Microorganism capable of simultaneous co-fermentation of mixed sugars and production method of butanol using the same
10266854 ยท 2019-04-23
Assignee
Inventors
Cpc classification
Y02E50/10
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N9/0008
CHEMISTRY; METALLURGY
C12Y208/03009
CHEMISTRY; METALLURGY
International classification
Abstract
Embodiments of the invention provide a microorganism capable of simultaneous co-fermentation of two or more sugars in a lignocellulosic hydrolysate and having tolerance against microorganism growth inhibitory substances in the lignocellulosic hydrolysate and further having butanol productivity. In addition, embodiments of the invention provide a recombinant microorganism in which a pathway converting butyryl-CoA into butanol or a pathway converting butyrate into butyryl-CoA is promoted, and butanol productivity is increased. Further, a method for producing butanol using the microorganisms is provided.
Claims
1. A microorganism capable of simultaneous co-fermentation of two or more sugars in a lignocellulosic hydrolysate and having the ability to produce butanol, wherein the microorganism is Clostridium acetobutylicum TM2-1-C(accession number KCTC 12604BP).
2. The microorganism according to claim 1, wherein the microorganism has tolerance against the lignocellulosic hydrolysate.
3. The microorganism according to claim 1, wherein the microorganism has the ability of simultaneous co-fermentation of glucose and xylose.
4. The microorganism according to claim 1, wherein, when the microorganism is grown under batch conditions in the presence of glucose and xylose, 30% or more of the metabolized sugar is xylose and butanol productivity is 1.0 g/L/h or more.
5. A recombinant microorganism having improved butanol productivity in comparison to Clostridium acetobutylicum TM2-1-C, wherein the recombinant microorganism is prepared from the Clostridium acetobutylicum TM2-1-C by promoting a pathway converting butyryl-CoA into butanol or a pathway converting butyrate into butyryl-CoA, the pathway converting butyryl-CoA into butanol is promoted by increasing aldehyde/alcohol dehydrogenase activity in comparison to Clostridium acetobutylicum TM2-1-C by introduction of an adhE gene encoding an aldehyde/alcohol dehydrogenase, and the pathway converting butyrate into butyryl-CoA is promoted by increasing CoA transferase activity in comparison to Clostridium acetobutylicum TM2-1-C by introduction of a ctfAB gene encoding a CoA transferase.
6. The recombinant microorganism according to claim 5, wherein the recombinant microorganism has the ability of simultaneous co-fermentation of two or more sugars in a lignocellulosic hydrolysate.
7. The recombinant microorganism according to claim 5, wherein the recombinant microorganism has the ability of simultaneous co-fermentation of glucose and at least one sugar selected from the group consisting of xylose, arabinose and cellobiose.
8. The recombinant microorganism according to claim 5, wherein butanol selectivity is 70% or more when the recombinant microorganism is grown under fed-batch conditions.
9. The recombinant microorganism according to claim 5, wherein acetone selectivity is less than 20% when the recombinant microorganism is grown under fed-batch conditions.
10. The recombinant microorganism according to claim 5, wherein ethanol selectivity is less than 20% when the recombinant microorganism is grown under fed-batch conditions.
11. The recombinant microorganism according to claim 5, wherein butanol productivity is 0.5 g/L/h or more when the recombinant microorganism is grown under fed-batch conditions.
12. A method for producing butanol, comprising: preparing a medium comprising two or more sugars; inoculating the medium with the microorganism according to claim 1; and culturing the microorganism.
13. A method for producing butanol, comprising: preparing a medium including two or more sugars; inoculating the medium with the recombinant microorganism according to claim 5; and culturing the recombinant microorganism.
14. The method according to claim 13, wherein the two or more sugars comprise glucose and at least one sugar selected from the group consisting of xylose, arabinose and cellobiose.
15. The method according to claim 13, wherein the medium comprises a lignocellulosic hydrolysate.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The above and other aspects, features, and advantages of the present invention will become apparent from the detailed description of the following embodiments in conjunction with the accompanying drawings, in which:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
DETAILED DESCRIPTION
(11) The present invention relates to a microorganism capable of simultaneous co-fermentation of two or more sugars in a lignocellulosic hydrolysate hydrolysate and having butanol productivity.
(12) In addition, the present invention relates to a method for producing butanol, including: preparing a medium including two or more sugars; inoculating the medium with a microorganism; and culturing the microorganism.
(13) Further, the present invention relates to a recombinant microorganism capable of simultaneous co-fermentation of two or more sugars in a lignocellulosic hydrolysate and having butanol productivity, wherein a pathway converting butyryl-CoA into butanol or a pathway converting butyrate into butyryl-CoA is promoted, and butanol productivity is increased.
(14) Furthermore, the present invention relates to a method for producing butanol, including: preparing a medium including two or more sugars; inoculating the medium with a recombinant microorganism according to the present invention; and culturing the recombinant microorganism.
(15) Hereinafter, the present invention will be described in detail.
(16) Microorganism Capable of Simultaneous Co-Fermentation of Two or More Sugars in Hydrolysate of a Lignocellulosic Biomass and Having Butanol Productivity.
(17) The present invention relates to a microorganism capable of simultaneous co-fermentation of two or more sugars in a lignocellulosic hydrolysates and having butanol productivity. The microorganism has tolerance against a lignocellulosic hydrolysate, more preferably tolerance against microorganism growth inhibitory substances in a lignocellulosic hydrolysate. Further, the microorganism is capable of simultaneous co-fermentation of glucose and xylose.
