Terpene synthases from ylang ylang (Cananga odorata var. fruticosa)
10266837 ยท 2019-04-23
Assignee
Inventors
Cpc classification
C12P5/007
CHEMISTRY; METALLURGY
C12N15/8243
CHEMISTRY; METALLURGY
International classification
C12P5/00
CHEMISTRY; METALLURGY
C12N15/82
CHEMISTRY; METALLURGY
Abstract
The present invention relates to the field of plant molecular biology. More particularly, the present invention relates to the isolation of nucleic acids encoding terpene synthases (TPSs), including a novel, multifunctional TPS identified herein as CoTPS2.
Claims
1. A cDNA encoding a Cananga odorata terpene synthase 2 protein (CoTPS2 protein) having the amino acid sequence set forth in SEQ ID NO:10 or a modified CoTPS2 protein, wherein the modified CoTPS2 protein has the amino acid sequence set forth in SEQ ID NO:10 with 1-10 conservative amino acid substitutions, wherein the modified CoTPS2 protein has the motifs R(R)X.sub.8W SEQ ID NO:1), DDXXD (SEQ ID NO:2) and NSE/DTE (SEQ ID NO:3/SEQ ID NO:4) and wherein the modified CoTPS2 protein has terpene synthase activity.
2. The cDNA of claim 1, wherein the modified CoTPS2 protein has 1-6 conservative amino acid substitutions.
3. The cDNA of claim 1, wherein the cDNA has the nucleotide sequence set forth in SEQ ID NO:9.
4. A nucleic construct comprising the cDNA of claim 1 operably linked to a plant operable promoter.
5. An expression vector comprising the cDNA of claim 1.
6. A transgenic plant cell, plant or plant seed comprising cDNA of claim 1 stably integrated into its genome.
7. The transgenic plant cell, plant or plant seed of claim 6, wherein the plant is a member of the Cananga genus.
8. The transgenic plant cell, plant or plant seed of claim 7, wherein the plant is a ylang ylang (Cananga odorata) plant.
9. A method for producing a transgenic plant which comprises introducing the cDNA of claim 1 or an expression vector comprising the cDNA into a plant, wherein the transgenic plant has the cDNA stably integrated in its genome.
10. A method for producing a transgenic plant which comprises transfecting the cDNA of claim 1 or an expression vector comprising the cDNA into a plant cell or plant cells and regenerating a transgenic plant from the transfected plant cell or transfected plant cells, wherein the transgenic plant has the cDNA stably integrated in its genome.
11. The method of claim 9, wherein the plant is a member of the Cananga genus.
12. The method of claim 11, wherein the transgenic plant is a ylang ylang (Cananga odorata) plant.
13. A method of synthesizing at least one terpene or sesquiterpene in a plant which comprises introducing the cDNA of claim 1 or an expression vector comprising the cDNA into a plant, wherein the cDNA is expressed in the plant thereby synthesizing the at least one terpene or sesquiterpene.
14. A method of synthesizing at least one terpene or sesquiterpene in a plant comprising transfecting the cDNA of claim 1 or an expression vector comprising the cDNA into a plant cell or plant cells and growing a plant from the transfected plant cell or transfected plant cells, wherein the cDNA is expressed in the plant thereby synthesizing the at least one terpene or sesquiterpene.
15. The method of claim 13, wherein the at least one sesquiterpene is -ylangene, -copaene or -cubebene.
16. The method of claim 13, wherein the plant is a member of the Cananga genus.
17. The method of claim 16, wherein the transgenic plant is a ylang ylang (Canangga odorata) plant.
18. The method of claim 13, wherein the cDNA is overexpressed.
19. A method of producing at least one terpene or sesquiterpene in a yeast cell, the method comprising exogenously expressing within the yeast cell the cDNA of claim 1, thereby producing the at least one sesquiterpene in the yeast cell.
20. The method of claim 19, wherein the at least one sesquiterpene is -ylangene, -copaene or -cubebene.
21. The cDNA of claim 1, wherein the modified CoTPS2 protein has 1 or 2 conservative amino acid substitutions.
22. An expression vector comprising the nucleic acid construct of claim 4.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
DETAILED DESCRIPTION OF THE INVENTION
(21) The present invention relates to the field of plant molecular biology. More particularly, the present invention relates to the isolation of nucleic acids encoding terpene synthases (TPSs), including a novel, multifunctional TPS identified herein as CoTPS2.
(22) Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which the invention belongs.
(23) As used herein, allele refers to any of one or more alternative forms of a gene locus, all of which alleles relate to a trait or characteristic. In a diploid cell or organism, the two alleles of a given gene occupy corresponding loci on a pair of homologous chromosomes.
(24) As used herein, gene refers to a nucleic acid sequence that encompasses a 5 promoter region associated with the expression of the gene product, any intron and exon regions and 3 or 5 untranslated regions associated with the expression of the gene product.
(25) As used herein, genotype refers to the genetic constitution of a cell or organism.
(26) The term heterologous or exogenous when used with reference to portions of a nucleic acid indicates that the nucleic acid comprises two or more subsequences that are not found in the same relationship to each other in nature. For instance, the nucleic acid is typically recombinantly produced, having two or more sequences from unrelated genes arranged to make a new functional nucleic acid, e.g., a promoter from one source and a coding region from another source. Similarly, a heterologous or exogenous protein indicates that the protein comprises two or more subsequences that are not found in the same relationship to each other in nature (e.g., a fusion protein).
(27) Operable linkage or operably linked as used herein is understood as meaning, for example, the sequential arrangement of a promoter and the nucleic acid to be expressed and, if appropriate, further regulatory elements such as, for example, a terminator, in such a way that each of the regulatory elements can fulfill its function in the recombinant expression of the nucleic acid to make RNA. This does not necessarily require direct linkage in the chemical sense. Genetic control sequences such as, for example, enhancer sequences, can also exert their function on the target sequence from positions which are somewhat distant, or indeed from other DNA molecules (cis or trans localization). Preferred arrangements are those in which the nucleic acid sequence to be expressed recombinantly is positioned downstream of the sequence which acts as promoter, so that the two sequences are covalently bonded with one another.
(28) As used herein, phenotype refers to the detectable characteristics of a cell or organism, which characteristics are the manifestation of gene expression.
(29) The terms polynucleotide, nucleic acid and nucleic acid molecule are used interchangeably herein to refer to a polymer of nucleotides which may be a natural or synthetic linear and sequential array of nucleotides and/or nucleosides, including deoxyribonucleic acid, ribonucleic acid, and derivatives thereof. It includes chromosomal DNA, self-replicating plasmids, infectious polymers of DNA or RNA and DNA or RNA that performs a primarily structural role. Unless otherwise indicated, nucleic acids or polynucleotide are written left to right in 5 to 3 orientation, Nucleotides are referred to by their commonly accepted single-letter codes. Numeric ranges are inclusive of the numbers defining the range. The nucleic acid may also optionally contain non-naturally occurring or altered nucleotide bases that permit correct read through by a polymerase and do not reduce expression of the nucleic acid.
(30) The terms polypeptide, peptide, and protein are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. Amino acids may be referred to by their commonly known three-letter or one-letter symbols. Amino acid sequences are written left to right in amino to carboxy orientation, respectively. Numeric ranges are inclusive of the numbers defining the range.
(31) As used herein, the term substantially homologous or substantial homology, with reference to a nucleic acid sequence, includes a nucleotide sequence that hybridizes under stringent conditions to a referenced SEQ ID NO, or a portion or complement thereof, are those that allow an antiparallel alignment to take place between the two sequences, and the two sequences are then able, under stringent conditions, to form hydrogen bonds with corresponding bases on the opposite strand to form a duplex molecule that is sufficiently stable under conditions of appropriate stringency, including high stringency, to be detectable using methods well known in the art. Substantially homologous sequences may have from about 70% to about 80% sequence identity, or more preferably from about 80% to about 85% sequence identity, or most preferable from about 90% to about 95% sequence identity, to about 99% sequence identity, to the referent nucleotide sequences as set forth the sequence listing, or the complements thereof. Alternatively, substantially homologous sequences include those which hybridize under stringent conditions to the target regions of introns of plant genes. As used herein, stringent conditions are those that (1) employ low ionic strength and high temperature for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate/0.1% NaDodSO.sub.4 at 50 C.; (2) employ during hybridization a denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42 C.; or (3) employ 50% formamide, 5SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5Denhardt's solution, sonicated salmon sperm DNA (50 g/ml), 0.1% SDS and 10% dextran sulfate at 42 C. in 0.2SSC and 0.1% SDS. For stringency conditions, see also U.S. Pat. Nos. 8,455,716 and 8,536,403.
(32) As used herein, the term sequence identity, sequence similarity or homology is used to describe sequence relationships between two or more nucleotide sequences. The percentage of sequence identity between two sequences is determined by comparing two optimally aligned sequences over a comparison window such as the full length of a referenced SEQ ID NO, wherein the portion of the sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity. A sequence that is identical at every position in comparison to a reference sequence is said to be identical to the reference sequence and vice-versa. A first nucleotide sequence when observed in the 5 to 3 direction is said to be a complement of, or complementary to, a second or reference nucleotide sequence observed in the 3 to 5 direction if the first nucleotide sequence exhibits complete complementarity with the second or reference sequence. As used herein, nucleic acid sequence molecules are said to exhibit complete complementarity when every nucleotide of one of the sequences read 5 to 3 is complementary to every nucleotide of the other sequence when read 3 to 5. A nucleotide sequence that is complementary to a reference nucleotide sequence will exhibit a sequence identical to the reverse complement sequence of the reference nucleotide sequence. These terms and descriptions are well defined in the art and are easily understood by those of ordinary skill in the art.
(33) As used herein, a comparison window or window of comparison refers to a conceptual segment of at least 6 contiguous positions, usually about 50 to about 100, more usually about 100 to about 150, in which a sequence is compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. The comparison window may comprise additions or deletions (i.e. gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Those skilled in the art should refer to the detailed methods used for sequence alignment, such as in the Wisconsin Genetics Software Package Release 7.0 (Genetics Computer Group, 575 Science Drive Madison, Wis., USA).
