Herbo-mineral Formulation for the treatment of Cardio vascular diseases and method of preparation thereof
20190117717 ยท 2019-04-25
Assignee
Inventors
Cpc classification
A61K36/899
HUMAN NECESSITIES
A61K36/47
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61K9/148
HUMAN NECESSITIES
A61K36/59
HUMAN NECESSITIES
A61K36/81
HUMAN NECESSITIES
A61K36/47
HUMAN NECESSITIES
A61K33/00
HUMAN NECESSITIES
A61K33/00
HUMAN NECESSITIES
A61K36/81
HUMAN NECESSITIES
A61K36/59
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K9/205
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
International classification
A61K36/59
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61K36/8965
HUMAN NECESSITIES
A61K9/14
HUMAN NECESSITIES
Abstract
Herbo-mineral formulation for the treatment of Cardio vascular diseases and method of preparing the same are disclosed herein. The disclosed herbo-mineral formulation includes herb and mineral components which facilitate in treating Cardio vascular diseases. Cardio vascular diseases may include any condition associated with heart and blood vessels. Further, the disclosed formulation may also be instrumental as anti-oxidating, anti-stress, hypolipidemic, atherogenic, antihypertensive, apoptotsis inhibiting and cardio-protective agent.
Claims
1. A formulation for treatment and management of Cardiovascular ailments comprising: a herb component comprising Terminalia arjuna, Sida rombifolia, Withania somnifera, Tinospora cordifolia, Punica granatum, Emblica officinalis and Commiphora mukul, or their extracts thereof; and a mineral component comprising shilajit and bhasma.
2. The formulation claimed in claim 1, wherein Terminalia arjuna is present in an amount ranging from 8 to 12 wt %, Sida rombifolia is present in an amount ranging from 2 to 6 wt %, Withania somnifera is present in an amount ranging from 2 to 6 wt %, Tinospora cordifolia is present in an amount ranging from 2 to 6 wt %, Punica granatum is present in an amount ranging from 2 to 6 wt %, Emblica officinalis is present in an amount ranging from 2 to 6 wt % and Commiphora mukul is present in an amount ranging from 2 to 6 wt %.
3. The formulation claimed in claim 1 wherein said herb component further comprises of at least one herb selected from a group consisting of Embelia ribes, Rubia cordifolia, Nardostachys jatamansi, Terminalia chebula, Terminalia bellerica, Piper longum, Piper nigrum, Zingiber officinalis, Boerhavia diffusa, Bamboo manna, Madhuka indica, Azhadirachta indica, Picrorhiza kurroa, Holy basil, Steriospermum suaveolens, Premna mucronata, Gmelina arborea, Aegle marmelos, Oroxylum indicum, Desmodium gangeticum, Uraria picta, Solanum indicum, Solanum xanthocarpum, and Tribulus terrestris; or their extracts thereof.
4. The formulation as claimed in claim 3, wherein said herb is present in an amount of 4 wt %.
5. The formulation as claimed in claim 1, wherein said mineral component comprises of at least one bhasma selected from a group consisting of Muktasukti bhasma, Loha bhasma, Abhraka bhasma, Swarnamaksika bhasma and Pravala bhasma.
6. The formulation as claimed in claim 1, wherein shilajit is present in an amount ranging from 1 to 3 wt %.
7. The formulation as claimed in claim 5, wherein Muktasukti bhasma is present in an amount of 2 wt %, Loha bhasma is present in an amount of 2 wt %, Abhraka bhasma is present in an amount of 3 wt %, Swarnamaksika bhasma is present in an amount of 2 wt % and Pravala bhasma is present in an amount of 2 wt %.
8. The formulation as claimed in claim 1, further comprising a suitable excipient, preferably gum acacia.
9. The formulation as claimed in claim 1, wherein said formulation is in the form of powder.
10. The formulation as claimed in claim 1, wherein said formulation is in the form of tablet.
11. The formulation as claimed in claim 10, wherein said tablet is in the form of 500 mg tablets.
12. A method for treating and preventing Cardiovascular diseases, comprising administering to a patient in need thereof an effective amount of the formulation as claimed in claim 1.
13. A method for reducing the risks of Cardiovascular diseases, comprising administering to a patient in need thereof an effective amount of the formulation as claimed in claim 1.
14. A process for the preparation of formulation claimed in claim 1, comprising: levigating bhasmas and shilajit; adding finely powdered herbs; and adding grinding decoction while continuing grinding to obtain a ground mass.
15. The process for the preparation of a formulation as claimed in claim 14, wherein said bhasmas are selected from a group consisting of Muktasukti bhasma, Loha bhasma, Abhraka bhasma, Swarnamaksika bhasma and Pravala bhasma.
16. The process for the preparation of a formulation as claimed in claim 14, wherein said finely powdered herbs comprises of finely powdered form of; Terminalia arjuna (dry stem bark), Sida rombifolia (dry root), Withania somnifera (dry root), Rubia cordifolia (dry root), Nardostachys jatamansi (dry root), Boerhavia diffusa (dry root), Picrorhiza kurroa (dry root), Steriospermum suaveolens (dry root), Premna mucronata (dry root), Gmelina arborea (dry root), Aegle marmelos (dry root), Oroxylum indicum (dry root), Solanum indicum (dry root), Embelia ribes (dry fruit), Emblica officinalis (dry fruit), Terminalia chebula (dry fruit), Terminalia bellerica (dry fruit), Piper longum (dry fruit), Piper nigrum (dry fruit), Tribulus terrestris (dry fruit), Azhadirachta indica (dry bark), Solanum xanthocarpum (dry plant), Uraria picta (dry plant), Desmodium gangeticum (dry plant), Tinospora cordifolia (dry stem), Punica granatum (dry fruit pericarp), Zingiber officinalis (dry rhizome), Bamboo manna (exudate), Madhuka indica (dry flower), Holy basil (dry leaves) and Commiphora mukul (gum resin).
17. The process for the preparation of a formulation as claimed in claim 14, wherein said grinding decoction is a decoction of at least one herb selected from the group consisting of Terminalia arjuna, Asparagus racemosus, Asafetida, Cuminum cyminum, Plumbago rosea, Baliospermum montanum, Ocimum sanctum, Aloevera, Plantago ovata, Steriospermum suaveolens, Premna mucronata, Gmelina arborea, Aegle marmelos, Oroxylum indicum, Desmodium gangeticum, Uraria picta, Solanum indicum, Solanum xanthocarpum and Tribulus terrestris.
18. A method of reducing the risks of Cardiovascular diseases comprising, administering a therapeutically effective amount of the formulation claimed in claim 1.
19. A method of treating and preventing Cardiovascular diseases comprising, administering a therapeutically effective amount of the formulation claimed in claim 1.
20. The method of treating and preventing Cardiovascular diseases as claimed in claim 19, wherein said formulation is preferably administered at a dose of two 500 mg tablets twice a day.
21. A method of treating and preventing Cardiovascular diseases comprising administering a therapeutically effective amount of the formulation claimed in claim 1.
22. The method of treating and preventing Cardiovascular diseases as claimed in claim 19, wherein said therapeutically effective amount is 500 to 1000 mg administered one to three times a day.
23. The method of treating/preventing Cardiovascular diseases as claimed in claim 19, wherein said formulation is administered along with administration of at least one other medication prescribed for treatment of Cardiovascular diseases.
