Lentiviral Vector Capable of Directly Reflecting Type I Interferon Response, Preparation Method Thereof, and Applications Thereof

20190119700 ยท 2019-04-25

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided are a method for establishing a lentiviral vector system capable of directly reflecting type I interferon response, and applications thereof. The method for establishing the lentiviral vector system comprises: cutting a Gaussia luciferase at the position of amino acid 109, removing 16 amino acids from N-terminus, and cloning the two polypeptides into a lentiviral vector to form a lentiviral BiLC expression vector; and cloning a shuttle plasmid of pEntry-IRF3 or pEntry-IRF5 or pEntry-IRF7 by homologous recombination into the lentiviral BiLC expression vector, so as to construct a lentiviral vector IRF3-BiLC or IRF5-BiLC or IRF7-BiLC capable of directly reflecting type I interferon response.

Claims

1. A lentiviral vector capable of directly reflecting type I interferon response, wherein Gaussia luciferase is cleaved at a position of amino acid 109 into two polypeptides of N-terminus and C-terminus, and 16 amino acids from the N-terminus are removed, and the resulting two polypeptides are denoted as GlucN and GlucC and are cloned into the lentiviral vector to form a lentiviral BiLC expression vector; then a shuttle plasmid of pEntry-IRF3 or pEntry-IRF5 or pEntry-IRF7 is cloned by homologous recombination into the above-mentioned lentiviral BiLC expression vector to construct a lentiviral vector IRF3-BiLC or IRF5-BiLC or IRF7-BiLC capable of directly reflecting type I interferon response.

2. The lentiviral vector capable of directly reflecting type I interferon response according to claim 1, wherein it is guaranteed that the amino acid sequence encoded by the IRF3 or IRF5 or IRF7 gene in the pEntry-IRF3 or pEntry-IRF5 or pEntry-IRF7 has a sequence homology of not less than 80% with NP_001184051.1 or NP_001092097.2 or NP_001563.2 respectively, and the gene sequence of the IRF3-BiLC or IRF5-BiLC or IRF7-BiLC vector is kept consistent with the gene sequence corresponding to IRF3 or IRF5 or IRF7.

3. Use of the lentiviral vector capable of directly reflecting type I interferon response according to claim 1, wherein the lentiviral vector is capable of constructing a cell line which induces the body to directly reflects type I interferon response when the body is infected by viruses, bacteria, fungus, and other microorganisms.

4. Use of the lentiviral vector capable of directly reflecting type I interferon response according to claim 1, wherein the lentiviral vector is capable of constructing a cell line which induces the body to generate innate immune response under the conditions of chronic inflammations caused by autoimmune system disorders of the body and a series of microenvironments of tumor tissues.

5. The use of the lentiviral vector capable of directly reflecting type I interferon response according to claim 3, wherein the cell line is a THP-1 (IRF3-BiLC) cell line, a THP-1 (IRF5-BiLC) cell line, a THP-1 (IRF7-BiLC) cell line, or a THP-1-Dual cell line.

6. The use of the lentiviral vector capable of directly reflecting type I interferon response according to claim 5, wherein the method for constructing the cell line comprises the following steps: S1. Construction of plasmids: IRF3, IRF5, or IRF7 gene is amplified by a specific primer, and a double enzyme digestion of the amplified products is performed, followed by ligation to a vector by T4 ligase, and the shuttle plasmid of a full-length pEntry-IRF3, pEntry-IRF5, or pEntry-IRF7 is extracted; S2. Construction of a lentiviral expression vector: GlucN and GlucC portions are adopted and are cloned into the lentiviral vector respectively; S3. Construction of the lentiviral vector capable of directly reflecting type I interferon response: the constructed shuttle plasmid of the full-length pEntry-IRF3, pEntry-IRF5, or pEntry-IRF7 is homologously recombined into the inducible lentiviral expression vector formed in S2 by cloning technology to form pBiLC-IRF3-GlucN and pBiLC-IRF3-GlucC, or pBiLC-IRF5-GlucN and pBiLC-IRF5-GlucC, or pBiLC-IRF7-GlucN and pBiLC-IRF7-GlucC, which express IRF3-GlucN fusion protein and IRF3-GlucC fusion protein, or IRF5-GlucN fusion protein and IRF5-GlucC fusion protein, or IRF7-GlucN fusion protein and IRF7-GlucC fusion protein respectively; S4. Construction of a cell stably expressing IRF3-BiLC, IRF5-BiLC or IRF7-BiLC: the IRF3-GlucN fusion protein-expressing vector and the IRF3-GlucC fusion protein-expressing vector, or the IRF5-GlucN fusion protein-expressing vector and the IRF5-GlucC fusion protein-expressing vector, or the IRF7-GlucN fusion protein-expressing vector and the IRF7-GlucC fusion protein-expressing vector are integrated into the corresponding cells by a pMDLg/pRRE, pRSV-Rev, pMD2.G three-plasmid system; wherein the sequence of the specific primer used for the amplification of the IRF3, IRF5 or IRF7 gene in S1 is SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6.

