METHODS AND A KIT TO REPROGRAM SOMATIC CELLS
20220389389 · 2022-12-08
Inventors
Cpc classification
C12M25/04
CHEMISTRY; METALLURGY
A61K35/12
HUMAN NECESSITIES
C12N2501/999
CHEMISTRY; METALLURGY
C12N5/0696
CHEMISTRY; METALLURGY
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
International classification
A61K35/12
HUMAN NECESSITIES
Abstract
The present invention relates to methods for reprogramming somatic cells into pluripotent stem cell-like cells. Such cells may express pluripotency inducing genes including Oct4, Nanog and Sox2 without introducing exogeneous genes, proteins, or chemicals. The discovery that the inhibition of mechanosensitive and stretch-activated ion channels in somatic cells specifically activates pluripotency inducing factor genes inspired the cell reprogramming culture methods in which somatic cells were incubated with the inhibitor, GsMTX4, against mechanosensitive and stretch-activated ion channels, cultured on the soft hydrogel surface, or treated with cholesterol depletion substance, methyl-beta-cyclodextrin (MβCD). Described methods produce pluripotent stem cell-like cells and subsequently re-differentiated cells, which include adipocytes, osteocytes, neuronal cells. Methods may be combined to increase the efficiency of the somatic cell reprogramming A somatic cell reprogramming kit was also created with tissue culture dishes casted with hydrogel (dehydrated) and MβCD.
Claims
1. A method of inducing a non-pluripotent mammalian cell into an induced pluripotent stem cell, the method comprising contacting the non-pluripotent mammalian cell with two or more of the following: a. one or more mechanosensitive and stretch-activated ion channel inhibitors in an amount sufficient to inhibit the mammalian cell ion channels; b. one or more cell cholesterol reducing agents in an amount sufficient to reduce the mammalian cell cholesterol level; c. a soft extracellular matrix having a Young's elastic modulus of 20 kPa or less.
2. The method of claim 1, wherein the non-pluripotent mammalian cell is not genetically modified to express pluripotency inducing factors.
3. The method of claim 1, wherein the mechanosensitive and stretch-activated ion channel inhibitor is selected from the group consisting of the L enantiomer of GsMTX4, the D enantiomer of GsMTX4, a peptide having a sequence at least 90% identical to the sequence of GsMTX4, or a mixture thereof.
4. The method of claim 1, wherein the mechanosensitive and stretch-activated ion channel inhibitor is GsMTX4.
5. The method of claim 3, wherein the mechanosensitive and stretch-activated ion channel inhibitor is at a concentration of about 5 μM.
6. The method of claim 1, wherein the cell cholesterol reducing agent is a cyclodextrin.
7. The method of claim 6, wherein the cyclodextrin is methyl-β-cyclodextrin.
8. The method of claim 7, wherein the cyclodextrin is at a concentration of about 5 mM.
9. The method of claim 1, wherein the extracellular matrix has a Young's elastic modulus of about 15 kPa or less.
10. The method of claim 1, wherein the extracellular matrix has a Young's elastic modulus of about 7.4 kPa or less.
11. The method of claim 1, wherein the induced pluripotent stem cell is capable of differentiating into a cell type selected from the group consisting of adipocytes, neuronal cells, osteocytes, endothelial cells, erythrocytes, dendritic cells, platelets, lymphocytes, and myoblasts.
12. The method of claim 1, wherein the expression of one or more of the genes Oct4, Nanog and Sox2 is induced in the induced pluripotent stem cell relative to the non-pluripotent mammalian cell.
13. A pharmaceutical composition comprising an isolated population of cells having a second non-pluripotent cell type, wherein the cells are obtained by a composition of converting animal cells from a first non-pluripotent cell type, and wherein the composition comprises inducing a non-pluripotent mammalian cell of a first cell type into an induced pluripotent stem cell by a. contacting the non-pluripotent mammalian cell with two or more of the following: i. one or more mechanosensitive and stretch-activated ion channel inhibitors in an amount sufficient to inhibit the mammalian cell ion channels; ii. one or more cell cholesterol reducing agents in an amount sufficient to reduce the mammalian cell cholesterol level; iii. a soft extracellular matrix having a Young's elastic modulus of 20 kPa or less, and b. inducing differentiation of the cells from step (a) into the second non-pluripotent cell type.
14. A cell culture container comprising a. cell culture media, b. one or more mammalian cells treated with one or both of the following: i. one or more mechanosensitive and stretch-activated ion channel inhibitors in an amount sufficient to inhibit the mammalian cell ion channels; ii. one or more cell cholesterol reducing agents in an amount sufficient to reduce the mammalian cell cholesterol level; and c. a soft extracellular matrix having a Young's elastic modulus of 20 kPa or less.
Description
6. BRIEF DESCRIPTION OF THE DRAWINGS
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
7. DETAILED DESCRIPTION OF THE INVENTION
[0072] Provided herein are methods to produce pluripotent cells from non-pluripotent cells by 1) contacting non-pluripotent cells with one more cholesterol depletion agents, 2) contacting non-pluripotent cells with one or more MSAIC inhibitors, 3) culturing the cells on a soft matrix, or 4) a combination of any of the foregoing. When a combination is utilized, the steps can be performed sequentially or simultaneously. In particular embodiments, the method comprises 1) contacting non-pluripotent cells with one more cholesterol depletion agents and contacting non-pluripotent cells with one or more MSAIC inhibitors, 2) contacting non-pluripotent cells with one more cholesterol depletion agents and culturing the cells on a soft matrix, and 3) contacting non-pluripotent cells with one or more MSAIC inhibitors and culturing the cells on a soft matrix. In one embodiment, the cholesterol depletion agent is contacted with non-pluripotent cells prior to culturing the cells on a soft matrix. In a particular embodiment, the cells are contacted with the cholesterol depletion agent while the cells are in suspension in, for example a tube. In another embodiment, cells are contacted with the MSAIC inhibitor prior to culturing the cells on a soft matrix. In an embodiment, cells are contacted with the MSAIC inhibitor simultaneously with culturing the cells on a soft matrix. Particular cholesterol depletion agents and MSAIC inhibitors, as well as their concentrations and time of contact with cells are provided below. Similarly, the degree of softness of the matrix measured in kPa is provided below.
[0073] Various non-pluripotent cells can be induced according to the disclosed methods. Mammalian cells are preferred, including human cells. Cell types include human fibroblasts and human peripheral blood mononuclear cells. In an embodiment, the non-pluripotent cells are cells that are not genetically modified to express pluripotency inducing factors, such as Oct4, Nanog and Sox2. In an embodiment, the non-pluripotent cells that are not genetically modified to express pluripotency inducing factors are mammalian cells. In an embodiment, the non-pluripotent cells that are not genetically modified to express pluripotency inducing factors are human cells. In certain embodiments, the expression of one or more of the genes Oct4, Nanog and Sox2 is induced in the pluripotent stem cell relative to the non-pluripotent mammalian cell.
[0074] Various non-pluripotent cells can be induced according to the disclosed methods. Mammalian cells are preferred, including human cells. Cell types include human fibroblasts and human peripheral blood mononuclear cells. In certain embodiments, the expression of one or more of the genes Oct4, Nanog and Sox2 is induced in the pluripotent stem cell relative to the non-pluripotent mammalian cell.
[0075] MSAIC Inhibitors
[0076] One embodiment of the invention provides a method to induce pluripotency in non-pluripotent (somatic) cells by contacting the non-pluripotent cells with an MSAIC inhibitor. In certain embodiments, the MSAIC inhibitor activates in somatic cells the transcription of PIFs that includes but is not limited to Oct4, Nanog, Sox2 and c-Myc. MSAIC inhibitors are known, and include gadolinium, ruthenium red, and GsMTX4. In one embodiment, the MSAIC inhibitor is an inhibitor of the Piezo 1 stretch-activated channel. The preferred embodiment for the MSAIC inhibitor is GsMTX4. GsMTX4 is a water-soluble 34.sup.mer peptide purified from a spider venom. Water-soluble inhibitors are preferred to those soluble only in in DMSO because expression of PIFs were found repressed by DMSO in the in vitro culture [Czysz et al., PLoS One 10 (2) (2015)]. Without being bound by theory, it is hypothesized that the inhibition of MSAICs with GsMTX4 stages the micro-environment on the polystyrene cell-culture surface (which possesses essentially infinite stretch force) simulates the environment of cells in contact with soft extracellular matrix.
[0077] In certain embodiments, cells are contacted with the MSAIC inhibitor at a concentration of at least 1 μM, between about 10 μM and about 1 μM, between 10 μM and 1 μM, between about 7 μM and about 3 μM, between 7 μM and 3 μM, about 5 μM or 5 μM. In particular embodiments, the MSAIC inhibitor is GsMTX4 at a concentration of between about 10 μM and about 1 μM, between 10 μM and 1 μM, between about 7 μM and about 3 μM, between 7 μM and 3 μM, about 5 μM or 5 μM. In a preferred embodiment, cells are contacted with GsMTX4 at a concentration of 5 μM.
[0078] In certain embodiments, cells are contacted with the MSAIC inhibitor for at least 12 hours, about 12 to about 96 hours, 12 to 20 hours, about 16 hours, 16 hours, 24 to 96 hours, 48 to 96 hours, about 72 hours, or for 72 hours. In one embodiment, cells are contacted with GsMTX4 at a concentration of 5 μM for 16 hours. In another embodiment, cells are contacted with GsMTX4 at a concentration of 5 μM for 72 hours.