Description
BRIEF DESCRIPTION OF FIGURES
[0012] The embodiments disclosed herein are illustrated in the accompanying drawings, throughout which like reference letters indicate corresponding parts in the various figures. The embodiments herein will be better understood from the following description with reference to the drawings, in which:
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
DETAILED DESCRIPTION
[0030] The embodiments herein and the various features and advantageous details thereof are explained more fully with reference to the non-limiting embodiments that are illustrated in the accompanying drawings and detailed in the following description. Descriptions of well-known components and processing techniques are omitted so as to not unnecessarily obscure the embodiments herein. The examples used herein are intended merely to facilitate an understanding of ways in which the embodiments herein may be practiced and to further enable those of skill in the art to practice the embodiments herein. Accordingly, the examples should not be construed as limiting the scope of the embodiments herein.
[0031] The embodiments herein achieve a herbo-mineral formulation of therapeutic value, and a process for the preparation of the formulation. The herbo-mineral formulation disclosed herein is useful in the treatment and prevention of Cardiovascular diseases and complications related to cardiovascular system. In the various embodiments herein, cardiovascular Diseases may include any condition associated to heart and blood vessels such as cardiac arrhythmias, ischemic heart diseases, coronary artery disease, valve defects, etc. Further, the complications related to cardiovascular system may be any condition generally known to be related to or considered as risk factors of CVDs including hypertension, increased blood sugar, hyperlipidemia, etc. The disclosed formulation also find use as an anti-oxidating, anti-stress, hypolipidemic, atherogenic, antihypertensive, apoptotsis inhibiting and cardio-protective agent. Accordingly, the embodiments disclosed herein achieve a method for the treatment/prevention of Cardiovascular diseases. Also disclosed are embodiments of a method of reducing the risks of Cardiovascular diseases.
Formulation
[0032] The disclosed embodiments herein provide herbo-mineral formulation having herbs and minerals. In an embodiment, the herbo-mineral formulation includes a herb component and a mineral component. In another embodiment, the herbo-mineral formulation includes a herb component, a mineral component and a suitable excipient.
Herb component
[0033] In an embodiment, the herb component includes the herbs Terminalia arjuna, Sida rombifolia, Withania somnifera, Tinospora cordifolia, Punica granatum, Embelia ribes, Rubia cordifolia, Nardostachys jatamansi, Emblica officinalis, Terminalia chebula, Terminalia bellerica, Piper longum, Piper nigrum, Zingiber officinalis, Boerhavia diffusa, Bamboo manna, Madhuka indica, Azhadirachta indica, Picrorhiza kurroa, Holy basil, Commiphora mukul, Steriospermum suaveolens, Premna mucronata, Gmelina arborea, Aegle marmelos, Oroxylum indicum, Desmodium gangeticum, Uraria picta, Solanum indicum and Solanum xanthocarpum or their extracts, or the active ingredients extracted from these herbs.
[0034] In an embodiment, the herb component may include the herb as a whole or may include specific parts of the herb such as roots, fruits, stem, leaves, rhizome, etc. In an embodiment, the herb component includes stem bark of Terminalia arjuna; root of Sida rombifolia, Withania somnifera, Rubia cordifolia, Nardostachys jatamansi, Boerhavia diffusa, Picrorhiza kurroa, Steriospermum suaveolens, Premna mucronata, Gmelina arborea, Aegle marmelos, Oroxylum indicum, Solanum indicum; fruit of Embelia ribes, Emblica officinalis, Terminalia chebula, Terminalia bellerica, Piper longum, Piper nigrum, Tribulus terrestris; bark of Azhadirachta indica; plant of Solanum xanthocarpum, Uraria picta, Desmodium gangeticum; stem of Tinospora cordifolia; fruit pericarp of Punica granatum; rhizome of Zingiber officinalis; exudate of Bamboo manna; flower of Madhuka indica; leaves of Holy basil and gum resin of Commiphora mukul or their extract. However, it is also within the scope of the claims for the herb component to include other parts of the herb such as leaf, flowers, etc. without otherwise deterring intended function of the herbo-mineral formulation.
[0035] Herbs (in whole or part), disclosed herein, maybe included in the formulation in any form that is generally known in the field. For example, the herbs may be processed to form extracts, dried, powdered, pelleted, concentrated, etc. In an embodiment, the herbs are dried and powdered which is further incorporated into the formulation.
[0036] In an embodiment, the herb component includes Terminalia arjuna in an amount in the range of 8 to 12 wt %, Sida rombifolia in an amount in the range of 2 to 6 wt %, Withania somnifera in an amount in the range of 2 to 6 wt %, Tinospora cordifolia in an amount in the range of 2 to 6 wt %, Punica granatum in an amount in the range of 2 to 6 wt %, Emblica officinalis in an amount in the range of 2 to 6 wt % and Commiphora mukul in an amount in the range of 2 to 6 wt %. Further, in another embodiment, the herb component includes at least one of Embelia ribes, Rubia cordifolia, Nardostachys jatamansi, Terminalia chebula, Terminalia bellerica, Piper longum, Piper nigrum, Zingiber officinalis, Boerhavia diffusa, Bamboo manna, Madhuka indica, Azhadirachta indica, Picrorhiza kurroa, Holy basil, Steriospermum suaveolens, Premna mucronata, Gmelina arborea, Aegle marmelos, Oroxylum indicum, Desmodium gangeticum, Uraria picta, Solanum indicum, Solanum xanthocarpum and Tribulus terrestris, preferably in an amount of 4 wt %.
Mineral Component
[0037] In an embodiment, the mineral component includes Bhasmas or calcined preparations such as Swarna Makshika bhasma, Abhraka bhasma, Loha bhasma, Muktasukti bhasma, and Pravala bhasma. Alternatively, the mineral component may also be selected from a group consisting of at least one of Iron, Mica, Copper pyrite and Coral. In the disclosed embodiments, the bhasmas along with the herb component form bioavailable herbo-mineral complexes which are useful in treating Cardio vascular Diseases and related complications. In another embodiment, the mineral component further includes Shilajit. However, it is also within the scope of claims provided herewith for the herbo-mineral formulation to include, as a substitute or additionally, other similar calcined preparations or minerals without otherwise deterring from the intended function of the herbo-mineral formulation.
[0038] In an embodiment, the mineral component includes shilajit in the range of 1 to 4 wt %. In another embodiment, the mineral component includes Muktasukti bhasma in an amount of 2 wt %, Loha bhasma in an amount of 2 wt %, Abhraka bhasma in an amount of 3 wt %, Swarnamaksika bhasma in an amount of 2 wt % and Pravala bhasma in an amount of 2 wt %.
[0039] The disclosed formulation, in the various embodiments herein, may further include a suitable excipient. The list of suitable excipients includes solvents, binders, lubricants, herbal carriers, oils and salts that are generally known in the art. In an embodiment, the excipient includes acacia gum.
[0040] Further, the amount of herb component and mineral component that may be included in the various embodiments of the disclosed formulation may be in the range of 0 to 12 wt %. In an embodiment, the formulation includes Terminalia arjuna (8 to 12 wt %), Sida rombifolia (2 to 6 wt %), Withania somnifera (2 to 6 wt %), Tinospora cordifolia (2 to 6 wt %), Punica granatum (2 to 6 wt %), Emblica officinalis (2 to 6 wt %) and Commiphora mukul (2 to 6 wt %), Shilajit 1 to 4 wt %), Muktasukti bhasma (2 wt %), Loha bhasma (2 wt %), Abhraka bhasma (3 wt %), Swarnamaksika bhasma (2 wt %) and Pravala bhasma (2 wt %).