(18) The microorganism is preferably Clostridium acetobutylicum, more preferably mutant Clostridium acetobutylicum, still more preferably mutant Clostridium acetobutylicum ATCC824 pta buk. Clostridium acetobutylicum ATCC824 pta buk is a recombinant microorganism in which a pta gene expressing phosphotransacetylase and a buk gene expressing butyrate kinase in Clostridium acetobutylicum ATCC824 are deleted at the same time.
(19) Preferably, the microorganism is Clostridium acetobutylicum TM2-1-C (accession number KCTC 12604BP).
(20) Lignocellulosic Hydrolysate
(21) The microorganism according to the present invention has tolerance against a lignocellulosic hydrolysate and is capable of simultaneous co-fermentation of two or more sugars in the lignocellulosic hydrolysate. The lignocellulosic hydrolysate is hydrolysates obtained by hydrolyzing lignocellulosic raw materials (for example, wood, EFB (empty fruit bunch), corn stalks, sugarcane stalks, rice straw, and the like), preferably hydrolysates obtained by hydrolyzing lignocellulosic materials and removing lignin. The lignocellulosic hydrolysate contains mixed sugars comprised of two or more sugars. Preferably, the hydrolysate contains pentoses, hexoses and disaccharides such as glucose, xylose, mannose, galactose, arabinose, cellobiose, and the like, and particularly has high content of glucose and xylose.
(22) Tolerance Against a Lignocellulosic Hydrolysate
(23) The microorganism according to the present invention has tolerance against the lignocellulosic hydrolysate. Tolerance against the lignocellulosic hydrolysate means that the microorganism is able to grow in a medium including the hydrolysate, and growth inhibition of the microorganism due to a substance in the does not occur.
(24) Simultaneous Co-Fermentation Capability
(25) The microorganism according to the present invention is capable of simultaneous co-fermentation of two or more sugars in a lignocellulosic hydrolysate. The term capable of simultaneous co-fermentation means that fermentation of one sugar is not preferred to fermentation of other sugars. Since the microorganism according to the present invention is capable of simultaneous co-fermentation of two or more sugars, a phenomenon that metabolism of one sugar is suppressed by metabolism of the other sugar is prevented between the sugars to be simultaneously co-fermented.
(26) Recombinant Microorganism
(27) The present invention relates to a recombinant microorganism capable of simultaneous co-fermentation of two or more sugars in the lignocellulosic hydrolysate and having butanol productivity, wherein a pathway converting butyryl-CoA into butanol or a pathway converting butyrate into butyryl-CoA is promoted, and butanol productivity is increased.
(28) The recombinant microorganism may have an increased CoA transferase activity, which leads to an accelerated pathway converting butyrate into butyryl-CoA or an increased aldehyde/alcohol dehydrogenase activity converting butyryl-CoA into butanol. The recombinant microorganism is capable of simultaneous co-fermentation of two or more sugars in the lignocellulosic hydrolysate, through which produces ABE (acetone, butanol, and ethanol) with particularly high productivity and selectivity of butanol.
(29) Acceleration of Pathway Converting Butyryl-CoA into Butanol
(30) Butyryl-CoA may be converted into butanol via butanal in butanol production pathway. The pathway may be accelerated by promoting the step of converting butyryl-CoA into butanal or the step of converting butanal into butanol. Each step may be accelerated by utilizing a known method such as increasing enzyme activity.
(31) For example, aldehyde/alcohol dehydrogenase regulates conversion of butyryl-CoA into butanal and conversion of butanal into butanol. The pathway converting butyryl-CoA into butanol may be accelerated by increasing aldehyde/alcohol dehydrogenase activity. The increase of aldehyde/alcohol dehydrogenase activity may be performed by increasing expression and enzyme activity of aldehyde/alcohol dehydrogenase, and the like. For example, a person skilled in the art may increase aldehyde/alcohol dehydrogenase activity by selecting an appropriate method such as introduction, amplification, rearrangement of adhE gene encoding aldehyde/alcohol dehydrogenase, or regulation of gene expression in the course of transcription or translation, and the like.
(32) Acceleration of Pathway Converting Butyrate into Butyryl-CoA
(33) CoA transferase regulates conversion of butyrate into butyryl-CoA in butanol production pathway. The pathway converting butyrate into butyryl-CoA may be accelerated by increasing the activity of CoA transferase. Increase in activity of CoA transferase may be performed by increasing expression and enzyme activity of CoA transferase, and the like. For example, a person having ordinary knowledge in the art can increase CoA transferase activity by selecting an appropriate method such as introduction, amplification, rearrangement of cftA or ctfB (hereinafter referred to as ctfAB) gene encoding CoA transferase, or regulation of gene expression in the course of transcription or translation, and the like.
(34) Simultaneous Co-Fermentation of Recombinant Microorganism
(35) The recombinant microorganism according to the present invention is capable of simultaneous co-fermentation of two or more sugars in a lignocellulosic hydrolysate. Preferably, the recombinant microorganism according to the present invention is capable of simultaneous co-fermentation of glucose and at least one sugar selected from the group consisting of xylose, arabinose and cellobiose. More preferably, the recombinant microorganism according to the present invention is capable of simultaneous co-fermentation of xylose at a ratio of 90% or more, preferably 95% or more. Still more preferably, the recombinant microorganism according to the present invention is capable of simultaneous co-fermentation of arabinose at a ratio of 90% or more, preferably 95% or more, still more preferably 98% or more. More preferably, the recombinant microorganism according to the present invention is capable of simultaneous co-fermentation of cellobiose at a ratio of 85% or more, preferably 90% or more, still more preferably 92% or more. The ratio of simultaneous co-fermentation refers to a value obtained by dividing a difference between the amount of sugars in the hydrolysate provided to a medium and the amount of sugars remaining after continuous fermentation.