[0079] In certain embodiments, cells are contacted with the MSAIC inhibitor at a temperature from about 4° C. to 42° C., a temperature from about 20° C. to 40° C., a temperature of about 37° C., a temperature of 37° C., a temperature of about 25° C., or a temperature of 25° C.
[0080] Cholesterol Depletion Agents
[0081] One embodiment of the invention provides a method to induce pluripotency in non-pluripotent (somatic) cells by contacting the non-pluripotent cells with a cholesterol depletion agent. In certain embodiments, the cholesterol depletion agent activates in somatic cells the transcription of PIFs that includes but is not limited to Oct4, Nanog, Sox2 and c-Myc. Cholesterol depletion agents include cylcodextrins, such as methyl-β-cyclodextrin (MβCD) hydroxypropyl-α-cyclodextrin (HPαCD), and hydroxypropyl-β-cyclodextrin (HPβCD).
[0082] Treatment with MSAIC inhibitors such as GsMTX4 divided somatic cells into two types, the first expressed PIFs within 16 hours, while the second expressed PIFs in a delayed manner after a period of the repression. One embodiment of the invention provides a method to change the second type of cell to the first type in vitro by treating with a cholesterol depletion agent. In one embodiment, the cholesterol depletion agent is one belonging to the cyclodextrin family. In preferred embodiment, the cellular cholesterol would be depleted by the treatment with MβCD (a cyclic oligosaccharide). After the depletion of the cellular cholesterol, treatment with GsMTX4 activated PI factors in the second type somatic cells within 16 hours. Thus, also provided herein are methods to convert second type somatic cells to first type somatic cells, which are readily reprogrammable into the pluripotent stem cell-like cells following the treatment with GsMTX4. The additional embodiment of the invention provides synergistic use of cellular cholesterol depletion and MSAIC inhibitor to reprogram somatic cells to pluripotent stem cell-like cells. The preferred embodiments to cause the synergy employ MβCD and GsMTX4.
[0083] In certain embodiments, cells are contacted with the cholesterol depletion agent at a concentration of at least 1 mM, between about 10 mM and about 1 mM, between 10 mM and 1 mM, between about 7 mM and about 3 mM, between 7 mM and 3 mM, about 5 mM or 5 mM. In particular embodiments, the cholesterol depletion agent is MβCD at a concentration of between about 10 mM and about 1 mM, between 10 mM and 1 mM, between about 7 mM and about 3 mM, between 7 mM and 3 mM, about 5 mM or 5 mM. In a preferred embodiment, cells are contacted with MβCD at a concentration of 5 mM.
[0084] In certain embodiments, cells are contacted with the cholesterol depletion agent for at least 12 hours, about 12 to about 96 hours, 12 to 20 hours, about 16 hours, 16 hours, 24 to 96 hours, 48 to 96 hours, about 72 hours, or for 72 hours. In one embodiment, cells are contacted with MβCD at a concentration of 5 mM for 20 minutes.
[0085] In certain embodiments, cells are contacted with the cholesterol depletion agent at a temperature from about 4° C. to 42° C., a temperature from about 20° C. to 40° C., a temperature of about 37° C., a temperature of 37° C., a temperature of about 25° C., or a temperature of 25° C.
[0086] Soft Extracellular Matrix
[0087] Another embodiment of the invention provides the method to induce pluripotency in somatic (non-pluripotent) cells by culturing cells on a soft extracellular matrix. In one embodiment, expression of PIFs in cells is induced culturing cells on soft extra cellular matrix. In preferred embodiment the soft extracellular matrix is made of hydrogel. The embodiment of the invention indicates that the hydrogel is polyacrylamide gel or a silicone gel. The softness of the polyacrylamide gel is tunable by altering the ratio of water, acrylamide, and bis-acrylamide. As shown in supra, the induction of the PIFs relies on the specific range of softness (indicated by pascals). Different type cells may require different softness of extra cellular matrix, which will be determinable by the person of ordinary skill in the art having benefit of the knowledge imparted by the teachings of this disclosure.
[0088] One embodiment of the invention provided the method to maintain in in vitro culture on a soft extracellular matrix the precursor pluripotent stem cells-like cells which express non-spliced messages of PIFs, Oct4 and Nanog.
[0089] In preferred embodiments the invention provided the examples of the softness at 7.4, 3.2 and 1.7 k pascal (kPa), in which 3.2 kPa is a preferred embodiment. In different embodiments, the extracellular matrix has a Young's elastic modulus of about 20 kPa or less, about 15 kPa or less, about 10 kPa or less, about 7.4 kPa or less, about 3.2 kPa or less, about 1.7 kPa or less, about 1 kPa or less, 20 kPa or less, 15 kPa or less, 10 kPa or less, 7.4 kPa or less, 3.2 kPa or less, 1.7 kPa or less, 1 kPa or less, 20 kPa, 15 kPa, 10 kPa, 7.4 kPa, 3.2 kPa, 1.7 kPa, 20 kPa, 15 kPa, 10 kPa, 7.4 kPa, 3.2 kPa, 1.7 kPa, 1 kPa.
Differentiated Cells
[0090] One embodiment of the invention thus provides the method to differentiate types of somatic cells in the medium DMEM/F12 supplemented with 10% knock out serum replacement, lx non-essential amino acid, and 5×10.sup.−5M 2-Mercaptoethanol. Examples of differentiated cells include Oil red 0-positive white and brown adipocytes, neuronal cells, Alizarin positive osteoblast.
[0091] For example, brown adipocytes are in demand for the therapy of the obesity as they take up and consume large amounts of diverse nutrients simultaneously (e.g. glucose, lipids, amino acids) and can simultaneously engage both anabolic and catabolic metabolism [Payab, M. et al. Int J Obes (2020) https://doi.org/10.1038/s41366-020-0616-5]. The methods provided herein include methods differentiating pluripotent cells into various cell types, including adipocytes, neuronal cells, osteocytes, endothelial cells, erythrocytes, dendritic cells, platelets, lymphocytes, and myoblasts. In the case of neuronal cells, the neuronal cell type can include cortical neurons, astrocytes, microglia, and oligodendrocytes. Methods of inducing pluripotent cells to differentiate into different lineages are known, and can be used to differentiate the pluripotent cells created according to the teachings of the present disclosure.
[0092] The embodiments of the invention supra provided the methods, in which the mechanosensitive and stretch-activated ion channels were attenuated with multiple methods combined (
[0093] Also provided are pluripotent cells produced according to the disclosed methods, pharmaceutical compositions comprising differentiated cells produced according to the disclosed methods, and reagents used in the methods, such as tissue culture media and cell culture containers. Cell culture containers include dishes, bottles, plates and multi-well plates.
[0094] All together the embodiment of the invention provided the novel methods and required tools to reprogram somatic cells to PSC-like cells, then re-differentiate them to various somatic cells useful for regenerative medicine. It is contemplated that the invention encompasses any aspect, or any combination of one or more aspects, of one or more of any of the embodiments presented herein.