(34) As described herein, the chemical composition of floral VOC was determined at 4 different stages of flower formation and performed RNA-seq on mature yellow flowers of C. odorata var. fruticosa where the production of floral VOCs is at the maximum. Terpenes formed the bulk of floral VOCs. The transcriptome data revealed 16 TPS transcripts from dwarf ylang ylang flowers out of which 4 were functionally characterized. Two TPSs were identified as mono-TPSs, CoTPS1 and CoTPS4, which catalyze the formation of multiproduct -thujene/sabinene/-pinene/-terpinene and geraniol, respectively. The other two CoTPS2 and CoTPS3 were ascertained as sesqui-TPSs. CoTPS3 was shown to catalyze the formation of -bergamotene. CoTPS2 was found to be a multifunctional and novel TPS which could synthesize three sesquiterpene compounds, -ylangene/-copaene/-cubebene from the farnesyl pyrophosphate (FPP) substrate.
(35) In a first aspect, the present invention provides an isolated nucleic acid encoding a CoTPS protein. In one embodiment, the nucleic acid further comprises a plant operable promoter operably linked to the coding sequence. In some embodiments, the CoTPS protein is CoTPS2 protein comprising the amino acid sequence set forth in SEQ ID NO:10. In one embodiment, the nucleic acid comprises the nucleotide sequence set forth in SEQ ID NO:9. In a further embodiment, the nucleic acid encodes a variant CoTPS2 protein. In one embodiment, the variant CoTPS2 protein has at least 90% sequence identity with the CoTPS2 protein while having the activity of the CoTPS2 protein. In another embodiment, the variant CoTPS2 protein has one or more amino acid changes in the amino acid sequence of the CoTPS2 protein while having the activity of the CoTPS2 protein.
(36) In other embodiments, the CoTPS protein is CoTPS3 protein comprising the amino acid sequence set forth in SEQ ID NO:6. In one embodiment, the nucleic acid comprises the nucleotide sequence set forth in SEQ ID NO:5. In a further embodiment, the nucleic acid encodes a variant CoTPS3 protein. In one embodiment, the variant CoTPS3 protein has at least 90% sequence identity with the CoTPS3 protein while having the activity of the CoTPS3 protein. In another embodiment, the variant CoTPS3 protein has one or more amino acid changes in the amino acid sequence of the CoTPS3 protein while having the activity of the CoTPS3 protein.
(37) In some embodiments, the CoTPS protein is CoTPS1 protein comprising the amino acid sequence set forth in SEQ ID NO:8. In one embodiment, the nucleic acid comprises the nucleotide sequence set forth in SEQ ID NO:7. In a further embodiment, the nucleic acid encodes a variant CoTPS1 protein. In one embodiment, the variant CoTPS1 protein has at least 90% sequence identity with the CoTPS1 protein while having the activity of the CoTPS1 protein. In another embodiment, the variant CoTPS1 protein has one or more amino acid changes in the amino acid sequence of the CoTPS1 protein while having the activity of the CoTPS1 protein.
(38) In other embodiments, the CoTPS protein is CoTPS4 protein comprising the amino acid sequence set forth in SEQ ID NO:12. In one embodiment, the nucleic acid comprises the nucleotide sequence set forth in SEQ ID NO:11. In a further embodiment, the nucleic acid encodes a variant CoTPS4 protein. In one embodiment, the variant CoTPS4 protein has at least 90% sequence identity with the CoTPS4 protein while having the activity of the CoTPS4 protein. In another embodiment, the variant CoTPS4 protein has one or more amino acid changes in the amino acid sequence of the CoTPS4 protein while having the activity of the CoTPS4 protein.
(39) In some embodiments, the polynucleotide may be one encoding a polypeptide of a variant of the amino acid sequences disclosed herein, which variant is an amino acid sequence disclosed herein having one or several amino acid residues substituted, deleted, inserted and/or added. The site at which one or several amino acid residues are substituted, deleted, inserted and/or added may be any site in the amino acid sequence, as long as the polypeptide with one or several amino acid residues substituted, deleted, inserted and/or added has the function of regulating the flowering time of a plant. As used herein, the term one or several amino acid residues refers specifically to up to 10 amino acid residues in number, preferably to up to 6 amino acid residues, more preferably to up to 2 amino acid residues and even more preferably to one amino acid residue.
(40) When the amino acids are altered, for example, by substitution, it is preferable to be conservatively substituted. This means that a particular amino acid residue is substituted with a different amino acid in which the properties of the amino acid side-chain are conserved. Non-limited examples of such the conservative substitution include substitution between hydrophobic amino acids such as alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, tyrosine and valine, substitution between hydrophilic amino acids such as arginine, aspartic acid, asparagine, cysteine, glutamic acid, glutamine, glycine, histidine, lysine, serine and threonine, substitution between amino acids having an aliphatic side chain such as glycine, alanine, valine, leucine, isoleucine and proline, substitution between amino acids having a hydroxy-containing side chain such as serine, threonine and tyrosine, substitution between amino acids having a sulfur atom-containing side chain such as cysteine and methionine, substitution between amino acids having a carboxylic acid- and amide-containing side chain such as aspartic acid, asparagine, glutamic acid and glutamine, substitution between amino acids having a base-containing side chain such as arginine, lysine and histidine, and substitution between amino acids having an aromatic-containing side chain such as histidine, phenylalanine, tyrosine and tryptophan. The substitutions between amino acids having the same amino acid side-chain properties may retain the biological activity of the polypeptide.
(41) In some embodiments, the polynucleotide may be a variant of a polynucleotide selected from the group consisting of the polynucleotides described herein, which variant has one to 30 nucleotides substituted, deleted, inserted and/or added. The site at which nucleotides are substituted, deleted, inserted and/or added may be any site, as long as the polynucleotide with substituted, deleted, inserted and/or added nucleotides has the function of synthesizing the terpene or sesquiterpene described herein for each of the CoTPS proteins described herein.
(42) Examples of methods for preparing a nucleic acid encoding a protein comprising altered amino acids are well known to those skilled in the art, including site-directed mutagenesis (Kramer and Fritz, 1987). Examples of specific methods for altering nucleotides also include methods using a commercially available kit (e.g. Transformer Site-Directed Mutagenesis Kit: Clonetech; QuickChange Site Directed Mutagenesis Kit: Stratagene) and methods using polymerase chain reaction (PCR). These methods are well known to those skilled in the art. The amino acid sequence of a protein may also be mutated in nature due to the mutation of a nucleotide sequence. A nucleic acid encoding proteins having the amino acid sequence of a natural CoTPS protein (such as the CoTPS2, CoTPS3, CoTPS1 or CoTPS4 protein) wherein one or more amino acids are substituted, deleted, and/or added are also included in the polynucleotide of the present invention, so long as they encode a protein functionally equivalent to a natural CoTPS protein. Also natural CoTPS protein homologs in related ylang ylang plants which show high identities to the sequences of the CoTPS protein are also included in the polynucleotide of the present invention, so long as they encode a protein functionally equivalent to a natural CoTPS protein. Additionally, nucleotide sequence variants that do not give rise to amino acid sequence changes in the protein (degeneracy variants) are also included in the polynucleotide of the present invention.
(43) In a second aspect, the present invention provides a construct or vector comprising an isolated nucleic acid as described herein. In one embodiment, the construct or vector is an expression construct or vector. In another embodiment, the construct or vector further comprises a selectable marker. In a further embodiment, the construct or vector comprises a recombination marker free system. In some embodiments, the recombination marker free system is a Cre-lox recombination marker free system, a Zinc finger marker free system, a TALE nucleases marker free system or a CRISPR-Cas marker free system.
(44) The construct typically includes regulatory regions operatively linked to the 5 side of the nucleic acid described herein (such as a nucleic acid encoding a CoTPS2 protein, a nucleic acid encoding a CoTPS3 protein, a nucleic acid encoding a CoTPS1 protein or a nucleic acid encoding a CoTPS4 protein) and/or to the 3 side of the nucleic acid. A cassette containing all of these elements is also referred to herein as an expression cassette. The expression cassettes may additionally contain 5 leader sequences in the expression cassette construct. The regulatory regions (i.e., promoters, transcriptional regulatory regions, and translational termination regions) and/or the polynucleotide encoding a signal anchor may be native/analogous to the host cell or to each other. Alternatively, the regulatory regions and/or the polynucleotide encoding a signal anchor may be heterologous to the host cell or to each other. See, U.S. Pat. No. 7,205,453 and U.S. Patent Application Publication Nos. 2006/0218670, 2006/0248616 and 20090100536, and the references cited therein. The expression cassettes may additionally contain 5 leader sequences in the expression cassette construct. Such leader sequences can act to enhance translation. Translation leaders are known in the art and include those described in International Publication No. WO 2008/094127 and the references cited therein. In some embodiments, the nucleic acid construct further comprises a plant operable terminator. Plant operable terminators are well known in the art. In one embodiment, the terminator is the native CoTPS terminator.
(45) A number of promoters can be used in the practice of the invention. The promoters can be selected based on the desired outcome. That is, the nucleic acids can be combined with constitutive, tissue-preferred, or other promoters for expression in the host cell of interest. Such constitutive promoters include, for example, the core promoter of the Rsyn7 (WO 99/48338 and U.S. Pat. No. 6,072,050); the core CaMV 35S promoter (Odell et al., 1985); rice actin (McElroy et al., 1990); ubiquitin (Christensen and Quail, 1989; Christensen et al., 1992); pEMU (Last et al., 1991); MAS (Velten et al., 1984); ALS promoter (U.S. Pat. No. 5,659,026), and the like. Other constitutive promoters include, for example, those disclosed in U.S. Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; and 5,608,142.
