Method for quantitative measuring short RNA using amplified DNA fragment length polymorphism

Abstract

The present invention relates to the technical field of molecular biology, provides a method for measuring short RNA using amplified DNA fragment length polymorphism, and comprises the following steps: first using at least two synthesized miRNAs as the internal measurement standard, said synthesized miRNAs containing no natural homologous sequence in comparison with the short RNA to be measured, and mixing the synthesized miRNAs using different molecule numbers so as to form a dynamic miRNA standard molecular gradient; mixing the same quantity of the dynamic miRNA standard with the short RNA to be measured, and performing RNA reverse transcription, cDNA tailing, PCR synchronous amplification, and fluorescent quantitative analysis on the length polymorphism fragment of the PCR product DNA so as to measure the relative ratio of the fluorescence intensity of the DNA fragment produced by the amplification of the short RNA to be measured to the dynamic miRNA standard fluorescence intensity gradient.

Claims

1. A method of quantitatively measurement of short-chain RNAs using amplified fragment length polymorphism of DNA, characterized in that: said method comprises the following steps of: first, utilizing at least two types of synthetic microRNA which has no natural homologous sequence when compared to a short-chain RNA for testing as an internal standard for measurement; and mixing the synthetic microRNA, which is used as the internal standard, with different molecule numbers to form a standard molecular gradient of dynamic microRNA; then, mixing the short-chain RNA for testing with an equal amount of the dynamic microRNA standard; processing RNA reverse transcription, cDNA tailing, PCR synchronous amplification and fluorescence quantitative analysis of DNA length polymorphism fragment of PCR products to measure a relative ratio of fluorescence intensity of DNA fragment produced from the amplification of the short-chain RNA for testing based on the standard fluorescence intensity gradient of dynamic microRNA, thereby achieving a relative quantification of the short-chain RNA for testing.

2. The method of quantitatively measurement of microRNAs using amplified fragment length polymorphism of DNA according to claim 1, characterized in that: said method comprises the following steps of: after measuring a relative ratio of fluorescence intensity of DNA fragment produced from the amplification of the short-chain RNA for testing relative to the standard fluorescence intensity gradient of dynamic microRNA, utilizing the short-chain RNA for testing as a template to synthesis short-chained RNA reference; then determining a relative ratio of RNA reference for testing at different molecular numbers on the standard fluorescence intensity gradient of dynamic microRNA, thereby obtaining a calibration curve of number of molecules relative intensity of the RNA reference for testing and calculating an absolute number of molecules of the short-chain RNA for testing in the test sample by utilizing the ratio of relative intensity of the short-chain RNA through the calibration curve.

3. The method of quantitatively measurement of short-chain RNA using amplified fragment length polymorphism of DNA according to claim 1, characterized in that: the short-chain RNA for testing refers to microRNA (miRNA) or small interfering RNA (siRNA).

4. The method of quantitatively measurement of short-chain RNA using amplified fragment length polymorphism of DNA according to claim 1, characterized in that: in the RNA reverse transcription, the primer used is omega primer.

5. The method of quantitatively measurement of short-chain RNA using amplified fragment length polymorphism of DNA according to claim 1, characterized in that: in the RNA reverse transcription, the primer used is stem-loop primer.

6. The method of quantitatively measurement of short-chain RNA using amplified fragment length polymorphism of DNA according to claim 5, characterized in that: the stem-loop primer refers to length-encoded stem-loop primer.

7. The method of quantitatively measurement of short-chain RNA using amplified fragment length polymorphism of DNA according to claim 6, characterized in that: the length-encoded stem-loop primer is produced by a length-encoding method comprising the steps of: adding different number of bases between a PCR target site of the stem-loop primer and a probe sequence, and adjusting a base sequence at the 5 terminal of the primer such that a secondary structure of the stem-loop remains unchanged.

8. The method of quantitatively measurement of short-chain RNA using amplified fragment length polymorphism of DNA according to claim 2, characterized in that: the calibration curve is logarithmically regressed and expressed as aX.sup.b, where a and b are constants and are determined by actual values of measurement of the different number of synthetic microRNAs.

9. The method of quantitatively measurement of short-chain RNA using amplified fragment length polymorphism of DNA according to claim 1, characterized in that: a number of types of synthetic microRNA which has no natural homologous sequence when compared to a short-chain RNA for testing equals to three.

10. The method of quantitatively measurement of short-chain RNA using amplified fragment length polymorphism of DNA according to claim 2, characterized in that: the short-chain RNA for testing refers to microRNA (miRNA) or small interfering RNA (siRNA).

11. The method of quantitatively measurement of short-chain RNA using amplified fragment length polymorphism of DNA according to claim 2, characterized in that: in the RNA reverse transcription, the primer used is omega primer.

12. The method of quantitatively measurement of short-chain RNA using amplified fragment length polymorphism of DNA according to claim 2, characterized in that: in the RNA reverse transcription, the primer used is stem-loop primer.

13. The method of quantitatively measurement of short-chain RNA using amplified fragment length polymorphism of DNA according to claim 12, characterized in that: the stem-loop primer refers to length-encoded stem-loop primer.