[0041] In another embodiment, the formulation further includes at least one of Embelia ribes, Rubia cordifolia, Nardostachys jatamansi, Terminalia chebula, Terminalia bellerica, Piper longum, Piper nigrum, Zingiber officinalis, Boerhavia diffusa, Bamboo manna, Madhuka indica, Azhadirachta indica, Picrorhiza kurroa, Holy basil, Steriospermum suaveolens, Premna mucronata, Gmelina arborea, Aegle marmelos, Oroxylum indicum, Desmodium gangeticum, Uraria picta, Solanum indicum, Solanum xanthocarpum and Tribulus terrestris, preferably in an amount of 4 wt %
[0042] Further, the amount of gum acacia may be any amount suitable to perform the activity of an excipient. In an embodiment, the formulation may include gum acacia in the range of 0 to 50 mg per 500 mg of the formulation, preferably 10 wt %.
[0043] However, it is apparent that slight variations in the amount of the ingredients may be performed without otherwise deterring from the intended function of the herbo-mineral formulation.
[0044] The herbo-mineral formulation disclosed herein may be formulated in various dosage forms such that it is suitable for oral administration. The herbo-mineral formulation may be in the form of powder, tablets, pellets, lozenges, granules, capsules, solutions, emulsions, suspensions, or any other form suitable for use. In an embodiment, the herbo-mineral formulation is formulated in the form of powder suitable for oral administration. In another embodiment, the herbo-mineral formulation is formulated in the form of tablets, preferably 500 mg tablets. For example: Table 1 depicts the quantities of each ingredient in a 500 mg tablet.
[0045] Further disclosed herein, is a tablet for treating/preventing CVDs and related complications. In an embodiment, the tablet is a 500 mg tablet having herb component, mineral component and an excipient as depicted in Table 1.
TABLE-US-00001 TABLE 1 Each 500 mg tablet includes: BOTANICAL/ S. SCIENTIFIC NO. SANSKRIT NAME NAME QUANTITY 1 Arjuna dry stem bark Terminalia arjuna 50 mg 2 Bala dry root Sida rombifolia 20 mg 3 Ashvagandha dry root Withania somnifeera 20 mg 4 Guduchi dry stem Tinospora cordifolia 20 mg 5 Dadima dry fruit pericarp Punica granatum 20 mg 6 Vidanga dry fruit Embelia ribes 10 mg 7 Manjishtha dry root Rubia cordifolia 10 mg 8 Jatamamsi dry root Nardostachys jatamansi 10 mg 9 Amalaki dry fruits Emblica officinalis 20 mg 10 Hareetaki dry fruits Terminalia chebula 10 mg 11 Vibhitaki dry fruits Terminalia bellerica 10 mg 12 Pippali dry fruit Piper longum 10 mg 13 Maricha dry fruit Piper nigrum 10 mg 14 Shunthi dry rhizome Zingiber officinalis 10 mg 15 Punarnava dry root Boerhavia diffusa 10 mg 16 Vamshalochana exudate Bamboo manna 10 mg 17 Madhuka dry flower Madhuka indica 10 mg 18 Nimba dry bark Azhadirachta indica 10 mg 19 Katuki dry root Picrorhiza kurroa 10 mg 20 Tulasi dry leaves Holy basil 10 mg 21 Guggulu oleo gum resin Commiphora mukul 20 mg 22 Patala dry root Steriospermum 10 mg suaveolens 23 Agnimantha dry root Premna mucronata 10 mg 24 Gambhari dry root Gmelina arborea 10 mg 25 Bilva dry root Aegle marmelos 10 mg 26 Shyonaka dry root Oroxylum indicum 10 mg 27 Shalaparni dry plant Desmodium gangeticum 10 mg 28 Prshniparni dry plant Uraria picta 10 mg 29 Brhati dry root Solanum indicum 10 mg 30 Kantakari dry plant Solanum xanthocarpum 10 mg 31 Gokshura dry fruit Tribulus terrestris 10 mg 32 Muktasukti bhasma Incinerated Pearle oyster 05 mg 33 Loha bhasma Incinerated Iron 05 mg 34 Abhraka bhasma Incinerated Mica 10 mg 35 Swarnamaksika bhasma Incinerated Copper pyrite 05 mg 36 Pravala bhasma Incinerated Coral 05 mg 37 Shilajatu fossil resin Asphaltum 10 mg Excipient Gum acacia 50 mg
[0046] Embodiments of the disclosed herbo-mineral formulation (also referred to as drug or test drug) in tablet form were analyzed for phytoconstituents, physicochemical etc, by methods generally known in the field. The analysis and results obtained are included hereunder as examples by way of illustration only, and should not be construed to limit the scope of the claims provided herewith. It will be apparent to those skilled in the art that many modifications, both to materials and methods, may be practiced without departing from the scope of the claims.
EXAMPLE 1
[0047] Physico-chemical investigation: Physicochemical investigations like Ash value, tablet hardness, disintegration time, alcohol soluble extractive value and chloroform soluble extractive values were analyzed as per the parameters given in Indian Pharmacopeia of Ayurveda. The tablet disintegration time was checked with the help of Tablet disintegration machine (I.P.Std.Rotek) and Tablet hardness tester (Secor.India) used to find out the hardness of the tablet. Each experiment was repeated thrice. Table 2 depicts the results of Physiochemical analysis.
TABLE-US-00002 TABLE 2 TEST PARAMETERS SPECIFICATIONS Description Dark brown colored biconvex discs Identification Positive for Iron, Calcium Average weight 500 mg 12.5 mg Uniformity of weight 2.5% of actual average weight Tablet hardness 3.6 kg/cm.sup.2 Loss on drying 6.2% w/w Methanol soluble extractive 41.2% w/v Chloroform soluble extractive 12.0% w/v Ash value 15.2% w/w Average Disintegration time 26 minutes ASSAY Each tablet contains, Iron - 4.5 mg, Calcium - 15 mg
EXAMPLE 2
[0048] Phyto constituents study: Tests were performed to screen the various phyto constituents such as glycosides, steroids, saponins, proteins, tannins etc.
[0049] Table 3 depicts the results of Qualitative analysis performed for phyto constituents. The test showed the presence of alkaloids, steroids, glycosides etc which could make the drug capable of curing diseases.
TABLE-US-00003 TABLE 3 Aqueous Methanol Ethanol Test for Extract Extract Extract Proteins + Carbohydrates + + + Phenols Tannins ++ ++ ++ Flavonoids ++ ++ ++ Saponins + + + Terpenoids + Glycosides + + + Steroids + + Alkaloids + + + (+) denotes presence and () denotes absence
Method
[0050] Disclosed herein are embodiments of a method of preparing the herbo-mineral formulation. In an embodiment, the method includes: [0051] levigating bhasmas and shilajit in a grinder; [0052] adding finely powdered herbs into the grinder; and [0053] adding grinding decoction while continuing grinding to obtain a ground mass.
[0054] The bhasmas include at least one of Muktasukti bhasma, Loha bhasma, Abhraka bhasma, Swarnamaksika bhasma and Pravala bhasma. The mixture of bhasmas and Shilajit may be in semi solid form. In an embodiment, the levigation may be performed for a duration of around 3 hours.
[0055] Further, the finely powdered herbs include finely powdered stem bark of Terminalia arjuna, root of Sida rombifolia, root of Withania somnifera, root of Rubia cordifolia, root of Nardostachys jatamansi, root of Boerhavia diffusa, root of Picrorhiza kurroa, root of Steriospermum suaveolens, root of Premna mucronata, Gmelina arborea, root of Aegle marmelos, root of Oroxylum indicum, root of Solanum indicum, fruit of Embelia ribes, fruit of Emblica officinalis, fruit of Terminalia chebula, fruit of Terminalia bellerica, fruit of Piper longum, fruit of Piper nigrum, fruit of Tribulus terrestris, bark of Azhadirachta indica, plant of Solanum xanthocarpum, plant of Uraria picta, plant of Desmodium gangeticum, stem of Tinospora cordifolia, fruit pericarp of Punica granatum, rhizome of Zingiber officinalis, exudate of Bamboo manna, flower of Madhuka indica, leaves of Holy basil and gum resin of Commiphora mukul.
