High-throughput and rapid nucleic acids detection method based on capillary microarrays

20190119722 ยท 2019-04-25

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention discloses a high-throughput and rapid nucleic acids detection method based on capillary microarrays, and belongs to the technical field of biomedicine. The method comprises the steps that firstly, microarray containing a number of hydrophilic and vertical micro-channels is fabricated by capillary assembling, casting and machining, and the outer surface of the capillary array is coated with super-hydrophobic Ultra-Ever Dry paint; secondly, different primer sets are individually loaded into the micro-channels and air-dried to adhere them on the inner surface, and then the microarray is anchored into a reaction tube; thirdly, the reaction mixture is introduced into every microchannel at once through capillary force by a special designed sample-loading adaptor, and then the amplification reaction is performed in the temperature control device; and finally, the fluorescence can either be measured continually during the reaction for real-time detection or be recorded once in the end for endpoint detection. Moreover, the products can also be recovered for other use later. The present invention is capable of achieving fast and easy-to-use monitoring of multiple nucleic acid targets simultaneously in a single reaction. The present invention could be widely applied in the field of the multiplex detection of nucleic acids and point-of-care tests (POCTs).

    Claims

    1: A high-throughput and rapid nucleic acids detection method based on capillary microarrays, comprising steps of: in a first step, individually loading different primer sets into corresponding micro-channels of the capillary microarrays and air-drying to adhere the different primer sets on an inner surface, and then anchoring each of the capillary microarrays into a reaction tube; in a second step, introducing a reaction mixture without primers into all the micro-channels to form a nucleic acid amplification system; in a third step, performing an amplification reaction in a temperature control device; and in a fourth step, measuring fluorescence either continually during reaction for real-time detection, or once in an end for endpoint detection.

    2: The high-throughput and rapid nucleic acids detection method based on the capillary microarrays according to claim 1, wherein in the first step, the primer sets comprise: ordinary PCR primers, real-time PCR primers, loop-medicated isothermal amplification primers, rolling circle amplification primers, and recombinase polymerase primers; wherein, when a nucleic acid amplification primers are real-time PCR primers, the primers are added to the micro-channels together with corresponding probes.

    3: The high-throughput and rapid nucleic acids detection method based on the capillary microarrays according to claim 1, wherein in the first step, each of the capillary microarrays also comprises a substrate; wherein, a plurality of the micro-channels in each of the capillary microarrays are arranged in an array on the substrate, and a small portion of the micro-channels is exposed on a surface of the substrate.

    4: The high-throughput and rapid nucleic acids detection method based on the capillary microarrays according to claim 3, wherein an upper surface of the substrate, an outer surface of the micro-channels exposed on the substrate, and an inner surface of a bottom of the micro-channels are all hydrophobic; remaining surfaces of the micro-channels are hydrophilic.

    5: The high-throughput and rapid nucleic acids detection method based on the capillary microarrays according to claim 1, wherein in the first step, the primer sets are dissolved in a cross-linking agent and then added to the micro-channels; wherein, the cross-linking agent is one of following three mixed liquids: (a) a mass percentage of chitosan in acetic acid aqueous solution is 0.1-1%, and a pH is 4.5-6.0; (b) a mass percentage of gelatin aqueous solution is 0.1-1%; and (c) a mass percentage of polyethylene glycol aqueous solution is 0.05%-5%.

    6: The high-throughput and rapid nucleic acids detection method based on the capillary microarrays according to claim 1, wherein in the second step, the reaction mixture is introduced into all the micro-channels through inverted capillary forces.

    7-10. (canceled)

    11: A high-throughput and rapid nucleic acids detection method based on capillary microarrays according to claim 1, wherein the reaction mixture is introduced into all the micro-channels by a special sample-loading adaptor; wherein, the sample-loading adaptor comprises a sample cell and a handle, and the handle is connected to a bottom of the sample cell; the sample cell has a smaller outer cross-section than an inner cross-section of the reaction tube; an inner cross-section of the sample cell is larger than a cross-section of each of the capillary microarrays; a depth of the sample cell is less than a height of a portion of the micro-channels exposed on a surface of the substrate.

    12: A high-throughput and rapid nucleic acids detection method based on capillary microarrays according to claim 6, wherein the reaction mixture is introduced into all the micro-channels by a special sample-loading adaptor; wherein, the sample-loading adaptor comprises a sample cell and a handle, and the handle is connected to a bottom of the sample cell; the sample cell has a smaller outer cross-section than an inner cross-section of the reaction tube; an inner cross-section of the sample cell is larger than a cross-section of each of the capillary microarrays; a depth of the sample cell is less than a height of a portion of the micro-channels exposed on a surface of the substrate.