14. The method of quantitatively measurement of short-chain RNA using amplified fragment length polymorphism of DNA according to claim 13, characterized in that: the length-encoded stem-loop primer is produced by a length-encoding method comprising the steps of: adding different number of bases between a PCR target site of the stem-loop primer and a probe sequence, and adjusting a base sequence at the 5 terminal of the primer such that a secondary structure of the stem-loop remains unchanged.

15. A fluorescent capillary electrophoresis method of quantitatively measurement of short-chain RNAs using amplified fragment length polymorphism of DNA, characterized in that: said method comprises the following steps of: first, utilizing at least two types of synthetic microRNA which has no natural homologous sequence when compared to a short-chain RNA for testing as an internal standard for measurement; and mixing the synthetic microRNA, which is used as the internal standard, with different molecule numbers to form a standard molecular gradient of dynamic microRNA; then, mixing the short-chain RNA for testing with an equal amount of the dynamic microRNA standard; processing RNA reverse transcription, cDNA tailing, PCR synchronous amplification and fluorescence quantitative analysis of DNA length polymorphism fragment of PCR products to measure a relative ratio of fluorescence intensity of DNA fragment produced from the amplification of the short-chain RNA for testing based on the standard fluorescence intensity gradient of dynamic microRNA, thereby achieving a relative quantification of the short-chain RNA for testing, utilizing the short-chain RNA for testing as a template to synthesis short-chained RNA reference; then determining a relative ratio of RNA reference for testing at different molecular numbers on the standard fluorescence intensity gradient of dynamic microRNA, thereby obtaining a calibration curve of number of molecules relative intensity of the RNA reference for testing and calculating an absolute number of molecules of the short-chain RNA for testing in the test sample by utilizing the ratio of relative intensity of the short-chain RNA through the calibration curve, wherein the short-chain RNA for testing refers to microRNA (miRNA).

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIGS. 1A and 1B illustrate a reaction process and measurement principle of miRFLP quantitative analysis.

(2) FIG. 2 is a fluorescence spectrum of DNA fragment length of randomly selected fluorescent PCR product which has a plurality of miscellaneous peaks and is diluted by 25 times.

(3) In FIG. 2, the y-axis FU refers to the fluorescence intensity and symbol marks the randomly selected DNA fragments.

(4) FIG. 3 illustrates a regression curve of DNA fragments which has a length of 62.00 nt and 91.22 nt(B) at different dilution levels, where the measured fluorescence value of the fragment and the dilution factor has a relation which fulfils the quadratic equation.

(5) In FIG. 3, A is a DNA fragment of 62.00 nt, B is a DNA fragment of 91.22 nt, the FU in the y-axis is the unit for fluorescence intensity.

(6) FIGS. 4A and 4B illustrate miRFLP analysis spectrum of standard dynamic miRNA and miRNA at various concentration;

(7) In FIGS. 4A and 4B, Std 1, Std 2, Std 3 represent the fluorescent DNA fragments of the dynamic miRNA standards (std 1, std 2, and std 3) respectively, 1, 2, 3, 4 represent reaction 1, reaction 2, reaction 3 and reaction 4 respectively, a represents the fluorescent DNA fragments of miR-92a, b represents the fluorescent DNA fragments of miR-92b, the y-axis is fluorescence intensity.

(8) FIGS. 5A and 5B are miRFLP assay spectrum and standard curve for different molecule numbers of miR-92a and miR-92b.

(9) In the FIGS. 5A and 5B, 1 represents the quantitative result of blank control which only contains standard dynamic miRNA, 2-10 represent the target for testing with 2.5105 to 244 number of added synthetic miR-92a molecules and equal amount of miR-92b. FIG. 5B is the graph of correspondence point of different miRNA copy number and its relative fluorescent intensity.

(10) FIG. 6 illustrates the results of detection range and repeatability of correction curve of miR-25 family members measured by miRFLP method.

(11) In FIG. 6, the x-axis is molecule number of miRNA, the y-axis is the relative fluorescent intensity.

(12) FIG. 7 is a graphical representation of miRFLP quantitative analysis profiles of the Let-7 family for individual Let-7 member.

(13) In FIG. 7, from the top to the bottom, are the results for let-7b, let-7c, let-7d and let-7g, Std 1, Std 2, Std 3 represent the same as the Std 1, Std 2, Std 3 of FIG. 4A.

(14) FIG. 8 shows the results of miRFLP analysis of miR-92b and miR-25 using stem-loop primer.

(15) FIG. 9 shows stem-loop primers using the number of bases for encoding.

(16) In FIG. 9, A: stem-loop primer designed for detection of Standard 1 RNA, where 4 bases (square) are placed between the 5 terminal of PCR target (arrow) and the probe as marker. Stem ring dG=13.71. B: stem-loop primer designed for detection of Standard 2 RNA, where 7 bases (square) are placed between the 5 terminal of PCR target (arrow) and the probe as marker. Stem ring dG=13.09.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT

(17) The present invention is further described in details with the accompanying figures and embodiments.

(18) In order to further illustrate the object, technical feature and advantageous effect of the present invention, the present invention is further described in details with the accompanying figures and embodiments. One skilled in the art will understand that the embodiment of the present invention as shown in the drawings and described above is exemplary only and not intended to be limiting.