[0056] The grinding decoction is a decoction of selected herbs (also referred as grinding herbs). In an embodiment, the grinding decoction is a decoction of one or more grinding herbs selected from a group consisting of: Terminalia arjuna, Asparagus racemosus, Asafetida, Cuminum cyminum, Plumbago rosea, Baliospermum montanum, Ocimum sanctum, Aloevera, Plantago ovata, Steriospermum suaveolens, Premna mucronata, Gmelina arborea, Aegle marmelos, Oroxylum indicum, Desmodium gangeticum, Uraria picta, Solanum indicum, Solanum xanthocarpum and Tribulus terrestris.
[0057] The decoction may be obtained by any method of decocting generally known in the field. In an embodiment, the method of preparation of grinding decoction includes, [0058] soaking the grinding herbs; for example: soaking powdered dry bark of Terminalia arjuna, fresh root of Asparagus racemosus, resin Asafetida, dry fruit of Cuminum cyminum, dry root of Plumbago rosea, dry root of Baliospermum montanum, dry leaves of Ocimum sanctum, fresh leaves of Aloevera, dry seeds of Plantago ovata, dry roots of Steriospermum suaveolens, dry roots of Premna mucronata, dry root of Gmelina arborea, dry root of Aegle marmelos, dry root of Oroxylum indicum, dry plant of Desmodium gangeticum, dry plant of Uraria picta, dry root of Solanum indicum, dry plant of Solanum xanthocarpum and dry fruit of Tribulus terrestris, and concentrating the soaked herb mixture.
[0059] In an embodiment, soaking may be performed by soaking the grinding herbs in 16 parts of water overnight. In a further embodiment, concentrating may be performed by boiling at high temperature, preferably about 80 C. to 85 C., until th of the liquid remains. Concentration may be confirmed with the help of Brix meter.
[0060] Further, once the grinding decoction is added, grinding is continued. In an embodiment, grinding is continued for about 72 hours, preferably at 120 rpm, to obtain a ground mass. In an embodiment, the method of preparation may further include adding excipient to the ground mass, wherein gum acacia may be added to the ground mass by dissolving in the grinding decoction, while continuing grinding for 3 hours to obtain a semisolid mass. The method of preparation may further include drying at 50 C.-60 C., preferably in a hot air oven; wet granulating; and punching to obtain 500 mg tablets.
TABLE-US-00004 TABLE 4 List of grinding herbs Decoction of following herbs: 1 Arjuna dry bark Terminalia arjuna 1 part 2 Shatavari fresh root Asparagus racemosus 1 part 3 Hingu resin Asafetida 1 part 4 Jeeraka dry fruit Cuminum cyminum 1 part 5 Chitraka dry root Plumbago rosea 1 part 6 Danti dry root Baliospermum montanum 1 part 7 Tulasi dry leaves Ocimum sanctum 1 part 8 Kumari fresh leaf Aloe vera 1 part 9 Ishvaragola dry seeds Plantago ovata 1 part 10 Patala dry root Steriospermum suaveolens 1 part 11 Agnimantha dry root Premna mucronata 1 part 12 Gambhari dry root Gmelina arborea 1 part 13 Bilva dry root Aegle marmelos 1 part 14 Shyonaka dry root Oroxylum indicum 1 part 15 Shalaparni dry plant Desmodium gangeticum 1 part 16 Prshniparni dry plant Uraria picta 1 part 17 Brhati dry root Solanum indicum 1 part 18 Kantakari dry plant Solanum xanthocarpum 1 part 19 Gokshura dry fruit Tribulus terrestris 1 part Jala Water 304 parts Avashesha part of water
[0061] The bhasmas that are used in the various embodiments of the disclosed herbo-mineral formulation may be prepared by methods that are generally known in the field. Bhasmas may be prepared by selecting genuine standard minerals as starting material such as Swarnamakshika, Mica, Iron, pearl oyster etc; drying in a hot air oven; purifying the mineral by triturating, quenching, boiling, etc; triturating with herbal decoction; preparing into discs; drying of discs; preparing sharavasam puta, subjecting Sharavasam puta to Gaja puta, and powdering of discs once cooled. As is generally known in the field, once the disc is powdered, the powder may again be subjected to many repetitions of trituration with herbal decoction followed by preparing into discs; drying of discs; preparing sharavasam puta, subjecting Sharavasam puta to Gaja puta, and powdering, until bhasma is obtained. The number of repetitions may vary from 0 to 30 times. In an embodiment, the method is repeated as many as 30 times till bhasma is obtained.
[0062] The starting materials used in the preparation of bhasmas may include standard minerals generally used in the field. In an embodiment, the preparation of Swarna Makshika Bhasma includes swarna makshika as the starting material.
[0063] In another embodiment, the preparation of Abhraka Bhasma includes Mica as the starting material.
[0064] In an embodiment, purification of mineral includes mixing the mineral with rocksalt and lemon juice and heating strongly till partially oxidized into reddish powder which is further be used in the preparation of Swarna makshika Bhasma. In another embodiment, purification of mineral includes quenching of mineral in Cow's milk wherein it is further used in the preparation of Abhraka Bhasma.
[0065] In yet another embodiment, purification of mineral includes quenching of mineral in Triphala decoction which is further used in the preparation of Loha Bhasma. In yet another embodiment, purification of mineral includes quenching of mineral in Kanjika (sour medicated gruel) which is further used in the preparation of Mukta sukti Bhasma.
[0066] Further, in an embodiment, purification of mineral includes boiling the mineral in alkaline solution of Barilla which is further used in the preparation of Pravala Bhasma.
[0067] The herbal decoction used may be any herbal decoction that is generally used for triturating in the preparation of bhasmas. In an embodiment, the herbal decoction includes at least one of Nimbu Swarasa (Lemon juice) and Kulatha Kwatha (Decoction of Dolichos biflorus), wherein it is useful in the preparation of Swarna Makshika bhasma. In another embodiment, the herbal decoction includes at least one of Arka Ksheera (Latex of calotropes procera), Snuhi Ksheera (Latex of Euphorbia neriifolia), Vata Ksheera (Latex of Ficus bengalensis), Kakamachi Rasa (fresh juice of Solanum nigrum whole plant), Gokshura Kwatha (decoction of tribulus terrestris fruits), Apamarga Rasa (Juice of Achyranthus aspera plant), Vata Praroha Swarasa (juice of aerial root of Ficus bengalensis), Gomutra (Cow urine), Tulasi Swarasa (Fresh juice of Ocimum sanctum leaves), Kadali Shipha Jala (Juice of plantain rhizome), Eranda patra rasa (Juice of Ricinus communis leaves), and Guda (Jaggery), wherein it is useful in the preparation of Abhraka Bhasma. In an embodiment, the herbal decoction includes Triphala Kashaya (decoction of fruits of Terminalia chebula, Terminalia bellerica and Emblica officinalis), wherein it is useful in the preparation of Loha Bhasma. In an embodiment, the herbal decoction includes Aloe Vera juice, wherein it is useful in the preparation of Muktasukti Bhasma. In another embodiment, the herbal decoction includes at least one of Aloe vera (fresh juice of leaves), Sesbania seban (fresh juice of leaves), Asparagus racemosus (fresh juice of roots) and Cow milk, wherein it is useful in the preparation of Pravala Bhasma.