(46) Other promoters include inducible promoters, particularly from a pathogen-inducible promoter. Such promoters include those from pathogenesis-related proteins (PR proteins), which are induced following infection by a pathogen; e.g., PR proteins, SAR proteins, beta-1,3-glucanase, chitinase, etc. Other promoters include those that are induced locally at or near the site of pathogen infection. In further embodiments, the promoter may be a wound-inducible promoter. In other embodiments, chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator. The promoter may be a chemical-inducible promoter, where application of the chemical induces gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression. In addition, tissue-preferred promoters can be utilized to target enhanced expression of a polynucleotide of interest within a particular plant tissue. Each of these promoters are described in U.S. Pat. Nos. 6,506,962, 6,575,814, 6,972,349 and 7,301,069 and in U.S. Patent Application Publication Nos. 2007/0061917 and 2007/0143880.
(47) Generally, the expression cassette may additionally comprise a selectable marker gene for the selection of transformed cells. Selectable marker genes are utilized for the selection of transformed cells or tissues. Usually, the plant selectable marker gene will encode antibiotic resistance, with suitable genes including at least one set of genes coding for resistance to the antibiotic spectinomycin, the streptomycin phosphotransferase (spt) gene coding for streptomycin resistance, the neomycin phosphotransferase (nptII) gene encoding kanamycin or geneticin resistance, the hygromycin phosphotransferase (hpt or aphiv) gene encoding resistance to hygromycin, acetolactate synthase (als) genes. Alternatively, the plant selectable marker gene will encode herbicide resistance such as resistance to the sulfonylurea-type herbicides, glufosinate, glyphosate, ammonium, bromoxynil, imidazolinones, and 2,4-dichlorophenoxyacetate (2,4-D), including genes coding for resistance to herbicides which act to inhibit the action of glutamine synthase such as phosphinothricin or Basta (e.g., the bar gene). See generally, International Publication No. WO 02/36782, U.S. Pat. No. 7,205,453 and U.S. Patent Application Publication Nos. 2006/0218670, 2006/0248616, 2007/0143880 and 2009/0100536, and the references cited therein. See also, Jefferson et al. (1987); De Wet et al. (1987); Goff et al. (1990); Kain et al. (1995) and Chiu et al. (1996). This list of selectable marker genes is not meant to be limiting. Any selectable marker gene can be used. The selectable marker gene is also under control of a promoter operable in the plant species to be transformed. Such promoters include those described in International Publication No. WO 2008/094127 and the references cited therein.
(48) Alternatively, the expression cassette may additionally comprise a recombination marker free system. In some embodiments, the recombination marker free system is a Cre-lox recombination marker free system, a Zinc finger marker free system, a TALE nucleases marker free system or a CRISPR-Cas marker free system. Such a system is useful for producing selection marker free transgenic oil palm plants or other plants.
(49) In preparing the expression cassette, the various DNA fragments may be manipulated, so as to provide for the DNA sequences in the proper orientation and, as appropriate, in the proper reading frame. Toward this end, adapters or linkers may be employed to join the DNA fragments or other manipulations may be involved to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites, or the like. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, e.g. transitions and transversions may be involved.
(50) In a third aspect, the present invention provides a transgenic plant comprising a nucleic acid, construct or vector described herein. In one embodiment, the transgenic plant may be any plant species. In another embodiment, the transgenic plant may be a member of the Cananga genus. In an additional embodiment, the transgenic plant is a Cananga odorata plant. In a further embodiment, the transgenic plant may be Cananga odorata var. fruticosa (dwarf ylang ylang). In some embodiments, the transgenic Cananga plant or Cananga odorata plant or Cananga odorata var. fruticosa plant overexpresses a CoTPS protein compared to a non-transgenic plant. In these embodiments, a nucleic acid, nucleic acid construct or expression vector as described above is introduced into a plant cell by conventional techniques such as those described below or those well known to the skilled artisan to produce transgenic plants that overexpress a CoTPS protein.
(51) In other embodiments, the transgenic plant expresses a lower amount of a CoTPS protein compared to a non-transgenic plant, i.e., the expression of a CoTPS gene is down regulated. A reduced expression level of a CoTPS protein be brought about by using well known techniques, including, but not limited to, RNAi techniques, such as dsRNA, miRNA, siRNA, smRNA, hpRNA or ihpRNA (collectively referred to as RNAi molecules), sense suppression (co-suppression), antisense, and the like. Such techniques are described in U.S. Pat. No. 7,312,323 and references cited therein. For example, reduction might be accomplished, for example, with transformation of a plant cell to comprise a promoter and other 5 and/or 3 regulatory regions described herein linked to an antisense nucleotide sequence, hairpin, RNA interfering molecule, double stranded RNA, microRNA or other nucleic acid molecule, such that tissue-preferred expression of the molecule interferes with translation of the mRNA of the native DNA sequence or otherwise inhibits expression of the native DNA sequence in plant cells. For further description of RNAi techniques or microRNA techniques, see, e.g., U.S. Pat. Nos. 5,034,323; 6,326,527; 6,452,067; 6,573,099; 6,753,139; and 6,777,588. See also International Publication Nos. WO 97/01952, WO 98/36083, WO 98/53083, WO 99/32619 and WO 01/75164; and U.S. Patent Application Publication Nos. 2003/0175965, 2003/0175783, 2003/0180945, 2004/0214330, 2005/0244858, 2005/0277610, 2006/0130176, 2007/0265220, 2008/0313773, 2009/0094711, 2009/0215860, 2009/0308041, 2010/0058498 and 2011/0091975. RNAi molecules or microRNA molecules (referred to collectively herein as RNAi molecules) can be prepared by the skilled artisan using techniques well known in the art, including techniques for the selection and testing of RNAi molecules and microRNA molecules that are useful for down regulating a CoTPS genes. See, for example, Wesley et al. (2001), Mysara et al. (2011) and Yan et al. (2012).
(52) It has typically been found that dsRNA of 200-700 bp are particularly suited for inducing RNAi in plants. It has also been found that hairpin RNAs containing an intron, for example, a construct comprising an RNA encoding sequence in a sense direction operably linked to an intron operably linked to an RNA encoding sequence in an antisense direction or vice versa which is capable of forming an intron-hairpin RNA (ihpRNA), is suitable for inducing RNAi in plants. See, for example, Wang et al. (2000), Fuentes et al. (2006), Bonfim et al. (2007) Vanderschuren et al. (2007a, 2007b), Zrachya et al. (2007). For example, a nucleic acid construct can be prepared that includes a nucleic acid that is transcribed into an RNA that can anneal to itself, e.g., a double stranded RNA having a stem-loop structure. In addition, hairpin structures can be prepared as described by Guo et al. (2003).
(53) For example, a nucleic acid construct can be prepared that includes a nucleic that is transcribed into an RNA that can anneal to itself, e.g., a double stranded RNA having a stem-loop structure. In some embodiments, one strand of the stem portion of a double stranded RNA comprises a sequence that is similar or identical to the sense coding sequence, or a fragment thereof, of a CoTPS as described herein, and that is from about 10 nucleotides to about 1,800 nucleotides in length. The length of the sequence that is similar or identical to the sense coding sequence can be from 10 nucleotides to 1000 nucleotides, from 15 nucleotides to 600 nucleotides, from 20 nucleotides to 500 nucleotides, or from 25 nucleotides to 100 nucleotides, or any length within the 10 nucleotides to 2,500 nucleotides. The other strand of the stem portion of a double stranded RNA comprises a sequence that is similar or identical to the antisense strand, or a fragment thereof, of the coding sequence of the polypeptide of interest, and can have a length that is shorter, the same as, or longer than the corresponding length of the sense sequence. In some cases, one strand of the stem portion of a double stranded RNA comprises a sequence that is similar or identical to the 3 or 5 untranslated region, or a fragment thereof, of the mRNA encoding the CoTPS, and the other strand of the stem portion of the double stranded RNA comprises a sequence that is similar or identical to the sequence that is complementary to the 3 or 5 untranslated region, respectively, or a fragment thereof, of the mRNA encoding the CoTPS. In other embodiments, one strand of the stem portion of a double stranded RNA comprises a sequence that is similar or identical to the sequence of an intron or a fragment thereof in the pre-mRNA encoding the CoTPS, and the other strand of the stem portion comprises a sequence that is similar or identical to the sequence that is complementary to the sequence of the intron or fragment thereof in the pre-mRNA.
(54) The loop portion of a double stranded RNA can be from 3 nucleotides to 5,000 nucleotides, e.g., from 3 nucleotides to 2500 nucleotides, from 15 nucleotides to 1,000 nucleotides, from 20 nucleotides to 500 nucleotides, or from 25 nucleotides to 200 nucleotides, or any length within the 3 nucleotides to 5,000 nucleotides. The loop portion of the RNA can include an intron or a fragment thereof. A double stranded RNA can have zero, one, two, three, four, five, six, seven, eight, nine, ten, or more stem-loop structures.
(55) Once a nucleic acid has been cloned into an expression vector, it may be introduced into a plant cell using conventional transformation procedures. Similarly, once a nucleic acid construct has been prepared that contains or encodes a molecule which suppresses or inhibits the expression of a CoTPS gene, the nucleic acid may be introduced into a plant cell using conventional transformation procedures. The term plant cell is intended to encompass any cell derived from a plant including undifferentiated tissues such as callus and suspension cultures, as well as plant seeds, pollen or plant embryos. Plant tissues suitable for transformation include leaf tissues, root tissues, meristems, protoplasts, hypocotyls, cotyledons, scutellum, shoot apex, root, immature embryo, pollen, and anther. Transformation means the directed modification of the genome of a cell by the external application of recombinant DNA from another cell of different genotype, leading to its uptake and integration into the subject cell's genome. In this manner, genetically modified plants, plant cells, plant tissue, seed, and the like can be obtained.