Ratio of simultaneous co-fermentation (%)={(Total sugars introduced (g)amount of sugars remaining after fermentation (g))/Total sugars introduced (g)}100
(36) Ex) Ratio of simultaneous co-fermentation of xylose (%)
Ratio of simultaneous co-fermentation of xylose={(Total xylose introduced (g)amount of sugars remaining after fermentation (g))/(Total xylose introduced (g))}100
(37) Butanol Productivity of Recombinant Microorganism
(38) The recombinant microorganism according to the present invention ferments two or more sugars in a lignocellulosic hydrolysate, thereby producing ABE with particularly high butanol productivity.
(39) The recombinant microorganism according to the present invention exhibits butanol selectivity of 70% or more, preferably 75% or more, based on fed-batch cultivation. Further, the recombinant microorganism according to the present invention exhibits acetone selectivity less than 20%, preferably less than 15%, more preferably less than 13%, based on fed-batch cultivation. In addition, the recombinant microorganism according to the present invention exhibits ethanol selectivity less than 20%, preferably less than 15%, more preferably less than 13%, based on fed-batch cultivation.
(40) The recombinant microorganism according to the present invention exhibits butanol productivity of 0.5 g/L/h or more, or 0.8 g/L/h or more, or 1.0 g/L/h or more, or 1.5 g/L/h or more, or 1.8 g/L/h or more, or 2.0 g/L/h or more, based on exponential phase of strains in fed-batch cultivation.
(41) Method for Producing Butanol Using Recombinant Microorganism
(42) The present invention relates to a method for producing butanol by simultaneous co-fermentation of two or more sugars in a lignocellulosic hydrolysate using the recombinant microorganism according to the present invention. Further, the present invention relates to a method for producing butanol including: preparing a medium including two or more sugars; inoculating the medium with a recombinant microorganism according to the present invention; and culturing the recombinant microorganism. The two or more sugars include glucose and at least one sugars selected from the group consisting of xylose, arabinose and cellobiose. The medium preferably includes a lignocellulosic hydrolysate.
(43) The above and other aspects, features, and advantages of the present invention will become apparent from the detailed description of the following embodiments in conjunction with the accompanying drawings. However, it should be underleft that the present invention is not limited to the following embodiments and may be embodied in different ways, and that the embodiments are provided for complete disclosure and thorough understanding of the invention by those skilled in the art. The scope of the invention should be defined only by the accompanying claims and equivalents thereof.
(44) Materials and Methods
(45) Wild-type strain Clostridium acetobutylicum ATCC824 was purchased from the American Type Culture Collection (ATCC).
(46) A gene deleted strain Clostridium acetobutylicum ATCC824 pta buk (hereinafter referred to as ABKO) was prepared using Clostridium acetobutylicum ATCC824 in accordance with the method disclosed in WO2011/037415. The mutant ABKO is a strain having butanol productivity.
(47) Methyl-N-Nitro-N-nitrosoguanidine (MNTG) to be used as a mutagen to cause random genetic mutation of genes was purchased from TCI (Tokyo Chemical Industry, Japan).
(48) On evaluating biobutanol productivity of C. acetobutylicum strain, selectivity for specific product (proportion of a specific product in the produced mixed products (ABE: acetone, butanol, ethanol)), butanol productivity and yield were calculated as below:
Butanol selectivity (%): (Produced amount of butanol (g)/produced amount of ABE (g))100
Ethanol selectivity (%): (Produced amount of ethanol (g)/produced amount of ABE (g))100
Acetone selectivity (%): (Produced amount of acetone (g)/produced amount of ABE (g))100
Butanol productivity (g/L/h): Amount of butanol produced per hour per unit volume
(49) (Butanol productivity in batch culture and fed-batch culture method is based on exponential phase of solvent production. In continuous culture, butanol productivity is based on cumulative amount of ABE produced in total phase.)
Yield (%): (Produced amount of ABE (g)/carbon source (g))100
ABE productivity (g/L/h): Amount of ABE produced per hour per unit volume
(50) The hydrolysates used in Experimental Examples were prepared by the following method.
(51) To a reactor containing 70% sulfuric acid, chopped waste wood was added and reacted at about 100 C. for 30 minutes while stirring, thereby performing pretreatment. To the pretreated slurry, a suitable amount of water was added to perform hydrolysis. In the hydrolyzed solution, various sugars including glucose, xylose, and the like derived from cellulose and hemicellulose are present in the form of mixtures (hereinafter, the mixture of sugars is referred to as mixed sugars). The hydrolyzed solution was pressed using a filter press at a pressure of about 3 bar such that mixed sugars could be contained in the filtrate while lignin could be separated as solid inside the filter. After removing lignin from the hydrolyzed solution, sulfuric acid was separated from the remaining solution (containing mixed sugars) using an anion exchange resin, thereby obtaining a hydrolysate having a concentration of about 100 g/L of the mixed sugars. The produced hydrolysate was concentrated again until the concentration of the mixed sugars reached about 200 g/L, and was utilized as a feeding solution for continuous cultivation.