Treatment
[0068] Disclosed herein are embodiments of a method of treating/preventing Cardio vascular diseases. Also disclosed are embodiments of a method of reducing the risks of CVD.
[0069] In an embodiment, the method includes administering to a patient a composition having a herb component, a mineral component and a suitable excipient, wherein [0070] the herb component includes the herbs Terminalia arjuna (8 to 12 wt %), Sida rombifolia (2 to 6 wt %), Withania somnifera (2 to 6 wt %), Tinospora cordifolia (2 to 6 wt %), Punica granatum (2 to 6 wt %), Emblica officinalis (2 to 6 wt %), Commiphora mukul (2 to 6 wt %) and at least one herb selected from the group consisting of Terminalia arjuna, Sida rombifolia, Withania somnifera, Tinospora cordifolia, Punica granatum, Embelia ribes, Rubia cordifolia, Nardostachys jatamansi, Emblica officinalis, Terminalia chebula, Terminalia bellerica, Piper longum, Piper nigrum, Zingiber officinalis, Boerhavia diffusa, Bamboo manna, Madhuka indica, Azhadirachta indica, Picrorhiza kurroa, Holy basil, Commiphora mukul, Steriospermum suaveolens, Premna mucronata, Gmelina arborea, Aegle marmelos, Oroxylum indicum, Desmodium gangeticum, Uraria picta, Solanum indicum and Solanum xanthocarpum; and [0071] the mineral component includes Shilajit (1 to 4 wt %), and at least on of Muktasukti bhasma (2 wt %), Loha bhasma (2 wt %), Abhraka bhasma (3 wt %), Swarnamaksika bhasma (2 wt %) and Pravala bhasma (2 wt %).
[0072] In an embodiment, the patient may be any individual in need of such treatment including ones having/suspected of having Cardiovascular diseases. Further, the patient may also be any individual having/suspected of having any complication associated with heart and blood vessels. In an embodiment, Cardio vascular diseases include cardiac arrhythmias, ischemic heart diseases, coronary artery disease, valve defects, mitral valve prolapse etc. Further, the patient may also be any individual prone to or having risks of Cardiovascular diseases, for example: individuals having hypertension, obesity, increased blood sugar, etc.
[0073] In an embodiment, the method of treating/preventing CVD includes administering the Disclosed formulation to a patient wherein the disclosed formulation acts as at least one of anti-oxidating, anti-stress, hypolipidemic, atherogenic, antihypertensive, apoptotsis inhibiting and cardio-protective agent.
[0074] The disclosed method of treatment may be used as a primary line of treatment or as an adjunct to other CVD treatment methods. In an embodiment, the method may be instrumental in improving the health conditions of individuals having CVD.
[0075] The dosage of the test drug and the treatment regimen may vary depending on the patient. The disclosed formulation was subjected to acute oral toxicity study, and a study to check its effect on behavior and nervous system. The studies proved that Test drug is free from toxicity even at a dose of 6000 mg/kg weight which was the maximum possible dose. It was also found to have no harmful effects on behavior and nervous system.
[0076] The Disclosed formulation (also referred as Test drug or Test product) was further evaluated for efficacy of cardio-protective activity by preclinical and clinical studies, as described hereunder by way of examples. Embodiments of the formulation disclosed herein is further described by reference to the following examples by way of illustration only, and should not be construed to limit the scope of the embodiments herein. It will be apparent to those skilled in the art that many modifications, both to materials and methods, may be practiced without departing from the scope of the claims.
EXAMPLE 3
Preclinical Study
[0077] The aim of this study was to analyze the Cardioprotective activity of test product on Isoproterenol (ISP) induced experimental model of myocardial infarction. The effect of Test drug on the membrane bound enzymes like Na+K+ATPase, Ca2+ATPase and Mg2+ATPase were investigated. The action of Test drug on apoptotic and pre-apoptotic markers gene expression in ISP induced myocardial infarction was analyzed. Also, the effect of Test drug on CK-MB activity and oxidative stress markers was evaluated.
Experiment details:
[0078] Animals: 35 male Sprague-Dawley rats of 150-200 g body weight were selected for the study. Animals were housed in individual polycarbonate cages in a well-ventilated room under an ambient temperature of 232 degree C. and 40-65% relative humidity, with artificial photoperiod 12-h light/12-h dark cycle. They were provided with standard rodent pellet diet (Nutrilab Rodent, Tetragon Chemie, India) and purified water ad libitum (RIOS, USA). Experimental animals were acclimatized for 7 days to the laboratory conditions prior to experimentation. The study protocol was approved by Institutional Animal Ethical Committee (IAEC).
[0079] Experimental groups and design: Rats were randomized into 5 groups based on the body weight. ISP (120 mg/kg) was injected subcutaneously to rats on 19th and 21st day to induce experimental myocardial infarction. Test drug was orally administered throughout the study. [0080] Group I (Normal control): 0.5% CMC [0081] Group II (Positive control): 0.5% CMC+ISP (120 mg/kg) [0082] Group III (Standard): Carvedilol (2 mg/kg/day,p.o)+ISP (120 mg/kg,s.c.) [0083] Group IV (Low dose): Test drug (50 mg/kg/day,p.o)+ISP (120 mg/kg,s.c.) [0084] Group V (High dose): Test drug (100 mg/kg/day,p.o)+ISP (120 mg/kg, s.c.)
[0085] The change in body weight was recorded every week. At the end of the experiment, blood was collected and the plasma was separated for biochemical investigation. The animals were euthanized and the organs (heart, Kidney and adrenals) were dissected out and weighed. Heart homogenate was used for further analysis and LV was separated for the analysis of apoptotic marker gene expression as depicted in the various examples hereunder.
Biochemical Parameters
EXAMPLE 3(a)
CK-MB (Creatinine Kinase-MB)
[0086] The CK-MB activity was measured by kit method (Spinreact, Spain) using Semi-automated biochemical analyzer.
[0087] Effect of Test drug on CK-MB activity:
[0088] The serum marker enzyme CK-MB in ISP induced rats serves as the index to assess the severity of myocardial injury. This increase in activity is accompanied by their concomitant increase in wet weight of myocardium confirms the onset of apoptotic pathway. Extent of cardio-protection offered by the drug is associated with the significant attenuation of CK-MB activity. Hence, pretreatment with Test Drug significantly possess cardio-protective effect and maintains myocardial membrane integrity.
EXAMPLE 3(b)
Na+K+ATPase
[0089] Reagents
[0090] 1. Tris HCl (184 mM) pH-7.5: 1.449 g in 50 ml of distilled water
[0091] 2. KCl (50 mM): 37.275 mg in 10 ml of distilled water
[0092] 3. Sodium EDTA (1 mM): 4 mg in 10 ml of distilled water
[0093] 4. NaCl (600 mM): 350.64 mg in 10 ml. of distilled water
[0094] 5. 10% TCA: 10 g in 100 ml of distilled water
[0095] 6. 15% sodium meta bisulphate: 7.5 g in 50 ml of distilled water
[0096] 7. 20% sodium sulphate: 2 g in 10 ml of distilled water
[0097] 8. 5N H2SO4: 13.5 ml of H2SO4 in 100 ml of distilled water
[0098] 9. Ammonium molybdate (2.5%): 2.5 g in 100 ml of 5N Sulphuric acid
[0099] 10. ANSA (0.1%): 100 mg in 39 ml of 15% sodium meta bisulphate. Then 1 ml of 20% sodium sulphite was added and the volume was made up to 100 ml with distilled water.