(56) DNA constructs containing the nucleic acids of the present invention encoding the CoTPS proteins can be used to transform any monocot or dicot plant and particularly ylang ylang varieties. The constructs may be introduced into the genome of the desired plant host by a variety of conventional techniques. Techniques for transforming a wide variety of higher plant species are well known and described in the technical and scientific literature. Transformation protocols may vary depending on the type of plant or plant cell, i.e., monocot or dicot, targeted for transformation, as is well known to the skilled artisan. For example, the DNA construct may be introduced directly into the genomic DNA of the plant cell using techniques such as electroporation and microinjection of plant cell protoplasts, or the DNA constructs can be introduced directly to plant tissue using ballistic methods, such as DNA particle bombardment. Alternatively, the DNA constructs may be combined with suitable T-DNA flanking regions and introduced into a conventional Agrobacterium tumefaciens host vector. The virulence functions of the Agrobacterium tumefaciens host will direct the insertion of the construct and adjacent marker into the plant cell DNA when the cell is infected by the bacteria. Thus, any method, which provides for effective transformation/transfection may be employed. See, for example, U.S. Pat. Nos. 7,241,937, 7,273,966 and 7,291,765 and U.S. Patent Application Publication Nos. 2007/0231905 and 2008/0010704 and references cited therein. See also, International Published Application Nos. WO 2005/103271 and WO 2008/094127 and references cited therein.
(57) Transformed plant cells which are derived by any of the above transformation techniques can be cultured to regenerate a whole plant which possesses the transformed genotype and thus the desired phenotype, e.g., a transgenic plant. A transgenic plant is a plant into which foreign DNA has been introduced. A transgenic plant encompasses all descendants, hybrids, and crosses thereof, whether reproduced sexually or asexually, and which continue to harbor the foreign DNA. Regeneration techniques rely on manipulation of certain phytohormones in a tissue culture growth medium, typically relying on a biocide and/or herbicide marker which has been introduced together with the desired nucleotide sequences. See for example, International Published Application No. WO 2008/094127 and references cited therein.
(58) The foregoing methods for transformation are typically used for producing a transgenic variety in which the expression cassette is stably incorporated. After the expression cassette is stably incorporated in transgenic plants, it can be transferred to other plants by sexual crossing. In one embodiment, the transgenic variety could then be crossed, with another (non-transformed or transformed) variety, in order to produce a new transgenic variety. Alternatively, a genetic trait which has been engineered into a particular ylang ylang line using the foregoing transformation techniques could be moved into another line using traditional backcrossing techniques that are well known in the plant breeding arts. For example, a backcrossing approach could be used to move an engineered trait from a public, non-elite variety into an elite variety, or from a variety containing a foreign gene in its genome into a variety or varieties which do not contain that gene. As used herein, crossing can refer to a simple X by Y cross, or the process of backcrossing, depending on the context. Any of a number of standard breeding techniques can be used, depending upon the species to be crossed.
(59) Once transgenic plants of this type are produced, the plants themselves can be cultivated in accordance with conventional procedures. Transgenic seeds can, of course, be recovered from the transgenic plants. These seeds can then be planted in the soil and cultivated using conventional procedures to produce transgenic plants. The cultivated transgenic plants will express the DNA of interest in a tissue-preferred or tissue-specific manner as described herein.
(60) In a fourth aspect, the present invention provides a method for manipulating synthesis of a terpene or sesquiterpene in a transgenic plant to alter fragrance/flavor characteristics and/or plant pathogen interactions and/or insect interactions. In one embodiment, the transgenic plant may be any plant species. In another embodiment, the transgenic plant may be a Cananga odorata plant. In a further embodiment, the transgenic plant may be Cananga odorata var. fruticosa (dwarf ylang ylang). In one embodiment, the synthesis of the sesquiterpenes -ylangene, -copaene and -cubebene is manipulated by overexpressing the CoTPS2 protein in the transgenic plant compared to a non-transgenic plant. In another embodiment, the synthesis of the sesquiterpene -bergamotene is manipulated by overexpressing the CoTPS3 protein in the transgenic plant compared to a non-transgenic plant. In an additional embodiment, the synthesis of multiproduct -thujene/sabinene/-pinene/-terpinene is manipulated by overexpressing the CoTPS I protein in the transgenic plant compared to a non-transgenic plant. In a further embodiment, the synthesis of the terpene geraniol is manipulated by overexpressing the CoTPS4 protein in the transgenic plant compared to a non-transgenic plant. In some embodiments, the synthesis of the described terpenes or sesquiterpenes is manipulated by reducing expression of the corresponding CoTPS protein in the transgenic plant compared to a non-transgenic plant.
(61) In one embodiment, an expression vector described herein is introduced into plant cells to obtain a transgenic plant, in which the synthesis of the terpene (-thujene/sabinene/-pinene/-terpinene or geraniol) or sesquiterpene (-bergamotene or -ylangene/-copaene/-cubebene) is manipulated. Even a transgenic plant is not necessary to be obtained. Depending on the host plant, the nucleic acids of the present invention may be introduced into plant cells such that the nucleic acid encoding a flowering protein described herein can be expressed in the plant cells.
(62) In another embodiment, a nucleotide sequence is integrated into the genomic DNA of a plant to enhance the expression of the endogenous CoTPS gene. Preferably, examples of such a nucleotide sequence include an expression control sequence. More specifically, examples of such an expression control sequence include promoter sequences and enhancer sequences. Such an expression control sequence is operably integrated into the genomic DNA of a plant to enhance the expression of the endogenous CoTPS gene in the plant. As described herein, enhanced expression of CoTPS2 gene in the plant will enhance synthesis of -ylangene, -copaene and -cubebene in the plant. Similarly, enhanced expression of CoTPS3 gene in the plant will enhance synthesis of -bergamotene in the plant. Similarly, enhanced expression of CoTPS1 gene in the plant will enhance synthesis of -thujene/sabinene/-pinene/-terpinene in the plant. Similarly, enhanced expression of CoTPS4 gene in the plant will enhance synthesis of geraniol in the plant.
(63) In a fifth aspect, the present invention provides a method of preparing at least one terpene or sesquiterpene comprising the steps of (a) culturing a cell which has been genetically modified with a polynucleotide of the invention to provide CoTPS activity and (b) separating the at least one terpene or sesquiterpene produced. In one embodiment, the cells may be any cell type that can be grown in culture. In another embodiment, the cells may be bacteria or yeast cells for producing the terpene or sesquiterpene. In one embodiment, the at least one sesquiterpene is -ylangene, -copaene and/or -cubebene and the CoTPS activity is CoTPS2 activity. In another embodiment, the at least one sesquiterpene is -bergamotene and the CoTPS activity is CoTPS3 activity. In an additional embodiment, the at least one terpene is -thujene/sabinene/-pinene/-terpinene and the CoTPS activity is CoTPS1 activity. In a further embodiment, the at least one terpene is geraniol and the CoTPS activity is CoTPS4 activity. In one embodiment, the cell contains a metabolic pathway for producing farnesyl pyrophosphate which provides the farnesyl pyrophosphate that is the substrate for CoTPS2 or CoTPS3. In another embodiment, the cell has been transformed with a nucleic acid encoding farnesyl pyrophosphate synthase to produce farnesyl pyrophosphate which provides the farnesyl pyrophosphate that is the substrate for CoTPS2 or CoTPS3. In one embodiment, the cell contains a metabolic pathway for producing geranyl diphosphate which provides the geranyl diphosphate that is the substrate for CoTPS1 or CoTPS4. In another embodiment, the cell has been transformed with a nucleic acid encoding geranyl diphosphate synthase to produce geranyl diphosphate which provides the geranyl diphosphate that is the substrate for CoTPS1 or CoTPS4. Techniques for synthesizing terpenes and/or sesquiterpenes in cell culture are described in, for example U.S. Pat. Nos. 7,453,024 and 8,062,878, U.S. Patent Application Publication Nos. 2012/0107893 and 2013/0302861 and International Published Application No. WO 2011/074954.
(64) In this aspect of the invention, the nucleic acid construct contains a promoter that is operably in the host cell and that is operatively linked to the CoTPS2 encoding nucleic acid described herein. Examples of suitable yeast promoters include, but not limited to, cupper inducible promoter CUP1 (P.sub.CUP1) as well as promoters for pyruvate decarboxylase (PDC1), phosphoglycerate kinase (PGK), xylose reductase (XR), xylitol dehydrogenase (XDH), L-(+)-lactate-cytochrome c oxidoreductase (CYB2), translation elongation factor-1 (TEF1) and translation elongation factor-2 (TEF2) genes. Additional yeast promoters include the GAP promoter, GAL1 promoter, AOX1 promoter, FLD1 promoter, ADH1 promoter, GAL3 promoter, GAL4 promoter, GALT promoter, CTR1 promoter, CTR3 promoter, MET3 promoter and TDH1 promoter. The nucleic acid construct may also contain a terminator. Examples of yeast terminators include, but not limited to, terminators for ADH1, TDH1, pyruvate decarboxylase (PDC1), xylose reductase, (XR), xylitol dehydrogenase (XDH), L-lactate:ferricytochrome c oxidoreductase (CYB2) or iso-2-cytochrome c (CYC) genes (e.g., terminator of CYC1 (T.sub.CYC1)), or a terminator from the galactose family of genes in yeast, particularly the GAL10 terminator and GAL80 terminator.
(65) Various methods can be used to introduce the expression vector of some embodiments of the invention into bacterial or yeast cells. Such methods are generally described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1982, 1989, 2001, 2012), in Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989), Chang et al., Somatic Gene Therapy, CRC Press, Ann Arbor, Mich. (1995), Vega et al., Gene Targeting, CRC Press, Ann Arbor Mich. (1995), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass. (1988) and Gilboa et al. (Biotechniques 4 (6): 504-512, 1986) and include, for example, stable or transient transfection, lipofection, electroporation and infection with recombinant viral vectors. In addition, see U.S. Pat. Nos. 5,464,764 and 5,487,992 for positive-negative selection methods.
