SINGLE CELL RNA AND MUTATIONAL ANALYSIS PCR (SCRM-PCR): A METHOD FOR SIMULTANEOUS ANALYSIS OF DNA AND RNA AT THE SINGLE-CELL LEVEL

20190119721 ยท 2019-04-25

    Inventors

    Cpc classification

    International classification

    Abstract

    A method of simultaneously analyzing RNA and DNA in a sample, the method comprising the step (a) contacting the sample with a reverse primer from a first primer pair directed to a target RNA region to effect reverse transcription of RNA into cDNA with a reverse transcriptase; (b) subsequently contacting the sample with (i) a forward primer from the first primer pair directed to a second cDNA region, (ii) a forward and a reverse primers from a second primer pair targeted to a DNA region, and (ii) a DNA polymerase to simultaneously amplify the target cDNA and target DNA region; and (c) analyzing the amplified target cDNA region and/or amplified target DNA region. Also encompassed are uses of the method to analyze gene expression and mutations, kits comprising primers, enzymes, buffers.

    Claims

    1.-36. (canceled)

    37. A method of simultaneously analyzing RNA and DNA in a sample, the method comprising the steps of: (a) contacting the sample with a reverse primer from a first primer pair, the reverse primer from the first primer pair being directed to a target RNA region, and a reverse transcriptase to effect reverse transcription of the RNA into cDNA; (b) subsequently contacting the sample with: (i) a forward primer from the first primer pair, the forward primer from the first primer pair being directed to a target cDNA region, (ii) a reverse primer and a forward primer from a second primer pair, the reverse primer and forward primer from the second primer pair being directed to a target DNA region, and (iii) a DNA polymerase to simultaneously amplify the target cDNA region and the target DNA region; and (c) analyzing the amplified target cDNA region and/or the amplified target DNA region.

    38. The method according to claim 37, wherein prior to step (a), the method comprises lysing a cell in the sample.

    39. The method according to claim 37, wherein the simultaneous amplification in step (b) is a pre-amplification step, and is followed by the step of subjecting the sample from step (b) to a semi-nested PCR using the reverse primer in step (a) or the forward primer in step (b)(i), nested primer that binds within the pre-amplified target cDNA region, and a DNA polymerase to further amplify the target eDNA region, and/or subjecting the sample from step (h) to a nested PCR using a nested primer pair that binds within the pre-amplified target DNA region and a DNA polymerase to further amplify the target DNA region, prior to step (c).

    40. The method according to the claim 37, further comprising the step of: (A) subjecting the sample from step (b) to a semi-nested PCR using the reverse primer in step (a) or the forward primer in step (b)(i), and a nested primer that binds within the amplified target cDNA region; and/or (B) subjecting the sample from step (b) to a nested PCR using a nested primer pair that binds within the amplified target DNA region.

    41. The method according to claim 37, wherein steps (a) and (b) are conducted in the same reaction mixture.

    42. The method according to claim 37, wherein the method is performed simultaneously for one or more target RNA regions, and/or one or more target cDNA regions, and/or one or more target DNA regions,

    43. The method according to claim 37, wherein the sample comprises a single cell, or a plurality of cells, selected from the group consisting of: a cell from a pre-implantation embryo, a stem cell, a suspected cancer cell, a suspected tumour-derived cell, a suspected embryonic cell, a cell from a pathogenic organism, and a cell obtained from a crime scene,

    44. The method according to claim 37, wherein the sample comprises cell-free RNA, or cell-free DNA, present in an amount selected from the group consisting of about 5 pg to about 10 ng, about 5 pg to about 5 ng, about 5 pg to about 1 ng, about 5 pg to about 500 pg, about 5 pg to about 250 pg, about 5 pg to about 125 pg, about 5 pg to about 100 pg, and about 5 pg to about 50 pg.

    45. The method according to claim 37, wherein the first primer pair comprises primers that span exon-exon boundaries or are separated by at least one intron on the corresponding DNA region.

    46. The method according to claim 39, wherein a) the forward primer of the first or second primer pair is selected from the group consisting of SEQ ID NOs 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85 and 87; b) the reverse primer of the first or second primer pair is selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86 and 88; c) the first or second primer pair is selected from the group consisting of SEQ ID NOs 1 and 2; SEQ ID NOs 3 and 4; SEQ ID NOs 5 and 6; SEQ ID NOs 7 and 8; SEQ ID NOs 9 and 10; SEQ ID NOs 11 and 12; SEQ ID NOs 13 and 14; SEQ ID NOs 15 and 16; SEQ ID NOs 17 and 18; SEQ ID NOs 19 and 20; SEQ ID NOs 21 and 22; SEQ ID NOs 23 and 24; SEQ ID NOs 25 and 26; SEQ ID NOs 27 and 28; SEQ ID NOs 29 and 30; SEQ ID NOs 31 and 32; SEQ ID NOs 33 and 34; SEQ ID NOs 35 and 36; SEQ ID NOs 37 and 38; SEQ ID NOs 39 and 40; SEQ ID NOs 41 and 42; SEQ ID NOs 43 and 14; SEQ ID NOs 45 and 46; SEQ ID NOs 47 and 48; SEQ ID NOs 49 and 50; SEQ ID NOs 51 and 52; SEQ ID NOs 53 and 54; SEQ ID NOs 55 and 56; SEQ ID NOs 57 and 58; SEQ ID NOs 59 and 60; SEQ ID) NOs 61 and 62; SEQ ID NOs 63 and 64; SEQ ID NOs 65 and 66; SEQ ID NOs 67 and 68; SEQ ID NOs 69 and 70; SEQ ID NOs 71 and 72; SEQ ID NOs 73 and 74; SEQ ID NOs 75 and 76; SEQ ID NOs 77 and 78; SEQ ID NOs 79 and 80; SEQ ID NOs 81 and 82; SEQ ID NOs 83 and 84; SEQ ID NOs 85 and 86; and SEQ ID NOs 87 and 88; d) the forward primer for semi-nested or nested PCR is selected from the group consisting of SEQ ID NOs; 89, 90, 91, 92, 93, 94, 95, 15, 17, 19, 99, 23, 101, 102, 104, 105, 106, 107, 108, 110, 111, 43, 45, 115, 116, 117, 118, 55, 120, 59, 61, 123, 124, 125, 126, 71, 127, 75, 77, 130, 81, 132, 133 and 134; e) the reverse primer for semi-nested or nested PCR is selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 96, 97, 98, 22, 100, 26, 103, 30, 32, 34, 36, 109, 40, 112, 113, 114, 48, 50, 52, 54, 119, 58, 121, 122, 64, 66, 68, 70, 72, 74, 128, 129, 80, 131, 84, 86 and 88; or f) the primers for semi-nested or nested PCR is selected from the group consisting of SEQ ID NOs 89 and 2; SEQ ID NOs 90 and 4; SEQ ID NOs 91 and 6; SEQ ID NOs 92 and 8; SEQ ID NOs 93 and 10; SEQ ID NOs 94 and 12; SEQ ID NOs 95 and 14; SEQ ID NOs 15 and 96; SEQ ID NOs 17 and 97; SEQ ID NOs 19 and 98; SEQ ID NOs 99 and 22; SEQ ID NOs 23 and 100; SEQ ID NOs 101 and 26; SEQ ID NOs 102 and 103; SEQ ID NOs 104 and 30; SEQ ID NOs 105 and 32; SEQ ID NOs 106 and 34; SEQ ID NOs 107 and 36; SEQ ID NOs 108 and 109; SEQ ID NOs 110 and 40; SEQ ID NOs 111 and 112; SEQ ID NOs 43 and 113; SEQ ID NOs 45 and 114; SEQ ID NOs 115 and 48; SEQ 1D NOs 116 and 50; SEQ ID NOs 117 and 52; SEQ ID NOs 118 and 54; SEQ ID NOs 55 and 119; SEQ ID NOs 120 and 58; SEQ ID NOs 59 and 121; SEQ ID NOs 61 and 122; SEQ ID NOs 123 and 64; SEQ ID NOs 124 and 66; SEQ ID NOs 125 and 68; SEQ ID NOs 126 and 70; SEQ ID NOs 71 and 72; SEQ ID NOs 127 and 74; SEQ ID NOs 75 and 128; SEQ ID NOs 77 and 129; SEQ ID NOs 130 and 80; SEQ ID NOs 81 and 131; SEQ ID NOs 132 and 84; SEQ ID NOs 133 and 86; and SEQ ID NOs 134 and 88.

    47. The method according to claim 37, wherein the second primer pair comprises primers that bind to intronic regions of the target DNA region.

    48. The method according to claim 37, wherein step (b) comprises one or more of the following: about 1 to about 50 cycling steps, and 3 cycling steps; and/or wherein the analysis in step (c) comprises analyzing one or more of the following: the amplified target cDNA for gene expression, and the amplified target DNA for mutations.

    49. The method according to claim 48, wherein each cycling step comprises one or more of the following: about 1 to about 50 cycles of denaturation, annealing and elongation, and 6 cycles of denaturation, annealing and elongation.

    50. The method according to claim 49, wherein the annealing and/or elongation temperature in a cycle is about 40 C. to about 75 C. and/or wherein the annealing and/or elongation is carried out for about 10 seconds to about 10 minutes and/or wherein the denaturation is carried out at a temperature of about 75 C. to about 120 C. for about 1 second to about 10 minutes.

    51. The method according to claim 37, wherein step (b) comprises: 6 cycles of 60 C. for 4 minutes followed by 95 C. for 1 minute, 6 cycles of 55 C. for 4 minutes followed by 95 C. for 1 minute, and 6 cycles of 50 C. for 4 minutes followed by 95 C. for 1 minute, and/or does not comprise a final extension step,

    52. The method according to claim 39, wherein the nested primer is one that matches or corresponds to the reverse primer in step (a) or the forward primer in step (b)(i). 53, (New) Use of the method according to claim 37 for determining the DNA profile and/or the gene expression profile of a single cell or a plurality of cells, or cell-free RNA and/or DNA derived from a single cell or a plurality of cells and/or for validation of large-scale transcriptomics data sets.

    54. A kit for performing the method according to claim 37, wherein the kit comprises: (a) a primer selected from the group consisting of: i. the reverse primer of step (a) of the method of claim 37, ii. the forward primer of step (b)(i) of the method of claim 37, iii, the primer pair of step NOD of the method of claim 37, and iv. the nested primer and nested primer pair of the method of claim 39; (b) one or more reagents, selected from the group consisting of: i. a reverse transcriptase and one or more suitable reaction buffers for the reverse transcription in step (a) of the method of claim 37, ii. a DNA polymerase and one or more suitable reaction buffers for the amplification in step (b) or the semi-nested or nested FCR of the method of claim 39, and iii. one or more labelled or unlabelled deoxyribonucleotides selected from the group consisting of dATP, dCTP, dGTP, and dTTP or dUTP; and (c) instructions for performing the method according to claim 37.

    55. The kit according to claim 54, wherein the primers and/or reagents are pre-mixed in combinations suitable for the lysis, pre-amplification, and amplification steps according to claim 1, and/or for analysis of gene expression profiles or mutation signatures.

    56. The kit according to claim 54, wherein the kit comprises one or more containers comprising one or more reaction buffers for performing the method according to claim 37 and/or use according to claim 53.

    Description

    BRIEF DESCRIPTION OF DRAWINGS

    [0041] The invention will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and the accompanying drawings, in which:

    [0042] FIG. 1 provides an outline of the scrmPCR method of the disclosure. This method can be used to detect and quantify RNA transcripts and to sequence DNA from the same single cell. A schematic of the method is enclosed as FIG. 1 and is composed of the following steps:

    [0043] 1) Primer design: Primer sets are designed for semi-nested PCR (RNA transcripts) or nested PCR (genomic DNA). In some cases, primers were derived from the literature (Table 1). 2) Reverse transcription: Multiplex reverse primers are added to the lysed single cell, together with a reverse transcriptase enzyme (step II in FIG. 1). 3) Pre-amplification: Multiplex forward primers are added to the mixture, together with primers specific for DNA sequences and a pre-amplification step is performed using an optimized annealing temperature (Step III in FIG. 1). 4) Cleanup: Unused primers are removed by spin column or enzymatic digestion. 5) Dilution of the sample. 6) For RNA analysis, perform qPCR using a semi-nested approach, where a primer is designed to bind a sequence internal to the pre-amplified product and the other primer has been previously used during the pre-amplification step (step IV in FIG. 1) 7) For DNA analysis: PCR using a nested approach where both primers are designed to bind a sequence internal to the pre-amplified product (step IV in FIG. 1).

    [0044] FIG. 2 shows that nested PCR is required for specific amplification of PCR products from single cells. In (a), primers for TP53 exon 6 were optimized to amplify tissue DNA and obtain specific products that can he sequenced. In (b), TP53 exon 6 was preamplified using the same primer pair and the reaction was split in 2 equal amounts. The first part was used in a second round of PCR using the same primer pairs. This resulted in unspecific and inefficient amplification (top panel). Specific PCR products were then obtained by performing the second amplification using a nested pair of primers (bottom panel). (c) shows melting curves of several seminested assays for RNA detection by qPCR, indicating specific amplification of the target product.

    [0045] FIG. 3 provides the proof of principle for the scrmPCR method of the disclosure. Single DLD1 and RKO cells (colorectal cancer cell lines) were micro-manipulated in 5 l 2 Reaction Buffer (CellDirect kit). scrmPCR was then performed as described herein, with the results shown in (a). Genomic regions belonging to TP53, KRAS and BRAF genes were amplified. PCR products were subjected to Sanger sequencing and known hotspot mutations that have been previously characterized in both cell lines were detected as shown in (b). At the same time several transcripts from the same cells were amplified and shown to have variable gene expression in both cell lines. Gene expression specificity was verified by the melting curve peak temperature and by the presence of a single peak, as shown in (c).

    [0046] FIG. 4 provides the proof of principle for the scrmPCR method of the disclosure using single cells and single clusters of cells isolated from clinical samples. Single cells or single clusters of unknown origin isolated from blood of colorectal cancer patients were micro-manipulated and subjected to scrmPCR as described herein. In (a), the gene expression of several epithelial and mesenchymal markers shows the predominant mesenchymal nature of single clusters. The expression of PTPRC (CD45) is also shown. Colours represent gene expression from absent (dark grey) to maximum (light grey). NTC, no template control. In (b), results of Sanger sequencing of targeted gene region mutated in matching colorectal cancer tissues show that the same clusters shown in (a) do not contain mutations and are thus not related to the tumor epithelium. (c) shows the use of the latest scrmPCR protocol containing additional assays to quantify transcripts from a set of clusters, to show that clusters express transcripts belonging to the endothelial lineage. Heat map represents scrmPCR gene expression in control single-cells and 14 CTM (n=4 patients). Color scale indicate gene expression from low or absent (dark grey) to high (light grey).

    [0047] FIG. 5 shows the retrieval of circulating tumour cells using a microfiltration device. (a) shows the device setup. Microfiltration devices enclosing a silicon microsieve (inset, scale bar=10 m) arc connected to a peristaltic pump for flow rate control. (b) shows the microfiltration procedure for various downstream applications. The numbers indicate procedure time for each step. (c) shows optimization of retrieval efficiency and purity for downstream single-cell micromanipulation. The individual scatter plots represent experiments using various flow rates and microsieve pore diameters. Black dashed rectangle indicates the target area of >90% retrieval efficiency and >510.sup.3 WBC depletion for optimal downstream handling of retrieved cells. Data points are meanss.c.m. of three independent experiments under each condition.

    [0048] FIG. 6 shows that CTM express EMT markers, but do not mirror primary tumour mutations or chromosome abnormalities. (a) shows images of nine CTM from 4 CRC patients with known primary tumour mutations micro-manipulated in single tubes for downstream scrmPCR. (b) CTM aCGH shows images of three CTM from a representative CRC patient with known chromosomal abnormality. (c) shows aCGH analysis of CTM shown in (b) with matching normal and tumour tissues.

    [0049] FIG. 7 shows that CTM are tumour-derived mature endothelial cells. (a) shows lineage inference from RNA-Seq data of single-CTM. Normalized odds ratios compare number of genes enriched for each sample (rows) and cell type (columns) over random enrichment. MEP, Megakaryocyte-erythroid progenitor. In (b), immunofluorescence studies confirm the endothelial lineage of CTM. Representative CTM stained for the indicated antibodies with internal controls for each staining. Inset mid panel, a CD45.sup.+ WBC. Inset right panel, a CD41/CD42B.sup.+ platelet aggregate. The Table indicates quantification of CTM positive or negative for the indicated immunofluorescence. (c) shows the results of the EPC clonogenic assay for CTM (n=5 patients). The scatter plot represents initial (x axis) and final (y axis) number of CTM (grey symbols) or HUVEC cells (black circles). Same grey symbols are technical replicates. HUVEC cells data are represented as means.e.m. of technical replicates. One representative experiment of two is shown. (d) shows the rank correlation of CTM and tissues RNA Seq data by principal component analysis. (e) shows the ladder plot of CD31.sup.+CD45.sup. CTM counts 0-24 h before and 24-72 h after surgery. Lines connect data from the same patient. Two-tailed Wilcoxon signed-rank test, ***P=0.0006, effect size r=0.54. (f) shows FOLH1 expression for the indicated tissues, PBMCs, and CTM for individual patients. Bars represent means. In tissues, error bars are s.c.m. from independent datapoints (n=3 patients). (g) shows CD276 in normal, tumour tissues and in single-CTM from RNA-Seq data. (h) shows the microvessel density count in patients with low (10 CTM/2 ml) and high (>10 CTM/2 ml) CTM counts (n=17 patients). Arrows and dashed white lines indicate microvessel lumens in representative images. Two-tailed Wilcoxon-Mann-Whitney U test with Bonferroni correction, *P=0.03, effect size r=0.57, {circumflex over ()} (95% CI)=2 (0.54.16). ns, not significant.