[0100] Protocol: Na+K+ATPase was assayed by taking 250 l of tris HCl buffer followed by the addition of 50 l of 600 mM NaCl, 50 l of 50 mM KCL, along with 50 l of 1 mM Na. EDTA, and 50 l of 80 mM ATP. The reaction mixture was pre-incubated at 37 C. for 10 mins. Then 25 l of 10% homogenate was added to the test alone and further incubated at 37 C. for 1 hr. The reaction was immediately arrested by the addition of 10% TCA. The control reaction rate was correspondingly assessed by adding 25 l of 10% homogenate only after arresting the reaction. The precipitate was removed by centrifugation at 3500 rpm for 10 minutes. To 50 l of the supernatant, 1075 l of distilled water, 125 l of Ammonium molybdate and 50 l of ANSA were added and incubated for 10 mins at 37 C. The intensity of blue colour was read at 640 nm using spectrophotometer against a blank that contained all the reagents minus the supernatant. The results are expressed in g of Pi liberated/min/mg of protein.
[0101] Effect of Test drug on membrane bound enzymes: Na.sup.+K.sup.+ATPase:
[0102] Na.sup.+ K.sup.+ ATPase, a membrane bound enzyme is responsible for sodium ion influx and potassium ion reflex during muscle contraction and relaxation. Induction of myocardial infarction with ISP inhibited the influx of sodium ions thereby hindering the contraction and relaxation of the heart muscle. Pretreatment with Test drug was comparable with the reference drug, carvedilol in enhancing the Na.sup.+K.sup.+ATPase activity
EXAMPLE 3(c)
Mg2+ ATPase
[0103] Reagents:
[0104] 1. Tris HCl (0.1M) pH-7.4: 1.576 g in 100 ml of distilled water
[0105] 2. KCl (0.1M): 74.55 mg in 10 ml of distilled water
[0106] 3. MgCl2 (0.1M): 200 mg in 10 ml of distilled water
[0107] 4. ATP (80 mM): 440 mg in 10 ml of distilled water
[0108] 5. 10% TCA: 10 g in 100 ml of distilled water
[0109] 6. 15% sodium meta bisulphate: 7.5 g in 50 ml of distilled water
[0110] 7. 20% sodium sulphate: 2 g in 10 ml of distilled water
[0111] 8. 5N H2SO4: 13.5 ml of H2SO4 in 100 ml of distilled water
[0112] 9. Ammonium molybdate (2.5%): 2.5 g in 100 ml of 5N Sulphuric acid.
[0113] 10. ANSA (0.1%): 100 mg in 39 ml of 15% sodium meta bisulphate. Then 1 ml of 20% sodium sulphite was added and the volume was made up to 100 ml with distilled water.
[0114] Protocol: Total ATPase was assayed by taking 0.75 ml of tris HCL buffer followed by the addition of 50 l of 100 mM KCl, along with 50 l of 100 mM MgCl.sub.2, and 50 l of 80 mM ATP. The reaction mixture was pre-incubated at 37 C. for 2 mins. Then 50 l of 10% homogenate was added to the test alone and further incubated at 37 C. for 20 mins. The reaction was immediately arrested by the addition of 500 l of 10% TCA. Control reaction rate was correspondingly assessed by adding 50 l of 10% homogenate only after arresting the reaction. The precipitate was removed by centrifugation at 3500 rpm for 10 minutes. To 50 l of the supernatant, 1075 l of distilled water, 125 l of Ammonium molybdate and 50 l of ANSA were added and incubated for 10 mins at 37 C. The intensity of blue colour was read at 640 nm using spectrophotometer against a blank that contained all the reagents minus the supernatant. The results are expressed in g of Pi liberated/min/mg of protein.
[0115] Effect of Test drug on membrane bound enzymes: Mg.sup.2+ ATPase:
EXAMPLE 3(d)
Ca2+ATPase
[0116] Reagents:
[0117] 1. Tris HCl (0.1M) pH-7.4: 1.576 g in 100 ml of distilled water
[0118] 2. KCl (0.1M): 74.55 mg in 10 ml of distilled water
[0119] 3. CaCl2 (0.1M): 147.02 mg in 10 ml of distilled water
[0120] 4. ATP (80 mM): 440 mg in 10 ml of distilled water
[0121] 5. 10% TCA: 10 g in 100 ml of distilled water
[0122] 6. 15% sodium meta bisulphate: 7.5 g in 50 ml of distilled water
[0123] 7. 20% sodium sulphate: 2 g in 10 ml of distilled water
[0124] 8. 5N H2SO4: 13.5 ml of H2SO4 in 100 ml of distilled water.
[0125] 9. Ammonium molybdate (2.5%): 2.5 g in 100 ml of 5N Sulphuric acid.
[0126] 10. ANSA (0.1%): 100 mg in 39 ml of 15% sodium meta bisulphate. Then 1 ml of 20% sodium sulphite was added and the volume was made up to 100 ml with distilled water.
[0127] Protocol: Ca.sup.2+ ATPase was assayed by taking 0.75 ml of tris HCL buffer followed by the addition of 50 l of 100 mM KCl, 50 l of 100 mM CaCl.sub.2 and 50 l of 80 mM ATP. The reaction mixture was pre-incubated at 37 C. for 2 mins. Then 50 l of 10% homogenate was added to the test alone and further incubated at 37 C. for 20 mins. The reaction was immediately arrested by the addition of 500 l of 10% TCA. Control reaction rate was correspondingly assessed by adding 50 l of 10% homogenate only after arresting the reaction. The precipitate was removed by centrifugation at 3500 rpm for 10 minutes. To 50 l of the supernatant, 1075 l of distilled water, 125 l of Ammonium molybdate and 50 l of ANSA were added and incubated for 10 mins at 37 C. The intensity of blue colour was read at 640 nm using spectrophotometer against a blank that contained all the reagents minus the supernatant. The results are expressed in g of Pi liberated/min/mg of protein.
[0128] Effect of Test drug on Ca2+ATPase:
[0129] Intracellular calcium (Ca.sup.2+) levels are maintained and regulated by Ca.sup.2+ ATPase. Enhanced Ca.sup.2+ ATPase and intracellular Ca.sup.2+ overload in ISP-treated rats can be correlated to the action of adenylate cyclase. Phosphorylation of Ca.sup.2+ channel protein by cAMP is expected to increase the Ca.sup.2+ influx into the myocardium and thus burdening it. In our study, pre-supplementation with Test drug showed potent resistance to the perturbations in Ca.sup.2+ ATPase caused due to ISP injection.
Oxidative Stress-Anti-Oxidant Potential of Test Drug on ISP Induced Myocardial Infarction
EXAMPLE 3(e)
Lipid Hydroperoxide (LPO)
[0130] Reagents: [0131] 1. ThioBarbituric Acid (TBA) (0.8%): 0.8 gms in 0.5N HCl [0132] 2. Butylated Hydroxyl Toluene (0.05%): 0.05 gms in methanol. [0133] 3. Saline (0.9%): 0.9 g in 100 ml distilled water
[0134] Protocol: The method involved heating of 0.5 ml of heart homogenate of experimental rats with 0.8 ml saline, 0.5 ml of BHT and 3.5 ml TBA reagent for 11/2 min in a boiling water bath. After cooling, the solution was centrifuged at 2,000 rpm for 10 min and the precipitate obtained was removed. The absorbance of the supernatant was determined at 532 nm using spectrophotometer against a blank that contained all the reagents minus the biological sample. The values were expressed in mg/g tissue (Okhawa H et al., 1979).