(52) <1-1> Random Mutagenesis
(53) ABKO strains were cultivated in 60 ml of liquid CGM (Clostridium Growth Medium) (0.75 g/L K.sub.2HPO.sub.4, 0.75 g/L KH.sub.2PO.sub.4, 0.7 g/L, MgSO.sub.4.7H.sub.2O, 0.017 g/L MnSO.sub.4.5H.sub.2O, 0.01 g/L, FeSO.sub.4.7H.sub.2O, 2 g/L (NH.sub.4).sub.2SO.sub.2, 1 g/L NaCl, 2 g/L asparagine, 0.004 g/L p-aminobenzoic acid, 5 g/L yeast extract, 4.08 g/L CH.sub.3COONa.3H.sub.2O, and 80 g/L glucose) at 37 C. under anaerobic conditions until absorbance at 600 nm reached 0.5 (i.e., OD600=0.5). The culture solution was centrifuged at 7000 g for 10 minutes at 4 C. The cell pellets were washed with liquid CGM three times, and then re-suspended in 50 ml of liquid CGM. Methyl-N-Nitro-N-nitrosoguanidine (MNTG) was treated to have a final concentration of 50 g/ml, and then left at 37 C. for 20 minutes to prepare libraries of mutants with a survival ratio of about 2.5%.
(54) <1-2> Selection of Strains Having Tolerance Against the Lignocellulosic Hydrolysate
(55) Strains prepared in the above <1-1> by random mutation were diluted. The diluted strains were streaked on 2000 solid CGMs (namely, 2000) prepared by replacing glucose with the lignocellulosic hydrolysate to form about 100 colonies. The random mutant strains formed on the streaked solid media were cultivated under the same conditions as in <1-1> for about 2 days, and 20 colonies that survived with tolerance were selected.
(56) <1-3> Evaluation of Butanol Productivity of Strains Having Tolerance Against the Lignocellulosic Hydrolysate
(57) Since the 20 random mutant strains selected in <1-2> could lose butanol productivity during mutagenesis, mutants maintaining butanol productivity were selected through liquid cultivation.
(58) Disposable tubes (Falcon, U.S.) including 40 ml of CGM and 5 g/L of CaCO.sub.3 was inoculated with 20 strains with tolerance against the lignocellulosic hydrolysate selected in <1-2>, and then cultured at 37 C. under anaerobic conditions set forth in <1-1> for 36 hours to identify butanol productivity. Analysis of butanol was performed by gas chromatography (Agilent, U.S.). The analysis conditions are shown in Table 1.
(59) Further, analysis of sugars was performed by liquid chromatography, in which 0.01N H.sub.2SO.sub.4 solution was used as a mobile phase and Aminex87H (Bio-Rad, U.S.) was employed as columns.
(60) TABLE-US-00001 TABLE 1 Injector temperature 320 C. Detector temperature 320 C. Injector split ratio 20/1 Injection volume 0.1 ul Oven condition 80 C./15 min Air flow 300 mL/min H.sub.2 flow 30 mL/min Column Supelco CarboWAX
(61) The analysis results are shown in
(62)
(63) <2-1> Random Mutagenesis
(64) Among mutant strains prepared in <Experimental Example 1>, TM1-3 having the highest butanol productivity was employed in random mutagenesis, thereby constructing a library of the mutant. The method for constructing the mutant library was the same as that disclosed in <1-1>.
(65) <2-2> Selection of Strains Capable of Simultaneous Co-Fermentation of Xylose and Glucose
(66) Randomly mutated strains prepared in <2-1> were diluted. The diluted strains were streaked on solid CGM prepared using 3 g/L of glucose and 3 g/L of xylose to form about 100 colonies. The random mutant strains formed on the streaked solid media were cultured under the same conditions as in <1-2> for about 2 days. 20 colonies grown rapidly were selected, and designated as TM2-1 to TM2-20.
(67) <2-3> Evaluation of Butanol Productivity of Strains Capable of Simultaneous Co-Fermentation of Xylose and Glucose
(68) Since the 20 random mutant strains selected in <1-2> could lose butanol productivity during mutagenesis, mutants maintaining butanol productivity were selected through liquid cultivation. A detailed method for selection is as follows.
(69) Disposable tubes (Falcon, U.S.) including 40 ml of CGM and 5 g/L of CaCO.sub.3 were inoculated with 20 strains (TM2-1 to TM2-20) prepared in <2-2>, and then cultured at 37 C. under anaerobic conditions set forth in <1-1> for 36 hours to identify butanol productivity. Analysis of butanol was performed using gas chromatography (Agilent, U.S.).
(70) As a result, it could be seen that mutant strains TM2-1, TM2-16 and TM2-19 showed butanol productivity similar to the control group TM1-3 (
(71) <2-4> Evaluation of Simultaneous Co-Fermentation of Glucose and Xylose
(72) Among tolerable strains considered as having butanol productivity similar to the control group in <2-3>, evaluation of simultaneous co-fermentation of glucose and xylose was performed for strains TM2-1, TM2-16 and TM2-19 by batch fermentation. A medium containing liquid CGM and mixed sugars (45 g/L glucose, 20 g/L xylose; proportion of xylose about 30% by weight) was used as the fermentation medium. Analysis of sugars was performed using liquid chromatography.
(73) Results are shown in
(74) Butanol productivity and simultaneous co-fermentation of strain TM2-1 were evaluated using mixed sugars containing 40% by weight of xylose (28 g/L xylose/42 g/L glucose).