7. The use of the lentiviral vector capable of directly reflecting type I interferon response according to claim 6, wherein the amplification condition of the IRF3, IRF5, or IRF7 gene in S1 is: pre-denaturation at 95 C. for 2 min; followed by 30 cycles, and the condition of each cycle is denaturation at 95 C. for 20 s, annealing at 56 C. for 30 s, elongation at 72 C. for 1 min; and lastly, elongation at 72 C. for 5 min.

8. The use of the lentiviral vector capable of directly reflecting type I interferon response according to claim 6, wherein IRF3-GlucN and IRF3-GlucC, IRF5-GlucN and IRF5-GlucC, or IRF7-GlucN and IRF7-GlucC belong to IRF3-BiLC, IRF5-BiLC, or IRF7-BiLC reporter system respectively, and they are based on a lentiviral vector system, which may be used either as a stable transfection system or as a transient transfection system.

9. The use of the lentiviral vector capable of directly reflecting type I interferon response according to claim 4, wherein the cell line is a THP-1 (IRF3-BiLC) cell line, a THP-1 (IRF5-BiLC) cell line, a THP-1 (IRF7-BiLC) cell line, or a THP-1-Dual cell line.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0032] FIG. 1 is a schematic diagram of the structure of a constructed IRF-BiLC plasmid.

[0033] FIG. 2a is a graph illustrating the detected signal values of IRF3 dimers induced by different stimulus conditions in THP-1 (IRF3-BiLC).

[0034] FIG. 2b is a graph illustrating the detected signal values of IRF5 dimers induced by different stimulus conditions in THP-1 (IRF5-BiLC).

[0035] FIG. 2c is a graph illustrating the detected signal values of IRF7 dimers induced by different stimulus conditions in THP-1 (IRF7-BiLC).

[0036] FIG. 3 is a graph illustrating the detected effects of different IFN stimulations on IRF3-BiLC.

[0037] FIG. 4 is a graph illustrating the detected effects of different IFN stimulations on ISRE-Luc.

[0038] FIG. 5 is a graph illustrating the detected effect of CHX on IRF3-BiLC.

[0039] FIG. 6 is a graph illustrating the detected effect of CHX on ISRE-Luc.

DETAILED DESCRIPTION

[0040] The present disclosure specifically discloses a reporter cell line that specifically, sensitively, and directly reflects type I interferon response, and a construction method and the specific application of the reporter cell line. The technical solution of the present disclosure is described in detail as follows.

[0041] 1. Construction of IRF3-BiLC, IRF5-BiLC, or IRF7-BiLC Lentiviral Vector

[0042] The principle of BiLC is as follows: Gaussia luciferase is cleaved at a specific site to form two polypeptides of N-terminus and C-terminus without luciferase activity, which are denoted as N-fragment and C-fragment (Remy and Michnick, 2006; Cassonnet et al., 2011; Tannous et al., 2005). When these two fragments are co-expressed in cells or mixed in vitro, they cannot be assembled spontaneously into active luciferase proteins. However, when the fragments of these two luciferase proteins are respectively linked to a group of target proteins having interactions and co-expressed in cells or the two fusion proteins are mixed in vitro, due to the interactions of the target proteins, the two fragments of the luciferase protein are spatially close to each other and complement each other, and are reconstituted into a complete and active luciferase protein molecule that emits fluorescence with coelenterazine (CTZ) as substrate under the condition of CTZ as substrate. In short, if there are interactions between the target proteins, there will be fluorescence produced by luciferase with CTZ as substrate; on the contrary, if there is no interaction between the proteins, there will be no luciferase activity. Gaussia luciferase was cleaved into N-terminus and C-terminus at a position of amino acid 109, and 16 amino acids at the N-terminus were removed. The two polypeptides were denoted as GlucN and GlucC respectively. Humanized GlucC and GlucN gene fragments synthesized by Shanghai Generay Biotech Co., Ltd. entered a lentiviral vector (US20120201794 A1) by T4 ligase (purchased from NEB) via AscI and RsrII (purchased from NEB) restriction sites, denoted as pBiLC1-2.