[0135] Lipid peroxidation (Thiobarbituric acid reactive substances):
[0136] ISP treatment is known to produce free radical moieties via its quinine metabolites that react with oxygen ultimately resulting in enhanced generation of Reactive oxygen species (ROS). ROS, the highly toxic by-products of aerobic metabolism are known to react extensively with cell membranes and macromolecules enhancing formation of lipid peroxides thus leading to tissue damage. Lipid peroxidation is an important pathogenic event in myocardial necrosis and accumulation of lipid hydroperoxides reflects damage of the cardiac constituents. The increased levels of MDA, a lipid peroxidation end-product, observed in our study following isoproterenol administration might be due to free radical mediated membrane damage. Our findings suggest that TEST DRUG possess lipid peroxidation inhibitory activity.
EXAMPLE 3(f)
Superoxide Dismutase (SOD)
[0137] Reagents: [0138] 1. Sodium pyrophosphate buffer (0.025M): 1.115 g in 100 ml of distilled water. [0139] 2. Phenazonium Metho Sulphate (PMS) (186 M): 3 mg in 10 ml of distilled water (930 M). Then 1:5 dilutions were carried out to obtain 186 M. [0140] 3. Nitro Blue Tetrazolium (chloride) (NBT) (300 M): 3 mg in 10 ml of phosphate buffer. [0141] 4. NADH (780 M): 6 mg in 10 ml of phosphate buffer.
[0142] Protocol: Superoxide dismutase was assayed by taking 0.05 ml of heart homogenate followed by addition of 0.3 ml of sodium pyrophosphate buffer (0.025M, PH 8.3), 0.025 ml of PMS (186 M) and 0.075 ml of NBT (300 M in buffer of PH 8.3) The reaction was started by addition of 0.075 ml of NADH (780 M in buffer of PH 8.3). After incubation at 300 C for 90 seconds, the reaction was stopped by addition of 0.25 ml glacial acetic acid. Then the reaction mixture was stirred vigorously and shaken with 2.0 ml of n-Butanol. The mixture was allowed to stand for 10 minutes and centrifuged. 1.5 ml of n-butanol alone was served as blank. The colour intensity of the chromogen was read at 560 nm (Kakkar, P., et al 1984).
[0143] Superoxide dismutase activity:
[0144] Superoxide anions and other reactive oxygen species produce an oxidative environment commonly called as oxidative stress in rat myocardium. Among the free radical scavenging antioxidants SOD was considered to be the cellular defense against oxidative injury. The results envisaged that the decreased levels of SOD following ISP administration were ameliorated to a greater extend by pre-treatment with Test drug.
EXAMPLE 3(g)
GSH and Glutathione Peroxidase Activity
[0145] Glutathione peroxidase [GPX]
[0146] Reagents: [0147] 1. Sodium Azide (10 mM): 16 mg in 25 ml of distilled water [0148] 2. GSH (2 mM): 30.732 mg in 50 ml of distilled water. [0149] 3. H2O2 (1 mM): 29 l in 1000 ml of distilled water [0150] 4. 10% TCA: 10 g in 100 ml of distilled water [0151] 5. K.EDTA (0.4 mM): 16 mg in 100 ml of distilled water [0152] 6. Tris HCL Buffer (0.4 mM): 6.304 g in 100 ml of distilled water [0153] 7. DTNB (0.6 mM): 12 mg in 50 ml PO4 buffer.
[0154] Protocol: Glutathione peroxidase (GPX) was assayed by taking 200 l of tris HCL buffer (0.4 M), 0.4 mM K.EDTA along with 100 l of sodium azide and 200 l of enzyme preparation (hemolysate) and mixed well. Thereafter, 200 l of reduced glutathione solution (2 mM) followed by 0.1 ml H2O2 were added The overall reaction was arrested by adding 0.5 ml of 10% TCA. The precipitate was removed by centrifugation at 4000 rpm for 10 minutes. The absorbance was read at 412 nm using spectrophotometer. The non-enzymatic reaction rate was correspondingly assessed by replacing the enzyme sample by buffer. The results are expressed as mg of GSH consumed/min/mg protein (Rotruck, J et al., 1973).
Reduced Glutathione [GSH]
[0155] Reagents: [0156] 1. 5% TCA: 5 g in 100 ml of distilled water. [0157] 2. Phosphate buffer (pH: 8) 0.2M [0158] 3. DTNB (0.6 mM): 12 mg in 50 ml PO4 buffer.
[0159] Protocol: Glutathione content was estimated according to the method (Moren et al 1979). 0.25 ml of serum was added to equal volume of ice cold 5% TCA. The precipitate was removed by centrifugation at 4000 rpm for 10 minutes. To 1 ml aliquot of supernatant, 0.25 ml of 0.2M phosphate buffer, pH 8.0 and 0.5 ml of DTNB (0.6 mM in 0.2M phosphate buffer, pH 8.0) was added and mixed well. The absorbance was read at 412 nm using spectrophotometer. The values were expressed in mg/g tissue.
[0160] GSH and Glutathione peroxidase activity:
EXAMPLE 3(i)
Total Protein by Biuret Method
[0161] Reagents: [0162] 1. 0.2N sodium hydroxide [0163] 2. 0.5% copper sulphate (CuSO4.5H2O) in 1% potassium sodium tartrate. [0164] 3. Stock Biuret solution: Dissolve 4.5 g of sodium potassium tartarate in 40 ml of 0.2N NaOH. Then add 1.5 g of CuSO4 until completely dissolved. Finally add 500 mg of KI and make up the volume to 100 ml with 0.2N NaoH. [0165] 4. Working Biuret solution: From stock biuret solution 1:5 dilution. [0166] 5. Stock Protein solution: Weigh accurately 50 mg of bovine serum albumin (fraction V) and dissolve in distilled water and make up to 50 ml in standard flask. [0167] 6. Working standard: Dilute 10 ml of the stock solution to 50 ml with distilled water in a standard flask. One ml of this solution contains 200 g protein.
[0168] Protocol: Estimation of protein was assayed by taking 0.2 ml of saline, 10% homogenate, followed by the addition of 1.25 ml of working biuret reagent. It was incubated at room temperature for 15 minutes. The color intensity was read at 540 nm.
[0169] Isoproterenol (ISP) injected rats (positive control) showed a significant decrease (P<0.001) in total protein levels as compared to control rats. Administration of test drug to ISP injected rats (Low dose) showed a significant (P<0.05) increase in the total protein level and highly significant increase in protein level (almost to normal level) is observed in both test drug group with high dose and standards (Carvedilol-2 mg/kg)
[0170] A decrease in the level of serum total proteins in Isoproterenol injected rats could be due to increased free radical production by Isoproterenol. Administration of test drug showed dose dependent improvement in serum protein levels as compared to ISP injected rats. This improvement is comparable to that of standard. Table 5 illustrates the effect of test drug on Total protein.