(75) Results are shown in
(76) Stain TM2-1 was deposited on Jun. 9, 2014 with the International Patent Organism Depositary, Korea Collection for Type Culture (KCTC) with a deposit number of KCTC 12604BP and a designated name TM-2-1C. Hereinafter, experiments of simultaneous co-fermentation of mixed sugars were performed using strain TM2-1-C.
(77) Based on disclosure of International Patent Applications PCT/KR2013/001951 and PCT/KR2013/001954, pGS1-E1AB was prepared.
(78) According to these publications, when adhE1 gene (aldehyde alcohol dehydrogenase) and cdAB gene (Co-A transferase) were overexpressed in strain ABKO (Clostridium acetobutylicum ATCC824 pta buk), it was reported that ethanol productivity was reduced while butanol productivity was increased. Accordingly, simultaneous co-fermentation of mixed sugars in the lignocellulosic hydrolysate, and productivity of butanol, acetone and ethanol were evaluated by overexpressing adhE1 gene and ctfAB gene in the strain TM2-1-C.
(79) <3-1> Preparation of pGS1-E1AB Plasmid
(80) Clostridium acetobutylicum ATCC824 was streaked on solid RCM, followed by anaerobic culturing for 24 hours. A colony selected from the streaked solid medium was cultured in 3 ml of a liquid culture medium for 18 hours, followed by centrifuging the culture solution to obtain cells. The cells were washed with 10 ml of Tris buffer, followed by purification using a Wizard Genomic DNA purification Kit (manufactured by Promega Corp., U.S.) to isolate chromosomes of the strain.
(81) adhE1 gene (SEQ ID NO: 1) was amplified using primers AdhE1-UP-PstI (SEQ ID NO: 2) and AdhE1-DN-XhoI (SEQ ID NO: 3) and using the isolated chromosome as a template (Table 2). 100 l of PCR reaction mixture was prepared by adding 250 M dNTP, 20 pmol of each primer, 1.5 mM MgCl.sub.2, 10 l of 10 buffer, 100 ng of DNA template, and 1 unit of pfu polymerase. In the PCR reaction, the reaction repeated 30 cycles consisting of initial denaturing at 95 C. for 5 minutes, followed by denaturing at 95 C. for one minute, annealing at 50 C. for one minute and then polymerizing at 72 C. for one minute. The amplified gene was purified on a 1% agarose gel, and then digested with PstI and XhoI restriction enzymes to cleave a DNA fragment. The digested DNA fragment was ligated to pGS1-MCS (PCT/KR2013/001951 and PCT/KR2013/001954) digested with the same restriction enzymes, to construct pGS1-AdhE1 (
(82) TABLE-US-00002 TABLE2 SEQIDNO:1 ATGAAAGTCACAACAGTAAAGGAATTAGATGAAAAACTCAAGGTAATTAAAGAAGCTCAAAAAAA ATTCTCTTGTTACTCGCAAGAAATGGTTGATGAAATCTTTAGAAATGCAGCAATGGCAGCAATCG ACGCAAGGATAGAGCTAGCAAAAGCAGCTGTTTGGAAACCGGTATGGGCTTAGTTGAAGACAAGG TTATAAAAAATCATTTTGCAGGCGAATACATCTATAACAAATATAAGGATGAAAAAACCTGCGGT ATAATTGAACGAAATGAACCCTACGGAATTACAAAAATAGCAGAACCTATAGGAGTTGTAGCTGC TATAATCCCTGTAACAAACCCCACATCAACAACAATATTTAAATCCTTAATATCCCTTAAAACTA GAAATGGAATTTTCTTTTCGCCTCACCCAAGGGCAAAAAAATCCACAATACTAGCAGCTAAAACA ATACTTGATGCAGCCGTTAAGAGTGGTGCCCCGGAAAATATAATAGGTTGGATAGATGAACCTTC AATTGAACTAACTCAATATTTAATGCAAAAAGCAGATATAACCCTTGCAACTGGTGGTCCCTCAC TAGTTAAATCTGCTTATTCTTCCGGAAAACCAGCAATAGGTGTTGGTCCGGGTAACACCCCAGTA ATAATTGATGAATCTGCTCATATAAAAATGGCAGTAAGTTCAATTATATTATCCAAAACCTATGA TAATGGTGTTATATGTGCTTCTGAACAATCTGTAATAGTCTTAAAATCCATATATAACAAGGTAA AAGATGAGTTCCAAGAAAGAGGAGCTTATATAATAAAGAAAAACGAATTGGATAAAGTCCGTGAA GTGATTTTTAAAGATGGATCCGTAAACCCTAAAATAGTCGGACAGTCAGCTTATACTATAGCAGC TATGGCTGGCATAAAAGTACCTAAAACCACAAGAATATTAATAGGAGAAGTTACCTCCTTAGGTG AAGAAGAACCTTTTGCCCACGAAAAACTATCTCCTGTTTTGGCTATGTATGAGGCTGACAATTTT GATGATGCTTTAAAAAAAGCAGTAACTCTAATAAACTTAGGAGGCCTCGGCCATACCTCAGGAAT ATATGCAGATGAAATAAAAGCACGAGATAAAATAGATAGATTTAGTAGTGCCATGAAAACCGTAA