    13: The high-throughput and rapid nucleic acids detection method based on the capillary microarrays according to claim 11, wherein an inner surface of the sample cell is hydrophilic.

    14: The high-throughput and rapid nucleic acids detection method based on the capillary microarrays according to claim 12, wherein an inner surface of the sample cell is hydrophilic.

    15: The high-throughput and rapid nucleic acids detection method based on the capillary microarrays according to claim 1, wherein in the fourth step, measurement is performed by means of a fluorescence detection device or a photometric detection device, or is visually recognized by differences in color or brightness.

    16: The high-throughput and rapid nucleic acids detection method based on the capillary microarrays according to claim 1, wherein the method is implemented individually in a single reaction tube, or implemented in parallel in an integrated 8-tube, 96-well, or 384-well plate.

    17: The high-throughput and rapid nucleic acids detection method based on the capillary microarrays according to claim 2, wherein the method is implemented individually in a single reaction tube, or implemented in parallel in an integrated 8-tube, 96-well, or 384-well plate.

    18: The high-throughput and rapid nucleic acids detection method based on the capillary microarrays according to claim 3, wherein the method is implemented individually in a single reaction tube, or implemented in parallel in an integrated 8-tube, 96-well, or 384-well plate.

    19: The high-throughput and rapid nucleic acids detection method based on the capillary microarrays according to claim 4, wherein the method is implemented individually in a single reaction tube, or implemented in parallel in an integrated 8-tube, 96-well, or 384-well plate.

    20: The high-throughput and rapid nucleic acids detection method based on the capillary microarrays according to claim 5, wherein the method is implemented individually in a single reaction tube, or implemented in parallel in an integrated 8-tube, 96-well, or 384-well plate.

    21: The high-throughput and rapid nucleic acids detection method based on the capillary microarrays according to claim 6, wherein the method is implemented individually in a single reaction tube, or implemented in parallel in an integrated 8-tube, 96-well, or 384-well plate.

    22: The high-throughput and rapid nucleic acids detection method based on the capillary microarrays according to claim 13, wherein the method is implemented individually in a single reaction tube, or implemented in parallel in an integrated 8-tube, 96-well, or 384-well plate.

    23: The high-throughput and rapid nucleic acids detection method based on the capillary microarrays according to claim 14, wherein the method is implemented individually in a single reaction tube, or implemented in parallel in an integrated 8-tube, 96-well, or 384-well plate.

    24: The high-throughput and rapid nucleic acids detection method based on the capillary microarrays according to claim 15, wherein the method is implemented individually in a single reaction tube, or implemented in parallel in an integrated 8-tube, 96-well, or 384-well plate.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0040] Other features, purposes, and advantages of the present invention will become more apparent by reading the detailed description of the non-limiting embodiments with reference to the accompanying drawings:

    [0041] FIG. 1 is a working flowchart of embodiment 1 of the present invention;

    [0042] FIG. 2 shows a capillary microarray;

    [0043] wherein 21 indicates a microchannel, 22 indicates a hydrophobic surface on the top of the substrate, and 23 indicates a substrate.

    [0044] FIG. 3 is a schematic diagram of the principle of sample-loading;

    [0045] wherein 31 indicates a hydrophilic sample cell in the sample-loading device, 32 indicates the handle in the sample-loading device, 33 indicates the reaction tube, and 34 indicates the capillary microarray.

    [0046] FIG. 4 is a schematic diagram of the primers arrangement pattern in embodiment 1 and embodiment 2;

    [0047] wherein 1-10 indicates P-CaMV35S, bar, CP4 epsps, P-FMV35S, pat, T-nos, nptII, ADH1, blank control, blank control, respectively;

    [0048] FIG. 5 is a schematic diagram of the results of embodiment 1.

    [0049] FIG. 6 is a schematic diagram of the results of embodiment 2.

    DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT

    [0050] The present invention will be described in detail below with reference to specific embodiments. The following embodiments will help those skilled in this field to further understand the present invention, but do not limit the present invention in any form. It should be noted that ordinary technicians in this field can also make several variations and improvements without departing from the concept of this invention. These are all within the protection scope of this invention.