(66) The method further comprises providing and/or maintaining conditions suitable for sesquiterpene production within the yeast cell, e.g. cultivating the yeast under conditions conducive to the production of the sesquiterpenes, prior to isolating the sesquiterpenes. These conditions are known to the skilled person. Generally, they may be adjusted by selection of an adequate medium, temperature, and pH.
(67) The sesquiterpenes may be isolated from the culture medium or the yeast cells by any method used in the art including, but not limited to, chromatography, extraction, in-situ product removal and distillation.
(68) It will also be appreciated that transformation of other non-plant hosts is feasible, including well known prokaryotic and eukaryotic cells, such as bacteria (e.g. E. coli, Agrobacterium, Lactobacillus), fungi, yeast, insect cells and animal cells. Such transformation enables production of recombinant polypeptides of the invention. Cell free systems (e.g. Roche Rapid Translation System) for production of recombinant proteins can also be used (Zubay Annu Rev Genet 7, 267-287 (1973)). The polypeptides of the invention produced in any such hosts may be isolated and purified from same using well known techniques. The polypeptides may be used in cell-free systems for synthesis of sesquiterpenes for flavoring or scent uses, or for use in pheromone or antimicrobial agents. Such compounds could be -ylangene, -copaene or -cubebene.
(69) The pleasant fragrance of ylang ylang varieties (Cananga odorata) are mainly due to volatile organic compounds (VOCs) produced by the flowers. Floral scents are a key factor in plant-insect interactions and are vital for successful pollination. C. odorata var. fruticosa or dwarf ylang ylang is a variety of ylang ylang which is popularly grown in Southeast Asia as a small and compact shrub with aromatic flowers. The following Examples describe the combined use of bioinformatics and chemical analysis to discover the VOC biosynthesis pathways and related genes. The scented flowers of C. odorata var. fruticosa were analysed by GC-MS and a total of 49 volatile organic compounds were identified at four different stages of flower development. The bulk of these VOCs were terpenesmainly sesquiterpenes. The various terpene synthases (TPSs) involved in the production of these essential oils was identified using RNA-seq on mature flowers. From the RNA-seq data, 4 full-length TPSs were functionally characterized. In vitro assays showed that recombinant proteins from two TPSs, CoTPS1 and CoTPS4 synthesized -thujene/sabinene/-pinene/-terpinene and geraniol from geranyl diphosphate, respectively. Accordingly, they were classified as mono-TPSs. The other two TPSs were identified as sesqui-TPSs. CoTPS3 catalysed the conversion of farnesyl diphosphate to -bergamotene, whereas CoTPS2 was found to be a multifunctional and novel TPS which could catalyse the synthesis of three sesquiterpene compounds, -ylangene/-copaene/-cubebene. Additionally, in vitro results of the two sesqui-TPSs were confirmed in planta by transient expression of these TPSs in N. benthamiana leaves by Agrobacterium-mediated infiltration.
(70) The practice of the present invention employs, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA, genetics, immunology, cell biology, cell culture and transgenic biology, which are within the skill of the art. See, e.g., Maniatis et al., 1982, Molecular Cloning (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Sambrook et al., 1989, Molecular Cloning, 2nd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Sambrook and Russell, 2001, Molecular Cloning, 3rd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Green and Sambrook, 2012, Molecular Cloning, 4th Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Ausubel et al., 1992), Current Protocols in Molecular Biology (John Wiley & Sons, including periodic updates); Glover, 1985, DNA Cloning (IRL Press, Oxford); Russell, 1984, Molecular biology of plants: a laboratory course manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Anand, Techniques for the Analysis of Complex Genomes, (Academic Press, New York, 1992); Guthrie and Fink, Guide to Yeast Genetics and Molecular Biology (Academic Press, New York, 1991); Harlow and Lane, 1988, Antibodies, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984); Transcription And Translation (B. D. Hames & S. J. Higgins eds. 1984); Culture Of Animal Cells (R. I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Methods In Enzymology, Vols. 154 and 155 (Wu et al. eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-IV (D. M. Weir and C. C. Blackwell, eds., 1986); Riott, Essential Immunology, 6th Edition, Blackwell Scientific Publications, Oxford, 1988; Fire et al., RNA Interference Technology: From Basic Science to Drug Development, Cambridge University Press, Cambridge, 2005; Schepers, RNA Interference in Practice, Wiley-VCH, 2005; Engelke, RNA Interference (RNAi): The Nuts & Bolts of siRNA Technology, DNA Press, 2003; Gott, RNA Interference, Editing, and Modification: Methods and Protocols (Methods in Molecular Biology), Human Press, Totowa, N.J., 2004; Sohail, Gene Silencing by RNA Interference: Technology and Application, C R C, 2004.
EXAMPLES
(71) The present invention is described by reference to the following Examples, which are offered by way of illustration and are not intended to limit the invention in any manner. Standard techniques well known in the art or the techniques specifically described below were utilized
Example 1
Materials and Methods
(72) Plant Materials:
(73) Cananga odorata var. fruticosa (known as dwarf ylang ylang) was grown in Singapore were collected in November for RNA-seq. Four different stages of flowers and leaves of of dwarf ylang ylang were obtained in April for further experiments. The four different stages of flowers are as follows: (B) bud stage; completely closed petal, green; (I) initial-flowering stage: semi-open small and short petals, green, 9 days after bud stage; (II) full-flowering stage: completely open large and long petals, yellowish green, 20 days after bud stage; (III) end-flowering stage: fully matured petals, yellow, 30 days after bud stage.
(74) Four-week old Nicotiana benthamiana plants grown in a greenhouse were used for in vivo characterization and subcellular localization of CoTPSs.
(75) Essential Oils Extraction from Ylang Ylang Flowers:
(76) Flowers and leaves from ylang ylang were frozen in liquid nitrogen and ground to a powder by pre-chilled mortar and pestle. About 500 mg of powder was dissolved in 500 l ethyl acetate (Fisher Scientific) including 1 l (10 mg/ml) of camphor (Sigma-Aldrich) as internal standard. The slush was vortexed and incubated on a horizontal shaker at 50 rpm for 2 hr. After centrifugation of the mixture at 13,000 g for 10 min, the resulting ethyl acetate upper layer extract was transferred into a new Eppendorf tube and mixed with 300 mg anhydrous Na.sub.2SO.sub.4 (Sigma-Aldrich) to remove water. Following the second centrifugation, the extract was transferred into a 2 ml glass vial for gas chromatography-mass spectrometry (GC-MS) analysis (Agilent Technologies).
(77) RNA Isolation for RNA Sequencing:
(78) Frozen ylang ylang flowers were homogenized using pre-chilled mortar and pestle into a fine powder, and total RNA was isolated using the TRIzol method (Invitrogen). Purified RNA samples were first treated with RNase-free DNase1 (Roche) to remove genomic DNA and then extracted by chloroform. The RNA quantity was determined with Nanodrop spectrophotometer, ND-1000 (Thermo Fisher Scientific). The RNA integrity number (RIN) was evaluated using Agilent 2100 bioanalyzer and RNA 6000 Nano Labchip Kit (Agilent Technologies). RNA with a RN value of 7<x<10 was sent for RNA-seq to the Rockefeller University Genomics Resource Center (New York, USA). RNA-seq and assembly were described in Jin et al (2014).
(79) Quantitative Real Time PCR (qRT-PCR):
(80) Quantitative RT-PCR was performed to investigate gene expression pattern during ylang ylang flower development. One g of total RNA was used for first-strand cDNA synthesis with M-MLV reverse transcriptase (RT) (Promega). The qRT-PCR reactions were performed using Applied Biosystems (AB) 7900HT fast real-time PCR system and AB power SYBR green PCR master mix (Life technologies). Oligonucleotide primers for qRT-PCR were designed for selected genes of MEP, MVA, shikimate, benzyl and phenyl propanoid pathways using the Primer3 (http colon slash slash bioinfo dot ut dot ee slash primer3-0.4.0 slash) and listed in Table 1. Each PCR product obtained from regular PCR was cloned into pGEM-T easy vector (Promega) and then verified by sequencing. Specificity of the amplified PCR product was assessed by a melting curve analysis. All experiments were carried out in technical triplicates and with biological duplicates. Non-template control was included for each gene to exclude random/reagent contamination and primer-dimer formation. A mock reaction containing all the RT-PCR reagents except the reverse transcriptase was used as a negative control. Actin gene was used as an internal normalization in each qRT-PCR.