    [0050] FIG. 8 shows that CTM are prevalent in CRC patients, mirror therapeutic intervention and indicate the presence of colorectal cancer in early stage treatment-naive patients. (a) is a case-control study of CTM in blood. CTM count for each healthy control (n=45) and CRC case (n=80) are shown. Two-tailed Wilcoxon-Mann-Whitney U test, ***P=7.3110.sup.15, effect size r=0.65, D (95% CI)=4 (39). (b) shows association of CTM count with patients and tumour characteristics (n=80 CRC cases). Two-tailed Wilcoxon-Mann-Whitney U test with Bonferroni correction, **P=0.0072, effect size r=0.34, {circumflex over ()} (95% CI)=6 (13(1)). (c) shows the trend of CTM count during colorectal cancer sequence of treatment. Blood samples were collected independently at discrete time points: 1) Treatment-naive, 2) Post neoadjuvant therapy, 3) Post surgery, 4) Post adjuvant therapy, 5) Palliative therapy. Light grey boxes indicate the interquartile range (IQR), line across boxes indicates the median, dashed line indicates the interpolation of medians by spline function. Arrows indicate treatment events. n=80 CRC cases, two-tailed Wilcoxon-Mann-Whitney U test, ***P=0.0002, effect size r=0.41, {circumflex over ()} (95% CI)=7 (15(2)). ND, not detected. Post operative samples shown in FIG. 7e are not included. (d) shows the ROC curve for treatment-nave CRC patients versus healthy controls (n=89). Shaded area (light grey) represents the bootstrapped 95% CI. AUC (95% CI)=0.930 (0.8800.980), effect size r=0.71. (c) Same as (d), but comparing early-stage CRC cases (IIA) with healthy controls (n=61). AUC (95% CI)=0.922 (0.8460.999), effect size r=0.70. In (a), (d) and (e), 100% stacked bar charts indicate the percentage of positive (dark grey) and negative (light grey) samples for both healthy controls and CRC cases.

    [0051] FIG. 9 illustrates a silicon microsieve, microfiltration device and its retrieval efficiency and purity. (a) shows a bright field composite image (left panel) and scanning electron micrographs (right panels) of silicon microsieve. (b) shows a microfiltration device with components. (c) shows a silicon microsieves allow efficient retrieval of captured cells. Capture efficiency of HCT 116 cells from the whole blood, indicating % of captured cells that can be retrieved for downstream assays (light grey bars) or cannot be retrieved (dark grey bars). Six independent experiments arc shown. (d) shows the size distribution of SW620 (light grey line), (n=50). Median size of WBCs and CTCs isolated from colorectal, prostate and breast cancer patients respectively reported from Coumans, F et al, 2013. (c) shows contaminating nucleated cells in clinical samples using optimized protocol shown in FIGS. 5b and 5c (n=13). (f) shows the retrieval efficiency from additional cell lines using optimized protocol shown in FIGS. 5b and 5c. Bars represent means.e.m.

    [0052] FIG. 10 shows characterization and definition of CTM. (a) shows a representative uncropped image of a CD45.sup. CTM (P7-CTM3, sec also FIG. 1, FIG. 4a and FIG. 6a) in 100 of wash buffer, indicating purity of sample suitable for downstream analysis, and showing the presence of target CD45.sup. CTM and sparse RBCs and a WBC, before final micromanipulation (Sec Methods). Scale bar 50 m. (b) shows representative immunofluorescence of CD45 and Ep-CAM of CTM retrieved from 5 CRC patients. The table indicates CD45.sup. CTM counts for each staining and patient. Scale bars=10 m. (c) Representative cytomorphology of CTM. Scale bars=10 m. DIC: differential interference contrast.

    [0053] FIG. 11 shows scrmPCR proof of principle using an epithelial-like (DLD-1) and a mesenchymal-like (RKO) CRC cell line. (a) shows DNA amplification (gel electrophoresis) and RNA quantitation (heat map) for the indicated genes and single or hulk cells. (h) shows sequence chromatograms from DNA hotspots of known mutant alleles in RKO and DLD-1 single-cells. (c) shows melt curve plots of the indicated genes from qPCR reactions. sc, single-cell. NTC, no template control. Rn, normalized reporter signal

    [0054] FIG. 12 shows that CTM express EMT markers but have normal chromosomal structures. (a) shows representative 4-colour immunofluorescence of two CTM for CD45, Vimentin (VIM), pan-Keratin (CK) and DAPI, indicating heterogeneous mesenchymal arid epithelial markers expression. (b) shows a control experiment to assess the impact of whole genome amplification (WGA) for aCGH experiments using single-cells. (c-e) each shows aCGH of single-CTM for the indicated patients similar to normal tissue DNA shown in (b).

    [0055] FIG. 13 shows that cytomorphology of CTM used for RNA-Seq. (a-g) each shows differential interference contrast (DIC) and Hoechst 33342 images of CTM used for RNA-Seq for each respective patients. No images arc available for patient P1.

    [0056] FIG. 14 shows a lineage inference workflow. (a) is a flow chart of the lineage inference workflow. (b) shows selected genes with highest specificity index for representative lineages are verified for specificity using BioGPS (Wu et al) (c) shows gene expression level of markers commonly used in CTC research to denote epithelial cells. Note KRT18 expression in the endothelial lineages and EPCAM expression in hematopoictic cells.

    [0057] FIG. 15 shows a lineage inference algorithm validation. (a) shows heat maps comparing number of genes enriched for each sample (rows) and lineage (columns) over random enrichment. Samples are published RNA-Seq data from selected lineages. Each coloured box represents a normalized odds ratio of the respective Fisher's exact test from 0 (black) to 1 (light grey). (b) Same as in (a), except that whole tissues or complex cell mixtures such as PBMCs, skin and brain datasets are used.

    [0058] FIG. 16 shows a comparison between CTM and CTC-clusters reported in Aceto et al. Lineage inference of CTC clusters data from Aceto et al. shows enrichment with epithelial cell types. Platelet and red blood cell signals were removed from this analysis. RNA-Seq data from CTM analyzed in this study are shown for comparison. MCF7 and HUVEC RNA-Seq are shown as positive controls.

    [0059] FIG. 17 shows tumour endothelial markers expressed in CTM. Additional tumor endothelial markers were expressed in normal, tumour tissues and CTM using RNA-Seq data. PLXDC1, plexin domain containing 1 (tumor endothelial marker 3/7) (St Croix et al); MMP2, matrix metallopeptidase 2 (St Croix et al); N1D1, nidogen 1 (St Croix et al); MMP11(St Croix et al), matrix metallopeptidase 11; CLEC14A, C-type lectin domain family 14, member A (Mura et al); POSTN, periostin (Borgia et al); VWF, von Willebrand factor (Zanetta et al); ECSCR, endothelial cell surface expressed chemotaxis and apoptosis regulator (Herbert et al).

    [0060] FIG. 18 shows that CTM counts do not correlate with inflammatory markers or other variables. (a-c) show the association of CTM number with the indicated tumour characteristics, patient's characteristics, and blood test values respectively. Correlations are shown as dot plots and measured using the Kendall's z coefficient and its derived P value. Comparisons of dichotomized variables are shown as boxplots and differences are quantified using P values from two-tailed exact Wilcoxon-Mann-Whitney U tests.

    DESCRIPTION OF EMBODIMENTS

    [0061] The method of the present disclosure can be used to simultaneously quantify RNA transcripts and sequence DNA regions from a single cell. The method can be applied to other samples, such as clinical or forensic samples, where nucleic acids arc often present in very limited amounts, or to experimental samples containing a low number of cells, such as 2-100 cells.

    [0062] In a first aspect, there is provided a method of simultaneously analyzing RNA and DNA in a sample, the method comprising the steps of:

    [0063] (a) contacting the sample with a reverse primer from a first primer pair, the reverse primer from the first primer pair being directed to a target RNA region, and a reverse transcriptase to effect reverse transcription of the RNA into cDNA;

    [0064] (b) subsequently contacting the sample with:

    [0065] (i) a forward primer from the first primer pair, the forward primer from the first primer pair being directed to a target cDNA region,

    [0066] (ii) a reverse primer and a forward primer from a second primer pair, the reverse primer and forward primer from the second primer pair being directed to a target DNA region, and

    [0067] (iii) a DNA polymerase [0068] to simultaneously amplify the target cDNA region and the target DNA region; and

    [0069] (c) analyzing the amplified target cDNA region and/or the amplified target DNA region.

    [0070] Advantageously, the simultaneous amplification of the target cDNA region and the target DNA region in step (b) may form a pre-amplification step that increases the amount of cDNA and/or DNA as templates for further amplification of the target cDNA and/or target DNA regions prior to analysis. The target DNA region may be a target genomic DNA region.

    [0071] By primer is meant an oligonucleotide which, when paired with a strand of DNA or RNA, is capable of initiating the synthesis of a primer extension product in the presence of a suitable polymerising agent. The primer is preferably single-stranded for maximum efficiency in amplification but may alternatively be double-stranded. A primer must be sufficiently long to prime the synthesis of extension products in the presence of the polymerisation agent. The length of the primer depends on many factors, including application, temperature to be employed, template reaction conditions, other reagents, and source of primers. For example, depending on the complexity of the target sequence, the oligonucleotide primer typically contains 15 to 35 or more nucleotides, although it may contain fewer nucleotides. Primers can be large polynucleotides, such as from about 200 nucleotides to several kilobases or more. Primers may be selected to be substantially complementary to the sequence on the template to which it is designed to hybridise and serve as a site for the initiation of synthesis. For example, not all bases in the primer need to reflect the sequence of the template molecule to which the primer will hybridizethe primer need only contain sufficient complementary bases to enable the primer to hybridize to the template. The primer may include additional bases, for example in the form of a restriction enzyme recognition sequence at the 5 end, to facilitate cloning of the amplified DNA. A primer may also include mismatch bases at one or more positions, being bases that are not complementary to bases in the template, but rather are designed to incorporate changes into the DNA upon base extension or amplification.

    [0072] The term amplification or amplify relates to the production of additional copies of a nucleic acid. Amplification may be carried out using polymerase chain reaction (PCR) technologies or other nucleic acid amplification technologies well known in the art.

    [0073] Primer pairs can be used for amplification (and identification) of a nucleic acid, e.g., by the polymerase chain reaction (PCR). The primer pair may comprise a forward primer and a reverse primer. In a PCR reaction, both strands of a double stranded DNA are amplified. The forward primer may bind to one strand of the DNA and allow the synthesis of a primer extension product from the 5 to 3 direction. The reverse primer may hind to the complementary strand of DNA, and also allow the synthesis of a primer extension product in the 5 to 3 direction of the complementary DNA strand. In a reverse transcription reaction, the reverse primer may bind to an RNA strand and allow the synthesis of a complementary DNA (cDNA) strand in a 5 to 3 direction of the cDNA strand in the presence of a reverse transcriptase enzyme. The reverse primer may subsequently be used together with a forward primer to amplify the synthesized cDNA strand. PCR primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose such as Primer (Version 0.5, 1991, Whitehead Institute for Biomedical Research, Cambridge Mass.) and those used in the Examples disclosed herein (e.g. PrimerBLAST, Ncbi primer design tool, ensembl genome browser, Netprimer). Oligonucleotides for use as primers are selected using software known in the art for such purpose. For example, OLIGO 4.06 software is useful for the selection of PCR primer pairs of up to 30-100 nucleotides each, and for the analysis of oligonucleotides and larger polynucleotides of up to 5,000 nucleotides from an input polynucleotide sequence of up to 32 kilobases.

    [0074] The methods and reagents for use in PCR amplification reactions, restriction enzyme digestion and subsequent fragment resolution, and nucleic acid sequencing are well known to those skilled in the art. In each case, suitable protocols and reagents will largely depend on individual circumstances. Guidance may be obtained from a variety of sources, such as for example Sambrook et al., Molecular Cloning A Laboratory Manual, Cold Spring Harbor, New York, 1989, and Ausubel et al., Current Protocols in Molecular Biology, Greene Publ. Assoc. and Wiley-Intersciences, 1992. A person skilled in'the art would readily appreciate that various parameters of these procedures may be altered without affecting the ability to achieve the desired product. For example, in the case of PCR amplification, the salt concentration may be varied. Similarly, the amount of DNA used as a template may also be varied depending on the amount of DNA available or the optimal amount of template required for efficient amplification.

    [0075] A skilled person would be able to understand that a reverse transcriptase is an enzyme that may he used to synthesise cDNA based on an RNA template. A skilled person would also understand that a DNA polymerase is an enzyme that can synthesise DNA molecules based on a DNA template.

    [0076] By contacting, a primer may he brought into physical association with a sample. This allows, for example, a primer pair to anneal with the DNA present in the sample, and subsequently amplify the DNA by PCR. This also allows a primer to anneal to an RNA strand present in the sample, to allow synthesis of cDNA using a reverse transcriptase enzyme as known to a person skilled in the art.

    [0077] The method as defined herein allows one to simultaneously amplify RNA and DNA in a sample or single cell. The term simultaneously means to be able to amplify both RNA and DNA, present in the very same sample or single cell. It may also mean being able to analyze both RNA and DNA from the same sample or single cell.

    [0078] To the inventor's knowledge, this is the first method that allows targeted analysis of both DNA mutations and RNA transcription in the same single cell. The method has undergone several optimization steps.

    [0079] The inventors have found that specific amplification of both DNA and RNA can only be achieved by using at least a semi-nested approach for RNA and a fully nested approach for DNA molecules (e.g. see FIG. 2). The term semi-nested PCR as used herein refers to a modified PCR technique in which one nested primer is used to reduce non-specific binding due to the amplification of unexpected binding sites. A fully nested approach would refer to a modified PCR technique where two nested primers are used on either side on a template DNA. The use of nested primers allow the specific recognition of a PCR product amplified using a first set of primers, thus eliminating contamination from unwanted products such as primer dimers, hairpins and alternative primer target sequences. The inventors have also found that amplification of DNA and RNA molecules are differentially affected by annealing temperature in the pre-amplification step. A trade-off therefore needs to he set in order to amplify both molecules.

    [0080] Accordingly, in one embodiment, the method according to the first aspect further comprises the step of: subjecting the sample from step (b) to a semi-nested PCR using the reverse primer in step (a) or the forward primer in step (b)(i), and a nested primer that binds within the amplified target cDNA region. The nested primer may be one that matches or corresponds to the reverse primer in step (a) or the forward primer in step (b)(i). In another embodiment, the method according to the first aspect further comprises the step of: subjecting the sample from step (b) to a nested PCR using a nested primer pair that binds within the amplified target DNA region. In one embodiment, steps (a) and (b) are conducted in the same reaction mixture.

    [0081] In one embodiment, the method according to the first aspect is performed simultaneously for one or more target RNA regions, and/or one or more target cDNA regions, and/or one or more target DNA regions. Accordingly, one or more reverse primers, each having the same or a differing specificity for a target RNA region may he used in step (a), one or more forward primers, each having the same or a differing specificity for a target cDNA region may be used in step (b)(i), one or more primer pairs, each having the same or a differing specificity for a target DNA region may be used in step (b)(ii), one or more nested primers that bind to a target cDNA region, and one or more nested primer pairs that bind to a target DNA region, may be used.

    [0082] Advantageously, the method according to the first aspect can be used to analyze RNA and DNA in instances where a limited amount of sample is available.

    [0083] In one embodiment, the sample comprises a single cell, or a plurality of cells (e.g. a low number of cells comprising about 2 to about 100 cells, about 2 to about 90 cells, about 2 to about 80 cells, about 2 to about 70 cells, about 2 to about 60 cells, about 2 to about 50 cells, about 2 to about 40 cells, about 2 to about 30 cells, about 2 to about 20 cells, about 2 to about 10 cells, about 2 to about 5 cells, about 5 to about 100 cells, about 10 to about 100 cells, about 20 to about 100 cells, about 30 to about 100 cells, about 40 to about 100 cells, about 50 to about 100 cells, about 60 to about 100 cells, about 70 to about 100 cells, about 80 to about 100 cells, or about 90 to about 100 cells). The single cell or plurality of cells may be lysed to release the RNA and DNA contained within the cell (or cells) prior to step (a).

    [0084] In another embodiment, the sample comprises cell-free RNA, or cell-free DNA.

    [0085] The RNA or DNA may be present in a low amount, for example from about 1 pg to about 10 ng, about 5 pg to about 10 ng, about 5 pg to about 5 ng, about 5 pg to about 1 ng, about 5 pg to about 500 pg, about 5 pg to about 250 pg, about 5 pg to about 125 pg, about 5 pg to about 100 pg, or about 5 pg to about 50 pg.

    [0086] The sample may be a sample of tissues, cells, vesicles such as exosomes, body fluids and isolates thereof etc., isolated from a subject. Examples of samples include: whole blood, blood fluids (e.g. serum and plasma), lymph and cystic fluids, sputum, stool, tears, mucus, hair, skin, ascitic fluid, cystic fluid, urine, nipple exudates, nipple aspirates, semen, vaginal fluid, sweat, exosomes or other vesicles, sections of tissues such as biopsy and autopsy samples, frozen sections taken for histologic purposes, archival samples, explants and primary and/or transformed cell cultures derived from patient tissues, clinical samples, forensic samples from crime scenes, soil samples etc.

    [0087] The single cell or plurality of cells may he a eukaryotic cell, a bacterial cell or an archeal cell, a cell from a pre-implantation embryo, a stem cell, a suspected cancer cell, a suspected tumor-derived cell, a suspected embryonic cell, a cell from a pathogenic organism, or a cell obtained from a crime scene.

    [0088] In one embodiment, the first primer pair comprises primers that span exon-exon boundaries or are separated by at least one intron on the corresponding DNA region.

    [0089] In one embodiment, the second primer pair comprises primers that bind to intronic regions of the target DNA region.

    [0090] The term exon refers to the portion of the genomic DNA that becomes a part of the genomic DNA that is converted into the mature messenger mRNA. The term intron or intronic region refers to the portion of the genomic DNA that is removed by RNA splicing and which would therefore not be present in the final mature mRNA.

    [0091] The term analyze or analyzing refers to studying or examining the amplified target cDNA region and/or the amplified target DNA region by various techniques known in the art.

    [0092] The amplified cDNA region and/or the amplified target DNA region may be studied for its gene expression or for mutations that may be present.

    [0093] In one embodiment, the analysis in step (c) comprises analyzing the amplified target cDNA for gene expression (e.g. in a gene expression analysis). The gene expression analysis may be conducted using any techniques known in the art, such as quantitative PCR, digital PCR, microarray, and the like.

    [0094] In one embodiment, the analysis in step (c) comprises analyzing the amplified target DNA for mutations (e.g. in a mutational analysis). The mutational analysis may be conducted using any techniques known in the art, such as Sanger sequencing, Maxam-Gilbert sequencing, Pyrosequencing, Shot-gun sequencing, high-throughput DNA sequencing, Allele-Specific PCR (ASPCR) or High Resolution Melting temperature PCR (HRM).

    [0095] The pre-amplification in step (b) of the method according to the first aspect may comprise one or more cycling steps. Each cycling step may comprise one or more cycles of amplification (i.e. denaturation, annealing and elongation) at a pre-determined temperature for a pre-determined duration. It would be appreciated that the number of cycling steps, the number of cycles of denaturation, annealing and elongation, the temperature(s) at which the cycles arc conducted, and the duration for which each temperature is applied would depend on the reagents used in the amplification reactions, the target cDNA or DNA region, the primers used, the sample(s) to be amplified. In one embodiment, the amplification does not include a final extension step.