Embodiment 1 Reaction Process and Measurement Principle of miRFLP Quantitative Analysis

(19) In this embodiment, omega primer is used as an example to illustrate the reaction process and measurement principle of miRFLP

(20) Referring to FIGS. 1A and 1B of the drawings, miRFLP reaction consists of four steps: miRNA reverse transcription, cDNA tailing, PCR synchronous amplification, and fluorescence fragment length polymorphism analysis of PCR products. The first step of the reaction is to hybridize miRNAs and omega primers. The miRNAs are paired with complementary probes. Then, reverse transcriptase is used to synthesis cDNA by using unpaired 3 terminal of miRNA as the template. After removing RNA, the newly synthesized cDNA and the 3 oligonucleotide primer containing a common PCR target undergo hybridization while DNA polymerase is used to fill the single-stranded gap after DNA pairing starting from 3 terminal of cDNA. After this combination, the correctly assembled cDNAs have the same 5 and 3 terminal sequences, which can process synchronous proportional amplification by a pair of fluorescent PCR primers. The amplified products are separated by capillary gel electrophoresis and the fluorescence intensity of PCR fragments of different lengths are determined and the miRFLP analysis spectrum is completed. FIG. 1B refers to the last step in the entire miRFLP quantitative analysis.

Embodiment 2: Determination Test of Fluorescence Intensity of PCR Fluorescent Labeled Products with Equal Times Dilution

(21) The fluorescence intensity measured by fluorescence quantitative analyzer has a direct proportional relationship to the number of fluorescent substances to be measured. This relationship is related to the configuration of the fluorescent probe, that is, different fluorescent probes have different fluorescence response curve. For ABI's Prizma 310 DNA sequencer, the number of fluorescent substances to be measured is in a linear quantitative relationship when the measured fluorescence intensity is in the range of 5-7000 FU, and the relationship changes to a parabola when the fluorescence intensity is greater than 7000FU. Different fluorescent probes of different instruments have different response characteristics which can affect the regression relationship between the measured fluorescence intensity and amount of fluorescence to be measured.

(22) According to this embodiment, calibration is carried out by 2-fold serial dilutions of the PCR products for Fluorescence Response Curve of ABI 3730xl model DNA Analyzer. In this experiment, the fluorescent PCR products which has more than one fraction and has a relative great fluorescence intensity variation is randomly selected. Dilute with 1TE at 25, 50, 100, 200 and 400 times and then analyze by ABI 3730xl model DNA Analyzer. FIG. 2 is the fluorescence spectrum of a sample of the fluorescent PCR product which is diluted by 25 times. Eleven DNA fragments with peaks of 253-25000FU are selected and their fluorescence readings at different dilution level are statistically calculated (see Table 1)

(23) The optimal assessment of the regression curve is carried out for the correspondence relationship between the dilution factor and the measured fluorescence intensity values by IBM SPSS Statistics 20 statistical software. The results show that a quadratic regression curve is applicable to describe the relationship between the fluorescence intensity of all fragments and the dilution factor, where the R-squared of goodness of fit of the regression are greater than 0.999. Accordingly, the correspondence relationship between the fluorescence intensity of DNA fragments measured by ABI 3730xl model DNA Analyzer and amount of fluorescence substances can be calculated accurately by using the regression curve of quadratic equation in one unknown, rather than a simple linear quantitative relationship. Repeated experiments show that the absolute values of the same sample in different batches can be different, but this quadratic equation of the regression model is not affected. FIG. 3 illustrates a regression curve of fragments with low abundance (A: 30FU-312FU) and fragments with great abundance (B: 2052FU-24949FU) after serial dilution levels. Different manufacturers or DNA fluorescence quantitative analysis with different models can also use the above method to process calibration for applicable fluorescence response curve and range so as to select the most suitable regression, which is also the most accurate regression.

(24) TABLE-US-00001 TABLE 1 The fluorescence values are measured at various dilution level by using the ABI 3730xl model DNA Analyzer for the PCR products used in FIG. 2 which is diluted by 25, 50, 100, 200, and 400 times and the R-square of the goodness of fit after regression with quadratic equation by using statistical analysis software IBM SPSS Statistics 20: PCR fragment Length Dilution Factor 52.87 nt 62.00 nt 88.98 nt 91.16 nt 92.09 nt 97.51 nt 103.18 nt 108.35 nt 111.25 nt 124.06 nt 126.00 nt Repeat #1 25x 3400 253 13137 21096 12402 688 570 9599 6101 328 322 50x 2180 172 8881 14113 8308 459 337 6253 3966 220 213 100x 1190 89 4852 7807 4683 250 191 3546 2175 123 130 200x 640 53 2594 4197 2512 140 104 1877 1125 59 67 400x 304 23 1211 1997 1180 70 50 918 552 36 R square 1.000 0.999 1.000 1.000 1.000 1.000 1.000 1.000 1.000 1.000 1.000 Repeat #2 25x 3501 265 13147 21005 11907 694 482 9494 5886 317 351 50x 2171 163 8195 13460 7643 444 325 6076 3647 207 210 100x 1235 93 4747 7570 4275 260 186 3328 2019 120 121 200x 582 46 2210 3569 2021 114 86 1552 905 48 60 400x 257 21 1544 1890 942 66 44 1060 571 34 40 R square 1.000 1.000 1.000 1.000 1.000 0.999 1.000 1.000 1.000 0.999 1.000 Repeat #3 25x 4015 312 15315 24949 14592 813 725 11584 7171 382 394 50x 2540 196 10055 15981 9542 538 380 7187 4495 247 245 100x 1301 98 5191 8263 4872 285 203 3646 2274 117 136 200x 726 61 2945 4660 2820 166 114 2037 1256 74 78 400x 307 30 1259 2052 1176 70 53 888 563 34 52 R square 1.000 0.999 1.000 1.000 1.000 1.000 1.000 1.000 1.000 0.999 1.000