8. EMBODIMENTS
[0095] Explicitly contemplated embodiments include the following: [0096] 1. A method of inducing a non-pluripotent mammalian cell into an induced pluripotent stem cell, the method comprising contacting the non-pluripotent mammalian cell with two or more of the following: [0097] a. one or more mechanosensitive and stretch-activated ion channel inhibitors in an amount sufficient to inhibit the mammalian cell ion channels; [0098] b. one or more cell cholesterol reducing agents in an amount sufficient to reduce the mammalian cell cholesterol level; [0099] c. a soft extracellular matrix having a Young's elastic modulus of 20 kPa or less. [0100] 2. The method of embodiment 1, wherein the non-pluripotent mammalian cell is not genetically modified to express pluripotency inducing factors. [0101] 3. The method of embodiment 1, wherein the mechanosensitive and stretch-activated ion channel inhibitor is selected from the group consisting of the L enantiomer of GsMTX4, the D enantiomer of GsMTX4, a peptide having a sequence at least 90% identical to the sequence of GsMTX4, or a mixture thereof [0102] 4. The method of embodiment 1, wherein the mechanosensitive and stretch-activated ion channel inhibitor is GsMTX4. [0103] 5. The method of embodiment 3, wherein the mechanosensitive and stretch-activated ion channel inhibitor is at a concentration between about 10 μM and about 1 μM. [0104] 6. The method of embodiment 3, wherein the mechanosensitive and stretch-activated ion channel inhibitor is at a concentration between 10 μM and 1 μM. [0105] 7. The method of embodiment 3, wherein the mechanosensitive and stretch-activated ion channel inhibitor is at a concentration between about 7 μM and about 3 μM. [0106] 8. The method of embodiment 3, wherein the mechanosensitive and stretch-activated ion channel inhibitor is at a concentration between 7 μM and 3 μM. [0107] 9. The method of embodiment 3, wherein the mechanosensitive and stretch-activated ion channel inhibitor is at a concentration of about 5 μM. [0108] 10. The method of embodiment 3, wherein the mechanosensitive and stretch-activated ion channel inhibitor is at a concentration of 5 μM. [0109] 11. The method of embodiment 3, wherein the cells are contacted with the mechanosensitive and stretch-activated ion channel inhibitor for about 12 to about 96 hours. [0110] 12. The method of embodiment 3, wherein the cells are contacted with the mechanosensitive and stretch-activated ion channel inhibitor for 12 to 20 hours. [0111] 13. The method of embodiment 3, wherein the cells are contacted with the mechanosensitive and stretch-activated ion channel inhibitor for about 16 hours. [0112] 14. The method of embodiment 3, wherein the cells are contacted with the mechanosensitive and stretch-activated ion channel inhibitor for 16 hours. [0113] 15. The method of embodiment 3, wherein the cells are contacted with the mechanosensitive and stretch-activated ion channel inhibitor for 24 to 96 hours. [0114] 16. The method of embodiment 3, wherein the cells are contacted with the mechanosensitive and stretch-activated ion channel inhibitor for 48 to 96 hours. [0115] 17. The method of embodiment 3, wherein the cells are contacted with the mechanosensitive and stretch-activated ion channel inhibitor for about 72 hours. [0116] 18. The method of embodiment 3, wherein the cells are contacted with the mechanosensitive and stretch-activated ion channel inhibitor for 72 hours. [0117] 19. The method of embodiment 1, wherein the cell cholesterol reducing agent is a cyclodextrin. [0118] 20. The method of embodiment 19, wherein the cyclodextrin is methyl-β-cyclodextrin. [0119] 21. The method of embodiment 20, wherein the cyclodextrin is at a concentration between about 10 mM and about 1 mM. [0120] 22. The method of embodiment 20, wherein the cyclodextrin is at a concentration between 10 mM and 1 mM. [0121] 23. The method of embodiment 20, wherein the cyclodextrin is at a concentration between about 7 mM and about 3 mM. [0122] 24. The method of embodiment 20, wherein the cyclodextrin is at a concentration between 7 mM and 3 mM. [0123] 25. The method of embodiment 20, wherein the cyclodextrin is at a concentration of about 5 mM. [0124] 26. The method of embodiment 20, wherein the cyclodextrin is at a concentration of 5 mM. [0125] 27. The method of embodiment 20, wherein the cells are contacted with the cyclodextrin for about 15 to about 60 minutes. [0126] 28. The method of embodiment 20, wherein the cells are contacted with the cyclodextrin for 15 to 60 minutes. [0127] 29. The method of embodiment 20, wherein the cells are contacted with the cyclodextrin for about 20 to about 40 minutes. [0128] 30. The method of embodiment 20, wherein the cells are contacted with the cyclodextrin for 20 to 40 minutes. [0129] 31. The method of embodiment 20, wherein the cells are contacted with the cyclodextrin for about 15 to about 30 minutes. [0130] 32. The method of embodiment 20, wherein the cells are contacted with the cyclodextrin for 20 to 30 minutes. [0131] 33. The method of embodiment 20, wherein the cells are contacted with the cyclodextrin for about 20 minutes. [0132] 34. The method of embodiment 20, wherein the cells are contacted with the cyclodextrin for 20 minutes. [0133] 35. The method of embodiment 20, wherein the cells are contacted with the cyclodextrin for about 30 minutes. [0134] 36. The method of embodiment 20, wherein the cells are contacted with the cyclodextrin for 30 minutes. [0135] 37. The method of embodiment 1, wherein the extracellular matrix has a Young's elastic modulus of about 15 kPa or less. [0136] 38. The method of embodiment 1, wherein the extracellular matrix has a Young's elastic modulus of about 10 kPa or less. [0137] 39. The method of embodiment 1, wherein the extracellular matrix has a Young's elastic modulus of about 7.4 kPa or less. [0138] 40. The method of embodiment 1, wherein the extracellular matrix has a Young's elastic modulus of about 3.2 kPa or less. [0139] 41. The method of embodiment 1, wherein the extracellular matrix has a Young's elastic modulus of about 1.7 kPa or less. [0140] 42. The method of embodiment 1, wherein the extracellular matrix has a Young's elastic modulus of about 1 kPa or less. [0141] 43. The method of embodiment 3, wherein the extracellular matrix has a Young's elastic modulus of about 15 kPa or less. [0142] 44. The method of embodiment 3, wherein the extracellular matrix has a Young's elastic modulus of about 10 kPa or less. [0143] 45. The method of embodiment 3, wherein the extracellular matrix has a Young's elastic modulus of about 7.4 kPa or less. [0144] 46. The method of embodiment 3, wherein the extracellular matrix has a Young's elastic modulus of about 3.2 kPa or less. [0145] 47. The method of embodiment 3, wherein the extracellular matrix has a Young's elastic modulus of about 1.7 kPa or less. [0146] 48. The method of embodiment 3, wherein the extracellular matrix has a Young's elastic modulus of about 1 kPa or less. [0147] 49. The method of embodiment 19, wherein the extracellular matrix has a Young's elastic modulus of about 15 kPa or less. [0148] 50. The method of embodiment 19, wherein the extracellular matrix has a Young's elastic modulus of about 10 kPa or less. [0149] 51. The method of embodiment 19, wherein the extracellular matrix has a Young's elastic modulus of about 7.4 kPa or less. [0150] 52. The method of embodiment 19, wherein the extracellular matrix has a Young's elastic modulus of about 3.2 kPa or less. [0151] 53. The method of embodiment 19, wherein the extracellular matrix has a Young's elastic modulus of about 1.7 kPa or less. [0152] 54. The method of embodiment 19, wherein the extracellular matrix has a Young's elastic modulus of about 1 kPa or less. [0153] 55. The method of embodiment 1, wherein the extracellular matrix is a hydrogel. [0154] 56. The method of embodiment 55, wherein the extracellular matrix is a polyacrylamide gel. [0155] 57. The method of embodiment 1, wherein the extracellular matrix is a silicone gel. [0156] 58. The method of embodiment 1, wherein the induced pluripotent stem cell is capable of differentiating into a cell type selected from the group consisting of adipocytes, neuronal cells, osteocytes, endothelial cells, erythrocytes, dendritic cells, platelets, lymphocytes, and myoblasts. [0157] 59. The method of embodiment 58, wherein the pluripotent stem cell is capable of differentiating into a neuronal cell, wherein the neuronal cell type is selected from the group consisting of cortical neurons, astrocytes, microglia, and oligodendrocytes. [0158] 60. The method of embodiment 1, wherein the non-pluripotent mammalian cell is a human cell selected from the group consisting of fibroblasts and peripheral blood mononuclear cells. [0159] 61. The method of embodiment 1, wherein the expression of one or more of the genes Oct4, Nanog and Sox2 is induced in the induced pluripotent stem cell relative to the non-pluripotent mammalian cell. [0160] 62. An embodiment comprising a method of inducing a non-pluripotent mammalian cell into an induced pluripotent stem cell, the method comprising contacting the non-pluripotent mammalian cell with two or more of the following: [0161] a. one or more mechanosensitive and stretch-activated ion channel inhibitors in an amount sufficient to inhibit the mammalian cell ion channels; [0162] b. one or more cell cholesterol reducing agents in an amount sufficient to reduce the mammalian cell cholesterol level; [0163] c. a soft extracellular matrix having a Young's elastic modulus of 20 kPa or less; [0164] wherein the non-pluripotent mammalian cell is not genetically modified to express pluripotency inducing factors; [0165] wherein the one or more mechanosensitive and stretch-activated ion channel inhibitors, if present, comprises GsMTX4 at a concentration of about 5 μM; [0166] wherein the one or more cholesterol reducing agents, if present, is methyl-β-cyclodextrin at a concentration of about 5 mM; and wherein the soft extracellular matrix, if present, has as Young's elastic modulus of about 7.5 kPa. [0167] 63. An embodiment comprising a method of inducing a non-pluripotent mammalian cell into an induced pluripotent stem cell, the method