GAACCTTTGTAAATATCCCAACCTCACAAGGTGCAAGTGGAGATCTATATAATTTTAGAATACCA CCTTCTTTCACGCTTGGCTGCGGATTTTGGGGAGGAAATTCTGTTTCCGAGAATGTTGGTCCAAA ACATCTTTTGAATATTAAAACCGTAGCTGAAAGGAGAGAAAACATGCTTTGGTTTAGAGTTCCAC ATAAAGTATATTTTAAGTTCGGTTGTCTTCAATTTGCTTTAAAAGATTTAAAAGATCTAAAGAAA AAAAGAGCCTTTATAGTTACTGATAGTGACCCCTATAATTTAAACTATGTTGATTCAATAATAAA AATACTTGAGCACCTAGATATTGATTTTAAAGTATTTAATAAGGTTGGAAGAGAAGCTGATCTTA AAACCATAAAAAAAGCAACTGAAGAAATGTCCTCCTTTATGCCAGACACTATAATAGCTTTAGGT GGTACCCCTGAAATGAGCTCTGCAAAGCTAATGTGGGTACTATATGAACATCCAGAAGTAAAATT TGAAGATCTTGCAATAAAATTTATGGACATAAGAAAGAGAATATATACTTTCCCAAAACTCGGTA AAAAGGCTATGTTAGTTGCAATTACAACTTCTGCTGGTTCCGGTTCTGAGGTTACTCCTTTTGCT TTAGTAACTGACAATAACACTGGAAATAAGTACATGTTAGCAGATTATGAAATGACACCAAATAT GGCAATTGTAGATGCAGAACTTATGATGAAAATGCCAAAGGGATTAACCGCTTATTCAGGTATAG ATGCACTAGTAAATAGTATAGAAGCATACACATCCGTATATGCTTCAGAATACACAAACGGACTA GCACTAGAGGCAATACGATTAATATTTAAATATTTGCCTGAGGCTTACAAAAACGGAAGAACCAA TGAAAAAGCAAGAGAGAAAATGGCTCACGCTTCAACTATGGCAGGTATGGCATCCGCTAATGCAT TTCTAGGTCTATGTCATTCCATGGCAATAAAATTAAGTTCAGAACACAATATTCCTAGTGGCATT GCCAATGCATTACTAATAGAAGAAGTAATAAAATTTAACGCAGTTGATAATCCTGTAAAACAAGC CCCTTGCCCACAATATAAGTATCCAAACACCATATTTAGATATGCTCGAATTGCAGATTATATAA AGCTTGGAGGAAATACTGATGAGGAAAAGGTAGATCTCTTAATTAACAAAATACATGAACTAAAA AAAGCTTTAAATATACCAACTTCAATAAAGGATGCAGGTGTTTTGGAGGAAAACTTCTATTCCTC CCTTGATAGAATATCTGAACTTGCACTAGATGATCAATGCACAGGCGCTAATCCTAGATTTCCTC TTACAAGTGAGATAAAAGAAATGTATATAAATTGTTTTAAAAAACAACCTTAA SEQIDNO:2 AdhE1-UP-PstI:5-CACCTGCAGATGAAAGTCACAACAGTAAAGGAATTAGAT-3 SEQIDNO:3 AdhE1-DN-XhoI:5-CACCTCGAGTTAAGGTTGTTTTTTAAAACAATTTATATACA-3
(83) On the other hand, pGS1-CtfAB was prepared by introducing ctfAB gene to pGS1-MCS (BglII) vector, which is disclosed in PCT/KR2013/001951 and PCT/KR2013/001954. First, ctfAB gene (SEQ ID NO: 4) was amplified using primers CtfAB-UP-BglII (SEQ ID NO: 5) and CtfAB-DN-EcoRI (SEQ ID NO: 6) and using the isolated chromosome of Clostridium acetobutylicum ATCC824 as a template, and cloned into pGS1-MCS to prepare pGS1-CtfAB (Table 3,
(84) Thereafter, ctfAB gene was amplified by PCR using primers THL-UP-XhoI (SEQ ID NO: 7) and CtfAB-DN-EcoRI (SEQ ID NO: 6) and using pGS1-CtfAB as a template. The amplified cfAB gene was purified on a 1% agarose gel, and digested with XhoI and EcoRI restriction enzymes to cleave a DNA fragment. The cleaved DNA was the ligated to a pGS1-AdhE1 vector digested with the same restriction enzymes to prepare pGS1-E1AB (
(85) TABLE-US-00003 TABLE3 SEQIDNO:4 ATGAACTCTAAAATAATTAGATTTGAAAATTTAAGGTCATTCTTTAAAGATGGGATGACAATTATGA TTGGAGGTTTTTTAAACTGTGGCACTCCAACCAAATTAATTGATTTTTTAGTTAATTTAAATATAAA GAATTTAACGATTATAAGTAATGATACATGTTATCCTAATACAGGTATTGGTAAGTTAATATCAAAT AATCAAGTAAAAAAGCTTATTGCTTCATATATAGGCAGCAACCCAGATACTGGCAAAAAACTTTTTA ATAATGAACTTGAAGTAGAGCTCTCTCCCCAAGGAACTCTAGTGGAAAGAATACGTGCAGGCGGATC TGGCTTAGGTGGTGTACTAACTAAAACAGGTTTAGGAACTTTGATTGAAAAAGGAAAGAAAAAAATA TCTATAAATGGAACGGAATATTTGTTAGAGCTACCTCTTACAGCCGATGTAGCATTAATTAAAGGTA GTATTGTAGATGAGGCCGGAAACACCTTCTATAAAGGTACTACTAAAAACTTTAATCCCTATATGGC AATGGCAGCTAAAACCGTAATAGTTGAAGCTGAAAATTTAGTTAGCTGTGAAAAACTAGAAAAGGAA AAAGCAATGACCCCCGGAGTTCTTATAAATTATATAGTAAAGGAGCCTGCATAAAATGATTAATGAT AAAAACCTAGCGAAAGAAATAATAGCCAAAAGAGTTGCAAGAGAATTAAAAAATGGTCAACTTGTAA ACTTAGGTGTAGGTCTTCCTACCATGGTTGCAGATTATATACCAAAAAATTTCAAAATTACTTTCCA ATCAGAAAACGGAATAGTTGGAATGGGCGCTAGTCCTAAAATAAATGAGGCAGATAAAGATGTAGTA AATGCAGGAGGAGACTATACAACAGTACTTCCTGACGGCACATTTTTCGATAGCTCAGTTTCGTTTT CACTAATCCGTGGTGGTCACGTAGATGTTACTGTTTTAGGGGCTCTCCAGGTAGATGAAAAGGGTAA TATAGCCAATTGGATTGTTCCTGGAAAAATGCTCTCTGGTATGGGTGGAGCTATGGATTTAGTAAAT GGAGCTAAGAAAGTAATAATTGCAATGAGACATACAAATAAAGGTCAACCTAAAATTTTAAAAAAAT GTACACTTCCCCTCACGGCAAAGTCTCAAGCAAATCTAATTGTAACAGAACTTGGAGTAATTGAGGT TATTAATGATGGTTTACTTCTCACTGAAATTAATAAAAACACAACCATTGATGAAATAAGGTCTTTA ACTGCTGCAGATTTACTCATATCCAATGAACTTAGACCCATGGCTGTTTAA SEQIDNO:5 CtfAB-UP-BglII:5-CACAGATCTATGAACTCTAAAATAATTAGATTTG-3 SEQIDNO:6 CtfAB-DN-EcoRI:5-CACGAATTCTTAAACAGCCATGGGTCTAAGTTCATTGGATATGA-3 SEQIDNO:7 THL-UP-XhoI:5-ATAAAGCTTAGAATGAAGTTTCTTATGCACAAGTATTTTTTATTAC-3