Embodiment 3 Experiments of miRFLP Quantitative Analysis for miR-92a and miR-92

(25) In miRFLP quantitative analysis, the miRNA for testing is mixed with standard dynamic microRNA, then processed through miRNA reverse transcription, cDNA tailing modification and synchronous fluorescent PCR amplification, and finally DNA fragment length and fluorescence quantitative analysis are performed by DNA sequencer. Specifically, first prepare stock solution:

(26) 2 l of 5RT buffer, 1 l of 10 mM MgSO.sub.4, and 1 l of a standard dynamic miRNA mixture, the mixture includes standard 1 RNA (i.e., std1 in FIG. 4A, the same applies hereinafter) having a molecule number of 310.sup.6, standard 2 RNA (i.e., std2 in FIG. 4A, the same applies hereinafter) having a molecule number of 10.sup.5, standard 3 RNA (i.e., std3 in FIG. 4A, the same applies hereinafter) having a molecule number of 310.sup.4, the RNA sequence of the standard dynamic miRNA is shown in Table 2. Sequence searches by the Sangers miRbase version 20 database showed no homologous sequences. Mix 4 l of hybridization stock solution with 41 of the RNA sample for testing and add 2 l of a 10 nM mixture of omega probes (containing probes for std1, 2, 3 and miR-92a and miR-92b, see Table 2 for probes sequences). After mixing evenly, carry out hybridization. The conditions for hybridization reaction are: 55 C for 10 minutes, and then from 55 C to 20 C at a rate of one degree per minute. Add 2 l of reverse transcriptase mixture (1 l of MMTV reverse transcriptase, 0.5 l of dNTP, 0.5 l of water, Takara), after mixing, keep at 25 C. for 30 minutes, 37 C for 10 minutes and denature at 85 C. for 5 minutes. Take 5 l the RT product to add to 15 l 3adapter primer buffer (10 l of JumpStart Taq ReadyMix, 2 l of 100 nM 3 Oligonucleotide adapter primers, 1 l of 0.1 g/l RNase A, 2 l of Sterile water, Sigma), reaction conditions: 95 C for 2 minutes, 60c for 10 minutes, 5 cycles for 55c for 1 minute to 30c for 5 minutes, keep at 20c for 30 minutes, increase from 42 C to 68 C at a rate of 1 C per minute, keep at 72 C for 5 minutes.

(27) Take 5 l to add to 25 l PCR reaction solution prepared by 15 l JumpStart Taq ReadyMix (Sigma), 0.5 M PCR primers and 10 l of water. Carry out fluorescence PCR amplification, reaction conditions: cycle of 95 C. for 2 minutes, 40 cycles for 10 seconds at 95 C., 68 C. for 3 minutes and 72 C. for 30 seconds. The universal PCR primers are: [5Fam] GTGCTGAGTCACGAGGTATTCTA and CACCGACAGGAGACCTGTTCT (purchased from GenScript). After the reaction is completed, the PCR products are diluted by 1:20 or 1:50 and then fluorescence fragment length polymorphism analysis is carried out by using ABI 3730xl type DNA analyzer. The results of miRFLP analysis spectrum are shown in FIGS. 4A and 4B.

(28) In FIG. 4A, reaction 1 is a blank control assay containing only the standard dynamic miRNA molecules; in reaction 2, 2.510.sup.5 miR-92a molecules and an equal amount of miR-92b are added as the target for testing. In FIG. 4B, 3.110.sup.4 miR-92a and an equal amount of miR-92b are added as the target for testing in reaction 3. In reaction 4, 78 pg of H1299 total RNA is added.

(29) In the miRFLP analysis profiles of FIGS. 4A and 4B, DNA fragments of different lengths represent different miRNA molecules (the value above the peak refers to fragment length, nt), the fluorescence intensity reflects the relative amount of the miRNA (the value below the peak refers to fluorescence intensity, FU). Fluorescence intensities measured by different standards dynamic miRNA in the same reaction form a fluorescence intensity gradient corresponding to its molecule number. The absolute numbers of the various standard dynamic miRNA that are proportionately placed in different reactions are consistent. However, due to various reasons of different nature, such as the operation, equipment, supplies, reagents, measurement conditions, the absolute determination value of fluorescence intensity is affected and significant differences are shown. (such as the peaks of std 1 in reaction 1 and reaction 3) As the dilution factor of the target for testing is relatively smaller, the concentration of the preservation solution used for RNA preservation in Reaction 2 is higher than that in Reaction 3, which affected the efficiency of RT or PCR reaction, resulting in a change in the fluorescence intensity gradient of standard dynamic miRNA. Because the target for testing and the standard dynamic miRNA are mixed evenly before the reaction, this factor which affect the reaction efficiency is the same to the target for testing and the standard dynamic miRNA. The relative ratio of the fluorescence intensity of target for testing to the standard dynamic fluorescence intensity gradient can be used to objectively determine the ratio of molecules between the target for testing and the standard dynamic miRNA.