comprising contacting the non-pluripotent mammalian cell with two or more of the following: [0168] a. one or more mechanosensitive and stretch-activated ion channel inhibitors in an amount sufficient to inhibit the mammalian cell ion channels; [0169] b. one or more cell cholesterol reducing agents in an amount sufficient to reduce the mammalian cell cholesterol level; [0170] c. a soft extracellular matrix having a Young's elastic modulus of 20 kPa or less; [0171] wherein the non-pluripotent mammalian cell is not genetically modified to express pluripotency inducing factors; [0172] wherein the one or more mechanosensitive and stretch-activated ion channel inhibitors, if present, comprises GsMTX4 at a concentration of about 5 μM and the non-pluripotent mammalian cell is contacted with GsMTX4 for about 16 hours; [0173] wherein the one or more cholesterol reducing agents, if present, is methyl-β-cyclodextrin at a concentration of about 5 mM and the non-pluripotent mammalian cell is contacted with methyl-O-cyclodextrin for about 20 minutes; and wherein the soft extracellular matrix, if present, has as Young's elastic modulus of about 7.5 kPa. [0174] 64. The method of embodiment 62, wherein the induced pluripotent stem cell is capable of differentiating into a cell type selected from the group consisting of adipocytes, neuronal cells, osteocytes, endothelial cells, erythrocytes, dendritic cells, platelets, lymphocytes, and myoblasts. [0175] 65. The method of embodiment 62, wherein the pluripotent stem cell is capable of differentiating into a neuronal cell, wherein the neuronal cell type is selected from the group consisting of cortical neurons, astrocytes, microglia, and oligodendrocytes. [0176] 66. The method of embodiment 62, wherein the non-pluripotent mammalian cell is a human cell selected from the group consisting of fibroblasts and peripheral blood mononuclear cells. [0177] 67. The method of embodiment 62, wherein the expression of one or more of the genes Oct4, Nanog and Sox2 is induced in the induced pluripotent stem cell relative to the non-pluripotent mammalian cell. [0178] 68. The method of embodiment 63, wherein the induced pluripotent stem cell is capable of differentiating into a cell type selected from the group consisting of adipocytes, neuronal cells, osteocytes, endothelial cells, erythrocytes, dendritic cells, platelets, lymphocytes, and myoblasts. [0179] 69. The method of embodiment 63, wherein the pluripotent stem cell is capable of differentiating into a neuronal cell, wherein the neuronal cell type is selected from the group consisting of cortical neurons, astrocytes, microglia, and oligodendrocytes. [0180] 70. The method of embodiment 63, wherein the non-pluripotent mammalian cell is a human cell selected from the group consisting of fibroblasts and peripheral blood mononuclear cells. [0181] 71. The method of embodiment 63, wherein the expression of one or more of the genes Oct4, Nanog and Sox2 is induced in the induced pluripotent stem cell relative to the non-pluripotent mammalian cell. [0182] 72. A pharmaceutical composition comprising an isolated population of cells having a second non-pluripotent cell type, wherein the cells are obtained by a composition of converting animal cells from a first non-pluripotent cell type, and wherein the composition comprises inducing a non-pluripotent mammalian cell of a first cell type into an induced pluripotent stem cell by [0183] a. contacting the non-pluripotent mammalian cell with two or more of the following: [0184] i. one or more mechanosensitive and stretch-activated ion channel inhibitors in an amount sufficient to inhibit the mammalian cell ion channels; [0185] ii. one or more cell cholesterol reducing agents in an amount sufficient to reduce the mammalian cell cholesterol level; [0186] iii. a soft extracellular matrix having a Young's elastic modulus of 20 kPa or less, and [0187] b. inducing differentiation of the cells from step (a) into the second non-pluripotent cell type. [0188] 73. The composition of embodiment 72, wherein neither the first not the second non-pluripotent mammalian cell is genetically modified to express pluripotency inducing factors. [0189] 74. The composition of embodiment 72, wherein the mechanosensitive and stretch-activated ion channel inhibitor is selected from the group consisting of the L enantiomer of GsMTX4, the D enantiomer of GsMTX4, a peptide having a sequence at least 90% identical to the sequence of GsMTX4, or a mixture thereof. [0190] 75. The composition of embodiment 72, wherein the mechanosensitive and stretch-activated ion channel inhibitor is GsMTX4. [0191] 76. The composition of embodiment 74, wherein the mechanosensitive and stretch-activated ion channel inhibitor is at a concentration between about 10 μM and about 1 μM. [0192] 77. The composition of embodiment 74, wherein the mechanosensitive and stretch-activated ion channel inhibitor is at a concentration between 10 μM and 1 μM. [0193] 78. The composition of embodiment 74, wherein the mechanosensitive and stretch-activated ion channel inhibitor is at a concentration between about 7 μM and about 3 μM. [0194] 79. The composition of embodiment 74, wherein the mechanosensitive and stretch-activated ion channel inhibitor is at a concentration between 7 μM and 3 μM. [0195] 80. The composition of embodiment 74, wherein the mechanosensitive and stretch-activated ion channel inhibitor is at a concentration of about 5 μM. [0196] 81. The composition of embodiment 74, wherein the mechanosensitive and stretch-activated ion channel inhibitor is at a concentration of 5 μM. [0197] 82. The embodiment of claim 74, wherein the cells are contacted with the mechanosensitive and stretch-activated ion channel inhibitor for about 12 to about 96 hours. [0198] 83. The composition of embodiment 74, wherein the cells are contacted with the mechanosensitive and stretch-activated ion channel inhibitor for 12 to 20 hours. [0199] 84. The composition of embodiment 74, wherein the cells are contacted with the mechanosensitive and stretch-activated ion channel inhibitor for about 16 hours. [0200] 85. The composition of embodiment 74, wherein the cells are contacted with the mechanosensitive and stretch-activated ion channel inhibitor for 16 hours. [0201] 86. The composition of embodiment 74, wherein the cells are contacted with the mechanosensitive and stretch-activated ion channel inhibitor for 24 to 96 hours. [0202] 87. The composition of embodiment 74, wherein the cells are contacted with the mechanosensitive and stretch-activated ion channel inhibitor for 48 to 96 hours. [0203] 88. The composition of embodiment 74, wherein the cells are contacted with the mechanosensitive and stretch-activated ion channel inhibitor for about 72 hours. [0204] 89. The composition of embodiment 74, wherein the cells are contacted with the mechanosensitive and stretch-activated ion channel inhibitor for 72 hours. [0205] 90. The composition of embodiment 72, wherein the cell cholesterol reducing agent is a cyclodextrin. [0206] 91. The composition of embodiment 90, wherein the cyclodextrin is methyl-β-cyclodextrin. [0207] 92. The composition of embodiment 91, wherein the cyclodextrin is at a concentration between about 10 mM and about 1 mM. [0208] 93. The composition of embodiment 91, wherein the cyclodextrin is at a concentration between 10 mM and 1 mM. [0209] 94. The composition of embodiment 91, wherein the cyclodextrin is at a concentration between about 7 mM and about 3 mM. [0210] 95. The composition of embodiment 91, wherein the cyclodextrin is at a concentration between 7 mM and 3 mM. [0211] 96. The composition of embodiment 91, wherein the cyclodextrin is at a concentration of about 5 mM. [0212] 97. The composition of embodiment 91, wherein the cyclodextrin is at a concentration of 5 mM. [0213] 98. The composition of embodiment 91, wherein the cells are contacted with the cyclodextrin for about 15 to about 60 minutes. [0214] 99. The composition of embodiment 91, wherein the cells are contacted with the cyclodextrin for 15 to 60 minutes. [0215] 100. The composition of embodiment 91, wherein the cells are contacted with the cyclodextrin for about 20 to about 40 minutes. [0216] 101. The composition of embodiment 91, wherein the cells are contacted with the cyclodextrin for 20 to 40 minutes. [0217] 102. The composition of embodiment 91, wherein the cells are contacted with the cyclodextrin for about 15 to about 30 minutes. [0218] 103. The composition of embodiment 91, wherein the cells are contacted with the cyclodextrin for 20 to 30 minutes. [0219] 104. The composition of embodiment 91, wherein the cells are contacted with the cyclodextrin for about 20 minutes. [0220] 105. The composition of embodiment 91, wherein the cells are contacted with the cyclodextrin for 20 minutes. [0221] 106. The composition of embodiment 91, wherein the cells are contacted with the cyclodextrin for about 30 minutes. [0222] 107. The composition of embodiment 91, wherein the cells are contacted with the cyclodextrin for 30 minutes. [0223] 108. The composition of embodiment 72, wherein the extracellular matrix has a Young's elastic modulus of about 15 kPa or less. [0224] 109. The composition of embodiment 72, wherein the extracellular matrix has a Young's elastic modulus of about 10 kPa or less. [0225] 110. The composition of embodiment 72, wherein the extracellular matrix has a Young's elastic modulus of about 7.4 kPa or less. [0226] 111. The composition of embodiment 72, wherein the extracellular matrix has a Young's elastic modulus of about 3.2 kPa or less. [0227] 112. The composition of embodiment 72, wherein the extracellular matrix has a Young's elastic modulus of about 1.7 kPa or less. [0228] 113. The composition of embodiment 72, wherein the extracellular matrix has a Young's elastic modulus of about 1 kPa or less. [0229] 114. The composition of embodiment 74, wherein the extracellular matrix has a Young's elastic modulus of about 15 kPa or less. [0230] 115. The composition of embodiment 74, wherein the extracellular matrix has a Young's elastic modulus of about 10 kPa or less. [0231] 116. The composition of embodiment 74, wherein the extracellular matrix has a Young's elastic modulus of about 