    [0096] In one embodiment, step (b) comprises about 1 to about 50 cycling steps, about 1 to about 40 cycling steps, about 1 to about 30 cycling steps, about 1 to about 25 cycling steps, about 1 to about 20 cycling steps, about 1 to about 10 cycling steps, about 1 to about 5 cycling steps, about 1 to about 4 cycling steps, about 1 to about 3 cycling steps, about 1 cycling step, about 2 cycling steps, or about 3 cycling steps. In one embodiment, step (b) comprises 3 cycling steps.

    [0097] In one embodiment, each cycling step comprises about 1 to about 50 cycles, about 1 to about 40 cycles, about 1 to about 30 cycles, about 1 to about 25 cycles, about 1 to about 20 cycles, about 1 to about 18 cycles, about 1 to about 15 cycles, about 1 to about 10 cycles, about 1 to about 6 cycles, about 2 cycles, about 4 cycles, about 6 cycles, about 8 cycles, about 10 cycles, about 20 cycles, about 30 cycles, about 40 cycles, or about 50 cycles of denaturation, annealing and elongation. In one embodiment, each cycling step comprises 6 cycles of denaturation, annealing and elongation.

    [0098] In one embodiment, the annealing and/or elongation temperature in a cycle is about 40 C. to about 75 C., about 40 C. to about 70 C., about 40 C. to about 65 C., about 40 C. to about 60 C., about 40 C. to about 55 C., about 40 C. to about 50 C., about 40 C., about 45 C., about 50 C., about 55 C., about 60 C., about 65 C., about 70 C., or about 75 C.

    [0099] The annealing and/or elongation temperature for successive cycling steps may be reduced by about 1 C. to about 10 C., about 1 C. to about 9 C., about 1 C. to about 8 C., about 1 C. to about 7 C., about 1 C. to about 6 C., about 1 C. to about 5 C., about 1 C. to about 4 C., about 1 C. to about 3 C., or about 1 C. to about 2 C.

    [0100] In one embodiment, the annealing and/or elongation is carried out for about 10 seconds to about 10 minutes, about 10 seconds to about 8 minutes, about 10 seconds to about 6 minutes, about 10 seconds to about 4 minutes, about 10 seconds to about 2 minutes, about 10 seconds to about 1 minute, about 1 minute, about 2 minutes, about 4 minutes, about 6 minutes, about 8 minutes, or about 10 minutes.

    [0101] In one embodiment, the denaturation is carried out at a temperature of about 75 C. to about 120 C., about 75 C. to about 105 C., about 75 C. to about 95 C., about 75 C. to about 90 C., about 75 C. to about 85 C., about 75 C. to about 80 C., about 75 C., about 80 C., about 85 C., about 90 C., about 95 C., about 100 C., about 105 C., about 110 C., about 115 C., or about 120 C. The denaturation may be carried out for about 1 second to about 10 minutes, about 1 second to about 5 minutes, about 1 second to about 4 minutes, about 1 second to about 3 minutes, about 1 second to about 2 minutes, about 1 second to about 1 minute, about 1 second, about 10 seconds, about 20 seconds, about 30 seconds, about 40 seconds, about 50 seconds, about 1 minute, about 2 minutes, about 3 minutes, about 4 minutes, about 5 minutes, or about 10 minutes. In one embodiment, step (b) of the method according to the first aspect comprises:

    [0102] 6 cycles of 60 C. for 4 minutes followed by 95 C. for 1 minute,

    [0103] 6 cycles of 55 C. for 4 minutes followed by 95 C. for 1 minute, and

    [0104] 6 cycles of 50 C. for 4 minutes followed by 95 C. for 1 minute.

    [0105] In a second aspect, there is provided a method of simultaneously analyzing RNA and DNA in a sample, the method comprising the steps of:

    [0106] (a) lysing a cell in the sample;

    [0107] (b) contacting the lysed cell sample with a reverse primer from a first primer pair, the reverse primer from the first primer pair being directed to a target RNA region, and a reverse transcriptase to effect reverse transcription of the RNA into cDNA;

    [0108] (c) subsequently contacting the lysed cell sample with:

    [0109] (i) a forward primer from the first primer pair, the forward primer from the first primer pair being directed to a target cDNA region,

    [0110] (ii) a reverse primer and a forward primer from a second primer pair, the reverse primer and forward primer from the second primer pair being directed to a target DNA region, and

    [0111] (iii) a DNA polymerase

    [0112] to simultaneously amplify the target cDNA region and the target DNA region in a pre-amplification step;

    [0113] (d) subjecting the sample from step (c) to a semi-nested PCR using the reverse primer in step (b) or the forward primer in step (c)(i), a nested primer that binds within the pre-amplified target cDNA region, and a DNA polymerase to further amplify the target cDNA region, and/or subjecting the sample from step (c) to a nested PCR using a nested primer pair that hinds within the pre-amplified target DNA region and a DNA polymerase to further amplify the target DNA region; and

    [0114] (c) analyzing the further amplified target cDNA region and/or the further amplified target DNA region.

    [0115] In one embodiment of the method of the second aspect, the nested primer in step (d) may be one that matches or corresponds to the reverse primer in step (b) or the forward primer in step (c)(i). In one embodiment of the method of the second aspect, steps (b) and (c) are conducted in the same reaction mixture.

    [0116] Like the method of the first aspect, the method according to the second aspect may also he performed simultaneously for one or more target RNA regions, and/or one or more target cDNA regions, and/or one or more target DNA regions (such as one or more target genomic DNA regions). Accordingly, one or more reverse primers, each having the same or a differing specificity for a target RNA region may be used in step (b) of the method according to the second aspect, one or more forward primers, each having the same or a differing specificity for a target cDNA region may be used in step (c)(i) of the method according to the second aspect, one or more primer pairs, each having the same or a differing specificity for a target DNA region may be used in step (c)(ii) of the method according to the second aspect, one or more nested primers that bind to a target cDNA region, and one or more nested primer pairs that bind to a target DNA region, may be used in step (d) of the method of the second aspect.

    [0117] The term lysing refers to breaking apart the membrane of a cell. This allows DNA or RNA in the cell to be accessible to contact by, for example, one or more primers and enzymes.

    [0118] The lysing in step (a) of the method of the second aspect may be conducted using any techniques known in the art, for example, use of a lysis buffer, sonication, freeze-thaw, mechanical disruption, and the like.

    [0119] In one embodiment, the pre-amplification in step (c) of the method of the second aspect does not include a final extension step.

    [0120] The samples, primers, primer pairs, analytical techniques, and pre-amplification conditions (such as cycling steps, and temperatures and durations used therein) as described above for the method of the first aspect may also be used in the method of the second aspect.

    [0121] In a third aspect, there is provided use of the method according to the first or second aspect for determining the DNA profile and/or the gene expression profile of a single cell or a plurality of cells (e.g. a low number of cells comprising about 2 to about 100 cells), or cell-free RNA and/or DNA (e.g. a low amount of DNA and/or RNA comprising about 1 pg to about 10 ng of DNA and/or RNA) derived from a single cell or a plurality of cells.

    [0122] The term DNA profile refers to the characterization of the DNA sequence of a selection of genes within a cell or a plurality of cells. The term gene expression profile refers to the characterization of the expression level of a selection of genes within a cell or plurality of cells.

    [0123] The use may be applied to a biological sample comprising heterogenous cell types from a subject or a low amount of cell-free RNA and/or DNA. The biological sample may be selected from the group consisting of a pre-implantation embryo, tissues, cells (e.g. a stem cell, a suspected cancer cell), body fluids and isolates thereof etc., isolated from a subject. Examples of biological samples include: whole blood, blood fluids (e.g. serum and plasma), lymph and cystic fluids, sputum, stool, tears, mucus, hair, skin, ascitic fluid, cystic fluid, urine, nipple exudates, nipple aspirates, semen, vaginal fluid, sweat, exosomes or other vesicles, sections of tissues such as biopsy and autopsy samples, frozen sections taken for histologic purposes, archival samples, explants and primary and/or transformed cell cultures derived from patient tissues, clinical samples, forensic samples from crime scenes, soil samples etc.

    [0124] The subject may he a mammal, such as a human. The linkage of the DNA profile to the gene expression profile for the single cell or the plurality of cells, or the low amount of cell-free DNA and/or cell-free RNA may be used to optimize anti-cancer therapy for the subject or for diagnostic/prognostic purposes, as illustrated by the Examples as described herein. Alternatively, the use may he applied to a cell from a pathogenic organism, or a cell obtained from a crime scene, or a low amount of cell-free RNA and/or cell-free DNA derived from a pathogenic organism or a crime scene.

    [0125] In a fourth aspect, there is provided use of the method according to the first or second aspect for validation of large-scale transcriptomics data sets. For example, the use may be applied to confirm specific results obtained by high-throughput RNA sequencing experiments that have been generated using small-scale samples (such as a biological sample comprising of a single cell or a low number of cells, e.g. about 2 to about 101) cells, or a low amount of RNA). This is important to rule out false positive results and to validate the results using an independent methodology. The method can be used to validate both RNA expression and/or mutational profile results that are generated by high-throughput RNA sequencing.

    [0126] In a fifth aspect, there is provided a kit for performing the method according to the first or second aspect, or for use according to the third or fourth aspect, wherein the kit comprises:

    [0127] (a) a primer selected from the group consisting of:

    [0128] i. the reverse primer of step (a) of the method of the first aspect or step (b) of the method of the second aspect,

    [0129] ii. the forward primer of step (b)(i) of the method of the first aspect or step (c)(i) of the method of the second aspect,

    [0130] iii. the primer pair of step (b)(ii) of the method of the first aspect or step (c)(ii) of the method of the second aspect, and

    [0131] iv. the nested primer and nested primer pair of the method of the first aspect or step (d) of the method of the second aspect;

    [0132] (b) one or more reagents, selected from the group consisting of:

    [0133] i. a reverse transcriptase and one or more suitable reaction buffers for the reverse transcription in step (a) of the method of the first aspect or step (b) of the method of the second aspect,

    [0134] ii. a DNA polymerase and one or more suitable reaction buffers for the amplification in step (b) or the semi-nested or nested PCR of the method of the first aspect, or step (c) or (d) of the method of the second aspect, and

    [0135] iii. one or more labelled or unlabelled deoxyribonucleotides selected from the group consisting of dATP, dCTP, dGTP, and dTTP or dUTP; and

    [0136] (c) instructions for performing the method according to the first or second aspect, or for use according to the third or fourth aspect.

    [0137] The kit according to the fifth aspect may include one or more lysis buffers for lysing a cell in a sample prior to the method of the first aspect, or in step (a) of the method of the second aspect. Lysis buffers commonly used in the art, such as alkaline lysis buffers or cell lysis buffers containing proteinase K, or simply buffers containing a detergent or a compound and/or an enzyme that will disrupt the cell and allow its nucleic acids to be released in solution may be used.

    [0138] The kit according to the fifth aspect may also include probes or dyes for quantitative real-time PCR. Exemplary probes and dyes include, but are not limited to SYBR green dye, EvaGreen, dsGreen, TaqMan probes, hybridization probes and the like.

    [0139] The kit may also include instructions for designing one or more of the primers of component (a) of the kit of the fifth aspect, and/or optimizing the pre-amplification cycling conditions of step (b) of the method of the first aspect or step (c) of the method of the second aspect.

    [0140] In one embodiment, the primers and/or reagents are pre-mixed in combinations suitable for the lysis, pre-amplification, and amplification steps described above. In another embodiment, the primers arc pre-mixed in combinations suitable for analysis of gene expression profiles or mutation signatures. The primers may be ones that have been designed for amplifying one or more target genes of interest.

    [0141] In a further embodiment, the kit comprises one or more containers comprising one or more reaction buffers for performing the methods and/or uses described above. In some embodiments, the kit includes software-driven assay protocols for use in commercial PCR instrumentation (such as the Life Technologies 7500 FastDx or Cepheid SmartCycler II), which may be provided on a CD.

    [0142] As used herein, the singular form a, an and the include plural references unless the context clearly dictates otherwise. For example, the term a primer includes a plurality of primers, including mixtures thereof.

    [0143] The word substantially does not exclude completely e.g. a composition which is substantially free from Y may be completely free from Y. Where necessary, the word substantially may he omitted from the definition of the invention.

    [0144] Unless specified otherwise, the terms comprising and comprise, and grammatical variants thereof, are intended to represent open or inclusive language such that they include recited elements but also permit inclusion of additional, unreeited elements.

    [0145] As used herein, the term about, in the context of concentrations of components of the formulations, typically means +/5% of the stated value, more typically +/4% of the stated value, more typically +/3% of the stated value, more typically, +/2% of the stated value, even more typically +/1% of the stated value, and even more typically +/0.5% of the stated value.

    [0146] Throughout this disclosure, certain embodiments may be disclosed in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not he construed as an inflexible limitation on the scope of the disclosed ranges. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should he considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

    [0147] Certain embodiments may also be described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the disclosure. This includes the generic description of the embodiments with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.

    EXAMPLES

    Example 1

    Primer Design and scrmPCR Protocols

    [0148] The following protocol steps or materials have been implemented in the method from sources already described elsewhere:

    [0149] 1) Conditions described in Pcixoto et al., specifically:

    [0150] a. Use of reverse specific primers for reverse transcriptase reaction.

    [0151] b. Use of seminested PCR for RNA transcripts quantitation.

    [0152] 2) Materials from the CellsDirect One-Step qRT-PCR Kit (Invitrogen), specifically:

    [0153] a. 2X Reaction Mix cat # 11753-100

    [0154] b. SuperScript III RT/Platinum Taq Mix contained in cat #11753-100

    [0155] 3) Conditions described in Protocol PN 100-4109 from the Biomark HD system (Fluidigm) (Sanchez-Freire et al) and

    [0156] http://www.fluidigm.com/home/fluidigm/docs/AppNote_2v1Step_pf9.pdf), specifically:

    [0157] a. Deposition of single cell in 2 Reaction mix.

    [0158] b. Annealing time of the preamplification step (4 minutes).

    [0159] Primer Design Protocol

    [0160] Primer Design Method for Detection of Small Amount of RNA in Multiplex Tests (Down to Single Cell Detection)

    [0161] To design primers for mRNA amplification in the presence of genomic DNA at the single cell scale, there must be an intronic sequence on the genomic DNA between primers, or at least one primer must sit at the exon-exon junction. In addition, the primers need to he specific and should not amplify unwanted products.

    [0162] This protocol can be used to generate primers for seminested/nested PCRs following the general method of Peixoto et.al. (http://www.ncbi.nlm.nih.gov/pubmed/15466292). Seminested PCR is required for robust amplification of RNA-derived gene transcripts. Nested PCR is required for robust amplification of genomic DNA.

    [0163] Procedure:

    [0164] The following tools were used (by opening in Firefox):

    [0165] 1) Nchi primer design tool at http://www.ncbi.nlm.nih.gov/tools/primer-blast/

    [0166] This software is based on Primer3 and Blast for optimal primer pair findings. It can also design primers at the exon-exon junction.

    [0167] Seminested PCR: for the external primer pairs, the parameters used may he varied accordingly depending on sample type and objective of the study.

    [0168] 2) Ensembl genome browser at http://www.ensembl.org/Homo_sapiens/Info/Index

    [0169] This webtool allows for straightforward gene selection and curated ID retrieval. 3) Netprimer at http://www.premierbiosoft.com/jsp/marketing/FreeToolLogin.jsp?PID=3

    [0170] This webtool allows checking of the quality of the primers, by rating it accordingly.

    [0171] The following steps using the above webtools were applied:

    [0172] a) searched for the gene of interest in Ensembl

    [0173] b) checked for the correct identification and clicked on external references

    [0174] c) scrolled down and identified the RefSeq identifier

    [0175] d) copied and pasted the identifier on the ncbi primer design tool window

    [0176] e) looked for primers using the link provided above or customized stringency

    [0177] f) checked the primers on the Netprimer application and selected the best primer pair by rating.

    [0178] g) if no primers were returned, less stringent parameters were used.

    [0179] Example: Design of CD45 primers.

    TABLE-US-00001 Forwardprimer (SEQIDNO:137) AAGACAACAGTGGAGAAAGGACGCA Reverseprimer (SEQIDNO:138) CAGTGGGGGAAGGTGTTGGGCT

    [0180] Product length 159

    [0181] Exon junction 131/132 (forward primer) on template NM_002838.3

    [0182] To look for the internal probe, the same search as above may be performed, using the primer with better ratings and constrain the PCR product length to retrieve a primer that sits in the PCR product.

    [0183] For primers on genomic regions, the following steps were applied:

    [0184] a) looked for the gene of interest in Ensembl

    [0185] b) clicked on sequence

    [0186] c) selected genomic region for sequencing including intronic regions

    [0187] d) copied and pasted on primer-blast

    [0188] e) looked for primers targeting the region of interest

    [0189] Two pairs of primers were designed, one with annealing temperature (T) of 60 C., one with annealing T of 65 C.

    [0190] For design of internal probes, the amplified region was selected by primer set one, copied and pasted in primer-blast. Primers with an annealing T of 60 C. were selected.

    [0191] Primers Design:

    [0192] Primers were designed using Primer-BLAST (Ye et al and Bbenek, et al) and using the primer design protocol described above. For each RNA transcript, primers either spanning exon-exon boundaries or primers separated by at least one intron on the corresponding genomic DNA region were designed. This allows primers to specifically amplify RNA transcripts, whereas DNA regions would not he amplified. Furthermore, primers for mutational analysis were designed to hind intronic regions of the target gene. This would avoid amplification of cDNA transcripts that may have arisen from unspecific or specific reverse transcription. (see Primer Design protocol (above) and Tables 1A to 1C).