    Embodiment 1: Multiple Detection of Known Transgenic Materials Using Loop-Mediated Isothermal Amplification (LAMP)

    [0051] For seven genetically modified elements and endogenous reference genes of corn commonly detected in the current transgenic products, we consulted the relevant literatures to find LAMP primer sets for these genes. All primers were synthesized by Invitrogen company (Shanghai). All primers were screened by routine LAMP reactions with calcein dyes, and a set of LAMP primers was screened for each gene that could be successfully detected. Specific primer information is shown in Table I below:

    TABLE-US-00001 TABLE1 Gene Name Primersandprobes(5-3) P- FIP(SEQIDNO.1) TGCGTCATCCCTTACGTCAGTGAAGAAGACGTTCCAACCACG CaMV35S BIP(SEQIDNO.2) TCCTTCGCAAGACCCTTCCTCTGTCAGCTTGTCAGCGTGT LoopF(SEQIDNO.3) GAGATATCATATCAATCCACTTGCTTTGAAGA LoopB(SEQIDNO.4) ATATAAGGAAGTTCATTTCATTTGGAGAGG F3(SEQIDNO.5) CAAAGATGGACCCCCACC B3(SEQIDNO.6) CGGACCATGGAGATCTGCTA bar FIP(SEQIDNO.7) TGCTGAAGTCCCTGGAGGCACAGTTGGGCAGCCCGATG BIP(SEQIDNO.8) TGGCGGGGGGAGACGTACAGGGTCCCTGGAAGGCA LoopF(SEQIDNO.9) GGGCTTCAAGAGCGTGGTCGCTGT LoopB(SEQIDNO.10) CGGTTGACTCGGCCGTCCAGTCGTAGGCGTTGCG F3(SEQIDNO.11) TGCATGCGCACGCTC B3(SEQIDNO.12) AGGTGGACGGCGAGGT CP4epsps FIP(SEQIDNO.13) AGCAGAACAGCGGACTTCACTTCCAACGCCAATCACCTACA BIP(SEQIDNO.14) ACACCCCAGGTATCACCACTGTGCACCAAAACCTTGAAGCAT LoopF(SEQIDNO.15) GAGCGGAAGCCATAGGTACCC LoopB(SEQIDNO.16) TATCGAGCCAATCATGACTCTGACCACACTGAAAAG F3(SEQIDNO.17) CTTGCGTGGACCAAAGACT B3(SEQIDNO.18) ACACCGTCAGCATCAGTCT P-FMV35S FIP(SEQIDNO.19) GCTGGAACAGTAGTTTACTTTGACCATTAGCCAAAGCTACA BIP(SEQIDNO.20) ACATGCATGGTCAGTAAGATTACTTTCAAAGATGCCCAC LoopF(SEQIDNO.21) ATTGAAGATTCTTCATTGATCTCC LoopB(SEQIDNO.22) GTTTCAGAAAAAGACATCCACCGAAGACTTAAAGTTA F3(SEQIDNO.23) GTCAGGGTACAGAGTCTCC B3(SEQIDNO.24) GCTGCTCGATGTTGACAA pat FIP(SEQIDNO.25) TACCCCGGGCTGTGTATCCCATAGGCCTTCCAAACGATCC BIP(SEQIDNO.26) ATTGCGCGCAGCTGGATACAAGGAGGAGCTGGCAACTCA LoopF(SEQIDNO.27) AAGCCTCATGCAACCTAACAGAT LoopB(SEQIDNO.28) GCATGGTGGATGGCATGATGTTGGTTTTTGGCAAAGGGA F3(SEQIDNO.29) GGCGCAAGGTTTTAAGTCTG B3(SEQIDNO.30) GGTAACTGGCCTAACTGGC T-NOS FIP(SEQIDNO.31) AGATGGGTTTTTATGATTAGATTTATCCTAGTTTGCGC BIP(SEQIDNO.32) TAATTCAACAGAAATTATATGAAGTTTCTTAAGATTGAATCCTG LoopF(SEQIDNO.33) AGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATA LoopB(SEQIDNO.34) ATAATCATCGCAAGACCGGCAA F3(SEQIDNO.35) CATAGATGACACCGCG B3(SEQIDNO.36) GATCGTTCAAACATTTGG NptII FIP(SEQIDNO.37) TAGCCGGATCAAGCGTATGCTCATCTCACCTTGCTCCT BIP(SEQIDNO.38) CCATTCGACCACCAAGCGACATCCTGATCGACAAGACC LoopF(SEQIDNO.39) TTGCATCAGCCATGATGGATA LoopB(SEQIDNO.40) CGTACTCGGATGGAAGCC F3(SEQIDNO.41) CTCGACGTTGTCACTGAAG B3(SEQIDNO.42) TGATGCTCTTCGTCCAGA ADH1 FIP(SEQIDNO.43) CCCCTCCGCAAATCTTCGAACAGTTTTGTAACTGGTGAAGGACTGAG BIP(SEQIDNO.44) GGTGATCAAGTGCAAAGGTCTTTTCATAAACCAAGATTAGTCAGATCAAG LoopF(SEQIDNO.45) CGCCTTGTTTCTCCTCTGTC LoopB(SEQIDNO.46) CCAAATCATCCACTCCGAGAC F3(SEQIDNO.47) CTTTGGATCGATTGGTTTC B3(SEQIDNO.48) CCCAAAATTACTCAACG

    [0052] The seed powder of the conventional transgenic corn event MON863 in the laboratory was extracted and purified using a commercial DNA extraction kit, and the concentration of DNA was verified using the NanoDrop 1000 as a sample to be tested.