(30) TABLE-US-00002 TABLE2 miRFLP Quantitive Analysis for omega primer of miR-92a and miR-92 (The base sequences are SEQ ID NO. 1, SEQ ID NO. 2 respectively; the base seequences of the omega-omega primer used are both SEQ ID NO. 3;thebasesequencesofthe3 oligonucleotideadapterprimers(thatisthe3 AdapterinTable2) areSEQIDNO.4,SEQIDNO.5respectively),thestandarddynamicmiRNA(Std1,2,3)(theirbase sequencesareSEQIDNO.6,SEQIDNO.7,SEQIDNO.8respectively;thebasesequencesofthe omega-omegaprimerusedareSEQIDNO.9,SEQIDNO.10,SEQIDNO.11respectively,thebase sequencesofthe3 oligonucleotideadapterprimersarebothSEQIDNO.12)anditscomposition:in thetable,theaveragemolecularweight(308.95daltons)ofdG,dC,dAanddTis1nt,themolecular weightof5 fluorophoreis474.5. miRNA RNA RNA OmegaPrimer sequence Copyper 3 Adapter FragmenLength Name 5-3 5-3 Rx 5-3 Expected Actual Std1 GTGCTGAGTCACGAGGTATTCTAT ACCGUACAUCU 4X10{circumflex over ()}5 CACCGACAGGAGACCT 91.01nt 91.35nt GGCACGCTTTCATTAGCGTGCCTCGGATTATGA UCAUAAUCCGA GTTCTACCGTACATCT Std2 GTGCTGAGTCACGAGGTATTCTATGTTCTT ACCGUACAUCU 4X10{circumflex over ()}4 96.90nt 97.49nt GGCACGCTTTCATTAGCGTGCCTCGGATATGCA UGCAUAUCCGA Std3 GTGCTGAGTCACGAGGTATTCTATGAACTTGAC ACCGUACAUCU 4X10{circumflex over ()}3 99.89nt 100.34nt GGCACGCTTTCATTAGCGTGCCTCGGATTACTA UAGUAAUCCGA miR- GTGCTGAGTCACGAGGTATTCTATGTTCTTGAG UAUUGCACUCG varies CACCGACAGGAGACCTGT 113.19nt 108.47nt 92b- TTATATTCAGGCACGCTTTCATTAGCGTGCCG UCCCGGCCUCC TCTATACTATTGCACTCG 3p miR- GAGGCCGGGA UAUUGCACUUG varies CACCGACAGGAGACCTGTT 116.20nt 111.38nt 92a- UCCCGGCCUGU CTATACATCTATTGCACTTG 3p

Embodiment 4 Test of Calibration Curve of miRFLP Quantitative Analysis and Quantitative Analysis of miR-92a and miR-92 in Total RNA

(31) MiRFLP quantitative analysis reaction for the reverse transcription, modification and amplification reactions of the small RNAs in the same reaction is in a linear equal ratio manner. Dynamic standard fluorescence intensity gradient can exclude the influence of external factors on the measurement. However, the differences in the Tm, PCR fragment length and conformation of the probe still affected the fluorescence intensity of the DNA fragment.

(32) Through the design and optimization of the reaction conditions, the effect of the latter two factors can be minimized to a ignoreable level. which can reduce the influence of the latter two to a negligible extent. But the influence of probe Tm on the fluorescence intensity of the target cannot be ignored.

(33) Therefore it is necessary to use the calibration curve between a known number of molecules of targets for testing and the relative fluorescence intensity in order to convert the relative fluorescence intensity of the target for testing to actual molecule number of the targets for testing. By using synthetic miRNAs with serial dilution as the target for testing, the conversion curves of the relative fluorescence intensity and the target molecules number can be obtained the target molecule to be measured.

(34) In this embodiment, an equal number of synthetic miR-92a and miR-92b nucleic acid small molecules of 2-fold dilution level is used as the target for testing. The relative fluorescence intensity of the synthetic miR-92a and miR-92b at nine different dilutions are determined according to the conditions of the miRFLP analysis of miR-92 in Embodiment 3. This experiment group is set up for assay reaction of 3.12 ng, 0.312 ng, 0.0312 ng of A549 cell RNA, 0.222 ng of Hela cell RNA, and 0.25 ng of H1299 cell RNA. Three replicates are set up for each assay to determine the error range for the assay. The numerals on the left in FIG. 5A show the number of molecules of miR-92a and miR-92b in each reaction. The right side is the miRFLP analysis spectrum, which shows that the fluorescence intensity of miR-92a and miR-92b decreased gradually with the decrease of the molecule number for testing. Use Microsoft Excel table for statistical analysis of regression for fluorescence intensity of standard dynamic miRNA and their corresponding molecule numbers to obtain the best quadrative equation, and in this equation, substituting the fluorescence intensity of the target for testing to obtain the relative fluorescence intensity of the target for testing to the standard dynamic small RNA. FIG. 5B is a point correspondence graph of different miRNA copy numbers and their relative fluorescence intensities, and the trend is consistent with the law of power regression. The regression curves of miR-92b and miR-92a are: 0.0001>^7.4237 and 0.0013^6.4765 respectively, the R-square of goodness of fit are greater than 0.98.