7.4 kPa or less. [0232] 117. The composition of embodiment 74, wherein the extracellular matrix has a Young's elastic modulus of about 3.2 kPa or less. [0233] 118. The composition of embodiment 74, wherein the extracellular matrix has a Young's elastic modulus of about 1.7 kPa or less. [0234] 119. The composition of embodiment 74, wherein the extracellular matrix has a Young's elastic modulus of about 1 kPa or less. [0235] 120. The composition of embodiment 90, wherein the extracellular matrix has a Young's elastic modulus of about 15 kPa or less. [0236] 121. The composition of embodiment 90, wherein the extracellular matrix has a Young's elastic modulus of about 10 kPa or less. [0237] 122. The composition of embodiment 90, wherein the extracellular matrix has a Young's elastic modulus of about 7.4 kPa or less. [0238] 123. The composition of embodiment 90, wherein the extracellular matrix has a Young's elastic modulus of about 3.2 kPa or less. [0239] 124. The composition of embodiment 90, wherein the extracellular matrix has a Young's elastic modulus of about 1.7 kPa or less. [0240] 125. The composition of embodiment 90, wherein the extracellular matrix has a Young's elastic modulus of about 1 kPa or less. [0241] 126. The composition of embodiment 72, wherein the extracellular matrix is a hydrogel. [0242] 127. The composition of embodiment 126, wherein the extracellular matrix is a polyacrylamide gel. [0243] 128. The composition of embodiment 72, wherein the extracellular matrix is a silicone gel. [0244] 129. The composition of embodiment 72, wherein the second non-pluripotent cell type is selected from the group consisting of adipocytes, neuronal cells, osteocytes, endothelial cells, erythrocytes, dendritic cells, platelets, lymphocytes, and myoblasts. [0245] 130. The composition of embodiment 129, wherein the second non-pluripotent cell type is a neuronal cell type selected from the group consisting of cortical neurons, astrocytes, microglia, and oligodendrocytes. [0246] 131. The composition of embodiment 72, wherein the first non-pluripotent cell type is a human cell selected from the group consisting of fibroblasts and peripheral blood mononuclear cells. [0247] 132. The composition of embodiment 72, wherein the expression of one or more of the genes Oct4, Nanog and Sox2 is induced in the first non-pluripotent cell type. [0248] 133. A pharmaceutical composition comprising an isolated population of cells having a second non-pluripotent cell type, wherein the cells are obtained by a composition of converting animal cells from a first non-pluripotent cell type, and wherein the composition comprises inducing a non-pluripotent mammalian cell of a first cell type into an induced pluripotent stem cell by [0249] a. contacting the non-pluripotent mammalian cell with two or more of the following: [0250] i. one or more mechanosensitive and stretch-activated ion channel inhibitors in an amount sufficient to inhibit the mammalian cell ion channels; [0251] ii. one or more cell cholesterol reducing agents in an amount sufficient to reduce the mammalian cell cholesterol level; [0252] iii. a soft extracellular matrix having a Young's elastic modulus of 20 kPa or less, and [0253] b. inducing differentiation of the cells from step (a) into the second non-pluripotent cell type; [0254] wherein the non-pluripotent mammalian cell is not genetically modified to express pluripotency inducing factors; [0255] wherein the one or more mechanosensitive and stretch-activated ion channel inhibitors, if present, comprises GsMTX4 at a concentration of about 5 μM; [0256] wherein the one or more cholesterol reducing agents, if present, is methyl-β-cyclodextrin at a concentration of about 5 mM; and wherein the soft extracellular matrix, if present, has as Young's elastic modulus of about 7.5 kPa. [0257] 134. The composition of embodiment 133, wherein the second non-pluripotent cell type is a cell type selected from the group consisting of adipocytes, neuronal cells, osteocytes, endothelial cells, erythrocytes, dendritic cells, platelets, lymphocytes, and myoblasts. [0258] 135. The composition of embodiment 133, wherein the second non-pluripotent cell type is a neuronal cell type, wherein the neuronal cell type is selected from the group consisting of cortical neurons, astrocytes, microglia, and oligodendrocytes. [0259] 136. The composition of embodiment 133, wherein the first non-pluripotent cell type is a human cell selected from the group consisting of fibroblasts and peripheral blood mononuclear cells. [0260] 137. The composition of embodiment 133, wherein the expression of one or more of the genes Oct4, Nanog and Sox2 is induced in the first non-pluripotent cell type. [0261] 138. A pharmaceutical composition comprising an isolated population of cells having a second non-pluripotent cell type, wherein the cells are obtained by a composition of converting animal cells from a first non-pluripotent cell type, and wherein the composition comprises inducing a non-pluripotent mammalian cell of a first cell type into an induced pluripotent stem cell by [0262] a. contacting the non-pluripotent mammalian cell with two or more of the following: [0263] i. one or more mechanosensitive and stretch-activated ion channel inhibitors in an amount sufficient to inhibit the mammalian cell ion channels; [0264] ii. one or more cell cholesterol reducing agents in an amount sufficient to reduce the mammalian cell cholesterol level; [0265] iii. a soft extracellular matrix having a Young's elastic modulus of 20 kPa or less, and [0266] b. inducing differentiation of the cells from step (a) into the second non-pluripotent cell type; [0267] wherein the non-pluripotent mammalian cell is not genetically modified to express pluripotency inducing factors; [0268] wherein the one or more mechanosensitive and stretch-activated ion channel inhibitors, if present, comprises GsMTX4 at a concentration of about 5 μM and the non-pluripotent mammalian cell is contacted with GsMTX4 for about 16 hours; [0269] wherein the one or more cholesterol reducing agents, if present, is methyl-β-cyclodextrin at a concentration of about 5 mM and the non-pluripotent mammalian cell is contacted with methyl-O-cyclodextrin for about 20 minutes; and [0270] wherein the soft extracellular matrix, if present, has as Young's elastic modulus of about 7.5 kPa. [0271] 139. The composition of embodiment 138, wherein the second non-pluripotent cell type is a cell type selected from the group consisting of adipocytes, neuronal cells, osteocytes, endothelial cells, erythrocytes, dendritic cells, platelets, lymphocytes, and myoblasts. [0272] 140. The composition of embodiment 138, wherein the second non-pluripotent cell type is a neuronal cell type, wherein the neuronal cell type is selected from the group consisting of cortical neurons, astrocytes, microglia, and oligodendrocytes. [0273] 141. The composition of embodiment 138, wherein the first non-pluripotent cell type is a human cell selected from the group consisting of fibroblasts and peripheral blood mononuclear cells. [0274] 142. The composition of embodiment 138, wherein the expression of one or more of the genes Oct4, Nanog and Sox2 is induced in the first non-pluripotent cell type. [0275] 143. A cell culture container comprising [0276] a. cell culture media, [0277] b. one or more mammalian cells treated with one or both of the following: [0278] i. one or more mechanosensitive and stretch-activated ion channel inhibitors in an amount sufficient to inhibit the mammalian cell ion channels; [0279] ii. one or more cell cholesterol reducing agents in an amount sufficient to reduce the mammalian cell cholesterol level; and [0280] c. a soft extracellular matrix having a Young's elastic modulus of 20 kPa or less. [0281] 144. The container of embodiment 143, wherein the mammalian cell is not genetically modified to express pluripotency inducing factors. [0282] 145. The container of embodiment 143, wherein the mechanosensitive and stretch-activated ion channel inhibitor is selected from the group consisting of the L enantiomer of GsMTX4, the D enantiomer of GsMTX4, a peptide having a sequence at least 90% identical to the sequence of GsMTX4, or a mixture thereof. [0283] 146. The container of embodiment 143, wherein the mechanosensitive and stretch-activated ion channel inhibitor is GsMTX4. [0284] 147. The container of embodiment 145, wherein the mechanosensitive and stretch-activated ion channel inhibitor is at a concentration between about 10 μM and about 1 μM. [0285] 148. The container of embodiment 145, wherein the mechanosensitive and stretch-activated ion channel inhibitor is at a concentration between 10 μM and 1 μM. [0286] 149. The container of embodiment 145, wherein the mechanosensitive and stretch-activated ion channel inhibitor is at a concentration between about 7 μM and about 3 μM. [0287] 150. The container of embodiment 145, wherein the mechanosensitive and stretch-activated ion channel inhibitor is at a concentration between 7 μM and 3 μM. [0288] 151. The container of embodiment 145, wherein the mechanosensitive and stretch-activated ion channel inhibitor is at a concentration of about 5 μM. [0289] 152. The container of embodiment 145, wherein the mechanosensitive and stretch-activated ion channel inhibitor is at a concentration of 5 μM. [0290] 153. The container of embodiment 143, wherein the cell cholesterol reducing agent is a cyclodextrin. [0291] 154. The container of embodiment 153, wherein the cyclodextrin is methyl-β-cyclodextrin. [0292] 155. The container of embodiment 154, wherein the cyclodextrin is at a concentration between about 10 mM and about 1 mM. [0293] 156. The container of embodiment 154, wherein the cyclodextrin is at a concentration between 10 mM and 1 mM. [0294] 157. The container of embodiment 154, wherein the cyclodextrin is at a concentration between about 7 mM and about 3 mM. [0295] 158. The container of embodiment 154, wherein the cyclodextrin is at a concentration between 7 mM and 3 mM. [0296] 159. The container of embodiment 154, wherein the cyclodextrin is at a concentration of about 5 mM. [0297] 160. The container of embodiment 154, wherein the cyclodextrin is at a concentration of 5 mM. [0298] 161. The