    TABLE-US-00002 TABLE1A Primers used in scrm-PCR assays (Pre-amplification step) Pramplification step Genename ID(transcriptorgene) Marker Forwardprimer Reverseprimer CEACAM5 NM_004363.2 C CCCAAGCCCTCCATCTCCAGCAAC GCATCCGGGCCATAGAGGACATT (SEQIDNO:1) (SEQIDNO:2) CDX2 NM_001265.4 C TGGGCTGCTGCAAACGCTCAAC TTTCGTCCTGGTTTTCACTTGGCTG (SEQIDNO:3) (SEQIDNO:4) KRT20 NT_01783.15 C AAAATGGCCATGCAGAACCT GAAGTCCTCAGCAGCCAGTT (SEQIDNO:5) (SEQIDNO:6) FN1 NT_5403.17 EMT CCACGGGAGCCTCGAA TAAAACCTCGGCTTCCTCCA (SEQIDNO:7) (SEQIDNO:8) CDH2 NT_010966.14 EMT GGATGAAGATGGCATGGTGT CCCAGTCTCTCTTCTGCCTT (SEQIDNO:9) (SEQIDNO:10) SERPINE1 NT_007933.15 EMT GCCAAGAGCGCTGTCAA CAGCAGACCCTTCACCAAA (SEQIDNO:11) (SEQIDNO:12) TWIST1 NM_000474.3 EMT ACCTAGATGTCATTGTTTCCAGAGA GCAGAGGTGTGAGGATGGTG (SEQIDNO:13) (SEQIDNO:14) SNAI1 NM_005985.3 EMT GACCCCAATCGGAAGCCTAA GCGGTGGGGTTGAGGAT (SEQIDNO:15) (SEQIDNO:16) VIM NM_003380.3 EMT GATGTTTCCAAGCCTGACCT CAGTGGACTCCTGCTTTGC (SEQIDNO:17) (SEQIDNO:18) SNAI2 NM_003068.4 EMT AGCGAACTGGACACACATACA AGGAGGTGTCAGATGGAGGA (SEQIDNO:19) (SEQIDNO:20) FOXC2 NM_005251.2 EMT CGCCTAAGGACCTGGTGAA GAAGCGGTCCATGATGAACT (SEQIDNO:21) (SEQIDNO:22) FOXC1 NM_001453.2 EMT CACACCCTCAAAGCCGAACT AAAGTGGAGGTGGCTCTGAA (SEQIDNO:23) (SEQIDNO:24) CDH1 NT_010498.15 EMT/L(Ep) GAGAGAGGCCGCGTCCT GGCCTTTTGACTGTAATCACAC (SEQIDNO:25) (SEQIDNO:26) KRT18(1) NM_000224.2 EMT/L(Ep) TGCTCACCACACAGTCTGAT CACTTTGCCATCCACTAGCC (SEQIDNO:27) (SEQIDNO:28) KRT8 NM_002273.3 EMT/L(Ep) AAGGATGCCAACGCCAAGTT CCGCTGGTGGTCTTCGTATG (SEQIDNO:29) (SEQIDNO:30) KR719 NM_002276.4 EMT/L(Ep) CAGCCACTACTACACGACCA CGTTGATGTCGGCCTCCA (SEQIDNO:31) (SEQIDNO:32) EPCAM NT_022184.15 EMT/L(Ep) GCAGGTCCTCGCGTTCG TCTCCCAAGTTTTGAGCCATTC (SEQIDNO:33) (SEQIDNO:34) TP53exon ENSG00000141510 G TGTTCACTTGTGCCCTGACT CAGCCCTGTCGTCTCTCCAG 5 (SEQIDNO:35) (SEQIDNO:36) TP53exon ENSG00000141510 G TGGTTGCCCAGGGTCCCCA TGGAGGGCCACTGACAACCA 6 (SEQIDNO:37) (SEQIDNO:38) TP53exon ENSG00000141510 G CTTGCCACAGGTCTCCCCAA AGGGGTCAGAGGCAAGCAGA 7 (SEQIDNO:39) (SEQIDNO:40) TP53exon ENSG00000141510 G TTCCTTACTGCCTCTTGCTT AGGCATAACTGCACCCTTGG 8 (SEQIDNO:41) (SEQIDNO:42) BRAFexon ENSG00000157764 G CATAATGCTTGCTCTGATAGG GGCCAAAATTTAATCAGTGGA 15(2) (SEQIDNO:43) (SEQIDNO:44) KRASexon ENSG00000133703 G TTATAAGGCCTGCTGAAAATGACTG TCATGAAAATGGTCAGAGAAACCTT 2 (SEQIDNO:45) (SEQIDNO:46) EGFR NT_033968.6 L(Ep) GTCGGGCTCTGGAGGAAAA CTCTGGAGGCTGAGAAAATGAT (SEQIDNO:47) (SEQIDNO:48) PTPRC NT_004487.19 L(He) GACATCATCACCTAGCAGTTCATG CAGTGGGGGAAGGTGTTGG (SEQIDNO:49) (SEQIDNO:50) VWF NM_000552.3 L(En) ACACAGGGGGACCAAAGAG GAGATGCCCGTTCACACCA (SEQIDNO:51) (SEQIDNO:52) PECAM1 NM_000442.4 L(He,En) TCTCAACGGTGACTTGTGG GTTCTTCCCATTTTGCACCGT (SEQIDNO:53) (SEQIDNO:54) COL1A1 NM_000088.3 L(Me) TGTTCAGCTTTGTGGACCTC GGTTTCCACACGTCTCGGT (SEQIDNO:55) (SEQIDNO:56) CD68 NM_001251.2 L/Me CATTCTTTCACCAGCTGTCCA GCACCAGGGCGAGGA (SEQIDNO:57) (SEQIDNO:58) MCAM NM_006500.2 L(En) CTCGGTCCCAGGAGTACC TGTACAAACCACTCGACTCCA (SEQIDNO:59) (SEQIDNO:60) FCGR3A NM_000569.6 L(He) CCCTTGCCAGACTTCAGACT GGGAGATCTTCAGTCCGCAT (SEQIDNO:61) (SEQIDNO:62) GYPA NM_002099.6 L(Er) CTAGCAGGCTAAGGTCAGACA GTGTCCCGTTTGTGCGTATC (SEQIDNO:63) (SEQIDNO:64) ITGA2H NM_000419.3 L(Me) CTTCTATGCAGGCCCCAAT AGCCTACATTTCGGGTCTCATC (SEQIDNO:65) (SEQIDNO:66) DCSTAMP NM_030788.3 L(He) CTCCCGCTGAATAAGGAGGAA TCTTGAGTTCCTTGTTTCTCTCCGT (SEQIDNO:67) (SEQIDNO:68) CD34 NM_001773.2 S/L(En) CCTTCTGGGTTCATGAGTCTTGACA TGTCGTTTCTGTGATGTTTGTTGTG (SEQIDNO:69) (SEQIDNO:70) ACTB NM_001101.3 QC CTGGCACCACACCTTCTACA TAGCACAGCCTGGATAGCAA (SEQIDNO:71) (SEQIDNO:72) FOLH1 NT_009237.18 TEC CGGATATTGTACCACCTTTCAGT AGCAGGGTCGGAGTAGAGAA (SEQIDNO:73) (SEQIDNO:74) ENG NT_008470.19 L(En) GTGACGGTGAAGGTGGAACTGA TTGAGGTGTGTCTGGGAGCT (SEQIDNO:75) (SEQIDNO:76) KDR NM_002253.2 L(En) GAAATGACACTGGAGCCTACAAG AATGGACCCGAGACATGGAAT (SEQIDNO:77) (SEQIDNO:78) CDH5 NM_001795.3 L(En) GTTCACGCATCGGTTGTTCAAT GCCTGCTTCTCTCGGTCCAA (SEQIDNO:79) (SEQIDNO:80) TEK NT_008413.19 L(En) CTTATTTCTGTGAAGGGCGAGTT CTCCCTTGTCCACAGTCATAGT (SEQIDNO:81) (SEQIDNO:82) ANGPT2 NM_001147.2 L(En) AACACTCCCTCTCGACAAACAAATT CTGTAGTTGGATGATGTGCTTGTC (SEQIDNO:83) (SEQIDNO:84) HPRT1 NM_000194.2 QC TGACCAGTCAACAGGGGACA GGTCCTTTTCACCAGCAAGCT (SEQIDNO:85) (SEQIDNO:86) UHC NM_021009.5 QC TCGGCCTTAGAACCCCAGTA ACGAAGATCTGCATTGTCAAGTG (SEQIDNO:87) (SEQIDNO:88)

    [0193] References and Legend

    [0194] (1) derived from Hesse et al. (2001) J. Cell Sci. 114, 2569

    [0195] (2) derived from Sakaizawa et al. Br. J. Cancer (2012) 106, 939

    [0196] Legend:

    [0197] C: Colon-specific

    [0198] EMT: Epithelial-mesenchymal transition marker

    [0199] L: Lineage marker

    [0200] G: Gene

    [0201] OC: Quality control

    [0202] TEC: Tumor endothelial cell marker

    [0203] S: Stem cell marker

    [0204] Ep: Epithelial marker

    [0205] He: Hematopoietic cell marker

    [0206] En: Endothelial cell marker

    [0207] Mn: Megakaryocyte/platelet marker

    [0208] Mo: Monocyte-macrophage marker

    [0209] Er: Erythrocyte marker

    TABLE-US-00003 TABLE1B Primersusedinscrm-PCRassaysfornestedandsemi-nestedamplification (AmplificationStep) Amplificationstep Genename AllowsDNA/RNAdiscrimination Forwardprimer Reverseprimer CEACAM5 Reverseprimeronexonjunction TGTGGTGGGTAAACAATCAGAGCC GCATCCGGGCCATAGAGGACATT (SEQIDNO:89) (SEQIDNO:2) CDX2 Reverseprimeronexonjunction CGGCGGAACCTGTGCGAGTG TTTCGTCCTGGTTTTCACTTGGCTG (SEQIDNO:90) (SEQIDNO:4) KRT20 2141bpintroninDNAsequence GCGACTACAGTGCATATTACAGA GAAGTCCTCAGCAGCCAGTT (SEQIDNO:91) (SEQIDNO:6) FN1 830bpintroninDNAsequence CAAGCCCGGTTGTTATGACA TAAAACCTCGGCTTCCTCCA (SEQIDNO:92) (SEQIDNO:8) CDH2 1690bpintroninDNAsequence AAGTTCCTGATATATGCCCAAGA CCCAGTCTCTCTTCTGCCTT (SEQIDNO:93) (SEQIDNO:10) SERPINE1 1148bpintroninDNAsequence AGAACTTCAGGATGCAGATGTCT CAGCAGACCCTTCACCAAA (SEQIDNO:94) (SEQIDNO:12) TWIST1 Forwardprimeronexonjunction CCAGAGAAGGAGAAAATGGACAGT GCAGAGGTGTGAGGATGGTG (SEQIDNO:95) (SEQIDNO:14) SNAI1 682bpintroninDNAsequence GACCCCAATCGGAAGCCTAA GTAGGGCTGCTGGAAGGTAA (SEQIDNO:15) (SEQIDNO:96) VIM 761bpintroninDNAsequence GATGTTTCCAAGCCTGACCT TGTACCATTCTTCTGCCTCCT (SEQIDNO:17) (SEQIDNO:97) SNAI2 745bpintroninDNAsequence AGCGAACTGGACACACATACA GTGGAATGGAGCAGCGGTAG (SEQIDNO:19) (SEQIDNO:98) FOXC2 NA(singleexoncodinggene) GCTCATCACCATGGCCATC GAAGCGGTCCATGATGAACT (SEQIDNO:99) (SEQIDNO:22) FOXC1 NA(singleexoncodinggene) CACACCCTCAAAGCCGAACT GAGGGATATTCTGTTCGCTGGT (SEQIDNO:23) (SEQIDNO:100) CDH1 63258bpintroninDNAsequence GGCAGAGTGAATTTTGAAGATTGC GGCCTTTTGACTGTAATCACAC (SEQIDNO:101) (SEQIDNO:26) KRT18(1) 641bpintroninDNAsequence TGGAGGACCGCTACGCCCTA CCAAGGCATCACCAAGACTA (SEQIDNO:102) (SEQIDNO:103) KRT8 159bpintroninDNAsequence GCTGGAGGGCGAGGAGA CCGCTGGTGGTCTTCGTATG (SEQIDNO:104) (SEQIDNO:30) KRT19 2745bpintroninDNAsequence TGCGGGACAAGATTCTTGGT CGTTGATGTCGGCCTCCA (SEQIDNO:105) (SEQIDNO:32) EPCAM 4118bpintroninDNAsequence CCGCAGCTCAGGAAGAATGT TCTCCCAAGTTTTGAGCCATTC (SEQIDNO:106) (SEQIDNO:34) TP53exon Primersonintronicsequences TTCAACTCTGTCTCCTTCCT CAGCCCTGTCGTCTCTCCAG 5 (SEQIDNO:107) (SEQIDNO:36) TP53exon Primersonintronicsequences GCCTCTGATTCCTCACTGAT TTAACCCCTCCTCCCAGAGA 6 (SEQIDNO:108) (SEQIDNO:109) TP53exon Primersonintronicsequences AAGGCGCACTGGCCTCATCTT AGGGGTCAGAGGCAAGCAGA 7 (SEQIDNO:110) (SEQIDNO:40) TP53exon Primersonintronicsequences AGTGGTAATCTACTGGGACGG ACCTCGCTTAGTGCTCCCTG 8 (SEQIDNO:111) (SEQIDNO:112) BRAFexon Primersonintronicsequences CATAATGCTTGCTCTGATAGG TAGCCTCAATTCTTACCATC 15(2) (SEQIDNO:43) (SEQIDNO:113) KRASexon Primersonintronicsequences TTATAAGGCCTGCTGAAAATGACTG CAAAGAATGGTCCTGCACCAGTAAT 2 (SEQIDNO:45) (SEQIDNO:114) EGFR 122920bpintroninDNAsequence TCTGGAGGAAAAGAAAGTTTGC CTCTGGAGGCTGAGAAAATGAT (SEQIDNO:115) (SEQIDNO:48) PTPRC 53092bpintroninDNAsequence CAACAGTGGAGAAAGGACGCA CAGTGGGGGAAGGTGTTGG (SEQIDNO:116) (SEQIDNO:50) VWF Forwardprimeronexonjunction TGCCTCCAAAGGGCTGTATC GAGATGCCCGTTCACACCA (SEQIDNO:117) (SEQIDNO:52) PECAM1 12457bpintroninDNAsequence CAGTCTTCACTCTCAGGATGC GTTCTTCCCATTTTGCACCGT (SEQIDNO:118) (SEQIDNO:54) COL1A1 1463bpintroninDNAsequence TGTTCAGCTTTGTGGACCTC GTGGGATGTCTTCGTCTTGG (SEQIDNO:55) (SEQIDNO:119) CD68 311bpintroninDNAsequence AAAGTTTCTCCTGCCCCAGT GCACCAGGGCGAGGA (SEQIDNO:120) (SEQIDNO:58) MCAM 1724bpintroninDNAsequence CTCGGTCCCAGGAGTACC CGGCCATTCTTGTACCAGATGA (SEQIDNO:59) (SEQIDNO:121) FCGR3A Reverseprimeronexonjunction CCCTTGCCAGACTTCAGACT TTTCCCCAGCCCCTCCA &introninDNAseq (SEQIDNO:61) (SEQIDNO:122) GYPA 20010bpintronsinDNAsequence CAGGAACCAGCTCATGATCTC GTGTCCCGTTTGTGCGTATC (SEQIDNO:123) (SEQIDNO:64) ITGA2B 3242bpintroninDNAsequence GGCGGCGTGTTCCTGT AGCCACATTTCGGGTCTCATC (SEQIDNO:124) (SEQIDNO:66) DCSTAMP Reverseprimeronexonjunction ACCTGGGGCTGTTTTTCCTC TCTTGAGTTCCTTGTTTCTCTCCGT (SEQIDNO:125) (SEQIDNO:68) CD34 Forwardandreverseprimerson CTACCCCAGAGTTACCTACCCA TGTCGTTTCTGTGATGTTTGTTGTG exonjunction (SEQIDNO:126) (SEQIDNO:70) ACTB 441bpintroninDNAsequence CTGGCACCACACCTTCTACA TAGCACAGCCTGGATAGCAA (SEQIDNO:71) (SEQIDNO:72) FOLH1 6811bpintroninDNAsequence CCAGAGGGCGATCTAGTGTA AGCAGGGTCGGAGTAGAGAA (SEQIDNO:127) (SEQIDNO:74) ENG 256bpintroninDNAsequence GTGACGGTGAAGGTGGAACTGA AGTATTCTCCAGTGGTCCAGATCT (SEQIDNO:75) (SEQIDNO:128) KDR 3192bpintroninDNAsequence GAAATGACACTGGAGCCTACAAG TGTTGGTCACTAACAGAAGCA (SEQIDNO:77) (SEQIDNO:129) CDH5 2143bpintroninDNAsequence CACGCCTCTGTCATGTACCA GCCTGCTTCTCTCGGTCCAA (SEQIDNO:130) (SEQIDNO:80) TEK 10352bpintroninDNAsequence CTTATTTCTGTGAAGGGCGAGTT GTAGCTGGTAGGAAGGAAGCT (SEQIDNO:81) (SEQIDNO:131) ANGPT2 6144bpintroninDNAsequence GGACCAGACCAGTGAAATAAACAA CTGTAGTTGGATGATGTGCTTGTC (SEQIDNO:132) (SEQIDNO:84) HPRT1 Reverseprimeronexonjunction TGACACTGGCAAAACAATGCA GGTCCTTTTCACCAGCAAGCT &intronsinDNAseq (SEQIDNO:133) (SEQIDNO:86) UBC Reverseprimeronexonjunction AAAGTAGTCCCTTCTCGGCG ACGAAGATCTGCATTGTCAAGTG (SEQIDNO:134) (SEQIDNO:88)

    [0210] References and Legend

    [0211] (1) derived from Hesse et al. (2001) J. Cell Sci. 114, 2569

    [0212] (2) derived from Sakaizawa et al. Br. J. Cancer (2012) 106, 939

    TABLE-US-00004 TABLE 1C Primers used in scrm-PCR assays (Amplification products and qPCR melt curve peak) qPCR melt Gene name Amplification product (bp) curve peak ( C.) CEACAM5 187 85.4 CDX2 75 92.6 KRT20 122 82.2 FN1 113 81.8 CDH2 184 83.2 SERPINE1 81 84.8 TWIST1 208 86 SNAI1 72 82.4 VIM 100 84.8 SNAI2 140 83.4 FOXC2 82 83.7 FOXC1 146 76.1 CDH1 107 83 KRT18(1) 210 89.2 KRT8 72 83.5 KRT19 144 86.35 EPCAM 179 82.9 TT53 exon 5 248 NA TT53 exon 6 182 NA TP53 exon 7 219 NA TP53 exon 8 141 NA BRAF exon 15(2) 197 NA KRAS exon 2 177 NA EGFR 87 81.75 PTPRC 155 83.5 VWF 275 86.2 PECAM1 173 86.4 COL1A1 108 88 CD68 84 85.5 MCAM 175 86.8 FCGR3A 90 81.8 GYPA 177 81/84 ITGA2B 91 88.4 DCSTAMP 172 78.1 CD34 155 82.3 ACTB 166 88.5 FOLH1 189 82 ENG 133 87.5 KDR 115 81 CDH5 107 80.8 TEK 88 82.4 ANGPT2 97 82.9 HPRT1 94 82.3 UBC 174 87.9

    [0213] References and Legend

    [0214] (1) derived from Hesse et al. (2001) J. Cell Sci. 11.4, 2569

    [0215] (2) derived from Sakaizawa et al. Br. J. Cancer (2012) 106, 939

    [0216] scrmPCR Protocol

    [0217] 1) Single cells were micromanipulated in 5 l 2 Reaction Buffer (CellsDirect One-Step qRTPCR Kit (Invitrogen)) and stored at 80 C. until use.