(81) TABLE-US-00001 TABLE1 OligonucleotidePrimers Name Forward(SEQIDNO:) Reverse(SEQIDNO:) ForqRT-PCR DXS1 TTTGATTGGGGGTGAGAGAG(13) GCCATCAAGGGACATGAACT(14) DXS2 GGGGATCACAAAATCCATTG(15) TGGGTAGCCTTTTCCCTTTT(16) DXS3 CTTCTGCAAGCCCCTAGATG(17) GTTGCAGCAATGTGCCTAGA(18) DXS4 AAGGGGAGAATCCTTGCAGT(19) TGTTCTTGGCAAAGCTTCCT(20) DXR GTTCTGAGTGCAGCCAATGA(21) CAAGAACAGGTCGCAGATCA(22) CMS AGGAGCGTGTCAGTGGTTCT(23) TGGCAAATTTCAGGTCAACA(24) CMK TCGGTTCTGATTGTCCCTTC(25) CGAAGGCGCTTGTAAACTTC(26) MCS ACGCAAGCAAAAACTCTCGT(27) CGGTAGCGTTATCAGCATCA(28) HDS GTGGCTCCATTTGAGGAAAA(29) AATCCACAGTGGCAAGATCC(30) IDI1 ACTGTACAAGGCCCCATCTG(31) CCCACCATTTCAGAAGGAAA(32) ID12 CATGAGTTGCTCCTTCAGCA(33) AAGCTTCCTTTGTGCAGCAT(34) AACT TGCAGTGAAGTCTGCTGGTC(35) CAACAGAGTTGCCACACAGC(36) HMGS CAAGACTTGGCTGATGCAAA(37) AACAACAAGCCCAAATCGTC(38) HMGR CAGGCTGATTTCCCTGACAT(39) CTGGCATGTGCATTGTATCC(40) MVK GGTGTTTCGGAGAGAGCTTG(41) ACCCCCATGCACTGAAGTAG(42) PMK TGCTCCTCGATGCTACAATG(43) AGGGTCTTCTCTGACCAGCA(44) MPDC CCCATCAATGACAGCATCAG(45) CGTATTCGGATCTCCCTCAA(46) DAHPS ATCCTCCATCTTCCCTGCTT(47) TTCTTGGATTTCCAGCCATC(48) DHQS CCTTTCCTTCCGCTTTCTCT(49) TTCCATGAACATGCCTTTGA(50) SDH TGATCAGCTAGAGCGCAGAA(51) CCATCTGTTCGACGGATTTT(52) SK CACCGTTCCGAAGATTTGTT(53) CCAGACCCCATCATACCAAC(54) CS GCTGCTGGAAGTTCTTTTGG(55) TCTGTCCTGGCCTCCTTCTA(56) PAL AATCTCTCAGGGGGAAGGAA(57) CAACCCCAGCGAGTTTACAT(58) SAMT TTAACGGCAGGAAGAGCCTA(59) ATCACGGCCTTCATTTCTTG(60) CHS TTCTGTTCCTCAAGCGGAGT(61) CGGAAGTAGCCCACATTCAT(62) CHI CATGAGCATGGTCAGGAAGA(63) GCACAGCAACTCACTTTCCA(64) F3H TATCTCTGGTGGGGATCGAC(65) CTGCTTCTCCCTGAAGATGG(66) DFR GCAATGGTGATTGGTCCTCT(67) GAAGCGGAATTGATGGGTAA(68) C4H ACCCACAAGCTTCCCTACCT(69) AGGTACCAGGCATTCACCAG(70) 4CL GTTGCACCTGCAGAACTTGA(71) ACCTTCCGCAGTCTCTTGAA(72) CCR GGAGCGATCTGGACTACTGC(73) GAACATCGACGTAGGCCTGT(74) CVOMT GCATGCTCACTCATTCTGGA(75) CCCAAAGACTTTTTCCGTGA(76) C3H ACGCTCCAGGAGAAGTACGA(77) CACACGGTCCAATTCCTCTT(78) COMT ACTCTCCAGTGCCTGTGCTT(79) AGCTGCCCGTTGTCTAGTGT(80) CCOMT TTGGATACCAGCGTCTACCC(81) CTCACGGTTGATGTCCATTG(82) CAD AAAGTGGGAACAACGAATGC(83) ACCGACCTCTTTGACCACAC(84) TPS1 AGGGCCTTCCAGATTACATGAAGC(85) AGCGTTGGAGTGTACTTGCTATTG(86) TPS2 CATCGATCATGGATGACACATATGATG(87) CTCAACAGCAGTCAGAAGGGCAC(88) TPS3 AGGCTGTGGCTGAACCTCTA(89) AGCAGATCCTTCTTGCTGGA(90) TPS4 TAGCCATCTTACTGGTGATTGACG(91) GTAGTGTTGTACAATGCCATGTAAC(92) actin CTGGACGTGACCTCACAGATGCT(93) TCTTCTCAACAGAGGAGCTGCTCT(94) ForTOPOCloning TPS1 CACCATGGCCTTGAATACGTTCTTGCATTTTCC(95) CTCAAGCACGATGGGTTCAACGGTAAGTGA(96) TPS2 CACCATGGCACTTATATTTGCAAATGGCCACTCTGA(97) ATCAACAAAACGGTCCACTAGCACCATCGCA(98) TPS3 CACCATGAATCCTGTTTCTCTTTTGAGCTTATCAGGAG(99) AACTTGTTGGGAAAATAGAGCCATGGCTTGA(100) TPS4 CACCATGGCTGCTACGAGAAACCTTTCTTTACTT(101) ATTGAAAGGCGTGAAAAACAAAGCTTGCA(102) ForE.coliexpressionvectors TPS1 aaGGATCCgATGGCCITGAATACGTTCTTGCATTTTC(103) aaGCGGCCGCTTACTCAAGCACGATGGGTTCAAC(104) TPS2 aacGTCGACATGGCACTTATATTTGCAAATGGCCACTCTGA(105) aaaGCGGCCGCTTAATCAACAAAACGGTCCACTAGCA(106) TPS3 aacGGATCCgATGAATCCTGTTTCTCTTTTGAGCTTATCAGGAG(107) aacGTCGACAACTTGTTGGGAAAATAGAGCCATGGCT(108) TPS4 aaaGGATCCtATGGCTGCTACGAGAAACCTTTCTTTACTT(109) aaaGTCGACATTGAAAGGCGTGAAAAACAAAGCTTGCA(110) GGATCC, Bam HI; GCGGCCGC, Not I; GTCGAC, Sal I
(82) Sequence Identification, Multiple Sequence Alignments and Phylogenetic Analysis:
(83) DNA sequences were edited and assembled using DNASTAR Lasergene 8 (DNASTAR, Inc.). The phylogenetic analysis of CoTPSs was performed using the maximum likelihood method in MEGA version 6 program (Tamura et al., 2011).
(84) Isolation of Full-Length cDNA of CoTPS and Vector Construction for Agrobacterium-Mediated Gene Expression:
(85) Full-length open reading frames (ORFs) of CoTPSs were amplified by PCR from dwarf ylang ylang flowers-derived cDNA with the primer sets listed in Table 1. Purified PCR products were cloned into pENTR/D-TOPO (Invitrogen). For YFP-fusion construct, the pTOPO clone harbouring each CoTPS gene was integrated into the destination vector, pBA-DC-YFP expression vector (Zhang et al., 2005), which contains the CaMV 35S promoter and C-terminal in frame YFP, to create CoTPS-YFP by LR Clonase (Invitrogen). All constructs were verified by DNA sequencing. The final plasmid was then transformed into GV3101 Agrobacterium tumefaciens by electroporation system (Bio-Rad), plated on LB plate containing spectinomycin (100 g/ml) and gentamycin (20 g/ml), and incubated at 28 C. for 2 days.
(86) Subcellular Localization of CoTPSs:
(87) To determine the subcellular localization of CoTPSs, Agrobacterium-mediated transient gene expression was performed using leaves of 4 week old N. benthamiana plant as described (Jin et al., 2014). Infiltrated N. benthamiana leaves expressing YFP-fused protein were excised, mounted onto slides, and imaged by a confocal laser scanning microscopy (Carl Zeiss LSM5 Exciter) with a standard filter set. Images were processed with LSM Image Browser (Carl Zeiss).
(88) Preparation of Recombinant Proteins:
(89) To construct the vectors for the recombinant N-terminal poly-histidine (His)-tagged proteins, the full-length cDNAs of CoTPS was amplified by PCR with the primers designed restriction enzymes sites to the ends (Table 1). The PCR-amplified product and pET28b plasmid (Novagen) were separately digested with the corresponding restriction enzymes (New England Biolabs) and purified with Qiagen PCR purification kit (Qiagen). Then, the digested PCR product was cloned into pET28b expression vector using Rapid DNA ligation kit (Roche). The final construct was transformed into E. coli BL21(DE3)pLysS (invitrogen) and recombinant proteins purified from E. coli extracts after isopropyl -D-1-thiogalactopyranoside induction as described (Jang et al., 2005).
(90) In Vitro TPS Assay:
(91) In vitro enzyme assay for TPS activity was performed in a final volume of 500 l of reaction buffer (25 mM HEPES pH 7.4, 100 mM KCl, 7.5 mM MgCl2, 5% (v/v) glycerol, 5 mM DTT), with about 20 g of recombinant protein, and 10 g of either farnesyl pyrophosphate (FPP) or geranyl pyrophosphate (GPP) (Sigma-Aldrich). The reaction mixtures were gently mixed and carefully overlaid with 250 l hexane (Sigma-Aldrich) to trap volatile products. The tube was then sealed with parafilm and incubated at 30 C. for 2 hr, followed by 1 min vortex. After centrifugation at 1,200 g, 4 C. for 30 min, the hexane upper layer was transferred into a 2 ml glass vial for GC-MS analysis (see below GC-MS analysis). As a negative control, heat-inactivated recombinant protein was added to the enzyme assay.
(92) In Vivo Characterization of CoTPSs:
(93) For in vivo TPS activity assay, Agrobacterium strain harbouring CoTPS construct was infiltrated with or without the strain carrying Arabidopsis HMGR (3-hydroxy-3-methylglutaryl-CoA reductase; AtHMGR) under the control of the CaMV 35S promoter into the underside of N. benthamiana leaves (Jin et al., 2014). All experiments were carried out with the viral-encoded protein P19 to improve transgene expression by suppressing post-transcriptional gene silencing (Voinnet et al, 2003). After infiltration, tobacco plants were maintained in a growth chamber at 25 C., under long day condition (16 hr light/8 hr dark) for 3 days. Four to five infiltrated leaves were frozen immediately in liquid nitrogen and then homogenized with a pre-chilled mortar and pestle. Up to 400-600 mg of leaf powder were obtained from 4-5 leaves. Subsequent sample processing for GC-MS analysis was performed as described above (See Essential oils extraction from ylang ylang flowers). A CaMV 35S::AtHMGR construct served as a negative control.
(94) GC-MS Analysis:
(95) GC-MS analysis was performed on Agilent 7890A GC (Agilent Technologies) system and an Agilent-Technologies 5975C inert XL Mass selective detector, equipped with a HP-5MS UI column (30 m0.25 mm0.25 m; Agilent Technologies). Conditions were as follows: 5 l sample injection, splitless injection, oven program 50 C. (1 min hold) at 8 C. min-1 to 300 C. (5 min hold). For data processing, MSD ChemStation Data Analysis (Agilent Technologies) was used. The essential oil components were identified by comparison of their mass spectra with those in NIST 2011 library data of GC-MS system and comparison of their retention indices (RI). The retention indices (RI) were determined on the basis of n-alkanes (C8-C40) mix standard (Sigma-Aldrich) under the same operation conditions. Camphor was added to serve as an internal standard. The amount of each compound was calculated by measuring its peak area related to that of a known amount of camphor. The identified components along with their RI and relative % values are listed in Table 2.