[0043] On the other hand, the IRF3, IRF5, and IRF7 genes are all members of the interferon regulatory factor family, and their structures and functions have a certain degree of similarity. A variant of the amino acid sequence of IRF3 or IRF5 or IRF7 of the present disclosure may be a substitution variant, an insertion variant or a deletion variant. As compared to the wild-type or unaltered polypeptides or other reference polypeptides, mutations in the genes encoding the polypeptides may affect 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, 325, 350, 375, 400, 425, 450 or more non-contiguous or contiguous amino acids (i.e., segments) of the polypeptides.

[0044] According to the technical solution of the present disclosure, the IRF3 (NM_001197122.1), IRF5 (NM_001098627.3), and IRF7 (NM_001572.3) genes were amplified by designing specific primers and using cDNA of cells of human origin as a template. Said amplification condition was: pre-denaturation at 95 C. for 2 min; followed by 30 cycles, and the condition of each cycle was denaturation at 95 C. for 20 s, annealing at 56 C. for 30 s, elongation at 72 C. for 1 min; and lastly, elongation at 72 C. for 5 min. The above-mentioned primer sequences are shown in Table 1.

TABLE-US-00001 TABLE1 Primersequences SEQIDNO:1 PA-F ATAGCGGCCGCAATGGGAACCCCAAAGCC SEQIDNO:2 PA-R GGCGCGCCCTTGGTTGAGGTGGTGGGG SEQIDNO:3 PA-F ATAGCGGCGCAATGAACCAGTCCATCC SEQIDNO:4 PA-R GGCGCGCCCCTTTTTATTGCATGCCAG SEQIDNO:5 PA-F ATAGCGGCCGCAATGGCCTTGGCTCCTG SEQIDNO:6 PA-R GGCGCGCCCTTCTAGGCGGGCTGCTCC

[0045] PCR products and a pEntry vector (purchased from the Invitrogen Corporation) were double digested with NotI and AscI (purchased from the NEB Corporation), and the fragments were ligated to the pEntry vector using T4 ligase (purchased from the NEB Corporation). After verification by sequencing, plasmids were extracted, preserved and denoted as pEntry-IRF3, pEntry-IRF5, and pEntry-IRF7. By Gateway cloning technology, pEntry-IRF3, pEntry-IRF5, and pEntry-IRF7 were cloned into the lentiviral BiLC expression vectors to obtain pBiLC-IRF3-GlucN and pBiLC-IRF3-GlucC, pBiLC-IRF5-GlucN and pBiLC-IRF5-GlucC, or pBiLC-IRF7-GlucN and pBiLC-IRF7-GlucC, which express the fusion proteins of IRF3-GlucN and IRF3-GlucC, IRF5-GlucN and IRF5-GlucC, or IRF7-GlucN and IRF7-GlucC, respectively. The constructed plasmid was exemplified by pEntry-IRF3, as shown in FIG. 1.

[0046] 2. Detection of the Responses of IRF3-BiLC and the Like to Different Stimulations

[0047] THP-1 cell line stably expressing IRF3-BiLC, IRF5-BiLC, or IRF7-BiLC was constructed. The specific operation steps were as follows with IRF3-BiLC as an example:

[0048] a. Lentiviral packaging: One day before transfection, HEK293T cells (ATCC: CRL-11268) were plated in a 24-well plate (purchased from the Thermo Corporation) in 500 L of DMEM (purchased from Invitrogen) complete culture medium (10% FBS, purchased from Gibco); transfection was performed when the cells reached a density of 50%-60%, and about 1 g of plasmid in total was used for transfection in each well, wherein:

[0049] pMDLg/pRRE:pRSV-Rev:pMD2.G:IRF3-GlucN/IRF3-GlucC=4:2:1:2.

[0050] After 8 h of transfection, the culture medium was removed, and 1 mL of fresh culture medium was supplemented. After 48 h, the supernatant was collected into an EP tube and centrifuged at 2500 rpm for 4 min. The supernatant was transferred into a new EP tube for virus invasion.

[0051] b. Virus invasion: 18 h before virus collection, 10,000 THP-1 cells (Invivogen) were plated in a 96-well plate (purchased from the Thermo Corporation) using 100 L of DMEM. Before invasion, approximately 50 L of RMPI 1640 was removed. 6 g/mL of polybrene (purchased from Sigma) was added into the collected supernatant of the virus solution, mixed well, and about 100 L of virus solution was added into each well of the 96 wells. After 6-8 h of invasion, 50 L of the culture medium in each wells of the 96 wells was removed, and 100 L of fresh culture medium was added. After 72 h, the cells could be transferred out of the 96-well plate for screening and expansion culture, thus a THP-1 (IRF3-BiLC) cell line was obtained.