(35) Table 3 lists the fluorescence intensity results of the three cellular RNAs and the relative fluorescence intensity (RFU) values converted from the measured fluorescence intensity of miR-92b and miR-92a using the fluorescence intensity of the standard dynamic small RNA in each reaction. Using the power of regression of the calibration curve of the miR-92a and miR-92b, the amount of miRNA in cell RNA and their respective error ranges are obtained. The results of three 10-fold dilutions of RNA from A549 cells show that in a RNA loading range of 0.03 ng to 3 ng, The error of detection of miR-92b and miR-92a are 10.13% and 12.63% respectively. It is shown that miRFLP assays have little effect on sample quantitation and has great reliability.

(36) TABLE-US-00003 TABLE 3 The miR-92a and miR-92b levels in total RNA of cell are determined by miRFLP method. The total RNA concentration of cell is determined by Qubic 2.0 Fluorescence Quantifier. Fluorescence Unit RFU miR copy/ng RNA RNA amount Std #1 Std #2 Std #3 miR-92b miR-92a miR-2b miR-92a miR-92b C.V miR-92a C.V 3.12 ng A549 RNA 27418 682 112 960 13251 5635 151696 7,110 12.61% 394,996 6.35% 31659 690 128 1246 15984 6934 166186 32118 662 133 1103 15867 5929 164125 0.312 ng A549 RNA 32073 689 168 370 4029 1273 27763 8,681 35.34% 345,449 25.50% 27276 405 143 159 2313 668 19071 30185 496 119 212 3316 963 27564 0.0312 ng A549 RNA 31859 928 206 68 1149 93 4306 8,248 24.83% 307,042 86.27% 31378 1880 241 146 372 145 553 31741 1087 186 87 1507 131 6093 0.222 ng Hela RNA 31356 1297 264 1487 7360 4567 46128 54,097 27.03% 747,141 40.34% 7536 198 39 184 946 3058 25880 31718 804 162 776 4509 3144 30931 0.250 ng H1299 RNA 31569 892 141 300 3488 963 22175 7,195 56.09% 509,963 24.15% 31825 1209 272 221 5702 295 32215 31733 1004 199 322 4895 752 30252

Embodiment 5 Test of Quantitative Measurement Range and Error Verification of miRFLP Quantitative Analysis

(37) Mixture of small molecules of synthetic miR-2, miR-92a and miR-92b nucleic acid of equal amount and three-fold dilution is used as a target for testing. Based on the miRFLP assay conditions of miR-92 in embodiment 3, the primer and standard dynamic small RNA as listed in Table 5 is used for measuring the relative fluorescent intensity of the synthetic miR-25, miR-92a and miR-92b under nine different dilution level. The molecules number of synthetic miRNA in each reaction are: 250,000, 83,333, 27,778, 9,259, 3,086, 1,029, 343, 114 respectively. There are 38 number of mixture of equal volume of miRNAs, miR-92a and miR-92b synthetic miRNAs, as well as blank control. Three replicates are set up for each assay to determine the error range for the assay. Statistical regression is carried out for the fluorescence intensity of the standard dynamic small RNA in each reaction and the corresponding molecule numbers by using the Microsoft Excel table to obtain the best quadratic equation. In this equation, the fluorescence intensity of the target for testing is substituted and then the relative fluorescence intensity of the target for testing relative to the standard dynamic small RNA is obtained. FIG. 6 shows the goodness-of-fit of the scatter of the various miRNA molecule numbers and its measured relative fluorescent intensity relative to the graph and relative to the logarithmic regression. The calibration regression curves of the molecule number of miR-92b, miR-92a and miR-25 are 4.3965^3.4854, 9.9139^3.0082 and 4.4131^3.3164 respectively, the R-square of goodness of fit are greater than 0.98. Table 4 lists the error ranges (C.V) for the relative fluorescence intensities at various molecule number obtained from three replicate experiments. This show that the effective quantitative detection range of miR-25 miRFLP analysis is 38-250,000. The detection error range at the level of 38 molecules is 104%. Outside this detection range, a relative quantitative measurement of the target for testing can be determined. One important reason of miRNA as an ideal biomarker is that the range of changes of miRNA molecule number resulted from the physiological and pathological effect is very great, and so the diagnostic sensitivity is very high. The range of quantitative measurement of miRNA, the detection error level and the objectivity determined by the MiRFLP analysis are all beyond the current identification methods to meet the clinical requirements of miRNA analysis, that the MiRFLP analysis has a very good application prospect.

(38) TABLE-US-00004 TABLE 4 Determination of error range of mi-R25 family at various level of molecule number by miRFLP Quantitative Analysis Ref miRNA miR-92b miR-92a miR-25 Copies C.V C.V C.V 250,000 29.19% 3.40% 4.84% 83,333 21.10% 8.39% 8.46% 27,778 14.96% 4.00% 6.66% 9,259 16.19% 5.49% 2.93% 3,086 13.13% 25.08% 17.95% 1,029 17.04% 26.68% 24.54% 343 13.38% 17.85% 23.72% 114 54.04% 26.95% 33.07% 38 103.62% 88.01%