(86) <3-2> Preparation of Strain TM2-1-C (pGS1-E1AB)
(87) Strain TM2-1-C was cultivated in 60 ml of liquid CGM (Clostridium Growth Medium) (0.75 g/L K.sub.2HPO.sub.4, 0.75 g/L KH.sub.2PO.sub.4, 0.7 g/L, MgSO.sub.4.7H.sub.2O, 0.017 g/L MnSO.sub.4.5H.sub.2O, 0.01 g/L, FeSO.sub.4.7H.sub.2O, 2 g/L (NH.sub.4).sub.2SO.sub.2, 1 g/L NaCl, 2 g/L asparagine, 0.004 g/L p-aminobenzoic acid, 5 g/L yeast extract, 4.08 g/L CH.sub.3COONa.3H.sub.2O, and 80 g/L glucose) under anaerobic conditions until absorbance at 600 nm reached 0.5 (i.e., OD600=0.5). The culture solution was left on ice for 10 minutes and then centrifuged at 7000 g for 10 minutes at 4 C. The cell pellets were washed with an electroporation buffer solution three times, and then resuspended in 2 ml of the same buffer solution to manufacture cells for transformation. To 500 l of the thus prepared cells for transformation, 2.0 g of pGS1-E1AB plasmid prepared in <3-1> was added followed by electroporation (4 mm cuvette, 2.5 kV, , 25 F) using a Gene Pulser II manufactured by Bio-Rad Corporation. Thereafter, the cells were cultured anaerobically in a medium with antibiotics to obtain transformed strain TM2-1-C (pGS1-E1AB).
(88) As a control experiment, pGS1-E1AB plasmid was added to strain ABKO, which was then subjected to electroporation to prepare ABKO (pGS1-E1AB).
(89) Strain TM2-1-C (pGS1-E1AB) manufactured in <3-2> was evaluated for biobutanol productivity using mixed sugars. This experiment intended to identify butanol productivity of the strain using mixed sugars by continuous cultivation of strain TM2-1-C (E1AB) using the lignocellulosic hydrolysate including the mixed sugars.
(90) A feed solution for performing fed-batch fermentation was prepared as follows. First, to the concentrate of lignocellulosic hydrolysate prepared previously in which the concentration of mixed sugars is about 200 g/L, 3% (wt/v) corn steep liquor, a liquid medium (MgSO.sub.4.7H.sub.2O, 0.017 g/L MnSO.sub.4.5H.sub.2O, 0.01 g/L, FeSO.sub.4.7H.sub.2O, 1 g/L NaCl) and water were added such that final sugar concentration was adjusted to about 150 g/L, thereby preparing a feed solution. The feed solution was injected into an incubator by adjusting the final glucose concentration to 2 g/L or less. Glass bottles including the feed solution were linked to a fermenter by a silicone tube, followed by providing a pump which allows continuous glucose injection. With a time interval of 1-1.5 hours, the concentration of glucose was measured by HPLC, and accordingly the speed of injecting glucose solution was adjusted. When the concentration of glucose is maintained at 2 g/L or less, the amount of sugars lost with discharged culture solution during continuous fermentation as set forth below is minimized, thereby enhancing yield. When the concentration of sugars in the culture solution is high and the concentration of sugars lost with discharged culture solution is also high, the amount of sugars to be converted into butanol is generally reduced, thereby reducing yield. Further, when the concentration of glucose is maintained low, metabolism inhibition of other mixed sugars by glucose (CCR, carbon catabolite repression) can be alleviated.