container of embodiment 143, wherein the extracellular matrix has a Young's elastic modulus of about 15 kPa or less. [0299] 162. The container of embodiment 143, wherein the extracellular matrix has a Young's elastic modulus of about 10 kPa or less. [0300] 163. The container of embodiment 143, wherein the extracellular matrix has a Young's elastic modulus of about 7.4 kPa or less. [0301] 164. The container of embodiment 143, wherein the extracellular matrix has a Young's elastic modulus of about 3.2 kPa or less. [0302] 165. The container of embodiment 143, wherein the extracellular matrix has a Young's elastic modulus of about 1.7 kPa or less. [0303] 166. The container of embodiment 143, wherein the extracellular matrix has a Young's elastic modulus of about 1 kPa or less. [0304] 167. The container of embodiment 145, wherein the extracellular matrix has a Young's elastic modulus of about 15 kPa or less. [0305] 168. The container of embodiment 145, wherein the extracellular matrix has a Young's elastic modulus of about 10 kPa or less. [0306] 169. The container of embodiment 145, wherein the extracellular matrix has a Young's elastic modulus of about 7.4 kPa or less. [0307] 170. The container of embodiment 145, wherein the extracellular matrix has a Young's elastic modulus of about 3.2 kPa or less. [0308] 171. The container of embodiment 145, wherein the extracellular matrix has a Young's elastic modulus of about 1.7 kPa or less. [0309] 172. The container of embodiment 145, wherein the extracellular matrix has a Young's elastic modulus of about 1 kPa or less. [0310] 173. The container of embodiment 153, wherein the extracellular matrix has a Young's elastic modulus of about 15 kPa or less. [0311] 174. The container of embodiment 153, wherein the extracellular matrix has a Young's elastic modulus of about 10 kPa or less. [0312] 175. The container of embodiment 153, wherein the extracellular matrix has a Young's elastic modulus of about 7.4 kPa or less. [0313] 176. The container of embodiment 153, wherein the extracellular matrix has a Young's elastic modulus of about 3.2 kPa or less. [0314] 177. The container of embodiment 153, wherein the extracellular matrix has a Young's elastic modulus of about 1.7 kPa or less. [0315] 178. The container of embodiment 153, wherein the extracellular matrix has a Young's elastic modulus of about 1 kPa or less. [0316] 179. The container of embodiment 143, wherein the extracellular matrix is a hydrogel. [0317] 180. The container of embodiment 179, wherein the extracellular matrix is a polyacrylamide gel. [0318] 181. The container of embodiment 143, wherein the extracellular matrix is a silicone gel. [0319] 182. A cell culture container comprising [0320] a. cell culture media, [0321] b. one or more mammalian cells treated with one or both of the following: [0322] i. one or more mechanosensitive and stretch-activated ion channel inhibitors in an amount sufficient to inhibit the mammalian cell ion channels; [0323] ii. one or more cell cholesterol reducing agents in an amount sufficient to reduce the mammalian cell cholesterol level; and [0324] c. a soft extracellular matrix having a Young's elastic modulus of 20 kPa or less: [0325] wherein the non-pluripotent mammalian cell is not genetically modified to express pluripotency inducing factors; [0326] wherein the one or more mechanosensitive and stretch-activated ion channel inhibitors, if present, comprises GsMTX4 at a concentration of about 5 μM; [0327] wherein the one or more cholesterol reducing agents, if present, is methyl-β-cyclodextrin at a concentration of about 5 mM; and [0328] wherein the soft extracellular matrix, if present, has a Young's elastic modulus of about 7.5 kPa. [0329] 183. A method of increasing expression of an endogenous pluripotency inducing transcription factor in a somatic cell, comprising modifying the signaling of cell membrane receptors. [0330] 184. The method of embodiment 183, wherein the somatic cell is a fibroblast. [0331] 185. The method of embodiment 183, wherein the pluripotency inducing transcription factor is selected from Oct-4, Sox-2, Nanog and c-Myc. [0332] 186. The method of embodiment 183, wherein the cell membrane receptor is mechanosensitive and/or stretch-activated ion channel [0333] 187. The method of embodiment 183, wherein the cell membrane receptor signaling is modified by contacting the cell with a mechanosensitive and/or stretch-activated ion channel-specific inhibitor. [0334] 188. The method of embodiment 187, wherein the inhibitor is GsMTX4. [0335] 189. The method of embodiment 183, wherein the cell membrane receptor signaling is modified by depletion of at least one cellular lipid. [0336] 190. The method of embodiment 189, wherein the at least one cellular lipid is cholesterol. [0337] 191. The method of embodiment 189, wherein depletion of the cellular lipid occurs by contacting the cell with a molecule of the cyclodextrin family. [0338] 192. The method of embodiment 191, wherein the molecule is methyl-beta-cyclodextrin. [0339] 193. The method of embodiment 183, wherein the cell membrane receptor signaling is modified by culturing the cells in a low elastic extra cellular matrix. [0340] 194. The method of embodiment 193, wherein the matrix is a polyacrylamide gel. [0341] 195. The method of embodiment 194, wherein the polyacrylamide gel elasticity is lower than 7.4 k pascal. [0342] 196. The method of embodiment 183, wherein the cell membrane receptor signaling is modified by [0343] a. contacting the cell with a mechanosensitive and/or stretch-activated ion channel-specific inhibitor; [0344] b. depletion of at least one cellular lipid; and [0345] c. culturing the cells in a low elastic extra cellular matrix. [0346] 197. A cell produced by the method of embodiment 183, which expresses endogenous pluripotency transcription factors. [0347] 198. A cell produced by the method of embodiment 183, which expresses pluripotency inducing transcription factors. [0348] 199. A differentiated cell, which is derived from the cell of embodiment 198. [0349] 200. A kit for performing the method of embodiment 183. [0350] 201. The kit of embodiment 200, comprising a cholesterol depletion compound and a low elastic extra cellular matrix. [0351] 202. The kit of embodiment 200, comprising methyl-β-cyclodextrin and dried polyacrylamide gel.
9. EXAMPLES
[0352] The following Examples, which highlight certain features and properties of the exemplary embodiments of the invention described herein are provided for purposes of illustration, and not limitation.
9.1. Example 1
[0353] 9.1.1. Materials and Methods
[0354] Mice, Cells and Antibodies
[0355] C57BL/6 male mice (4-6 weeks old) were purchased from Jackson Laboratory. Bone marrow cells and spleen cells were obtained from 4-6-week-old male C57BL/6 mice. Cells in single cell suspension were red cell-depleted before use. Bone marrow stromal cells were cultured and passaged in T75 culture flask as it was described [Torino et al., Bio-protocol 4: e1031 (2014)]. The embryonic fibroblast was prepared from 13-day fetus of C57BL/6 as described previously [Qiu et al., Bio-protocol 6: e1859 (2016)]. Cells used for the reprogramming were those cultured for 2 to 4 passage periods.
[0356] MSAIC Inhibition Assay with GsMTX4
[0357] Cells were cultured in 6 well plates (10.sup.7 cells/well) in triplicate per group. GsMTX4 dissolved in PBS was added to the concentration 5 μM in the experimental group. Sixteen hours later, cells were harvested by scraper for spleen cells and bone marrow cells, pelleted for total RNA-extraction with RNeasy (Qiagen) or Trizol (Invitrogen). For EF cells and BM stromal cells, cell culture medium was drained and directly resuspended to the cell lysis buffer in the culture wells. Extracted RNAs were subjected to cDNA synthesis (Applied Bioscience) and analyzed for the messages specific for mouse PI genes and control genes by real time PCR thereto cycler (Bio-Rad, CFX384). Primers used were: Oct4 (5′: CTACAGTCCCAGGACATGAA (SEQ ID NO:5), 3′: TGGTCTCCAGACTCCACCTC (SEQ ID NO:6), Sox2 (5′: ATGATGGAGACGGAGCTGAA (SEQ ID NO:7), 3′: TTGCTGATCTCCGAGTTGTG (SEQ ID NO:8), Nanog (5′: AAGTACCTCAGCCTCCAGCA (SEQ ID NO:90), 3′: GCTTGCACTTCATCCTTTGG (SEQ ID NO:10), CFBP/α (5′: CGACTTCTACGAGGTGGAGC (SEQ ID NO:11), 3′: TCGATGTAGGCCGCTGATGTC (SEQ ID NO:12), c-Myc (5′: CACCATGCCCCTCAACGTGA (SEQ ID NO:13), 3′: TTATGCACCAGAGTTTCG (SEQ ID NO:14), RUNX1 (5′: CGTATCCCCGTAGATGGCAG (SEQ ID NO:15), 3′: GCCAGGGTGGTCAGCTAGTA (SEQ ID NO:16), PU1 (5′: AGAGCATACCAACGTCCAATGC (SEQ ID NO:17), 3′: GTGCGGAGAAATCCCAGTAGTG (SEQ ID NO:18), IRF8 (5′: CGTGGAAGACGAGGTTACGCTG (SEQ ID NO:19), 3′: GCTGAATGGTGTGTGTCATAGGC (SEQ ID NO:20), FOXP1 (5′: ATCCCAGAACGGGTCCAGCGGTGGCAACCAC (SEQ ID NO:21), 3′: GATCTGCTGCATTTGTTGAGGAGTGATAAC (SEQ ID NO:22), KLF4 (5′: GGTGCAGCTTGCAGCAGTAA (SEQ ID NO:23), 3′: AAAGTCTAGGTCCAGGAGGTCGTT (SEQ ID NO:24), Actin (5′: GTGACGAGGCCCAGAGCAAGAG (SEQ ID NO:25), 3′: AGGGGCCGGACTCATCGTACTC (SEQ ID NO:26), GAPDH 5′: CATCACCATCTTCCAGGAGCG (SEQ ID NO:27), 3′: ACGGACACATTGGGGGTAGG (SEQ ID NO:28). The value of each Cq (Ct) were applied to the formula by which the message level of each specific gene (shown by the index value) was estimated in comparison to that of Actin or GAPDH housekeeping genes.
[0358] Low Elasticity Tissue Culture Plates and Hydrogel Casting in Culture Plates
[0359] Tissue culture plates with defined elasticity surface (0.2, 4, 50 kpa) were purchased from Matrigen. To cast polyacrylamide gel in petri-dishes, 3.5 cm petri-dish was used. Each dish was loaded with 330 μL of polyacrylamide gel cocktail and promptly the size-matched drop lid (polypropylene) was placed on the top (
[0360] Ninety minutes later drop lids were carefully removed and the gels in the dishes were washed 5 times with 3 ml of sterile water. Each aspiration of the water from the dish was gently performed with 1 ml micro pipettor. During the washing, casted acrylamide gel come off the bottom. Lastly gels were saturated with DMEM/F12 medium for two hours before use. Every component for polyacrylamide gel except TEMED was filter sterilized. Drop lids were sterilized with 70% Et-OH and dried in the tissue culture hood. Whole process was performed in the tissue culture hood.