TABLE-US-00005 TABLE 5 Anti-Apoptosis (Gene expression) Example 3(j): Reverse transcriptase (RT) Total protein Group Treatment (mg/dl) I Normal Control 7.34 0.37 II Positive Control 3.58 0.65 III Standard (Carvedilol- 2 mg/kg) 7.24 0.32 IV Low dose (50 mg/kg) 6.89 0.36 V High dose (100 mg/kg) 7.31 0.42
[0171] PCR was performed to determine the level of mRNA expression of Caspase, Bax, BCl2 and p53. Briefly, total RNA was extracted from left ventricle (Heart) using TRIzol Reagent (Sigma, USA). After homogenization, the tubes were incubated for 10 minutes and centrifuged at 1000 rpm for 5 min. 200 l of chloroform was added to the supernatant, allowed to incubate for 5 min at room temperature and centrifuged at 12000 rcf for 20 min. Then 500 l of isopropyl alcohol was added to the supernatant to precipitate the total RNA and centrifuged at 12000 rcf for 15 min following the incubation period of 10 min. The supernatant was decanted carefully; the pellet was washed three times with 75% ethanol, centrifuged at 12000 rcf for 15 min and the pellet was allowed to air dry. The pellet was resuspended in 20 l of RNase free water and stored in 80 C. until use. The isolated RNA was allowed to undergo reverse transcription and polymerization reaction to get cDNA using PCR master cycler gradient. The formed cDNA was loaded in agarose gel, allowed to run the electrophoresis at 80V for 30 min and the gene expression was analyzed using the bands formed. 200 nanograms of RNA were used for reverse transcription polymerase chain reaction (RT-PCR) according to the manufacturer's instructions (Genet Bio, Korea). The following sequence was performed for each PCR reaction: 42.0 for 30 s, 94.0 for 5 min (1 cycle); 94 C. for 1 min, Caspase (56.0), Bax (58.8), Bcl2 (56.7) and p53 (57.9) for 1 min, and 72 C. for 1 min (with 35 cycles); and a final extension phase at 74 C. for 10 min.
[0172] The primer sequences (5-3) used for the proteins Bax, Bcl2, Caspase 3 and P53 are as follows,
TABLE-US-00006 Bax- (Forwardprimer)- SEQIDNO:1 GAGTGTCTCCGGCGAATTG (Reverseprimer)- SEQIDNO:2 TGGTGAGCGAGGCGGTGAC Bcl2- (Forwardprimer)- SEQIDNO:3 CGGGAGATCGTGATGAAGT (Reverseprimer)- SEQIDNO:4 CCACCGAACTCAAAGAAGG Caspase3- (Forwardprimer)- SEQIDNO:5 CTGGACTGCGGTATTGAG (Reverseprimer)- SEQIDNO:6 GGGTGCGGTAGAGTAAG P53- (Forwardprimer)- SEQIDNO:7 GGATGCCCGTGCTGCCGAGGAG (Reverseprimer)- SEQIDNO:8 AGTGAAGGGACTAGCATTGTC
Data analysis
[0173] Statistical analysis was performed using GraphPad Prism, 4.03 (San Diego, US). Data were expressed as mean SEM. Mean difference was analyzed by one way ANOVA with Tukey's multiple comparison as the post hoc test. Probability value less than 0.05 was fixed as the statistical significance criterion.
[0174] Effect of Test drug on apoptotic markers:
[0175] Clinical observations: No mortality was observed between the groups. The rats that were induced with isoproterenol showed increased heart rates and heart palpitation. Rigidity of the muscles was observed in the animals and there was decreased movement and activity in the animals. Exophthalmus, the protrusion of the eye balls, was very evident after the induction of isoproterenol. They exhibited increased respiration rate. Further, the symptoms of myocardial infarction were clearly visible in the ISP injected animals and the offset of these clinical signs prolonged in positive control.
[0176] Effect of Test Drug on body weight: Table 6 depicts the body weight of animals for three weeks. No significant body weight changes were observed between the experimental groups on day 0, 7 and 14, whereas there was significant alteration in body weight on day 21.
TABLE-US-00007 TABLE 6 Body weight of animals for three weeks. Body weight (g) Group Treatment 0.sup.th day 7.sup.th day 14.sup.th day 21.sup.st day I Normal Control 201.29 2.00 215.86 2.50 223.43 1.62 226.14 3.19 II Positive Control 206.86 1.11 202.00 1.19 202.71 3.48 192.29 1.44.sup.## III Standard 211.00 1.70 210.57 3.22 218.43 4.37 216.43 1.58** (Carvedilol- 2 mg/kg) IV Low dose 204.71 6.04 207.57 5.84 216.14 2.97 203.29 0.14** (50 mg/kg) V High dose 202.00 4.99 203.71 4.37 207.14 1.47 200.71 0.39* (100 mg/kg) Values were expressed in Mean SEM (n = 6); .sup.#, .sup.##denotes P < 0.05 and 0.01 respectively (Comparison between Normal and Positive control); *, **denotes P < 0.05 and 0.01 respectively (Comparison between Positive control and other treatment groups).
[0177] Effect of Test Drug on organ weight: Table 7 depicts the organ weight of various groups. No significant difference in kidney and adrenals weight was observed between the treatment groups. The ISP induced MI rats showed increase in heart weight (24%) when compared to normal rats, whereas treatment with TEST DRUG altered the changes.
TABLE-US-00008 TABLE 7 Organ weight of various groups Organ weight (g) Group Treatment Kidney Adrenals Heart I Normal Control 0.85 0.02 0.02 0.01 0.41 0.02 II Positive Control 0.77 0.06 0.02 0.00 0.51 0.02 (24%) III Standard (Carvedilol- 2 mg/kg) 0.68 0.10 0.02 0.00 0.44 0.07 (13.1%) IV Low dose (50 mg/kg) 0.79 0.02 0.02 0.00 0.51 0.02 (0.2%) V High dose (100 mg/kg) 0.69 0.09 0.02 0.00 0.45 0.06 (12.3%) Values were expressed in Mean SEM (n = 6); Normal control was compared with positive and Positive control compared with other treatment groups.
EXAMPLE 4
Clinical Study
[0178] 150 hypertensive patients comprising 86 men and 74 women who were already on anti-hypertensives were advised to take Test drug along with their existing allopathic medicines. They were studied for a period of six weeks.
[0179] Dose: Two tablets (500 mg02) were administered twice daily swallowed with water after food.
Results and Observation
[0180] Table 8 depicts Mean B.P before and after 3 and 6 weeks of Test drug administration (n=150).
TABLE-US-00009 TABLE 8 Mean systolic B.P Mean diastolic B.P Duration Week 0 Week 3 Week 6 Week 0 Week 3 Week 6 MEAN 167.12 131.2 125.12 104.76 84.16 81 S.D. 19.61 15.6 11.62 9.5 6.99 5.05 S.E.M 0.71 2.77 1.64 11.34 0.98 0.71
[0181]
[0182] After using the test drug, the resting pulse rates and blood pressure, both systolic and diastolic showed a significant reduction. In addition to helping in lowering of blood pressure and reduction of dosage of allopathic drugs there was also a feeling of general well-being. After the treatment with test drug for 6 months, there was an effective reduction in the dosages of the other anti-hypertensive drug in many cases.
[0183] Note: In a case of mitral valve prolapse with mild mitral regurgitation, when the test product was administered for 8 months follow up 2D Echocardiography confirmed that mitral valve prolapse is completely resolved and no mitral regurgitation was observed. Patient became asymptomatic, cardiac chambers and output were within normal limits.
[0184] The aforementioned studies proved that test product is free from toxicity. Preclinical study shows that test product exerts its Cardioprotective action through anti-apoptotic pathway in Isoproterenol induced experimental model of myocardial infarction. Clinical study supports antihypertensive, cardioprotective and valve correcting actions of the Test drug.
[0185] The foregoing description of the specific embodiments will so fully reveal the general nature of the embodiments herein that others can, by applying current knowledge, readily modify and/or adapt for various applications such specific embodiments without departing from the generic concept, and, therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments. It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation. Therefore, while the embodiments herein have been described in terms of preferred embodiments, those skilled in the art will recognize that the embodiments herein can be practiced with modification within the spirit and scope of the embodiments as described herein.