    [0218] 2) Single cell RNA transcripts were reverse transcribed at 50 C. for 30 min using SuperScript III RT (Invitrogen) and a mix of 100 nM target reverse primers. The reverse transcriptase component was inactivated at 95 C. for one minute. Next, the samples were placed on ice, and was proceeded immediately to the next step.

    [0219] 3) A pre-amplification round was next performed by adding a mix of forward primers (matching the reverse primers added in step 2) and primer pairs for specific DNA regions.

    [0220] 4) Preamplification was performed similarly as described for the Protocol PN 100-4109 from the Biomark HD system (Fluidigm), using 4 minutes annealing time but changing the annealing temperature to the following cycling steps:

    [0221] 6 cycles: 4, 60 C.-1, 95 C.

    [0222] 6 cycles: 4, 55 C.-1, 95 C.

    [0223] 6 cycles: 4, 50 C.-1, 95 C.

    [0224] 5) Primers cleanup from the samples was performed using standard methods (e.g. spin columns such as Axygen Axyprcp PCR Clean-up Kit-Cat #14-223-018).

    [0225] 6) Samples were diluted 1/20-1/50 and stored at 20 until further use. This resulted in at least 200 l of preamplified sample, which is sufficient for 100 reactions.

    [0226] 7) For RNA transcript quantitation, quantitative PCR was performed on a ViiA7 Instrument (Applied Biosystems) using 2 ul of preamplification reaction from 5), scmincsted primer pairs according to the target transcript (Table 1B) and the SensiFAST SYBR Lo-ROX Kit (Bioline) following the manufacturer protocol. To analyze selected DNA mutational hotspots, PCR was performed by using 2 ul of preamplification reaction from 5), nested PCR primer pairs (Table 1B) and a mastermix containing a proof reading polymerase (KOD Mastermix, EMD Millipore) following manufacturer's instructions. PCR products were separated on agarose gel, specific bands were excised and sequenced using the Sanger method. Step 7 can be performed using any qPCR method and the listed primers. PCR for DNA sequence can be performed using any Taq polymerase with proofreading activity and mutation detection can be performed also using qPCR techniques such as Allele specific PCR (ASPCR) or High resolution melting temperature PCR (HRM).

    Example 2

    Tumour-Derived Endothelial Microemboli Prevalent in Early Stage Colorectal Cancer Patients

    [0227] Patient samples and clinical data. All subjects had given informed written consent to participate. Clinical samples were obtained between July 2012 and April 2014 according to protocols approved by the Institutional Review Boards (IRB) of the National University of Singapore, Fortis Surgical Hospital and Singapore Health Services (SingHealth). Consecutive blood samples from 82 CRC patients were provided by Fortis Surgical Hospital (FSH) and National Cancer Center, Singapore (NCC). Blood samples from 45 healthy subjects were provided by the Singapore Consortium of Cohort Studies (SCCS). All samples were collected in EDTA Vacutainer tubes (Becton-Dickinson) and processed within 6 h at the Institute of Bioengineering and Nanotechnology. Two cases were excluded from analysis because of technical failure of the microfiltration device. Wherever available, matched tumour and metastatic samples were immediately frozen after resection, and stored at 80 C. until use. Clinicopathologic data for participating subjects are described in Supplementary Table 6 and were collected retrospectively after completion of CTM counts. Clinical data collection was conducted without prior knowledge of CTM counts. Similarly, clinical data for CRC patients were not known at the time of CTM count except for diagnosis and preoperative status of FSH samples. Tumour area was calculated by widthlength.

    [0228] Cell lines and culture. HCT 116, COLO 201, SW480, SW620, DLD-1 and RKO colorectal cancer cell lines, BJ-5ta immortalized human foreskin fibroblasts and HUVECs were from ATCC. HUVECs were used at passage 1 and 2 and cultured in EGM-2 medium (Lonza). All other cell lines were cultured in DMEM (Life Technologies) supplemented with 10% FBS. Cells were maintained in a humidified incubator at 37 C. in the presence of 5% CO.sub.2.

    [0229] Device fabrication and assembly. Silicon microsieves were fabricated as described (Lim et al). Briefly, the microsieve consists of a silicon disk having an overall diameter () of 7.3 mm and a support ring of thickness 300 m. The central capture region has 5.3 mm and 60 m thickness containing 100,000 circular pores obtained by deep reactive ion etching. To embed the microsieve in a sterile 3-mI syringe, an acrylic sleeve insert was designed, consisting of an inlet channel of 8.58 mm tapered to a 5.54 mm channel, which corresponded to the microsieve cell capture region. The sleeve insert housed the microsieve and silicone O-rings (0.5 mm-thick) that ensured good sealing and cushioning as shown in FIG. 9b. The retrieval device was assembled as follow. Firstly, the rubber plug of a 3 ml syringe plunger was removed and a hole of 5.5 mm diameter was created using a punch cutter. The perforated rubber plug was placed in the 3-ml syringe. Next, an O-ring was placed in the slot of sleeve insert, followed by microsieve and another O-ring. Finally the sleeve insert with microsieve and O-rings was placed in the 3-ml syringe above the perforated rubber plug. This arrangement enabled the microfiltration of cells by size from whole blood and the subsequent retrieval of captured cells from the upper surface of microsieve in a convenient set-up.

    [0230] Microfiltration. To optimize blood microfiltration, 5 M CellTracker (Life Technologies) labelled cells were added to donor blood at 10-50 cells per ml of whole blood. Blood was filtered at various flow rates by means of a peristaltic pump (Ismatec). After 6 washes using PBS, 0.5% BSA and 2 mM EDTA, cells were resuspended in culture medium. Subsequently, cell nuclei were stained using Hoechst 33342 (Life Technologies), and cells were retrieved to determine retrieval efficiency and fold depletion of contaminating WBCs. In some experiments, CellTracker positive cells remaining on the microsieve were also counted. [0231] Percent retrieval efficiency was calculated as follow:


    % Retrieval Efficiency=(Retrieved cells)100/(Spiked Cells) [0232] Fold depletion from 1 ml whole blood was calculated as follow:


    Fold Depletion=(WBCs in Whole Blood)/(WBCs in Microfiltrate)

    [0233] WBC count in microfiltrate is defined as the number of any Hoechst 33342 positive, CellTracker negative event in the case of experimental enrichment or by any CD45 positive event in the case of clinical sample analysis. All clinical samples were immediately processed for the indicated downstream applications using optimized parameters described in FIG. 5b and c. To estimate ideal target WBC depletion, micromanipulation on serial dilution of PBMCs containing 50 CellTracker positive HCT 116 cells was performed. Five thousand fold depletion allowed micromanipulation of pure HCT 116 cells without contaminant white blood cells. The ideal target retrieval efficiency was chosen based on literature search on existing label-free CTC isolation devices (Cima et al). Microfiltration of clinical samples was performed using 2 ml whole blood for each device and optimized microfiltration conditions.

    [0234] On-sieve immunofluorescence. Suspension cells were stained for 30 min directly on sieve after 5 washes in PBS containing 0.5% BSA, 2 mM EDTA and human FcR Blocking Reagent (Miltenyi Biotec) using following fluorescent-labelled antibodies: anti-CD45 1:200 (clone 2D1; cBioscience), anti-Ep-CAM 1:20 (9C4, BioLegend), anti-CD31 1:20 (WM59, BioLegend), anti-CD144 1:10 (55-7H1, BD), anti-CD41 1:20 (HIP8, BioLegend) anti-CD42B 1:20 (HIP1, BioLegend). For intracellular antigens, the Inside Stain kit (Miltenyi Biotec) and human FcR Blocking Reagent were used with following antibodies: anti-VWF 1:200 (rabbit polyclonal A 0082, DAKO, conjugated in-house to Alexa 488 or Alexa 555 using Life Technologies APEX Antibody Labeling Kit), anti-Vimentin (V9, Santa Cruz Biotechnology), anti-pan Cytokeratin (C11, Cell Signaling Technology). Nuclei were stained using Hoechst 33342 (Life Technologies). In some experiments, Calcein AM (Life Technologies) was used to identify living cells. After a washing step, cells were retrieved and visualized in suspension under an inverted fluorescence microscope (IX81, Olympus) for imaging, counting and/or micromanipulation. Images were recorded using the MetaMorph software (Molecular Devices) with a CoolSNAP HQ2 CCD Camera (Photometrics).

    [0235] CTM definition and count. CTM were defined in this study by any CD45.sup. cell or CD45.sup. cellular cluster with a major axis of >10 m and having at least 2 clearly distinct nuclei. In the studies described herein, all cells defined as such, stained positive for endothelial markers CD31, CD144 or VWF (FIG. 7b). Importantly, the cellular populations belonging to the megakaryocytic lineages, having large and lobulated single nuclei or large and round single nuclei, were excluded. These cells had characteristic cytomorphology easily discernible from CTM, stained positive for CD41 and CD42B, and were predominantly observed in CRC patients undergoing treatment, but also in some healthy volunteers and treatment-naive CRC patients. Single endothelial cells, owing to their smaller diameter that would allow them to pass through the microsieve, were also excluded from the analysis. CTM were counted by applying these inclusion and exclusion criteria by adding the microfiltrate obtained from 2 ml of whole blood to a well of a 96-well plate. After a short centrifugation step, CTM were identified and counted by manually scanning the target well three times using a 20 objective. A positive sample was defined by the detection of at least one CTM.

    [0236] Target cell identification, micromanipulation and storage. Target cells were manually micropipcttcd using a mouth pipette attached to a 25-ml syringe. Briefly, cells were identified from total cell retrieval by means of bright field image, nuclear staining and specific fluorescent signals. Target single-cells or CTM were then micropipcttcd in a 10-l droplet of wash buffer, followed by deposition in 0.2-ml PCR tubes containing appropriate buffer: 5 l of 2 Reaction buffer (CellsDirect One-Step qRT-PCR Kit, Life Technologies) for scrmPCR, 2 l of PBS for whole genome amplification or 2 l of SuperBlock buffer (Thermo Scientific) for low-input RNA-Seq. Cells were stored immediately at 80 C. until use. In some cases, the complete microfiltrate was spun down, and stored at 80 C. until further use.

    [0237] Single-cell RNA and mutational analysis PCR (scrmPCR). Primers were designed using Primer-BLAST (Ye et al). For each RNA transcript, primers were desgined either spanning exon-exon boundaries or primers separated by at least one intron on the corresponding genomic DNA region. Primers for mutational analysis were designed to bind intronic regions of the target gene (Tables 1A-C). The method for scrmPCR was highlighted in FIG. 1 as described in Example 1 above. This method could be used to simultaneously detect and quantify RNA transcripts and sequence DNA hotspots in the same cell. Briefly, single-cell RNA transcripts were reverse transcribed at 50 C. for 30 min using SuperScript III Reverse Transcriptase (Invitrogen) and a mix of 500 nM target reverse primers. A preamplification round (Table 1A) was then performed using Platinum Taq DNA polymerase (Invitrogen) by adding a matching mix of forward primers to the transcript-specific reverse primers and primers pairs for targeted genomic regions. Preamplification cycling was conducted by alternating annealing and denaturation steps without extension as follow: 6 cycles at 60 C., 4 min, 95 C., 1 min; 6 cycles at 55 C., 4 min, 95 C., 1 min; 6 cycles at 50 C., 4 min, 95 C., 1 min. Primers cleanup was performed using the Axyprep PCR Clean-up Kit (Axygen). Samples were diluted 1/20 and stored at 20 C. until further use. For RNA transcript quantitation, quantitative PCR was performed on a ViiA7 Instrument (Applied Biosystems) using 2 l of preamplification reaction, seminested primer pairs according to the target transcript (Table 1B) and the SensiFAST SYBR Lo-ROX Kit (Bioline) following manufacturer's protocol. Relative gene expression was normalized using ACTB as reference gene. To analyze selected DNA mutational hotspots, PCR was performed by using 2 l of preamplification reaction, nested PCR primer pairs (Table 1B) and a master mix containing a proof-reading polymerase (KOD Hot Start Master Mix, EMD Millipore) following manufacturer's instructions. For KRAS exon 2 sequencing in tumour and normal tissue (FIG. 4b), PCR amplification was performed using the following forward primer, TTTGTATTAAAAGGTACTGGTGGAG (SEQ ID NO: 135) and reverse primer, CCTTTATCTGTAT CAAAGAATGGTC (SEQ ID NO: 136). PCR products were separated on agarose gel; specific bands were excised and sequenced using the Sanger method.

    [0238] Nucleic Acid Extraction. Complete microfiltrates or isolated cells were subjected to RNA extraction using the RNAqueous-Micro Total RNA Isolation Kit (Ambion) following manufacturer's instructions. Total RNA from tissues was isolated using the RNeasy mini kit (Qiagen). DNA from tissues was isolated using DNeasy mini kit (Qiagen).

    [0239] CTM targeted resequencing and array comparative genomic hybridization (aCCH). Single-CTM were subjected to whole genome amplification using the GenomePlex Single-cell Whole Genome Amplification Kit (Sigma) and following manufacturer's instructions. Tissue DNA (50 pg) samples were amplified using the same procedure. For targeted resequencing, a custom gene panel targeting axons for NRAS, CTNNB1, PIK3CA, EGFR, BRAF, PTEN, KRAS, AKTI and TP53 genes (6.1kb) was designed. The libraries were constructed using Ion AmpliSeq Library Kits 2.0 (Life Technologies) with 10 ng of input DNA. Targeted resequencing run was performed on Ion Torrent Personal Genome Machine (PGM) Sequencer (Life Technologies). Variants were called using Ion Torrent Variant Caller Plugin in high stringency settings. aCGH was performed by hybridizing 250 ng of DNA to CyloScan 750 K arrays (Affymetrix) with manufacturer's instructions and reagents. Data were analyzed and visualized using Chas software version 2.1 (Affymetrix).

    [0240] CTM and tissues cDNA synthesis and RNA-Seq. cDNA was synthesised from single-CTM and 10 pg of tissue RNA with the SMARTer Ultra Low RNA kit (Clontech Laboratories) using long distance PCR (LDPCR) with 25 cycles and 18 cycles respectively. For each sample, cDNA was sheared using the Adaptive Focused Acoustics system (Covaris). Libraries using NEBNext DNA Library Prep Master Mix kit (New England Biolabs) were constructed. All libraries were barcoded using unique indexes and pooled for RNA sequencing run on the Illumina HiSeq 2000 platform. Data were mapped to Human Genome version 19 (hg19) using Tophat (version 2) (Trapnell et al, 2009). Cufflinks (version 2.2) (Trapnell, C. et al, 2010) was used to quantify gene expression as FPKM (Fragments Per Kilobase of transcript per Million mapped reads).

    [0241] RNA-Seq data principal component analysis. Principal component analysis on the complete RNA-Seq dataset (FIG. 16) was performed. Rank correlations coefficients were calculated by selecting the top 300 genes sorted by their maximum loading in the 1st to 3rd principal component. From this list, the Spearman rank correlation coefficient (p) was calculated for each CTM and tissues and the resulting data were plotted as a heatmap. Dendrograms were generated by average linkage clustering.

    [0242] RNA-Seq data lineage inference. Workflow for lineage inference is presented in FIG. 14a and was implemented in an R script. Briefly, the primary cell atlas dataset (GSE49910) (Mabbott et al) was obtained and expression data from 298 different experiments were selected, corresponding to N=42 different cell types or lineages. For each gene g in each lineage l, a specificity index S was calculated based on Shannon information entropy and the Q statistics introduced by Schug et al.,

    [00001] S ( l | g ) = - .Math. l = 1 N .Math. p ( l | g ) .Math. log 2 ( p ( l | g ) ) - log 2 ( p ( l | g ) )

    [0243] where p(l|g) is the relative expression of the gene g in the lineage l. Gene specificity was confirmed by visualizing expression data of genes with high specificity index using BioGPS (FIG. 14b). For each lineage the top 80 genes with highest specificity index (specific genes) were selected. 80 genes were chosen as this provided the best resolution in the analysis reported herein. Next, for each RNA-Seq sample, the number of genes specific for each lineage was calculated. At the same time, 1,000 lists of 80 randomly selected genes were generated from the Affymetrix HG-U133_Plus_2 gene list (random genes) and the average number of genes present by chance in each experimental RNA-Seq profile was determined. Finally, it was examined whether the number of enriched specific genes was equal to the number of randomly enriched genes by performing a Fisher exact test for each tested lineage in each experimental sample. The odds ratios for each test were mean-centered, scaled and visualized in a heat map comprising all tested lineages. The final results were used to generate hypotheses on cellular lineages based on the distribution of the normalized odds ratios. The algorithm was validated using published RNA-Seq datasets generated from various cell types and tissues (FIG. 15).

    [0244] Endothelial progenitor cell (EPC) assay. Colony-forming EPC assay was performed as previously described (Kalka et al, Colombo et al). Briefly, living endothelial CTM were counted in 2-ml microfiltrates by CD144 and Calcein AM fluorescent staining. Unstained microfiltrates from 2 ml of blood from a second device was then placed in culture on 96-well plate coated with fibronectin (1 g/cm.sup.2) (Sigma-Aldrich) in the presence of EGM-2 cell culture medium (Lonza). Presence of CTM was confirmed by bright field microscopy before incubation. HUVECs were used as positive control as follow: 10,000 HUVECs were spiked in 2 ml of donor blood and isolated by microfiltration using two devices. In one device, retrieved HUVECs were quantified by CD144 and Calcein AM staining. HUVECs retrieved from the other device were seeded at defined numbers (5, 10, 20, 40, 80 and 160 cells) in octuplicate wells. After 2 days, the medium was changed and cells were allowed to grow for a total of 30 days by changing half of the medium every other day. Presence and viability of colonies were monitored every week under bright field microscopy. After 30 days, cells were detached by trypsinisation, stained using CD144 antibodies, Calcein AM and Hoechst 33342, and quantified under an IX81 (Olympus) inverted fluorescence microscope.