(39) TABLE-US-00005 TABLE5 Tableofbasesequencesandcompositionofomegaprimer,standard dynamicmiRNA(Std1,2,3)and3 oligonucleotideadapterprimers(3 Adapter)ofmi- R25familyatvariouslevelofmoleculenumberdeterminedbymiRFLPQuantitativeAnalysis miRNA RNA OmegaPrimer sequence copyper 3 Adapter FragmenLength RNA 5-3 5-3 Rx 5-3 Expected Actual Std1 GTGCTGAGTCACGAGGTATTCTAT ACCGUACAUCU 4X10{circumflex over ()}5 CACCGACAGGAGACCT 91.01nt 91.35nt GGCACGCTTTCATTAGCGTGCCTCGGATTATGA UCAUAAUCCGA GTTCTACCGTACATCT Std2 GTGCTGAGTCACGAGGTATTCTATGTTCTT ACCGUACAUCU 4X10{circumflex over ()}4 96.90nt 97.49nt GGCACGCTTTCATTAGCGTGCCTCGGATATGCA UGCAUAUCCGA Std3 GTGCTGAGTCACGAGGTATTCTATGAACTTGAC ACCGUACAUCU 4X10{circumflex over ()}3 99.89nt 100.34nt GGCACGCTTTCATTAGCGTGCCTCGGATTACTA UAGUAAUCCGA miR- GTGCTGAGTCACGAGGTATTCTATGTTCTTGAG UAUUGCACUCG varies CACCGACAGGAGACCTGT 113.19nt 108.47nt 92b- TTATATTCAGGCACGCTTTCATTAGCGTGCCG UCCCGGCCUCC TCTATACTATTGCACTCG 3p GAGGCCGGGA miR- UAUUGCACUUG varies CACCGACAGGAGACCTGTT 116.20nt 111.38nt 92a- UCCCGGCCUGU CTATACATCTATTGCACTTG 3p *Average Molecular Weight (308.95 delton) of dG, dC, dA and dT is counted as 1 nt, MW of 5 Fam: 474.5

Embodiment 6 Specificity Verification Test for the Method of miRFLP Quantitative Analysis

(40) Determine the relative fluorescence intensities of let-7b, let-7c, let-7d and let-7g respectively by using parts of the let-7 miRFLP profile as determined by using the primers and standard dynamic miRNA listed in Table 6 under the same conditions of the miRFLP Analysis requirements in the embodiment 3. The number of synthetic miRNA molecules added as a template in each reaction is 12,500.

(41) TABLE-US-00006 Whereinthesequenceoflet-7bis: (SEQIDNO.13) ugagguaguagguugugugguu thesequenceoflet-7cis (SEQIDNO.14) ugagguaguagguuguaugguu thesequenceoflet-7dis (SEQIDNO.15) agagguaguagguugcauaguu thesequenceoflet-7gis (SEQIDNO.16) ugagguaguaguuuguacaguu

(42) The resulting miRFLP spectrum is shown in FIG. 7. As seen from FIG. 7, the miRFLP assay has a very high specificity and is capable of distinguishing miRNA molecules which differ from each other by one single base. When 12500 number of different members of Let-7 as templates is used and miRFLP spectrum of Let-7 family is used for separate testing of individual let-7 members, the results show that the largest cross-reaction of let-7 members occurs between Let-7b and Let-7f and its value is less that 5%, which is similar to the specificity of the stem-loop primer of ABI company. However, the difference is that the cross-reactivity assay of the present invention is carried out with omega mixed probe which can detect all of the Let-7 members. That is its realization is achieved in reaction for multi-target measurement, rather than in a single primer. This assessment of specificity is closer to the practical application.

(43) TABLE-US-00007 TABLE6 ThestandarddynamicmiRNA(Std1,2,3)andcompositionofomega primer(thebasesequencesareSEQIDNO.17,SEQIDNO.18,SEQIDNO.19,SEQID NO.20respectively,thebasesequenceofthe3 oligonucleotideadapterprimers(3 Adapter)usedareallSEQIDNO:21)ofsomeofthelet-7familymembers(let-7b,let- 7c,let-7d,let-7g)bymiRFLPquantitativeanalysis. miRNA RNA OmegaPrimer Sequence copy FragmentLength RNA 5-3 5-3 perRx 5-3 Expected Actual Std1 GTGCTGAGTCACGAGGTATTCTA ACCGUACAUCU 4X10{circumflex over ()}5 CACCGACAG 121.75nt 120.39nt TGAATACcTTCAACTTGCAGTTACTGCAAGTCaT UCAUAAUCCGA GAGACCTGTT GGCACGCTTctTAGCGTGCCTCGGATATGCA CT Std2 GTGCTGAGTCACGAGGTATTCTA ACCGUACAUCU 4X10{circumflex over ()}4 ACCGTACATC 124.73nt 123.45nt TGAATACcTTCAACTTGCAGTTACTGCAAGTCaT UGCAUAUCCGA T GGCACGCTTctTAGCGTGCCTTATCGGATATGCA Std3 GTGCTGAGTCACGAGGTATTCTA ACCGUACAUCU 4X10{circumflex over ()}3 127.56nt 126.49nt TGAATACcTTCAACTTGCAGTTACTGCAAGTCaT UAGUAAUCCGA GGCACGCTTctTAGCGTGCCTTACTTTCGGATTACTA Let-7b GTGCTGAGTCACGAGGTATTCTAAcTTcTAA ugagguaguag 12500 CACCGACAG 97.11nt 96.32nt GGCACGCTTctTAGCGTGCCAACCACACAAC guugugugguu GAGACCTGTT Let-7c GTGCTGAGTCACGAGGTATTCTAAcTTcTAAcaa ugagguaguag 12500 CTACA 100.08nt 99.60nt GGCACGCTTctTAGCGTGCCAACCATACAAC guuguaugguu TGAGGTAGTA Let-7d GTGCTGAGTCACGAGGTATTCTAAcTTcTAAcaaTCA agagguaguag 12500 GDTT 103.16nt 102.46nt GGCACGCTTctTAGCGTGCCAACTATGCAAC guugcauaguu Let-7g GTGCTGAGTCACGAGGTATTCTAAcTTcTAAcaaTCAA ugagguaguag 12500 109.11nt 108.59nt CttCAGGCACGCTTctTAGCGTGCCAACTGTACAAA uuuguacaguu *Average Molecular Weight (308.95 delton) of dG, dC, dA and dT is counted as 1 nt, MW of 5 Fam: 474.5