    [0053] Multiple LAMP reactions are performed using a capillary microarray (see FIG. 2, specifically including the microchannel 21 and the substrate 23; the top surface of the substrate 23 and the portion of the microchannel that exposes to the top surface of the substrate 22 are hydrophobic). That is, 8 sets of LAMP primers were added to each capillary in the array and air-dried to adhere them (micro-channels 1-10 in the microarray indicates P-CaMV35S, bar, CP4 epsps, P-FMV35S, pat, T-nos, nptII, ADH1, blank control, blank control, respectively). The LAMP reaction system containing the DNA template is introduced into all micro-channels through inverted capillary forces to perform multiple LAMP reactions. Each reaction system only has the volume of 1.6 L. The specific operational process is shown in FIG. 1.

    [0054] The specific sample-loading process is shown in FIG. 3. The sample-loading device includes a sample cell 31 and a handle 32. The handle 32 is connected to the bottom of the sample cell 31. The sample cell 31 has a smaller outer cross-section than the inner cross-section of the reaction tube. The inner cross-section of the sample cell 31 is larger than the cross-section of the capillary microarray, and the depth of the sample cell 31 is slightly less than the height of the portion of the micro-channels exposed on the surface of the substrate. The inner surface of the sample cell 31 is hydrophilic. When the sample is loaded, the sample cell 31 filled with the LAMP reaction system containing the DNA template is inserted downwards into a reaction tube, and the solutions quickly fill the hydrophilic channels through the contact of the top of the inner wall, and then the sample-loading device is removed.

    [0055] Other reaction conditions not explicitly given are all conventional nucleic acid amplification conditions.

    [0056] Results detection and analysis. After the reaction is completed, a hand-held UV lamp emitting at a wavelength of 365 nm is used to irradiate the reaction tube from the side and excite the fluorescent reactants in the microchannel, and then the fluorescence signal in each capillary is photographed from the top of the reaction tube. The photo was converted to a 16-bit TIFF format by using Photoshop 7.0 (Adobe Systems Inc., USA), and the specific fluorescence intensity in each capillary was read by using a GenePix Pro 6.1 (Molecular Devices, USA).

    [0057] According to FIG. 5, combined with the pattern diagram 4, we can see that the positive signals are marked as 1, 6, 7, and 8, which represents P-CaMV35s, T-nos, nptII, and ADH1 (endogenous genes of corn), respectively. With reference to relevant databases and literatures, theoretically, the genetic elements and endogenous genes contained in the transgenic corn were all detected at once in the multiple LAMP reaction based on a capillary microarray. For two replicates of the same sample, the results were exactly the same, and all were consistent with expectations.

    Embodiment 2: Multiplex Detection of Unknown Transgenic Materials

    [0058] Using the above-mentioned experimental procedures, the M2, a corn sample with unknown composition collected from Shanghai Port by the Shanghai Entry-Exit Inspection and Quarantine Bureau, was tested. The detection results are shown in FIG. 6; According to FIG. 6, combined with the pattern diagram FIG. 4, we can see that the positive signals are marked as 1, 4, 5, 6, and 8, which represents P-CaMV35s, FMV-35S, pst, T-nos, and ADH1 (endogenous genes of corn), respectively. Comparing this results with the results of an independent real-time PCR, we found that the detected target is completely consistent, so the detection method can be considered to have high specificity and accuracy. The real-time PCR results are as follows:

    TABLE-US-00002 TABLE 2 Ct Value Control Targets Replicates M2 (no template) P-CaMV35s 1 29.94 not detected 2 29.40 not detected 3 29.84 not detected Mean 29.73 not detected bar 1 not detected not detected 2 not detected not detected 3 not detected not detected Mean not detected not detected cp4 epsps 1 not detected not detected 2 not detected not detected 3 not detected not detected Mean not detected not detected FMV-35S 1 29.34 not detected 2 28.99 not detected 3 28.81 not detected Mean 29.04 not detected Pat 1 27.71 not detected 2 27.94 not detected 3 28.67 not detected Mean 28.11 not detected T-nos 1 28.48 not detected 2 28.30 not detected 3 28.31 not detected Mean 28.36 not detected nptII 1 not detected not detected 2 not detected not detected 3 not detected not detected Mean not detected not detected ADH1 1 29.38 not detected 2 29.37 not detected 3 29.11 not detected Mean 29.29 not detected

    [0059] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific implementation manners above, and technicians in this field can also make several variations and improvements within the scope of the claims, which would not affect the essence of this invention.