    [0245] Microvessel density and lumen count. Microvessel density (MVD) count was performed using immunofluorescence images of CD31-stained tissue sections as described previously (Wild et al, Gupta et al) and using Image? (Schneider et al). Briefly, fresh tissues were embedded in Tissue-Tek O.C.T Compound (Sakura) and stored at 80C until further use. From all available tissues, five-micrometer cryostat sections were cut on poly-L-lysine slides, fixed in PBS containing 4% paraformaldehyde for 8 min, washed in PBS, and stained using PE-anti-CD antibodies (1:20, clone WM59, BioLegend). The whole tumour area for each tissue section was imaged with a 10 objective by means of an IX71 microscope system (Olympus) and the MctaMorph software (Molecular Devices). Before imaging and throughout MVD and lumen count, patient's IDs were blinded to avoid subjective bias during data acquisition and analysis.

    [0246] Endothelial cell isolation from fresh tissues. Endothelial cells were isolated from normal colon and tumour tissues as previously described (Van Beijnum et al) with minor modifications of the protocol. Briefly, fresh tissues were minced and digested for 60 min at 37 C. using collagenase, dispase and DNAse as described. After a Ficoll-Paque density centrifugation step, a two-step magnetic selection was performed using MACS reagents and materials (Miltenyi Biotec) following manufacturer's instructions. First, CD45-expressing cells were depleted by negative selection in LD columns, after labelling the cells with anti-CD45 magnetic beads and Human FcR Blocking Reagent. The CD45-depleted fraction was next collected and a second labelling was performed by adding anti-CD31 magnetic heads and human FcR Blocking Reagent. After a positive selection using MS columns the fraction with enriched CD31.sup.+CD45.sup. cells was stored at 80 C. until further use.

    [0247] Statistical analysis. Statistical analysis was performed in R environment (version 3.1.0) (R Core Team et al). Unpaired samples were tested using two-tailed Wilcoxon-Mann-Whitney U test with Bonferroni correction in case of multiple comparisons. For each test, exact P value with location parameter (Hodges-Lehmann estimate {circumflex over ()}) and its 95% confidence interval (CI) were computed using the coin package (Zeilcis et al). For paired samples, a two-tailed exact Wilcoxon signed-rank test was used. ROC curves with AUC and 95% CI intervals were computed using the pROC package (Robin et al). For easy interpretation and comparison of effect sizes, the effect size r for each statistical test was derived as follows: r=|Z|/{square root over (n)} where Z is the Z score of the Wilcoxon-Mann-Whitney U or the Wilcoxon signed-rank test (Rosenthal, et al). r from AUC was derived as described in Rice & Harris (Rice et al). As introduced by Cohen (Cohen et al), the following interpretations were applied: r=0.1, small effect; r=0.3, medium effect; r=0.5, large effect. Boxplots are shown as boxes representing the interquartile range (IQR) with a line across the box indicating the median, whiskers indicate 1.5IQR. To derive the minimal sample size required to the case control study, it was first assumed there was no association between presence of CTM and presence of CRC (null hypothesis) and for a target power of 0.95, a minimal sample size of n=72 was estimated using the pwr.chisq.test function of the pwr package (Champely et al). An effect size w=0.5 at the significance level of 0.01 was assumed, where w=0.5 was chosen based on a pilot test of five CRC patients (FIG. 10b), information derived from four healthy controls with negative CTM counts and a review of the literature that reported no CTM in healthy individuals but widespread presence of CTM in cases in various cancer types (Supplementary Table 1). Correlations in FIG. 18 were tested using Kendall's tau (T) coefficient and its derived P value. For lineage inference and principal component analysis of RNA-Seq data, Fisher's exact tests and Spearman correlation coefficient (p) were used respectively, as described in the dedicated method paragraphs. Level of significance was set at 0.05. One asterisk (*), P<0.05; two asterisks (**), P<0.01; three asterisks (***), P<0.001; not significant (ns), P0.05.

    [0248] Results of Analysis

    [0249] Circulating tumour microemboli (CTM) are clusters of cells commonly observed in blood sampled from cancer patients. CTM have been generally described as malignant entities for over 50 years and their investigation might yield insights on tumour progression and clinical outcomes. However, comprehensive characterization of these structures has not yet been presented. Here it is shown that contrary to current consensus, CTM isolated from colorectal cancer patients are not cancerous but represent a distinct population of tumour-derived endothelial cells. CTM do not mirror the genetic variations of matching tumours, yet CTM express epithelial and mesenchymal transcripts in agreement with previous reports on circulating tumour cell phenotyping. Transcriptomc analysis of single-CTM reveals their identity as endothelial cells with further results indicating their tumor origin and mature phenotype. Widespread presence of endothelial CTM was found in blood sampled from preoperative, early stage cancer patients but not in healthy donors, suggesting endothelial CTM count as potential indicator for colorectal cancer. Endothelial CTM should not be confused with bonafide circulating tumour cells although their analysis might be helpful diagnostically, and provide direct information on the underlying tumour vasculature during treatment and disease course.

    [0250] To analyze transcriptional and genetic profiles of circulating tumour cells (CTCs), a label-free, size-based microfiltration device that enables both retrieval and downstream micromanipulation of CTCs (FIG. 5a, b and FIG. 9a-c). was developed. CTC enrichment and retrieval efficiency was optimised by spiking 1 ml of donor blood with 30 SW620 cells, a colorectal cancer (CRC) cell line with similar median size as CTCs (FIG. 9d). An optimal tradeoff between retrieval efficiency and cell purity was obtained using a flow rate of 0.25 ml min.sup.1 and pore sizes of 9-10 m. This resulted in >90% SW620 retrieval efficiency with >510.sup.3 fold depletion of white blood cells (FIG. 5c), allowing for a variety of downstream applications beyond cell counting (FIG. 5b, FIG. 9f and FIG. 10a). Similar results were obtained using additional CRC cell lines (FIG. 9f).

    [0251] Microfiltrates derived from a pilot series of five patients were next tested and stained for epithelial cell adhesion molecule (hp-CAM), a canonical CTC marker, and CD45, a marker for white blood cells. Ep-CAM positive cells were not detected. However, it was noted that there were large aberrant clusters of Ep-CAM.sup./CD45.sup. cells present (FIG. 10b). First described in 1959, many studies have reported malignant circulating cell clusters or circulating tumour microenaboli (CTM) (Supplementary Table 1). The CTM that have been isolated displayed similar cytomorphology consistent with malignancy such as atypical nuclei, prominent nucleoli, and high nuclear-to-cytoplasmic ratio (FIG. 10a-c). In addition, lack of hp-CAM staining suggested a drift from the epithelial phenotype, an event previously reported for CTCs. It was therefore hypothesized that CTM harboured DNA alterations mirroring the primary tumour. To confirm the presence of DNA mutations in single-cells undergoing epithelial-mesenchymal transition (EMT), the polymerase chain reaction (PCR) protocol as described herein was established for the simultaneous quantitation of RNA transcripts and detection of DNA mutations at the single-cell scale (Single-cell RNA and Mutational Analysis PCR or scrmPCR) (FIG. 1, FIG. 11, Tables 1A-1C). scrmPCR in 9 CTM derived from 4 patients revealed the presence of epithelial and mesenchymal markers including SERPINE1, FOXC1 and KRT8, in line with epithelial-mesenchymal profiles reported previously for breast cancer CTCs (FIGS. 4a and 6a). These results were confirmed by panCK and Vimentin immunostaining (FIG. 11a and Cima et al). These CTM were next sequenced for mutations present in the corresponding primary tumours. Surprisingly, all tested DNA sequences hotspots matched the wild-type alleles (FIG. 4b). Targeted high-throughput DNA sequencing was further applied to 8 commonly mutated genes in DNA amplified from 16 single-CTM (6 patients) and matching tumour tissues. Again, matching mutations between tumour tissues and associated CTM (Supplementary Tables 2 and 3) could not be detected. Using amplified DNA from 12 CTM (4 patients), array comparative genomic hybridization (aCOH) was next performed. In fact, CTCs from lung cancer patients have been shown to reproducibly mirror cancer tissue copy number variations (Ni. X, et al). Here, the CTM had instead normal cytogenetic profiles in contrast to matched primary tumours (FIG. 6b-c and FIG. 11b-c). In summary, single-cell scale analysis of 26 CTM from 10 patients, while displaying epithelial-mesenchymal marker expression, did not mirror DNA anomalies found in matching tumour tissues. This suggested a source for CTM that was unrelated to the tumour epithelium.

    [0252] Next, 18 single-CTM from 8 patients and matching normal colon and tumour tissues were subjected to RNA expression profiling by high-throughput sequencing (RNA-Seq) (FIG. 12, FIG. 16, Supplementary Table 4). A workflow for the inference of cellular lineages from transcriptional profiles was further developed (FIG. 14, FIG. 15). In a comparison including 42 different cell types, all CTM transcriptomes were associated with the cell types of the endothelial lineage (FIG. 7a). The presence of a series of endothelial lineage markers together with general EMT markers by scrmPCR was confirmed in an additional 14 CTM (FIG. 4c). Endothelial cells are considered a specialized epithelium, and are known to express both Vimentin (often used as a mesenchymal marker) and various keratins (classic markers of epithelium). All CTM, including those with malignant cytomorphology, stained without exception for endothelial markers such as CD31, VWF or CD144 (FIG. b) but were negative for CD45 or markers of megakaryocytic lineages CD41 and CD42B. This indicated that in the CRC patients, all CTM detected were of endothelial origin. In addition, single tumour cells within CTM were not detected as reported previously elsewhere. The present findings were in line with El-Heliebi et al., who reported CD31 expression on circulating non-hematologic cells (CNHC) from kidney cancer patients, but were dissimilar from a recent report that described CTC clusters of malignant origins (Aceto et al). Lineage inference from the RNA-Seq data of CTC-clusters described in Aceto et al. in fact indicated the presence of epithelial derived cells (FIG. 15). CTM characterized in the present study represented thus a distinct population of circulating endothelial cell clusters in CRC patients.

    [0253] An endothelial progenitor clonogenic assay (Kalka et al and Colombo et al) revealed a mature phenotype for CTM as living CTM failed to proliferate on fibronectin substrate over a 30-day period (FIG. 7c). Principal component analysis of CTM-derived RNA-Seq data showed stronger associations with the tumour tissue transcriptome as compared to the normal colon tissue transcriptome (FIG. 7d). To test if CTM were tumour-derived, paired samples from 17 CRC patients 0-24 h before and 24-72 h were collected after surgical tumour resection (n =34). Tumour removal caused a sharp decline of endothelial CTM, supporting the direct link between the tumour and CTM (FIG. 7e and Supplementary Table 5). Folate hydrolase (FOLH1), the gene encoding for prostate-specific membrane antigen (PSMA), is specifically expressed in tumour vasculature of various cancer types, but absent in normal vasculature and peripheral blood. FOLH1 was indeed expressed in CD31.sup.+CD45.sup. cells isolated from fresh CRC tissues and in CTM isolated from the blood of 7/10 CRC patients, but not in endothelial cells isolated from normal tissues or in healthy donor peripheral blood mononuclear cells (PBMCs). This result further supported the tumour origin of endothelial CTM (FIG. 7f). Additionally, RNA-Seq data of CTM revealed the expression of several tumour endothelial markers, including CD276 (FIG. 7g and FIG. 17). It was further asked whether CTM numbers might correlate with features of the underlying tumour vasculature, by counting blood vessels in tumour tissues derived from patients with low or high CTM count. Although the median number of vessel units did not differ, the median number of lumens was significantly higher in patients with high CTM counts (FIG. 7h). Taken together, it was shown that CTM in colorectal cancer patients were not malignant entities but clusters of tumour-derived mature endothelial cells.

    [0254] Because of the above-described associations between CTM and the primary tumour, it was next asked if endothelial CTM were informative indicators of CRC. Endothelial CTM from a total of 141 clinical specimens from 125 subjects (45 control healthy volunteers and a consecutive series of 80 CRC patients, including CTM counts from above-mentioned patients) were counted. At least one endothelial CTM in 76.2% (61/80) of CRC patients but only in 2.2% (1/45) of healthy individuals was observed (FIG. 8a). It was found that treatment-naive patients presented with significantly higher endothelial CTM counts as compared to patients that underwent therapeutic interventions for CRC (n=80) (FIG. 8h). However, endothelial CTM count did not associate with clinical parameters such as tumour stage, grade or presence of distant metastasis (FIG. 8b, Supplementary Tables 6 and 7) or with other variables, including inflammatory markers (FIG. 18). In particular, endothelial CTM numbers in time series analysis indicated that surgical resection events has the strongest effect on CTM distribution, confirming the results in FIG. 7c and further supporting the association of endothelial CTM with the presence of a primary tumour (FIG. 8c). The presence of endothelial CTM in 86.5% of treatment-naive patients (45/52), but only of 2.2% of healthy controls (1/45) indicated that CTM count might be useful in assisting CRC diagnosis. Area under the curve (AUC) of the receiving operator characteristic (ROC) curve comparing treatment-naive patients and healthy controls was 0.930 (FIG. 8d). Remarkably, CRC patients with low pathologic tumour stage (stageIIA) were also positive for endothelial CTM in 86.4% (19/22) of cases, with AUC=0.922 (FIG. 8e). Taken together, these results further confirmed the association between endothelial CTM counts and presence of a primary tumour. Moreover, widespread presence of endothelial CTM in treatment-naive patients but not in healthy individuals indicated the potential use of endothelial CTM count as a diagnostic adjunct for CRC.

    [0255] In conclusion, the isolation, retrieval and analysis of single circulating tumour microemboli (CTM) from colorectal cancer patients is reported here. It is presented for the first time transcriptome profiling of single-CTM and, in contrast to current consensus, several lines of evidence for the tumour endothelial origin of CTM are provided. Endothelial CTM were detected as structures of multiple cells. As such, CTM might he shed from the chaotic tumour vasculature undergoing pathological angiogenesis, a recognized early event in CRC tumour progression. Preclinical models might reveal the mechanisms underlying tumor endothelial cell shedding in circulation, and are currently under investigation. In contrast to CTCs, which are often detected in patients with advanced diseases, CTM were tumor-derived entities prevalent in early stage and preoperative CRC patients. Endothelial CTM counts represent therefore an intriguing modus for early CRC detection. In this study, the presence of CTC clusters was not detected as reported in Aceto et al. This might be the result of differences in patient profiles. In fact, Aceto et al. analyzed blood samples from terminal breast cancer patients, whereas blood samples in this study were mostly derived from preoperative CRC patients. Further studies would need to address specificities of circulating endothelial cell clusters in various diseases. Interestingly, tissue-specific molecular signatures have been demonstrated in endothelial cells from various organs, indicating that CTM might be traced back to their organ of origin based on the expression of specific gene sets. Because of their cellular morphology reminiscent of malignancy, keratins expression and the mixed epithelial and mesenchymal marker profiles, endothelial CTM should not be confused with bona fide malignant CTCs undergoing EMT. At the same time, endothelial CTM analysis might contribute to early colorectal cancer detection and provide direct information on the underlying tumour vasculature during treatment and disease course.

    TABLE-US-00005 SUPPLEMENTARY TABLE 1 Selected publications including circulating tumor cell clusters or CTM described as cancerous entities (1959-2014) Article reporting CTM or CTC clusters # Year as cancerous entity Experimental evidence used to define malignancy 1 1959 Engell, H..sup.54 Cytomorphology 2 1960 Finkel, G. C., & Teshkoff, G. H..sup.1 Cytomorphology 3 1964 Seal, S. H..sup.5 Cytomorphology 4 1964 Sellwood, R. A. et al..sup.55 Cytomorphology 5 1965 Cole, W. H. et al..sup.56 Cytomorphology 6 1971 Song, J., et al..sup.57 Cytomorphology 7 1973 Griffiths, J. D. et al..sup.58 Cytomorphology 8 1975 Salsbury, A. J..sup.2 Cytomorphology 9 1979 Ejeckam, G. C. et al..sup.59 Cytomorphology/Myeloperoxidase staining 10 1988 Glaves. D. et al..sup.60 Cytomorphology/CK staining 11 1992 Aboulafia, D. M..sup.61 Cytomorphology/CK staining 12 2000 Vona, G. et al..sup.3 Cytomorphology/AFP staining 13 2001 Molnar, B. et al..sup.62 Keratin magnetic labeling 14 2004 Vona, G. et al..sup.63 Cytomorphology/AFP staining 15 2004 Allard, W. J. et al..sup.64 Cytomorphology/CD45-keratin staining 16 2007 Patertini-Brechot, P. & Benall, N. L..sup.6 Cytomorphology 17 2010 Stott, S. L. et al..sup.65 PSMA/CD45, CK7,8/CD45 stainings 18 2010 Hou, J. M. et al..sup.66 Cytomorphology/CD45-NSE stainings 19 2011 Hou, J. M. et al..sup.67 CD45/various epithelial and mesenchymal markers immunostainings 20 2011 Khoja, L. et al..sup.68 Cytomorphology/CD45-CK stainings 21 2011 Desitter, I. et al..sup.69 Cytomorphology/CD45-CK stainings 22 2011 Hofman, V. J. et al..sup.70 Cytomorphology 23 2011 Hofman, V. et al..sup.71 Cytomorphology 24 2012 Hou, J. M. et al..sup.72 EPCAM/CD45/CK/Ki67/Mcl-1 stainings 25 2012 Kling, J. CD45-CK stainings 26 2012 Cho, E. H. et al..sup.73 CD45-CK stainings 27 2012 Krebs, M. G. et al..sup.74 Cytomorphology/CD45 28 2012 Marnnucci, D. et al..sup.75 CD45-CK stainings 29 2013 Yu, M. et al..sup.4 Epithelial and mesenchymal transcript and protein markers, high-throughput RNA sequencing 30 2014 Aceto, N et al..sup.20 Various stainings including PSMA. EPCAM, CK Single cell high-throughout sequencing

    TABLE-US-00006 SupplementaryTable2:Targetedhigh-throughputsequencingofsingleCTM donotmirrormatchingprimarytumormutations Patient13 Gene Position Type Zygosity Genotype ExonicFunc.refGene P13-Turner KRAS KRAS:chr12:25398284 SNP Het C/T nonsynonymousSNV N/A PIK3CA PIK3CA:chr3:178936095 SNP Het A/G nonsynonymousSNV N/A TP53 TP53:chr17:7574003 SNP Het G/A stopgainSNV N/A TP53 TP53:chr17:7577120 SNP Het C/T nonsynonymousSNV N/A TP53 TP53:chr17:7578202 DEL Het ACACTATGTCG/A N/A TP53 TP53:chr17:7578407 SNP Het G/C nonsynonymousSNV 32.33082707 TP53 TP53:chr17:7578463 INS Het C/CG frameshiftinsertion N/A TP53 TP53:chr17:7578645 SNP Het C/T N/A Treshold:10% Patient10 Gene P13-CTM2 P13-CTM3 P13-CTM4 P13-CTM5 P10-Tumor P10-CTM1 P10-CTM4 P10-CTM5 KRAS NA NA NA NA NA NA NA NA PIK3CA NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA 49.17458729 NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA 98.61111111 NA NA NA Threshold:10% Patient14 Patient15 Gene P10-CTM10 P10-CTM12 P14-Tumor P14-CTM1 P14-CMT2 P15-Tumor P15-CTM5 KRAS NA NA 68.43291995 NA NA NA NA PIK3CA NA NA NA NA NA 59.6774193b NA TP53 NA NA NA NA NA 76.29072682 NA TP53 NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA TP53 NA NA 47.32098147 NA NA NA NA TP53 NA NA NA NA NA NA NA Threshold:10% Patient7 Patient8 Gene P7-Tumor P7-CMT6 P7-CTM8 P7-CTM9 P8-Tumor P8-CMT12 KRAS NA NA NA NA NA NA PIK3CA NA NA NA NA NA NA TP53 NA NA NA NA NA NA TP53 NA NA NA NA NA NA TP53 NA NA NA NA 81.56565657 NA TP53 NA NA NA NA NA NA TP53 NA NA NA NA NA NA TP53 NA NA NA NA NA NA Threshold:10%