[0361] Treatment of Cells with MβCD and Reprogramming Culture
[0362] Cells were suspended in DMEM supplemented with 5 mM MβCD at the concentration of 2×10.sup.6/ml in 15 ml centrifuge tube. Cell suspension was incubated for 30 min at 37° C. with every 5 min gentle agitations. Washed once with 37° C. warmed DMEM/F12 and resuspended in small volume complete medium (30 μl/2×10.sup.6 cells) [DMEM/F12 (Corning), 20% knockout serum replacement (Gibco), 1% nonessential amino acids (Gibco), 5×10.sup.−5M 2-Mercaptethanol]. To initiate reprogramming culture on hydrogel, petri dish was added with 2.5 ml complete medium, then 30 μl of cell suspension was loaded on the hydrogel. Multiple dishes were housed in a 15 cm diameter petri dish with a water filled un-lid 6 cm petri dish. Cells on the gel and on the dish-bottom surface were monitored daily and the remarkable phenotype cells were recorded with EVOS cell monitoring system (Thermofisher). Various phenotype cells were characterized by the assays for the markers specific for the cell lineages (e.g., Oil red 0 for the adipocytes and alizarin for calcium deposited cells) as commonly available methods.
[0363] RT-PCR Assay for the Expression of PI Genes in the Reprogramming Cultures of EF Cells
[0364] Cells derived from the MβCD-treated and hydrogel-exposed culture in petri dish were subjected to the extraction of total RNA by Trizol. cDNAs were prepared as described above and the regular PCR was performed (35 cycle) using PCR master mix (Biotool) and the primers listed above for the real time PCR assays. The PCR products were resolved using 1.5% agarose gel, Ethidium Bromide-stained and the results were acquired by Gel Documentation system (Bio-Rad).
9.2. Example 2
[0365] Nuclear Reprogramming of Human Peripheral Blood Mononuclear Cells (PBMC)
[0366] Human PBMC is an attractive source of somatic cells for reprogramming to stem cells by the available iPSC technology. The sampling of the peripheral blood is a common practice in the medicine and possible to obtain at the individual specific fashion. The purification of the PBMC is also a regular method by Ficol gradient centrifugation. Previously, the standard iPSC technology by using Lentivirus resulted in the establishments of the set of iPSCs [Simara, Pavel et al. Stem cells and development vol. 27, 10-(2018), U.S. Pat. No. 9,447,382B2]. To investigate if the methods of the current invention can apply to reprogram human PBMC into the stem cell-like cells, and also differentiate into the de novo phenotypes in vitro, experiments were conducted in which cell were treated with MβCD and then cultured on the soft polyacrylamide gel as described infula.
[0367] Human peripheral blood was corrected into the heparinized tube from left forearm vein. The blood mononuclear cells were separated using the Ficoll-Hypaque technique (density, 1.077; Pharmacia Biotech, Uppsala, Sweden). Cells were twice repeatedly 37° C. incubated for 20 min with 5 mM MβCD in DMEM, pelleted by centrifugation at 900 g at room temperature. Washed once with 37° C. warmed DMEM/F12 and resuspended in small volume complete medium (30 μl/2×10.sup.6 cells) [DMEM/F12 (Corning), 20% knockout serum replacement (Gibco), 1% nonessential amino acids (Gibco), 5×10.sup.−5M 2-Mercaptethanol]. Cells in the culture petri-dishes were monitored daily by microscopy and novel phenotype cells were recorded. As shown in
[0368]
[0369] Importantly, the erythrocytes production is known to be strictly limited to originated from the bone marrow cells and not from the peripheral blood mononuclear cells [Dzierzak and Sjaak, Cold Spring Harbor perspectives in medicine vol. 3,4 a011601. 1 Apr. 2013, doi:10.1101/cshperspect.a011601]. Thus, the invention provided the unique and valuable opportunity to generate cells to meet the demand, to transfuse blood cells to the anemic as well as the lymphocytopenia.
9.3. Example 3
[0370] Somatic Cell Reprogramming Kit
[0371] The current discovery taught that somatic cells are reprogrammable to pluripotent stem cell-like cells after the attenuation of the mechanical stress. In this context, the in vitro culture on the low pascal (eg., 3.2 kpa) acrylamide gel surface transform fibroblastic cells to pluripotent stem cell-like cells. Additionally, the cellular cholesterol depletion with MβCD reprogram fibroblastic cells to pluripotent stem cell-like cells. Potentially, those techniques could generate novel platforms to reprogram somatic cells to stem cells and the subsequent differentiation to different type of cells. A kit that enables standard skilled person to reprogram somatic cells comprises a 3.5 cm diameter petri dish, in which soft polyacrylamide gel is casted and dried, and an aliquot of MβCD powder in a tube. The following describes the “Materials, Methods, and Procedures” associates with the “Somatic cell reprogramming kit”
[0372] 9.3.1. Materials and Methods
[0373] Tubes containing reprogramming reagents (MβCD). Each tube for one cell type reprogramming.
A set 35 mm petri-dishes containing dried stem cell matrix (acrylamide gel). Each petri dish has dried polyacrylamide gel with different elasticity after the rehydration as one has the 1.7 kpa, second, 3.2 kpa, and the third has 7.4 kpa. The different softness of the matrix in each dish, thus could be selected for the optimum reprogramming and the subsequent re-differentiation for the specific somatic cell of interest.
DMEM with antibiotics
Complete medium: DMEM/F-12 with antibiotics, Knockout serum (20%), Nonessential amino acid (1×), 2-Mercaptoethanol at 5×10.sup.−5M.
Petri dishes (14 cm diameter; 6 cm diameter)
Disposable 10 ml syringe
Syringe filter (0.22 μm)
Cell imaging system to keep records, e.g., EVOS cell imaging system (ThermoFisher).
[0374] Daily Protocol
Day 1
[0375] In the tissue culture hood, place petri-dishes in a 14 cm petri-dish, which houses a clean water filled 5.5 cm petri-dish without lid. Add 3 ml of the complete medium to 3.5 cm petri-dishes with stem cell matrix (dried polyacrylamide gel).
See
Day 2
[0376] Monitor the petri-dishes for any contamination and the presence of the reconstituted stem cell matrix.
Day 3
[0377] Monitor the petri-dishes for any contamination.
Prepare the reprogramming solution right before the use. Dissolve the reprogramming reagents in the tube to 5 ml DMEM. Voltex well to mix/dissolve completely and sterilize by the syringe filter.
Warm at 37° C.
[0378] Harvest embryonic fibroblast cells (3-5 million cells) to 15 ml conical tube.
Wash once with DMEM.
[0379] Resuspend cell pellets to the half volume of the reprogramming MβCD solution (˜2.5 ml), incubate at 37° C. for 20 min with mixing every 5 min. Spin and pellet, remove the supernatant then resuspend again to the remaining half (˜2.5 ml) of the reprogramming solution, continue additional 20 min 37° C. incubation with every 5 min mixing. Spin down (no need to wash) and resuspend the pellet to 20-30 μl complete medium. With 200 μl pipetman, gently seed cells on the stem cell matrix in the 35 mm petri-dish. Seed ˜20 μl on the matrix per petri-dish (
Day 7
[0380] Add βFGF (10 ng/ml)
Day 8 and Beyond
[0381] Monitor cells on the matrix and the bottom surface of the culture.
9.4. Discussion
[0382] The investigation was conducted to test if the signaling of MSAIC in bone marrow cells could activate the expression of pluripotency inducing (PI) genes. To modify the signaling of MSAICs the employed was GsMTX4 [Gnanasambandam et al., Biophys. J. 112:31 (2017)], which possesses the specific functional blocking activity against MSAICs [Park et al., PAIN, 137:208 (2008)]. GsMTX4 is a water soluble 34.sup.mer peptide purified from the venom of the Theraphosidae family spider (Tarantula) that was previously used to increase the mechanical threshold of sensory neurons for touch, pressure, proprioception, and pain [Bowman et al., Toxicon, 49:249 (2007)]. To characterize the PI gene expression, the water soluble GsMTX4 was useful because some other MSAIC inhibitors (e.g., HC 067047 [Everaerts et al., Proc. Natl. Acad. Sci. USA 107:19084 (2010)]) are only soluble in DMSO or alcohols, which were by themselves known to alter the expression of PI genes [Czysz et al., PLoS One, 10 (2) (2015); Ogony et al., Stem Cells Dev., 22: 2196 (2013)].
[0383] In experiments, mouse bone marrow cells were in vitro 37° C. cultured 16 hours in the presence of 5 μM GsMTX4. Cells were then assayed for the PI genes' messages as listed in the left of the
[0384] The fresh bone marrow cells were cultured for 16 hours in 6 well plates with GsMTX4 (5 μM) in DMEM supplemented with 10% FBS. The messages specific for the genes listed in the left were real time PCR-characterized and presented as the relative index in comparison with the value of β-actin message. Each experimental value shown was the average and the standard deviation of triplicate samples. The results shown represent three experiments with similar results.
[0385] When RNAs were assayed for the expression of non-PI genes, IRF8 and FOXP1, the expression change was small and no compare to that of PI genes. Therefore, GsMTX4 enhanced the PI gene expression in the gene-specific manner. The study showed that the stretch insults detected by the MSAICs, sensitively/dominantly suppressed the expression of PI genes in bone marrow cells. It may be construed that the stiffer extra-cellular matrix-stimulated MSAIC signaling promotes the stem cell differentiation by reducing the pluripotent differentiation potentials.