Example 2
Stage Specific Variations of Volatile Organic Compounds in Dwarf Ylang Ylang Flowers
(96) Flowers can emit different volatile compounds at different stages of development (Dudareva et al., 2000). The dwarf ylang ylang flowers have little floral scent when the petals are green but their scent gradually becomes stronger as the flower matures. To examine the overall intensity and the diversity of the floral scent during flower development, total essential oils from flowers at four different stages of development were analysed by gas chromatography-mass spectrometry (GC-MS) (
(97) TABLE-US-00002 TABLE 2 Essential Oils Composition of the Flowers from Cananga odorata var. fruticosa Relative contents (%).sup.d No.sup.a Compounds RT (min).sup.b RI.sup.c Formula Bud I II III 1 -Thujene 9.507 904 C.sub.10H.sub.16 0.21 0.36 2 -Pinene 9.652 919 C.sub.10H.sub.16 3.08 1.30 0.99 0.65 3 Camphene 9.894 943 C.sub.10H.sub.16 0.13 4 Sabinene 10.199 974 C.sub.10H.sub.16 0.26 0.43 5 -Pinene 10.342 988 C.sub.10H.sub.16 0.45 0.66 6 -Phellandrene 10.661 993 C.sub.10H.sub.16 0.05 7 -Terpinene 10.846 1012 C.sub.10H.sub.16 0.27 8 p-Cresol methyl ether 10.884 1016 C.sub.8H.sub.10O 0.49 9 trans--Ocimene 11.054 1023 C.sub.10H.sub.16 0.46 0.88 1.55 10 -Ocimene 11.170 1024 C.sub.10H.sub.16 0.40 1.09 1.99 11 -Terpinene 11.397 1027 C.sub.10H.sub.16 0.15 12 Terpinolene 12.011 1032 C.sub.10H.sub.16 0.16 13 -Linalool 12.102 1040 C.sub.10H.sub.18O 0.38 0.99 1.40 14 Neo-allo-ocimene 12.594 1089 C.sub.10H.sub.16 0.18 15 3,4-Dimethoxytoluene 14.460 1197 C.sub.9H.sub.12O.sub.2 0.39 16 2-Methoxy-4-vinylphenol 15.854 1276 C.sub.9H.sub.10O.sub.2 0.19 17 -Elemene 16.176 1306 C.sub.15H.sub.24 0.16 18 Eugenol 16.481 1309 C.sub.10H.sub.12O.sub.2 0.17 19 -Copaene 16.831 1321 C.sub.15H.sub.24 1.81 1.24 0.83 0.44 20 -Gurjunene 17.025 1340 C.sub.15H.sub.24 3.00 1.16 0.56 0.32 21 Methyleugenol 17.062 1344 C.sub.11H.sub.14O.sub.2 0.08 22 -Caryophyllene 17.600 1398 C.sub.15H.sub.24 16.47 23.50 15.90 11.57 23 -Ylangene 17.683 1406 C.sub.15H.sub.24 3.55 1.80 1.16 0.63 24 (E)--Farnesene 17.836 1421 C.sub.15H.sub.24 0.51 0.61 0.77 25 -Muurolene 17.910 1429 C.sub.15H.sub.24 1.21 0.60 0.38 0.20 26 Humulene 18.020 1440 C.sub.15H.sub.24 3.44 3.44 2.24 1.63 27 -Cubebene 18.110 1449 C.sub.15H.sub.24 1.02 0.35 0.19 0.08 28 GermacreneD 18.580 1450 C.sub.15H.sub.24 50.17 33.17 27.33 13.26 29 -Farnesene 18.686 1461 C.sub.15H.sub.24 10.03 19.89 31.50 30 -Bergamotene 18.771 1469 C.sub.15H.sub.24 18.67 23.63 26.79 31 Cedrene 18.932 1485 C.sub.15H.sub.24 0.32 0.33 32 -Cadinene 18.989 1491 C.sub.15H.sub.24 1.54 0.43 0.17 0.17 33 -Patchoulene 19.035 1495 C.sub.15H.sub.24 0.07 0.13 34 Elemicin 19.233 1515 C.sub.12H.sub.16O.sub.3 0.13 35 Germacrene D-4-ol 19.845 1537 C.sub.15H.sub.26O 0.75 0.21 0.16 0.13 36 -Caryophyllene oxide 19.950 1548 C.sub.15H.sub.24O 0.07 37 Isoelemicin 20.561 1609 C.sub.12H.sub.16O.sub.3 0.15 0.13 38 Farnesol 21.527 1763 C.sub.15H.sub.26O 0.88 0.85 0.75 39 Benzyl benzoate 22.236 1812 C.sub.14H.sub.12O.sub.2 0.27 0.69 40 cis-11-Hexadecenal 22.505 1830 C.sub.16H.sub.30O 0.11 41 Octadecanal 22.623 1841 C.sub.18H.sub.36O 0.07 42 (E,E,) farnesol acetate 22.941 1873 C.sub.17H.sub.28O.sub.2 0.10 0.10 43 Z-9-Hexadecen-1-ol 23.328 1912 C.sub.16H.sub.32O 0.17 44 9-Nonadecene 23.475 1918 C.sub.19H.sub.38 0.18 45 Benzyl salicylate 23.600 1931 C.sub.14H.sub.12O.sub.3 0.21 46 -Elemene 16.173 1308 C.sub.15H.sub.24 4.81 0.98 0.34 47 -Ylangene 18.662 1458 C.sub.15H.sub.24 7.16 48 -Cadinene 18.910 1483 C.sub.15H.sub.24 1.31 0.52 49 -Copaene-11-ol 21.094 1720 C.sub.15H.sub.24O 0.67 .sup.aCompound listed in order of elution in a HP-5MS UI column; .sup.bRT, retention time (min); .sup.cRI, retention indices calculated against C.sub.8-C.sub.40 n-alkanes on the HP-5MS UI column; .sup.dRelative contents were done by calculating percentage of moles using internal standard, camphor (10 ug/ul).
(98) Two sesquiterpenes, -caryophyllene and germacrene D could be found at all stages and their levels were retained or slightly decreased during open flower development (#22, 28,
Example 3
RNA Sequencing, De Novo Assembly and Annotation of Transcriptome
(99) To profile ylang ylang floral transcriptome, RNA-seq libraries that were synthesized from the ylang ylang mature yellow flowers were sequenced. Illumina sequencing runs generated more than 110 million reads of 101 base pairs (bp) and the quality of reads were evaluated by FastQC (
(100) TABLE-US-00003 TABLE 3 Overview of the Assembly Results of RNA-seq # isoforms N50 (bp) # unigenes # annotation % annotation 86,512 2,016 45,379 30,539 67.3
Example 4
RNA-Seq Analysis of Different Biosynthetic Pathways Active in Flowers
(101) GC-MS analysis of the mature flowers showed a domination of VOCs by terpenes and minor benzenoids/phenolpropanoid compounds. The RNA-seq data was used to analyze the expression profile of the precursor pathways leading to the formation of VOCs in mature flowers. Majority of ylang ylang orthologue unigenes were full length and showed high sequence similarity with known enzymes of these pathways from other plants (
Example 5
Phylogenetic Analysis of TPS Genes from Dwarf Ylang Ylang Flowers
(102) Domination of terpenes is observed in the floral VOCs. From the dwarf ylang ylang RNA-seq data 4 full-length open reading frames (ORFs) of TPSs were PCR-amplified from cDNA pools of dwarf ylang ylang flowers. Phylogenetic analysis based on the deduced amino acid sequences of four CoTPS cDNAs showed that CoTPS2 (561 amino acids) belongs to the TPS-a subfamily representing the sesqui-TPSs, whereas CoTPS1 (590 amino acids) and CoTPS3 (547 amino acids) fall into the IFS-b subfamily, which consist mainly of mono-TPSs (Chen et al., 2011;
Example 6
Subcellular Localization and Expression of Four CoTPSs
(103) Apart from the phylogenetic analysis and bioinformatics-based attempts to classify TPSs, their subcellular localization is also important for function prediction. This is especially true for CoTPS3, since its function was unpredictable from the bioinformatics analyses based on amino acid sequences. To address this issue, full-length cDNA of each CoTPS fused to yellow fluorescent protein (YFP) reporter gene to produce a CoTPS-YFP fusion protein was transiently expressed in N. benthamiana leaves using Agrobacterium-mediated infiltration.