    TABLE-US-00007 SUPPLEMENTARY TABLE 3 Sparse CTM mutations are not detected in matching primary tumor tissues Patient 13 Gene Position Type Zygosity Genotype ExonicFunc.refGene P13-Tumor P13-CTM2 AKT1 AKT1:chr14:105258943 SNP Het T/C nonsynonymous SNV NA NA AKT1 AKT1:chr14:105258954 SNP Het C/T synonymous SNV NA NA AKT1 AKT1:chr14:105258963 SNP Het A/G synonymous SNV NA NA AKT1 AKT1:chr14:105259001 SNP Het C/T NA NA NA AKT1 AKT1:chr14:105259015 SNP Het T/C NA NA NA BRAF BRAF:chr7:140453027 SNP Het T/C NA NA NA BRAF BRAF:chr7:140453110 SNP Het G/A stopgain SNV NA NA BRAF BRAF:chr7:140453135 SNP Hom A/A synonymous SNV NA NA BRAF BRAF:chr7:140453160 DEL Het AT/A NA NA BRAF BRAF:chr7:140453221 SNP Het G/T NA NA NA CTNNB1 CTNNB1:chr3:41265533 SNP Het A/C NA NA NA EGFR EGFR:chr7:55240848 SNP Hom G/G NA NA NA EGFR EGFR:chr7:55241616 DEL Hom T/T NA NA EGFR EGFR:chr7:55241661 SNP Het C/T synonymous SNV NA NA EGFR EGFR:chr7:55241727 SNP Het G/A synonymous SNV NA NA EGFR EGFR:chr7:55241730 SNP Hom T/T synonymous SNV NA NA EGFR EGFR:chr7:55249014 SNP Het A/G nonsynonymous SNV NA NA EGFR EGFR:chr7:55249133 SNP Het T/C nonsynonymous SNV NA NA EGFR EGFR:chr7:55260481 SNP Het T/C nonsynonymous SNV NA NA EGFR EGFR:chr7:55260492 SNP Het T/C synonymous SNV NA NA KRAS KRAS:chr12:25378745 SNP Het A/G NA NA 12 KRAS KRAS:chr12:25380190 SNP Het A/G nonsynonymous SNV NA NA KRAS KRAS:chr12:25380261 SNP Het G/C nonsynonymous SNV NA NA KRAS KRAS:chr12:25380262 SNP Het C/T nonsynonymous SNV NA NA KRAS KRAS:chr12:25380285 SNP Het GT nonsynonymous SNV NA NA KRAS KRAS:chr12:25380307 SNP Het A/C nonsynonymous SNV NA NA KRAS KRAS:chr12:25380309 DEL Het GT/G NA NA KRAS KRAS:chr12:25398236 SNP Het A/G nonsynonymous SNV NA NA NRAS NRAS:chr1:115256498 SNP Hom T/T stopgain SNV NA NA NRAS NRAS:chr1:115258685 SNP Het C/T nonsynonymous SNV NA NA PIK3CA PIK3CA:chr3:178916625 SNP Het A/G synonymous SNV NA NA PIK3CA PIK3CA:chr3:178916635 SNP Het G/A nonsynonymous SNV NA NA PIK3CA PIK3CA:chr3:178916638 DEL Het TGGGGCATCCACTT/G NA NA PTEN PTEN:chr10:89685300 DEL Hom C/C NA NA PTEN PTEN:chr10:89690872 SNP Het T/C NA NA NA PTEN PTEN:chr10:89690906 SNP Het T/C NA NA NA PTEN PTEN:chr10:89692825 DEL Het CT/C NA NA PTEN PTEN:chr10:89692891 SNP Het A/G synonymous SNV NA NA PTEN PTEN:chr10:89692916 SNP Het A/T nonsynonymous SNV NA NA PTEN PTEN:chr10:89711843 SNP Het A/G NA NA NA PTEN PTEN:chr10:89711866 SNP Het G/A NA NA NA PTEN PTEN:chr10:89711910 SNP Het T/C synonymous SNV NA NA PTEN PTEN:chr10:89711998 SNP Het T/C nonsynonymous SNV NA NA PTEN PTEN:chr10:89720698 SNP Het A/G synonymous SNV NA NA PTEN PTFN:chr10:89720707 SNP Het C/T synonymous SNV NA NA PTEN PTEN:chr10:89720709 SNP Het C/T nonsynonymous SNV NA NA TP53 TP53:chr17:7572967 SNP Het T/C nonsynonymous SNV NA NA TP53 TP53:chr17:7573857 SNP Het A/G NA NA NA TP53 TP53:chr17:7576637 SNP Het T/A nonsynonymous SNV NA NA TP53 TP53:chr17:7577102 SNP Het C/T nonsynonymous SNV NA NA TP53 TP53:chr17:7577127 DEL Het CAA/C NA NA TP53 TP53:chr17:7577396 SNP Het T/C NA NA NA TP53 TP53:chr17:7577444 SNP Het A/G NA NA NA TP53 TP53:chr17:7577450 SNP Het A/G NA NA NA TP53 TP53:chr17:7577559 SNP Hom A/A nonsynonymous SNV NA NA TP53 TP53:chr17:7578155 SNP Het A/G NA NA NA TP53 TP53:chr17:7578237 SNP Hom T/T synonymous SNV NA NA TP53 TP53:chr17:7578297 SNP Het C/T NA NA NA TP53 TP53:chr17:7578369 DEL Hom A/A NA NA TP53 TP53:chr17:7578385 SNP Hom T/T nonsynonymous SNV NA NA TP53 TP53:chr17:7578389 DEL Hom G/G NA NA TP53 TP53:chr17:7578399 SNP Het G/A synonymous SNV NA NA TP53 TP53:chr17:7578400 SNP Het G/A nonsynonymous SNV NA NA TP53 TP53:chr17:7578502 SNP Het A/G nonsynonymous SNV NA NA TP53 TP53:chr17:7578645 SNP Hom T/T NA NA TP53 TP53:chr17:7579393 SNP Het A/G synonymous SNV NA NA TP53 TP53:chr17:7579432 SNP Het A/G NA 14.814815 TP53 TP53:chr17:7579432 DEL Het AG/AGG NA NA Treshold: 10% Patient 10 Gene P13-CTM3 P13-CTM4 P13-CTM5 P10-Tumor P10-CTM1 P10-CTM4 P10-CTM5 P10-CTM10 AKT1 NA NA NA NA 26.869159 NA NA NA AKT1 NA NA NA NA NA NA 12.262357 NA AKT1 NA NA NA NA 15.242494 NA NA NA AKT1 NA NA NA NA NA NA 11.568123 NA AKT1 NA NA NA NA NA 39.308963 NA NA BRAF NA NA NA NA NA NA NA NA BRAF NA NA NA NA NA NA NA NA BRAF NA NA NA NA NA NA NA NA BRAF NA NA NA NA NA NA NA NA BRAF NA NA NA NA NA NA NA NA CTNNB1 NA NA NA NA NA NA NA NA EGFR NA NA 100 NA NA NA NA NA EGFR NA NA 100 NA NA NA NA NA EGFR NA NA NA NA NA NA NA NA EGFR NA NA NA NA NA NA NA NA EGFR NA NA 100 NA NA NA NA NA EGFR NA NA NA NA NA NA NA NA EGFR NA NA NA NA NA NA NA NA EGFR NA NA NA NA NA NA NA 13.173653 EGFR NA 25.728643 NA NA NA NA NA NA KRAS NA NA NA NA NA NA NA NA KRAS NA NA NA NA NA NA NA NA KRAS NA NA NA NA NA NA NA NA KRAS NA NA NA NA NA NA NA NA KRAS NA NA NA NA NA NA NA NA KRAS NA NA NA NA NA NA NA NA KRAS NA NA 58.930373 NA NA NA NA NA KRAS NA NA NA NA NA NA NA NA NRAS NA NA NA NA NA NA NA NA NRAS NA NA 20.731097 NA NA NA NA NA PIK3CA NA NA NA NA NA NA NA NA PIK3CA NA NA NA NA NA NA NA NA PIK3CA NA NA NA NA NA NA NA NA PTEN NA NA NA NA NA NA NA 100 PTEN NA NA 10.619469 NA NA NA NA NA PTEN NA NA NA NA NA NA NA NA PTEN NA NA NA NA NA NA NA NA PTEN NA NA NA NA NA NA NA NA PTEN NA NA NA NA NA NA NA NA PTEN NA NA NA NA NA NA NA NA PTEN NA NA NA NA NA NA NA 13.293944 PTEN NA NA NA NA NA NA NA 13.543307 PTEN NA NA NA NA NA NA NA NA PTEN NA NA NA NA NA NA NA NA PTEN NA NA 14.035088 NA NA NA NA NA PTEN NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA 34.554974 TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA 38.157895 TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA 59.375 Threshold. 10% Patient 14 Patient 15 Patient 7 Gene P10-CTM12 P14-Tumor P14-CTM1 P14-CTM2 P15-Tumor P15-CTM5 P7-Tumor P7-CTM6 AKT1 NA NA NA NA NA NA NA NA AKT1 NA NA NA NA NA NA NA NA AKT1 NA NA NA NA NA NA NA NA AKT1 NA NA NA NA NA NA NA NA AKT1 NA NA NA NA NA NA NA NA BRAF NA NA 37.5 NA NA NA NA NA BRAF NA NA NA 64.839468 NA NA NA NA BRAF NA NA NA 100 NA NA NA NA BRAF NA NA 30.30303 NA NA NA NA NA BRAF NA NA 56.149733 NA NA NA NA NA CTNNB1 NA NA 23.333333 NA NA NA NA NA EGFR NA NA NA NA NA NA NA NA EGFR NA NA NA NA NA NA NA NA EGFR NA NA NA NA NA NA NA NA EGFR NA NA 50 NA NA NA NA NA EGFR NA NA NA NA NA NA NA NA EGFR 17.751479 NA NA NA NA NA NA NA EGFR NA NA NA NA NA NA NA NA EGFR NA NA NA NA NA NA NA NA EGFR NA NA NA NA NA NA NA NA KRAS NA NA NA NA NA NA NA NA KRAS NA NA NA NA NA NA NA NA KRAS NA NA NA NA NA NA NA NA KRAS NA NA NA NA NA NA NA NA KRAS NA NA 33.766234 NA NA NA NA NA KRAS NA NA 11.538462 NA NA NA NA NA KRAS NA NA NA NA NA NA NA NA KRAS NA NA NA 42.857143 NA NA NA NA NRAS NA NA NA NA NA NA NA NA NRAS NA NA NA NA NA NA NA NA PIK3CA NA NA 22.413793 NA NA NA NA NA PIK3CA NA NA NA NA NA NA NA NA PIK3CA NA NA NA NA NA NA NA NA PTEN NA NA NA NA NA NA NA NA PTEN NA NA NA NA NA NA NA NA PTEN NA NA NA NA NA 18.233296 NA NA PTEN NA NA NA NA NA NA NA NA PTEN NA NA 10.344828 NA NA NA NA NA PTEN NA NA NA NA NA NA NA NA PTEN NA NA NA NA NA NA NA NA PTEN NA NA NA NA NA NA NA NA PTEN NA NA NA NA NA NA NA NA PTEN NA NA 72.727273 NA NA NA NA NA PTEN NA NA NA NA NA NA NA NA PTEN NA NA NA NA NA NA NA NA PTEN NA NA 47.727273 NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA 13.571429 NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA 19.088319 NA NA NA NA NA TP53 10.515774 NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA 100 NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA 100 TP53 NA NA NA NA NA NA NA 100 TP53 NA NA NA NA NA NA NA 100 TP53 NA NA NA NA NA NA NA 97.345133 TP53 NA NA 11.188811 NA NA NA NA NA TP53 NA NA 17.241379 NA NA NA NA NA TP53 NA NA NA NA NA NA NA 100 TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA TP53 NA NA NA NA NA NA NA NA Threshold. 10% Patient 8 Gene P7-CTMB P7-CTM9 P8-Tumor P8-CTM12 AKT1 NA NA NA NA AKT1 NA NA NA NA AKT1 NA NA NA NA AKT1 NA NA NA NA AKT1 NA NA NA NA BRAF NA NA NA NA BRAF NA NA NA NA BRAF NA NA NA NA BRAF NA NA NA NA BRAF NA NA NA NA CTNNB1 NA NA NA NA EGFR NA NA NA NA EGFR NA NA NA NA EGFR 35 NA NA NA EGFR NA NA NA NA EGFR NA NA NA NA EGFR NA NA NA NA EGFR 23.880597 NA NA NA EGFR NA NA NA NA EGFR NA NA NA NA KRAS NA NA NA NA KRAS NA NA NA 19.626168 KRAS NA NA NA NA KRAS NA NA NA 16.8 KRAS NA NA NA NA KRAS NA NA NA NA KRAS NA NA NA NA KRAS NA NA NA NA NRAS NA 98.372966 NA NA NRAS NA NA NA NA PIK3CA NA NA NA NA PIK3CA NA NA NA 91.941392 PIK3CA NA NA NA 88.489209 PTEN NA NA NA NA PTEN NA NA NA NA PTEN NA NA NA NA PTEN 40 NA NA NA PTEN NA NA NA NA PTEN 18.518519 NA NA NA PTEN 19.485294 NA NA NA PTEN NA NA NA NA PTEN NA NA NA NA PTEN NA NA NA NA PTEN 11.666667 NA NA NA PTEN NA NA NA NA PTEN NA NA NA NA TP53 NA NA NA NA TP53 NA NA NA NA TP53 NA NA NA NA TP53 10.714286 NA NA NA TP53 NA NA NA NA TP53 NA NA NA NA TP53 NA 13.157895 NA NA TP53 NA 18.421053 NA NA TP53 NA NA NA NA TP53 NA NA NA 14.220183 TP53 NA NA NA 98.536585 TP53 NA NA NA 93 TP53 NA NA NA NA TP53 NA NA NA NA TP53 NA NA NA NA TP53 NA NA NA NA TP53 NA NA NA NA TP53 NA NA NA NA TP53 NA NA NA 100 TP53 NA NA NA NA TP53 NA NA NA NA TP53 NA NA NA NA Threshold 10%

    TABLE-US-00008 SUPPLEMENTARY TABLE 4 RNA-seq data, uniquely mapped reads to hg19 exons ID #Unique reads mapped to hg19 exons P10-T 9,824,250 P19-Met 9,200,220 P1-N 12,046,807 P1-TUc 11,627,650 P1-TUd 10,474,561 P1-TUs 12,120,551 P18-N 11,691,022 P18-T 10,077,598 P10-N 11,940,709 P21-N 12,115,725 P21-T 10,030,315 P20-N 9,710,218 P20-T 7,196,431 P8-N 9,574,544 P8-T 9,413,088 P19-N 9,868,631 P19-T 9,156,651 P8-CTM10 7,055,733 P8-CTM11 6,873,889 P16-CTM2 772,636 P21-CTM11 6,526,429 P19-CTM2 741,682 P1-CTM1 3,368,445 P1-CTM3 4,825,103 P1-CTM4 5,493,502 P10-CTM10 2,916,536 P18-CTM4 357,115 P18-CTM6 3,113,219 P20-CTM16 1,001,059 P20-CTM14 896,617 P1-CTM8 620,380 P18-CTM5 1,363,670 P8-CTM7 3,763,227 P20-CTM15 1,424,262 P18-CTM2 1,007,933 Legend: P, patient T, tumor tissue c, center d, deep s. superficial N, normal tissue Met, metastasis CTM, circulating tumor microembolus

    TABLE-US-00009 SUPPLEMENTARY TABLE 5 Pre- and post surgery CTM count. Data from FIG. 4e CTM count Patient Pre Post P05 9 6 P19 2 0 P22 124 0 P54 0 3 P64 4 0 P66 46 0 P67 1 0 P69 0 0 P71 79 2 P72 24 0 P73 48 0 P74 13 2 P75 3 0 P77 1 0 P78 1 0 P80 0 0 P82 36 0 Pre: CTM count in blood 0-24 hrs before surgery Post: CTM count in blood 24-72 hrs after surgery

    TABLE-US-00010 SUPPLEMENTARY TABLE 6 Baseline patients and healthy donors characteristics Characteristic Patients Controls Total, n 80 45 Age, yr, median (range) 60 (26-80) 45 (26-81) Gender, n (%) Male 48 (60) 19 (43) Female 32 (40) 25 (57) Ethnicity, n (%) Chinese 56 (70) Other 24 (30) Tumor Location n (%) Recto-sigmoid 67 (77) Other 18 (23) Stage, n (%) IIA 26 (35) IIB-IIIC 26 (35) IV 22 (30) Grade, n (%) 1-2 58 (89) 3-4 7 (11) Metastatic CRC, n (%) M0 (no distant metastasis) 54 (72) M1 (distant metastasis) 21 (28) Treatment, n (%) Untreated 52 (65) Neoadjuvant 11 (14) Surgery* 5 (6) Adjuvant 4 (5) Palliative 8 (10) *post op. data from FIG. 3e not included