[0386] The GsMTX4-mediated inhibition of MSAICs is assumed to render the micro-environment, in which cells were in contact with the soft extracellular matrix. In this context, to obtain the insights in depth, the investigated was the response of bone marrow cells cultured in various stiffness tissue culture wells. The stiffness chosen were 0.2 k pascal, 4 k pascal and 50 k pascal. Cells were cultured 16 hours in the wells and assayed for the PI genes-expression as described above. Significantly, the prominent expression of the PI genes was observed at the specific stiffness as 4 k pascal induced the highest and 0.2 or 50 k pascal showed lower levels of induction (
[0387] Bone marrow cells were cultured in the 6 well plates coated with the specific stiffness matrix as listed in the left. The messages of the genes listed left were qPCR-characterized as described in the
[0388] The regulation of PI genes in spleen cells by GsMTX4 contradicts to that observed in bone marrow cells. When spleen cells were cultured 16 hours in the presence of GsMTX4 the activation of PI genes was not observed, instead, although the expression level was low, the PI genes expression was consistently repressed (
[0389] To investigate, more definitively, the cells possessing the opposite phenotypes when exposed to the same pressure and stretch stress, the study was extended by preparing a bone marrow-derived stromal cell line and an EF line. When bone marrow stroma cell line was O/N cultured in the presence of GsMTX4, the activation of PI genes in the cell resembled to that of fresh bone marrow cells (
[0390] The data showed that the PI gene's regulation pattern induced by the mechanical stress could be inherited in the in vitro-adapted cell lines. The data also indicated that the specific phenotype in response to MSAIC signaling is not because of the transient mechanism resulting from the in vivo to in vitro adaptation but of an intrinsically programmed mechanism. This stable phenotype of the PI gene regulation by MSAICs may be relevant to the mechanism, which renders stem cells to retain the pluripotency.
[0391] In further experiments the PI gene regulation in spleen cells and EF cells was investigated three days after the onset of the GsMTX4 treatment to obtain the insight if the repression is continuous. When assayed the PI gene expression the repression was no longer detected, instead, the activation of the PI genes was significantly observed (
[0392] Spleen cells were cultured in 6 well plates as described in
[0393] The data showed that the repression of PI genes in response to MSAIC inhibition was transient. Thus, the origin of the cells appeared to influence the early response against the mechanical stress measured by the PI genes' expression. The results seemed to reveal an unprecedented receptor mechanism, of which the same input of the stimulation causes entirely different outcome dependent on the type of cells, possibly because of the different stages of the cell differentiation.
[0394] The results indicated the presence of distinct type somatic cells following the attenuation of MSAIC signaling; one promptly activates the PI genes and the second responds in the delayed mode activate PI genes after the transient suppression. The data also showed that a prolonged attenuation of MSAIC signaling could reprogram both somatic cell types to acquire the stem cell like phenotypes possessing the high levels of PI genes.
[0395] Cholesterol depletion from spleen cell modified cells to respond against GsMTX4 in a resembling fashion to that of the bone marrow cells.
[0396] To obtain an insight into the molecular mechanism, which distinguishes spleen cells from bone marrow cells following the MSAIC inhibition, the roles of different stiffness and the signaling potential of cell membrane were investigated. In the physiological condition with a stable temperature, the cholesterol level, which is known to be higher in spleen than in bone marrow, would alter the cell membrane stiffness [Los and Murata, Biochim. Biophys. Acta. 1666:142 (2004); Simons and Sampaio, Cold Spring Harb. Perspect Biol. 3 (10) (2011)]. Cholesterol also plays a central role for the membrane receptor signaling by forming lipid rafts, in which MSAICs reside and initiate the mechanosensory signals [Szoke et al., Eur. J. Pharmacol. 628:67 (2010)]. Spleen cells were investigated for the expression of PI genes after the treatment with MβCD, which depletes cholesterol from cell membrane [Mahammad and Parmryd, Methods Mol. Biol. 1232: 91 (2015)]. Strikingly, the spleen cells treated with MβCD showed the activation of PI genes in response to GsMTX4 treatment in O/N culture (
[0397] Spleen cells were 37° C.-treated with MβCD before the in vitro culture with GsMTX4 as described in
[0398] The results demonstrated that the level of the cholesterol in the cell membrane determined the resulting PI gene's expression in response to the MSAIC inhibition.
[0399] Conversion of EF cells to pluripotent stem cell-like cells by the depletion of cellular lipids and/or soft extra-cellular matrix.
[0400] A cell culture method was developed by which cells acquired pluripotent stem cell-activity, as was seen with EF cells gene-transfected with PI genes [Takahashi and Yamanaka, Cell, 126:663 (2006)]. Cells were treated with MβCD, then seeded on the low pascal hydrogels (1,7 kpa, 3.2 kpa and 7.4 kpa). Within 60 min, after the initiation of the culture, cells adhered tightly to the hydrogel, then the formation of various size spheres were observed in the O/N culture (
[0401] To investigate the expression of PI genes, the total RNAs from the sphere and the well bottom-adhered cells (spilled from the gel surface during the seeding procedure) were RT-PCR characterized by 1.5% agarose gel electrophoresis.
[0402] EF cells were MβCD-treated and cultured in the hydrogel-casted petri dishes for 7 days before RNA extraction. The stiffness of the hydrogel was listed on the top of each lane. Total RNAs from spheres and dish-adhered cells were analyzed for the expression of the PI genes by RT-PCR. PCR-amplified fragments were dissolved by 1.5% agarose gel and stained by Ethidium Bromide. Mouse embryonic stem (mES) cell total RNA was used as the positive control. From left to right, a; Oct4 analysis, b; Nanog analysis, c; Sox2 analysis.
[0403] As shown in the
[0404] The study was extended by investigating the activation kinetics of the PIF messages induced in the cells attached to the well bottom surface (
[0405] EF cells were MβCD-treated and cultured in the petri dishes. Microscopic morphological views at day 1, day 4 and day 7 after the onset of the experiment was shown in A. The total RNA was extracted at the time points listed on the top. The message for each PI gene was analyzed as described in
[0406] Surprisingly, un-spliced messages within 24 hours after the cholesterol depletion were detected. The spliced messages were present only in the cells cultured 7 days. The results indicated that 1) the cholesterol depletion activated PI genes precursor transcription within 24 hours, 2) the expression of the spliced messages starts later after 4 days but before 7 days and 3) the soft hydrogel prevented the splicing of the precursor messages of the PI genes. Thus, the softness of the extracellular matrix profoundly controlled the activation and splicing mechanisms of PI genes in somatic cells.
[0407] To investigate if the differentiation of new phenotype cells follows in the continuing culture from those PI gene-activated pluripotent stem cell-like cells, cells were cultured for an extended period. Within fourteen days, most of the spheres on the gel dissolved to the clusters of round cells (
[0408] Specifically, the EF cells were MβCD-treated and cultured in 3,2 kpa hydrogel-casted petri dishes. Cells differentiated on the dish bottom were photographed as they were observed. Based on the reported phenotypes of the different lineage cells, each cell unique from the original EF cell (
[0409] Clusters of the cells resembled immature adipocytes, and those cells transformed to the mature adipocytes within several days (
[0410] Brown adipocytes (
[0411] On the other hand, the staining with Alizalin demonstrated the calcium deposits and osteoblastic cells in the specific area of the culture (
[0412] The presence of the osteoblasts/osteocytes was demonstrated with Alizalin staining and shown in
[0413] Neuronal cell-like cells at the size 100-500 μm (
[0414] Often observed within 10 days were the neuronal cells including cortical neuron-like cells (
[0415] Similar phenotype cells tended to cluster in the specific areas of the bottom surface (
[0416]
[0417] Later after 3 weeks, the well-developed neuronal cell clusters (
[0418] Five examples of the cells interacted and formed the alignment were shown.
[0419] Thus, the results suggested that the pluripotent stem cell-like cells derived from EF cells vigorously differentiated into various lineage cells in vitro.
[0420] Spheres were harvested from the surface of 3.2 kpa acrylamide gel with Trypsin treatment as described in
[0421] Hydrogel alone can activate PI genes in EFs to generate stem cell-like cells, but the efficiency is low and takes long incubation time before reprogrammed and differentiated cells start populating on the bottom surface of the petri dish.
[0422] MβCD only-treatment induces stem cell-like cells within a week with a greater efficiency than that of the hydrogel only.
[0423] Combined treatment with MβCD and the hydrogel results in the highest efficiency to the development of differentiated cells on the bottom of petri dish.
[0424] The Examples presented supra indicated that the current invention can reprogram somatic cells to pluripotent stem cell-like cells, which possess functions to differentiate to various phenotype cells with different functions. The discovery is that MSAIC signal repress the PI gene expression and the inhibition of the MSAIC signal render somatic cells express PI genes and acquire the pluripotency. The discovery taught multiple methods to attenuate MSAIC signaling in somatic cells: specific inhibitor, GsMTX4, soft polyacrylamide gel and the cholesterol depletion with MβCD. All methods are capable to activate PI genes and reprogram somatic cells. The discovery also taught that the combined use of different methods potentiates the reprogramming of somatic cells. The discovery taught the re-differentiation of the pluripotent stem cell-like cell generates large repertoire of somatic cells. All those differentiated cells are expected to be useful for the regenerative therapy. Among them, for example, osteocytes are useful to reconstitute bone fracture and neuronal cells are expected to restore the neuronal injury and the brain diseases, Parkinson disease and Alzheimer's diseases. It is also anticipated that, based on these examples, the present invention will provide novel methods of treatment of diseases that either enhance or repress cellular regeneration. The invention will broadly encompass the use of the PS-like cells and the re-differentiated cells for treatment or prevention of diseases wherein enhanced presence of specific type somatic cell is desirable.
[0425] It is to be understood that the invention is not limited to the embodiments listed above and the right is reserved to the illustrated embodiments and all modifications coming within the scope of the following claims.
[0426] The various references to journals, patents, and other publications which are cited herein comprise the state of the art and are incorporated by reference as though fully set forth.