[0052] The obtained THP-1 (IRF3-BiLC) cell line was used to test the luciferase activities formed by the dimerization of IRF3, IRF5, and IRF7 under different stimulations. TNF, IL-1B, LPS, polyI:C, polydA:dT, and VSV-EGFP were used for stimulation, respectively. Lysis was performed on ice for 10 min using 80 L of Renilla luciferase lysate (purchased from Promega, E2820). The mixture was mixed well by a pipette and 50 L of cell lysate was transferred to a luciferase detector plate (purchased from PE). 20 L of Renilla luciferase substrate (purchased from Promega, E2820) was added per well, and the luciferase activity was detected by a microplate reader (purchased from Bio-Tek, Synergy H1).

[0053] Similar to the above-mentioned steps, THP-1 cell lines of IRF5-BiLC and IRF7-BiLC could be constructed, and the results of the dimer formation of IRF3, IRF5, and IRF7 were detected. The results are as shown in FIG. 2a, FIG. 2b, and FIG. 2c. It can be seen from the figures that TNFa and IL-1B cannot cause the formation of the signals of the IRF3, IRF5, and IRF7 dimers, while LPS, polyI:C, polydA:dT, and VSV-eGFP may cause the signals of the IRF3, IRF5, and IRF7 dimers to varying degrees.

[0054] 3. Detection of the Specificity of IRF3-BiLC to Reflect the Interferon Response Reaction

[0055] THP-1-Dual (with a stable expression's ISRE-Luc reporter system, purchased from the Invivogen Corporation) or THP-1 (IRF3-BiLC) cells were plated in a 24-well plate at a concentration of 1000,000 cells per mL. After 14 hours, transfection was performed. The plated cells were divided into 8 groups. Among them, for four groups of Dual, one group was denoted as NT group, and IFN (final concentration: 10 ng/mL), IFN (final concentration: 10 ng/mL), IFN (final concentration: 20 ng/mL) were added into the other three groups respectively; four groups of IRF3-BiLC were treated in the same manner as the four groups of ISRE-Luc. At 24 hours, firefly luciferase (with Renilla luciferase as an internal reference) and Gaussia luciferase (with firefly luciferase as an internal reference) were detected respectively.

[0056] The results are shown in FIG. 3 and FIG. 4: the IRF3-BiLC groups are not affected by the secondary amplification and activation of interferon, while the ISRE-Luc groups are strongly affected and cannot specifically reflect the induction of type I interferon.

[0057] 4. Detection of the Universality of the Application of IRF3-BiLC

[0058] In order to verify the extensive application of IRF3-BiLC, in the present disclosure, experimental verification was performed in the presence of transcription inhibitors. The details are as follows.

[0059] THP-1-Dual (Invivogen) had an ISRE-Luc reporter system with stable expression. THP-1-Dual and THP-1 (IRF3-BiLC) cells were plated at a concentration of 1000,000 cells per mL in a 24-well plate. 4 groups were arranged for THP-1-Dual and THP-1 cells respectively, resulting in a total of 8 groups. After 12 hours, for THP-1-Dual cells, two groups of cells were transfected with Lipo2000 and stimulated with 5 mg/mL of polydA:dT, and the other two groups were not treated. The same treatment was performed for THP-1 (IRF3-BiLC). 4 hours after transfection, for the 2 groups of THP-1-Dual cells that were transfected and stimulated with polydA:dT, CHX with a final concentration of 100 ng/mL was added into one group. For the 2 groups of THP-1-Dual cells that were not treated, CHX with a final concentration of 100 ng/mL was added into one group. The other two groups were not treated. The same treatment was performed for THP-1 (IRF3-BiLC).

[0060] After 10 h of CHX treatment, for THP-1-Dual cells, 40 L of supernatant was taken respectively to detect the luciferase activity. For THP-1 (IRF3-BiLC), 80 L of Renilla luciferase lysate (purchased from Promega, E2820) was used to lyse on ice for 10 min. The mixture was mixed well by a pipette, and 50 L of cell lysate was transferred to a luciferase detector plate (purchased from PE). 20 L of Renilla luciferase substrate (purchased from Promega, E2820) was added into each well, and the luciferase activity was detected by a microplate reader (purchased from Bio-Tek, Synergy H1).

[0061] The detected values of luciferase were normalized with regard to the untreated groups. The results are as shown in FIG. 5 and FIG. 6: IRF3-BiLC is capable of reflecting the intracellular type I interferon response reaction in the presence of CHX, and ISRE-Luc is affected significantly.