Embodiment 7 Quantitative Analysis of miRFLP Using Stem-Loop Primers

(44) Determine the relative fluorescence intensities of the synthetic miR-25 and miR-92b respectively by using the stem-loop primers and standard dynamic miRNA listed in Table 7 under the same conditions of the miRFLP Analysis requirements of miR-92 in the embodiment 3.

(45) The analytical profile correctly shows the DNA fragments representing the target miRNA while the fluorescence intensity of the fragment is directly proportional to the usage amount of target miRNA. This suggests that stem-loop primers can also be used in the miRFLP analysis of miRNAs after certain level of optimization. The miRFLP analysis spectrum in FIG. 8 shows the results of quantitative results of miR-92b and miR-25 by using stem-loop primers. In FIG. 8, the correct DNA fragment representing miR-92b is 94.93 nt. The illustrations on the right shows miRFLP analysis of miR-25. The correct DNA fragment representing miR-25 is 80.74 nt. The relationship between fluorescence intensity and number of various miRNA templates as determined by miRFLP analysis by using stem-loop primers is similar to the results of miRFLP analysis by using omega primer, thus stem-loop primers can also be substituted for the omega primer to determine the absolute quantitation of miRNA by the same method.

(46) The original design of stem-loop primers is used to initiate reverse transcription of miRNAs. The original aim is to determine the concentration of target miRNAs using the qPCR amplification cycle while the PCR products with complementary sequences are quantitatively determined using fluorescently labeled hybridization probes. Therefore, the method of identifying the target RNA by using the polymorphism of PCR fragment length is not considered. Stem-loop primers can be used for reverse transcription of miRNAs as well as primers for synthetic cDNA in miRFLP analysis. Different numbers of bases are introduced as coding between the PCR target site of conventional stem-loop primer and the probe, and different miRNA targets can be distinguished in the same reaction, which meets the need for simultaneous detection of multiple miRNAs. FIG. 9 illustrates an exemplary design which utilizes the stem-loop primer probe with base number encoding and length polymorphism targeting miR-25 and miR-92b. In FIG. 9, the PCR fragment length of primer A is 67.17 nt and the PCR fragment length of primer B is 70.08 nt, which can be distinguished from the miRFLP analysis spectrum.

(47) TABLE-US-00008 TABLE7 BasesequencesandcompositionofmiR-25andmiR-92bomega primer,standarddynamicmiRNA(Std1,2,3)and3 oligonucleotiadapterprimers(3 Adapter)determinedbymiRFLPQuantitativeAnalysis miRNA RNA Size-codedstemloopprimer sequence copy 3 Adapter FragmentLength 5-3 5-3 perRx 5-3 Expected Actual Std1 gtctTAGAATACCTCaaGTGCTGAGTC ACCGUACAUCUU 4X10{circumflex over ()}5 CACCGACAGGAGACCT 69.04nt 67.17nt ACGAGGTATTCTAagacTCGGATTA CAUAAUCCGA GTTCTGTACATCTTCA Std2 gtctagtTAGAATACaaGTGCTGAGTCA ACCGUACAUCU 4X10{circumflex over ()}4 CACCGACAGGAGACCT 71.93nt 70.08nt CGAGGTATTCTAactagacTCGGATAT UGCAUAUCCGA GTTCTGTACATCTTGC Std3 gtctTAGAATACCTCaaGTGCTGAG ACCGUACAUCU 4X10{circumflex over ()}3 CACCGACAGGAGACCTGTT 74.88nt 73.36nt TCACGAGGTATTCTAagacTCGGATTA UAGUAAUCCGA CTATACGAGTACATCTTAG miR- gtctTAGAATACCTCaaaGTGCTGAGTC CAUUGCACUUG varies CACCGACAGGAGACCTGTTCT 99.66nt 94.86nt 25-3p ACGAGGTATTCTAagacGGAGGCC UCUCGGUCUGA TGTTCTTA TTCTCGTCATTCCACGACG TATTGCACTCG miR- gtctTAGAATACCTCaaaGTGCTGA UAUUGCACUCG varies CACCGACAGGAGACCTG 82.37nt 80.81nt 92b-3p GTCACGAGGTATTCTAagacTCAGACC UCCCGGCCUCC TTCTATACAACACA CATTGCACTTG *Average Molecular Weight (308.95 delton) of dG, dC, dA and dT is counted as 1 nt, MW of 5 Fam: 474.5