    TABLE-US-00011 SUPPLEMENTARY TABLE 7 CTM count for each baseline sample type and number of single CTM analyzed in this study Patient ID Abbreviation Source Baseline sample type CTM count* Donor 1 D01 NUH Healthy 0 Donor 2 D02 NUH Healthy 0 Donor 3 D03 NUH Healthy 0 Donor 4 D04 NUH Healthy 0 Donor 5 D05 NUH Healthy 0 Donor 6 D06 NUH Healthy 0 Donor 7 D07 NUH Healthy 0 Donor 8 D08 NUH Healthy 0 Donor 9 D09 NUH Healthy 0 Donor 10 D10 NUH Healthy 0 Donor 11 D11 NUH Healthy 0 Donor 12 D12 NUH Healthy 0 Donor 13 D13 IBN Healthy 0 Donor 14 D14 NUH Healthy 0 Donor 15 D15 NUH Healthy 0 Donor 16 D16 NUH Healthy 0 Donor 17 D17 NUH Healthy 0 Donor 15 D18 NUH Healthy 0 Donor 19 D19 NUH Healthy 0 Donor 20 D20 NUH Healthy 0 Donor 21 D21 NUH Healthy 0 Donor 22 D22 NUH Healthy 0 Donor 23 D23 NUH Healthy 0 Donor 24 D24 NUH Healthy 0 Donor 25 D25 NUH Healthy 0 Donor 26 D26 NUH Healthy 0 Donor 27 D27 NUH Healthy 0 Donor 28 D28 NUH Healthy 0 Donor 29 D29 IBN Healthy 0 Donor 30 D30 IBN Healthy 0 Donor 31 D31 IBN Healthy 0 Donor 32 D32 IBN Healthy 0 Donor 33 D33 NUH Healthy 0 Donor 34 D34 NUH Healthy 0 Donor 35 D35 NUH Healthy 0 Donor 36 D36 NUH Healthy 0 Donor 37 D37 NUH Healthy 0 Donor 38 D38 NUH Healthy 0 Donor 39 D39 NUH Healthy 0 Donor 40 D40 NUH Healthy 0 Donor 41 D41 NUH Healthy 0 Donor 42 D42 NUH Healthy 0 Donor 43 D43 NUH Healthy 0 Donor 44 D44 NUH Healthy 0 Donor 45 D45 NUH Healthy 0 Patient 01 P01 NCC CRC - Treatment Naive 49 Patient 02 P02 NCC CRC - Treatment Naive 3 Patient 03 P03 FSH CRC - Treatment Naive 7 Patient 04 P04 NCC CRC - Palliative 17 Patient 05 P05 NCC CRC - Treatment Naive 9 Patient 06 P06 FSH CRC - Post Neoadjuvant 0 Patient 07 P07 FSH CRC - Treatment Naive - Early stage 26 Patient 08 P08 FSH CRC - Treatment Naive - Early stage 76 Patient 09 P09 FSH CRC - Treatment Naive - Early stage 52 Patient 10 P10 FSH CRC - Treatment Naive 26 Patient 11 P11 NCC CRC - Palliative 1 Patient 12 P12 NCC CRC - Palliative 0 Patient 13 P13 FSH CRC - Treatment Naive - Early stage 32 Patient 14 P14 FSH CRC - Treatment Naive - Early stage 3 Patient 15 P15 FSH CRC - Treatment Naive - Early stage 13 Patient 16 P16 FSH CRC - Treatment Naive 2 Patient 17 P17 FSH CRC - Treatment Naive 0 Patient 18 P18 FSH CRC - Treatment Naive - Early stage 9 Patient 19 P19 NCC CRC - Treatment Naive 2 Patient 20 P20 FSH CRC - Treatment Naive 80 Patient 21 P21 FSH CRC - Treatment Naive 16 Patient 22 P22 FSH CRC - Post Neoadjuvant 124 Patient 23 P23 FSH CRC - Treatment Naive - Early stage 12 Patient 24 P24 FSH CRC - Treatment Naive - Early stage 23 Patient 25 P25 FSH CRC - Treatment Naive 45 Patient 26 P26 FSH CRC - Treatment Naive 5 Patient 27 P27 FSH CRC - Treatment Naive - Early stage 34 Patient 28 P28 FSH NA Patient 29 P29 FSH CRC - Post Neoadjuvant 15 Patient 30 P30 FSH CRC - Treatment Naive 3 Patient 31 P31 FSH CRC - Treatment Naive 0 Patient 32 P32 FSH CRC - Treatment Naive - Early stage 18 Patient 33 P33 FSH CRC - Post Neoadjuvant 3 Patient 34 P34 FSH CRC - Treatment Naive - Early stage 2 Patient 35 P35 FSH CRC - Post Neoadjuvant 2 Patient 36 P36 FSH CRC - Post Neoadjuvant 0 Patient 37 P37 FSH CRC - Post Neoadjuvant 1 Patient 38 P38 FSH NA Patient 39 P39 FSH CRC - Treatment Naive 0 Patient 40 P40 FSH CRC - Treatment Naive - Early stage 1 Patient 41 P41 FSH CRC - Treatment Naive 2 Patient 42 P42 FSH CRC - Treatment Naive - Early stage 3 Patient 43 P43 FSH CRC - Treatment Naive 93 Patient 44 P44 FSH CRC - Treatment Naive 48 Patient 45 P45 FSH CRC - Treatment Naive 9 Patient 46 P46 FSH CRC - Treatment Naive 249 Patient 47 P47 FSH CRC - Treatment Naive - Early stage 0 Patient 48 P48 FSH CRC - Treatment Naive 6 Patient 49 P49 FSH CRC - Treatment Naive 25 Patient 50 P50 FSH CRC - Treatment Naive - Early stage 0 Patient 51 P51 NCC CRC - Palliative 24 Patient 52 P52 NCC CRC - Palliative 0 Patient 53 P53 NCC CRC - Post Surgery 0 Patient 54 P54 NCC CRC - Post Neoadjuvant 0 Patient 55 P55 NCC CRC - Post Surgery 0 Patient 56 P56 NCC CRC - Post Surgery 0 Patient 57 P57 NCC CRC - Post Adjuvant 0 Patient 56 P56 NCC CRC - Post Adjuvant 6 Patient 59 P59 NCC CRC - Palliative 1 Patient 60 P60 NCC CRC - Palliative 0 Patient 61 P61 NCC CRC - Post Surgery 0 Patient 62 P62 NCC CRC - Palliative 3 Patient 63 P63 NCC CRC - Post Neoadjuvant 40 Patient 64 P64 NCC CRC - Post Neoadjuvant 4 Patient 65 P65 NCC CRC - Post Surgery 0 Patient 66 P66 NCC CRC - Treatment Naive 46 Patient 67 P67 NCC CRC - Treatment Naive 1 Patient 68 P68 NCC CRC - Post Adjuvant 0 Patient 69 P69 NCC CRC - Treatment Naive - Early stage 0 Patient 70 P70 NCC CRC - Treatment Naive 7 Patient 71 P71 NCC CRC - Treatment Naive 79 Patient 72 P72 NCC CRC - Treatment Naive - Early stage 24 Patient 73 P73 NCC CRC - Treatment Naive 48 Patient 74 P74 NCC CRC - Treatment Naive - Early stage 13 Patient 75 P75 NCC CRC - Treatment Naive - Early stage 3 Patient 76 P76 NCC CRC - Treatment Naive 12 Patient 77 P77 NCC CRC - Treatment Naive - Early stage 1 Patient 78 P78 NCC CRC - Treatment Naive 1 Patient 79 P79 NCC CRC - Treatment Naive, Early stage 14 Patient 80 P80 NCC CRC - Treatment Naive 0 Patient 81 P81 NCC CRC - Treatment Naive 14 Patient 82 P82 NCC CRC - Post Neoadjuvant 36 Legend: NUH, National University Hospital Singapore IBN, Institute of Bioengineering and Nanotechnology, Singapore FSH, Fortis Surgical Hospital, Singapore NCC, National Cancer Center, Singapore CRC, Colorectal cancer Early stage, stage IIA *post-OP samples from FIG. 3f not included

    REFERENCE

    [0256] Aboulafia, D. M. Carcinocythemia. A terminal manifestation of metastatic breast cancer. West. J. Med. 157, 672-674 (1992).

    [0257] Allard, W. J. et al. Tumor cells circulate in the peripheral blood of all major carcinomas but not in healthy subjects or patients with nonmalignant diseases. Clin. Cancer Res. 10, 6897-6904 (2004).

    [0258] Aceto, N. et al. Circulating tumor cell clusters are oligoclonal precursors of breast cancer metastasis. Cell 158, 1110-1122 (2014).

    [0259] Bbenek, K., Kunkel, A. T., (1993). The fidelity of retroviral reverse transcriptases. In Skalka, M. A., Goff, P. S. Reverse transcriptase. New York: Cold Spring Harbor Laboratory Press. p. 85.ISBN 0-87969-382-7.

    [0260] Borgia, B. et al. A proteomic approach for the identification of vascular markers of liver metastasis. Cancer Res. 70, 309-318 (2010).

    [0261] Champely, S. pwr: Basic Functions for Power Analysis. (R Foundation for Statistical Computing, Vienna, 2009),

    [0262] Cima, I. et al. Label-free isolation of circulating tumor cells in microfluidic devices: current research and perspectives. Biomicrofluidics 7, 011810 (2013).

    [0263] Cohen, J. Statistical Power Analysis for the Behavioral Sciences. (L. Erlbaum Associates, 1988).

    [0264] Cole, W. H., Roberts, S. S., Webb, R. S., Strehl, F. W. & Oates, G. D. Dissemination of cancer with special emphasis on vascular spread and implantation. Ann. Surg. 161, 753-770 (1965).

    [0265] Colombo, E., Calcaterra, F., Cappelletti, M., Mavilio, D. & Della Bella, S. Comparison of fibronectin and collagen in supporting the isolation and expansion of endothelial progenitor cells from human adult peripheral blood. PLoS One 8, c66734 (2013).

    [0266] Coumans, F. A. W., van Dalum, G., Beck, M. & Terstappen, L. W. M. M. Filter characteristics influencing circulating tumor cell enrichment from whole blood. PLoS One 8, e61770 (2013).

    [0267] Cho, E. H. et al. Characterization of circulating tumor cell aggregates identified in patients with epithelial tumors. Phys. Biol. 9, 016001 (2012).

    [0268] Desitter, I. et al. A new device for rapid isolation by size and characterization of rare circulating tumor cells. Anticancer Res. 31,427-441 (2011).

    [0269] Ejeckam, G. C., Sogbein, S. K. & McLeish, W. A. Carcinocythemia due to metastatic oat-cell carcinoma of the lung. Can. Med. Assoc. J. 120,336-338 (1979).

    [0270] Engell, H. C. Cancer cells in the blood; a five to nine year follow up study. Ann. Surg. 149, 457-461 (1959).

    [0271] El-Heliebi, A. et al. Are morphological criteria sufficient for the identification of circulating tumor cells in renal cancer? J. Transl. Med. 11, 214 (2013).

    [0272] Finkel, G. C. & Tishkoff, G. H. Malignant cells in a peripheral blood smear: report of a case. N. Engl. J. Med. 262, 187-188 (1960).

    [0273] Glaves, D., Hubert, R. P. & Weiss, L. Haematogenous dissemination of cells from human renal adenocarcinomas. Br. J. Cancer 57, 32-35 (1988).

    [0274] Griffiths, J. D., McKinna, J. A., Rowbotham, H. D., Tsolakidis, P. & Salsbury, A. J. Carcinoma of the colon and rectum: circulating malignant cells and five-year survival. Cancer 31, 226-236 (1973).

    [0275] Gupta, G. P. et al. Mediators of vascular remodelling co-opted for sequential steps in lung metastasis. Nature 446,765-770 (2007).

    [0276] Herbert, J. M. J., Stekel, D., Sanderson, S., Heath, V. L. & Bicknell, R. A novel method of differential gene expression analysis using multiple eDNA libraries applied to the identification of tumour endothelial genes. BMC Genomics 9,153 (2008).

    [0277] Hofman, V. J. et al. Cytopathologic detection of circulating tumor cells using the isolation by size of epithelial tumor cell method: promises and pitfalls. Am. J. Clin. Pathol. 135, 146-156 (2011).

    [0278] Hofman, V. et al. Preoperative circulating tumor cell detection using the isolation by size of epithelial tumor cell method for patients with lung cancer is a new prognostic biomarker. Clin. Cancer Res. 17, 827-835 (2011).

    [0279] Hou, J.-M. et al. Circulating tumor cells, enumeration and beyond. Cancers (Basel). 2, 1236-1250 (2010).

    [0280] Hou, J.-M. et al. Circulating tumor cells as a window on metastasis biology in lung cancer. Am. J. Pathol. 178, 989-996 (2011).

    [0281] Hou, J. M. et al. Clinical significance and molecular characteristics of circulating tumor cells and circulating tumor microemboli in patients with small-cell lung cancer. J. Clin. Oncol. 30, 525-532 (2012).

    [0282] Kalka, C. et al. Transplantation of ex vivo expanded endothelial progenitor cells for therapeutic neovascularization. Proc. Natl. Acad. Sci. USA 97, 3422-3427 (2000).

    [0283] Khoja, L. et al. A pilot study to explore circulating tumour cells in pancreatic cancer as a novel biomarker. Br. J. Cancer 106, 508-16 (2012).

    [0284] Kling, J. Beyond counting tumor cells. Nat. Biotechnol. 30, 578-580 (2012).

    [0285] Krebs, M. G. et al. Analysis of circulating tumor cells in patients with non-small cell lung cancer using epithelial marker-dependent and -independent approaches. J. Thorac. Oncol. 7, 306-315 (2012).

    [0286] Lim, L. S. et al. Microsieve lab-chip device for rapid enumeration and fluorescence in situ hybridization of circulating tumor cells. Lab on a Chip 12, 4388-4396 (2012).

    [0287] Mabbott, N. A., Baillie, J. K., Brown, H., Freeman, T. C. & Hume, D. A. An expression atlas of human primary cells: inference of gene function from coexpression networks. BMC Genomics 14, 632 (2013).

    [0288] Marrinucci, D. et al. Fluid biopsy in patients with metastatic prostate, pancreatic and breast cancers. Phys. Biol. 9, 016003 (2012).

    [0289] Molnar, B., Ladanyi, A., Tanko, L., Sreter, L. & Tulassay, Z. Circulating tumor cell clusters in the peripheral blood of colorectal cancer patients. Clin. Cancer Res. 7, 4080-4085 (2001).

    [0290] Mura, M. et al. Identification and angiogenic role of the novel tumor endothelial marker CLEC14A. Oncogene 31, 293-305 (2012).

    [0291] Ni, X. et al. Reproducible copy number variation patterns among single circulating tumor cells of lung cancer patients. Proc. Natl. Acad. Sci. USA 110, 21083-21088 (2013).

    [0292] Paterlini-Brechot, P. & Benali, N. L. Circulating tumor cells (CTC) detection: clinical impact and future directions. Cancer Lctt. 253, 180-204 (2007).

    [0293] Peixoto, A., Monteiro, M., Rocha., B. & Veiga-Fernandes, H. Quantification of multiple gene expression in individual cells. Genome Res. 14, 1938-1947 (2004).

    [0294] R Core Team. R: A Language and Environment for Statistical Computing. (R Foundation for Statistical Computing, Vienna, 2005).

    [0295] Rice, M. E. & Harris, G. T. Comparing effect sizes in follow-up studies: ROC Area, Cohen's d, and r. Law Hum. Behay. 29,615-62(1(2005).

    [0296] Robin, X. et al. pROC: an open-source package for R and S+ to analyze and compare ROC curves. BMC Bioinformatics 12, 77 (2011).

    [0297] Rosenthal, R. Meta-analytic Procedures for Social Research. (SAGE Publications, 1991).

    [0298] Salsbury, A. J. The significance of the circulating cancer cell. Cancer Treat. Rev. 2, 55-72 (1975).

    [0299] Sanchez-Freire, V., Ebert, A. D., Kalisky, T., Quake, S. R. & Wu, J. C. Microfluidic single-cellreal-time PCR for comparative analysis of gene expression patterns. Nature protocols 7, 829-38 (2012).

    [0300] Schneider, C. A., Rasband, W. S. & Elicciri, K. W. NIH Jmage to ImageJ: 25 years of image analysis. Nature Methods 9, 671-675 (2012).

    [0301] Schug, J. et al. Promoter features related to tissue specificity as measured by Shannon entropy. Genome Biol. 6, R33 (2005).

    [0302] Seal, S. H. A sieve for the isolation of cancer cells and other large cells from the blood. Cancer 17, 637-642 (1964).

    [0303] Sellwood, R. A., Kuper, S. W., Burn, J. I. & Wallace, E. N. Circulating cancer cells. Br. Med. J. 1, 1683-1686 (1964).

    [0304] Song, J., From, P., Morrissey, W. J. & Sams, J. Circulating cancer cells: pre- and post-chemotherapy observations. Cancer 28, 553-561 (1971).

    [0305] St Croix, B. et al. Genes expressed in human tumor endothelium. Science 289, 1197-1202 (2000).

    [0306] Stott, S. L et al. Isolation of circulating tumor cells using a microvortex-generating herringbone-chip. Proc. Natl. Acad. Sci. USA 107, 18392-18397 (2010).

    [0307] Trapnell, C., Pachter, L. & Salzberg, S. L. TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 25, 1105-1111 (2009).

    [0308] Trapnell, C. et al. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 28, 511-515 (2010).

    [0309] Wild, R., Ramakrishnan, S., Sedgewick, J. & Griffioen, A. W. Quantitative assessment of angiogenesis and tumor vessel architecture by computer-assisted digital image analysis: effects of VEGF-toxin conjugate on tumor microvessel density. Microvasc. Res. 59, 368-376 (2000).

    [0310] Wu, C. et al. BioGPS: an extensible and customizable portal for querying and organizing gene annotation resources. Genome Biol. 10, R130 (2009).

    [0311] Ye, J. et al. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics 13, 134 (2012).

    [0312] Yu, M. et al. Circulating breast tumor cells exhibit dynamic changes in epithelial and mesenchymal composition. Science 339, 580-584 (2013).

    [0313] Van Beijnum, J. R., Rousch, M., Castermans, K., van der Linden, E. & Griffioen, A. W. Isolation of endothelial cells from fresh tissues. Nat. Protoc. 3, 1085-1091 (2008).

    [0314] Vona, G. et al. Isolation by size of epithelial tumour cells: a new method for the immunomorphological and molecular characterization of circulating tumor cells. Am. J. Pathol. 156, 57-63 (2000).

    [0315] Vona, G. 590 et al. Impact of cytomorphological detection of circulating tumor cells in patients with liver cancer. Hepatology 39, 792-797 (2004).

    [0316] Zanetta, L. et al. Expression of Von Willebrand factor, an endothelial cell marker, is up-regulated by angiogenesis factors: a potential method for objective assessment of tumor angiogenesis. Int. J. Cancer 85, 281-288 (2000)

    [0317] Zeileis, A., Wiel, M., Hornik, K. & Hothorn, T. Implementing a class of permutation tests: The coin package. J. Stat. Softw. 28, 1-23 (2008).

    [0318] What is claimed is: