZ57. The brnQ complete deletion was introduced into E. coli QZ20 and the resulting strain designated as QZ69.

[0573] Fermentation Trial of QZ57 and QZ69

[0574] Strain QZ57 (brnQ 667-764) and QZ69 (brnQ KO) were tested for their performance during fermentation as described before. Alanine formation was monitored in comparison to strain QZ20.

[0575] The 97 bp brnQ deletion in QZ57 and the complete brnQ knockout performed comparable. Both resulted in higher alanine formation and alanine titer than QZ20 (FIG. 20). The vol- umetric alanine productivity of QZ57 was 1.300.04 g/(Lh) and the productivity of QZ69 was 1.28 g/(Lh) compared to 1.150.06 g/(Lh) in QZ20 after 46 h (FIG. 21).

Example 9

Confirming the Effect of a SNP in the IpxD Gene

[0576] In QZ23 a SNP was detected in the IpxD gene leading to a A15T mutation of the encoded enzyme. UDP-3-O-(3-hydroxymyristoyl) glucosamine-N-acetyltransferase encoded by LpxD is an essential enzyme involved in the biosynthesis of lipid A. Lipid A is an integral part of the E. coli outer membrane lipopolysaccharide (LPS).

[0577] Strain Construction of QZ56 and QZ70

[0578] The IpxD-cat-sacB cassette was amplified from vector pQZ11 (Genescript) with primers IpxD_1C_F/R (Table 1). The IpxD SNP cassette (2588 bp) was amplified from the genomic DNA of strain QZ23 with primers IpxD_fix_F/R (Table 1). Red/ET was conducted as described previously. Clones were tested by colony PCR with IpxD_flank_F/R sequencing primers. The IpxD SNP was introduced into E. coli QZ20 and the resulting strain designated as QZ56. The IpxD SNP was also introduced into QZ68 (argP SNP, gcvA/B promoter SNP, brnQ 667-764) and the resulting strain designated as QZ70.

[0579] Fermentation Trial of QZ56 and QZ70

[0580] Strain QZ56 (IpxD SNP) was tested for its performance during fermentation as described before. Alanine formation was monitored in comparison to strain QZ20. The LpxD A15T mutation in QZ56 resulted in an increased alanine titer compared to QZ20 (FIG. 22). The volumetric alanine productivity of QZ56 was 1.340.06 g/(Lh) compared to 1.150.06 g/(Lh) in QZ20 after 46 h (FIG. 23).

[0581] The IpxD SNP was also introduced into QZ68 (argP SNP, gcvA/B promoter SNP, brnQ 667-764) and the resulting strain QZ70 was tested during alanine fermentation in comparison to QZ68. The LpxD A15T mutation had a strong influence on alanine formation. The alanine formation rate between QZ68 and QZ70 was comparable, however the alanine titer of QZ68 plateaued at around 75 g/L, while alanine formation continued in QZ70 until all glucose in the medium was consumed and an alanine titer of 102 g/L was reached after ca 37 h (FIG. 24). The volumetric alanine productivity of QZ70 was 2.240.002 g/(Lh) compared to 1.640.03 g/(Lh) of QZ68 after 46 h (FIG. 25).