(91) In addition, an incubator for continuous culturing process was manufactured in accordance with Korean patent application no. 10-2012-0038770. First, at upper and lower ends of a 3 L column, a filter having a pore size of about 150 m was provided in order to prevent loss of an adsorbent, followed by providing a stirrer, and then charging 300 g of an adsorbing agent. Two columns were prepared. These columns were linked to the incubator by a silicone tube, followed by providing a pump, thereby allowing a culture solution to be circulated between the columns. As the inlet and outlet for the columns, 4-way valves were provided such that in the course of culturing, the columns could be subjected to desorption in real time by introducing a solvent for elution when the adsorbent in the columns was saturated with butanol and mixed solvent. In case that the first column was subjected to desorption, the culture solution was provided to the second column such that the culture solution was circulated continuously. The culture solution was circulated from the top to the bottom of the column, but the direction is not particularly limited. Strain TM2-1-C (pGS1-E1AB) was cultured in the incubator manufactured above.
(92) To the incubator, 2.6 L of a medium containing about 50 g/L of the concentrated lignocellulosic hydrolysate was charged. The medium containing the lignocellulosic hydrolysate was inoculated with 600 ml of TM2-1-C (pGS1-E1AB), which had been anaerobically cultured in liquid CGM, to initiate cultivation. After initiation of the cultivation, the culture solution taken from the incubator was transferred to a first column, wherein the culture solution was circulated by passing through the first column with a flow rate of 100 ml/min through a pump when butanol concentration became about 6 g/L to 8 g/L. As the culture solution passed through the first column, the adsorbent was suspended in the culture solution to form a dilute slurry phase, which prevented the culture solution from flocking, thereby passing through the column. Butanol concentration was maintained at 8 g/L or less by taking the culture solution samples just before and after passing through the column and monitoring the concentration. Cultivation was performed by continuous fermentation for 162.5 hours.
(93) As a result, among mixed sugars introduced as the feed solution, xylose was added up to 957.3 g wherein only about 31 g xylose remained in a remaining culture solution, discharged culture solution and solvent-desorption solution, and the other xylose was converted into mixed solvent (ABE). From this, it can be seen that xylose showed 97% simultaneous co-fermentation. Further, arabinose which is a pentose showed 100% simultaneous co-fermentation. Cellobiose was introduced up to 383.2 g, wherein about 363.8 g of cellobiose was converted into a mixed solvent (ABE) and an amount of about 19.4 g of cellobiose is remained in a remaining culture solution, discharged culture solution and solvent-desorption solution. From this, it can be seen that cellobiose is capable of 95% or more simultaneous co-fermentation (
(94) As a control group, the same experiment was performed using ABKO (pGS1-E1AB). However, since ABKO (pGS1-E1AB) did not have tolerance against microorganism inhibitory substances in the lignocellulosic hydrolysate, cultivation was substantially impossible.
(95) TABLE-US-00004 TABLE 4 Total mixed Proportion Simultaneous sugars of mixed Total amount of co- Mixed introduced sugars remaining sugars fermentation sugars g % g % ratio Glucose 2607.66 65.80 7.49 0% 100% Xylose 957.32 24.16 30.94 3% 97% Galactose 0.00 0 0.00 Arabinose 14.83 0.37 0.00 0% 100% Mannose 0.00 0 0.00 Cellobiose 383.19 9.67 19.35 5% 95% Sum 3963 58
(96) Total mixed sugars introduced: Mixed sugars introduced as a feed solution
(97) Total amount of remaining sugars: Sugars present in a remaining culture solution, discharged culture solution and solvent-desorption liquid.
Simultaneous co-fermentation ratio={(Total sugars introduced (g)Total amount of remaining sugars (g))/Total sugars introduced (g)}100
(98) Discharged culture solution: Fermented liquid removed from the fermenter in proportion to the amount of the feed solution introduced during continuous co-fermentation
(99) Solvent-desorption liquid: Liquid generated from desorption of column through steam when an adsorbent is saturated by adsorbing acetone, butanol and ethanol (ABE) as fermentation products
Proportion of mixed sugars (%)={(Total amount of each sugars introduced (g)/Total sugars introduced (g)}100
Ex) Proportion of xylose in mixed sugars={Total amount of xylose introduced 957.32 (g)/Total amount of sugars introduced 3963 (g)}100=24.16%
(100) Analysis of fermented products adsorbed to the adsorbent in the column showed that TM2-1-C (pGS1-E1AB) performed simultaneous co-fermentation using mixed sugars as a mixed solvent while maintaining tolerance against inhibitory substances included in the mixed sugars in the lignocellulosic hydrolysate, and thus achieved a yield of 33.9%, productivity of 2.8 g/L/h, and butanol selectivity of 79.3%. The strain exhibited excellent performance as compared with any other strains capable of simultaneous co-fermentation of mixed sugars reported up to now (Table 5).
(101) TABLE-US-00005 TABLE 5 Acetone Ethanol Butanol ABE Produced amount (g) 148.2 129.8 1064.6 1342.6 Productivity (g/L/h) 0.3 0.3 2.2 2.8 Yield (based on introduced 3.7 3.3 26.9 33.9 amount) (%) Selectivity (%) 11.0 9.7 79.3 100.0
<Deposit Number> International Patent Organism Depositary: Korea Collection for Type Culture (KCTC) Deposit number: KCTC 12604BP Deposit date: Jun. 10, 2014