(104) Transcript levels for the four CoTPS genes at different developmental stages of dwarf ylang ylang flowers were examined by qRT-PCR. The expression levels of all four transcripts were very low or below detection limits in leaf tissues and greatly elevated in flower tissues (
Example 7
Functional Characterization of CoTPSs
(105) The subcellular localization of each CoTPS-YFP provided preliminary evidence to elucidate the function of each TPS. The exact functional annotation of a new TPS requires activity characterization of the recombinant protein. To determine the enzymatic activity of CoTPSs in vitro, 6His-tagged CoTPSs recombinant proteins purified from E. coli BL21(DE3) (
(106) Similarly, recombinant CoTPS2 catalyzed the synthesis of three compounds, -ylangene, -copaene, and -cubebene from FPP. These results suggest that CoTPS2 is a multifunctional -ylangene/-copaene/-cubebene synthase capable of producing three sesquiterpenes, -ylangene, -copaene, and -cubebene (
(107) CoTPS3 is a member of TPS-b family with an unusual feature that it lacks a putative N-terminal Tp sequence. Enzyme assays showed that CoTPS3 catalysed the formation of -bergamotene from FPP (
Example 8
Functional Characterization of CoTPS In Vivo
(108) Whether CoTPSs would produce the same terpene products in vivo was investigated using Agrobacterium-mediated transient gene expression in tobacco leaves. The YFP-fused CoTPS1, CoTPS2, CoTPS3, or CoTPS4 was expressed in N. benthamiana with or without co-expression of the Arabidopsis 3-Hydroxy-3-Methylglutaryl Coenzyme A Reductase (HMGR). HMGR catalyses a rate limiting step of the mevalonate pathway and its overexpression is known to increases heterologous sesquiterpene production (Song et al., 2012; Jin et al., 2014). Analysis by GC-MS showed that the in vivo results were consistent with those obtained in vitro. CoTPS2-YFP produced clearly three compounds, -ylangene, -copaene and -cubebene when it was co-expressed with AtHMGR (
Example 9
Dwarf Ylang Ylang Essential Oils are Quantitatively Dominated by Sesquiterpene Compounds
(109) Like jasmine and rose extracts, scent extracts derived ylang ylang flowers are widely used in the perfumery, cosmetic, and food industries. Plants use the vibrant colors and VOCs of flowers to attract pollinators. The chemical composition of floral VOCs produced by ylang ylang varieties has been previously reported (Gaydou et al, 1986; Benini et al., 2010, 2012; Brokl et al., 2013). These papers show the presence of volatile terpenes, benzenoid and phenylpropanoids in floral VOCs. A previous report described the composition of essential oils of ylang ylang flowers originating from Madagascar (Cananga odorata Hook Fil. et Thomson forma genuina) (Gaydou et al, 1986). These authors found that the primary component was the monoterpene linalool (19%), and the other major compounds were two sesquiterpenes, -caryophyllene (10.7%) and germacrene D (10.3%) (Gaydou et al., 1986). Additionally, the variety of ylang ylang from Madagascar contained more than 20% of other aromatic compounds such as p-methylanisole, benzyl benzoate, methyl benzoate and benzyl salicylate (Gaydou et al., 1986). By contrast, our analysis on volatile essential oils of dwarf ylang ylang flowers (C. odorata var. fruticosa) showed that over 90% of it is composed of sesquiterpenes, such as -farnesene (31.50%), -bergamotene (26.79%), germacrene D (13.26%), -caryophyllene (11.57%), humulene (1.63%), farnesol (0.75%), trans--farnesene (0.77%) and -ylangen (0.63%) (
Example 10
RNA-Seq Uncovers Terpene Synthase Genes from Dwarf Ylang Ylang
(110) The RNA-seq approach provided a rich resource to identify and functionally characterize TPSs from the flowers of dwarf ylang ylang. Approximately 16 candidate TPS transcripts for various mono- and sesquiterpenes were found from the transcriptome data of dwarf ylang ylang flowers. However, many of the candidate TPS transcripts contained partial mRNA sequences from the RNA-seq data. Amongst the four CoTPSs transcripts studied, the expression level of CoTPS1 was the highest, followed by CoTPS2 and CoTPS3, with CoTPS4 being the lowest. However, the RNA-seq expression level of CoTPSs transcripts did not exactly correlate with the abundance of terpenes produced by these TPSs when analyzed by GC-MS. This may be due to post-translational modification or a reflection of different enzyme activities.
Example 11
Sequence Characteristics of CoTPSs
(111) According to the phylogenetic analysis, CoTPS1 and CoTPS3 were grouped into TPS-b subfamily, which commonly represents angiosperm mono-TPSs. Generally, the TPS-b group contains two distinct structural domains, the plastid TP domain and the R(R)X.sub.8W (SEQ B3 NO:1) motif for monoterpene cyclization located at N-terminal region of mature TPS (Bohlmann et al., 1998). CoTPS1 appears to be a typical member of TPS-b subfamily, and has both these mono-TPS characteristics. In vitro studies also showed that CoTPS1 catalyzed the formation of the monoterpene, -thujene/sabinene/-pinene/-terpinene from GPP. In contrast to CoTPS1, CoTPS3 has a conserved R(R)X.sub.8W (SEQ ID NO:1) motif, but no TP sequence for plastid targeting, which explains its cytosolic localization in transient expression assays (
(112) Conversely, the CoTPS4 contains N-terminal 35 amino acid residues of a putative plastid TP sequence, but lacks the R(R)X.sub.8W (SEQ ID NO:1) motif, a characteristic feature of TPS-b mono-TPS. CoTPS4 was annotated as a plastid geraniol synthase through Blast X analysis since it closely resembled the geraniol synthase from Madagascar periwinkle (Catharanthus roseus), with an amino acid sequence identity of 84% (Simkin et al., 2013). As expected, this protein catalysed the synthesis of geraniol from GPP in vitro. Since the new TPS-g family lacking the R(R)X.sub.8W (SEQ ID NO:1) motif was first defined from Snapdragon TPS genes related to floral scent biosynthesis (Dudareva et al., 2003), two additional TPS genes belonging to the TPS-g family were subsequently identified from Arabidopsis and rice. These TPSs produce an acyclic monoterpene linalool (Chen et al., 2011; Yuan et al., 2008), which eventually became a prominent feature for members of the TPS-g group. As expected from a member of TPS-g family CoTPS4 produced an acyclic geraniol and the protein sequence clustered closely with the grapevine geraniol synthases of the TPS-g subfamily (Martin et al., 2010) indicating these TPS functions are highly conserved among plants.
Example 12
CoTPS2 is a Multifunctional and Novel Sesquiterpene Synthase
(113) Many TPSs are known to synthesize several products simultaneously. Typical multiproduct mono-TPSs such as cineole synthases, terpinene synthases, terpinolene synthases, bornyl diphosphate synthases, carene synthases and myrcene synthases additionally produce the same compounds such as sabinene, /-pinene (Fhnrich et al., 2011; Chen et al., 2003; Fldt et al., 2003; Shimada et al., 2004; Lcker et al., 2002). Most of the multiproduct TPSs are likely to synthesize one or two compounds dominantly as major products and others as minor components. Interestingly, CoTPS1 was capable of producing all four monoterpenes, -thujene, sabinene, -pinene, and -terpinene at similar levels, which was named as -thujene/sabinene/-pinene/-terpinene synthase in this study. Monoterpene thujene, usually referred to as -thujene, has two double-bond isomers known as -thujene and sabinene. Since all thujene synthases identified catalyses the form, CoTPS1 possessed the ability to cyclize GPP to -thujene, found in dwarf ylang ylang flowers.
(114) Some sesqui-TPSs belonging to the TPS-a subfamily from Magnolia and kiwifruit preserved the N-terminal R(R)X.sub.8W (SEQ ID NO:1) motif (Lee and Chappell, 2008; Nieuwenhuizen et al., 2009). This is the case with CoTPS2 in this study. While CoTPS3 and CoTPS4 produced a single terpene product, -bergamotene and geraniol, respectively, CoTPS2 was able to synthesize three kinds of sesquiterpenes, -ylangene, -copaene, and -cubebene (
(115) Almost all the terpenes produced by the four CoTPSs are accounted for in the ylang ylang essential oils composition as shown in
(116) TPSs for -bergamotene and geraniol have been reported in other plant species (Lu et al., 2002; Landmann et al, 2007; Iijima et al, 2004). However, exclusive -ylangene/-copaene/-cubebene synthase has not yet been reported. -cubebene synthase gene has been identified in Magnolia grandiflora (Lee and Chappell, 2008), as Mg25, sharing 55% amino acid sequence identity and 72% similarity to CoTPS2. -ylangene/-cubebene or -copaene/-cubebene were found as minor peaks out of total 52 or 15 sesquiterpenes synthesized in vitro assays in Abies grandis or Medicago truncatula (Steele et al., 1998; Arimura et al., 2008). Interestingly, a fungal (Coprinus cinereus) sesqui-TPS that synthesizes 10 different sesquiterpenes with -cadinene and -copaene as the major products was capable of synthesizing -ylangene, when the amino acid residues which presumably interact with a conserved Asp in the two metal-binding motifs were mutated (Lopez-Gallego et al, 2010). -ylangene is a diastereomer of -copaene, however it was not produced by the wild type sesqui-TPS (Lopez-Gallego et al., 2010). In conclusion, CoTPS2 is a multifunctional and novel TPS producing three sesquiterpenes, -ylangene, -copaene, and -cubebene in vitro as well as in vivo. -copaene, the isomer of -copaene is a potent attractant for an agricultural pest, Mediterranean fruit flies, Ceratitis capitata (Nishida et al., 2000).
(117) The use of the terms a and an and the and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms comprising, having, including, and containing are to be construed as open-ended terms (i.e., meaning including, but not limited to,) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., such as) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
(118) Embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.
BIBLIOGRAPHY
(119) Arimura G, Garms S, Maffei M, Bossi S, Schulze B, Leitner M, Mithofer A, Boland W. 2008. Herbivore-induced terpenoid emission in Medicago truncatula: concerted action of jasmonate, ethylene and calcium signaling. Planta 227, 453-464. Benini C, Danflous J P, Wathelet J P, du Jardin P, Fauconnier M L. 2010. Ylang-ylang [Cananga odorata (Lam.) Hook. f. & Thomson]: An unknown essential oil plant in an endangered sector. Biotechnology, Agronomy, Society and Environment 14, 693-705. Benini C, Mahy G, Bizoux J P, Wathelet J P, du Jardin P, Brostaux Y, Fauconnier M L. 2012. Comparative chemical and molecular variability of Cananga odorata (Lam.) Hook.f. & Thomson forma genuina (ylang-ylang) in the Western Indian Ocean Islands: implication for valorization. Chemistry & Biodiversity 9, 1389-1402. Bohlmann J, Meyer-Gauen G, Croteau R. 1998. Plant terpenoid synthases: molecular biology and phylogenetic analysis. Proceedings of the National Academy of Sciences, USA 95, 4126-4133. Bonfim, K. et al. 2007. RNAi-mediated resistance to Bean golden mosaic virus in genetically engineered common bean (Phaseolus vulgaris). Mol Plant Microbe Interact 20:717-726. Brokl M, Fauconnier M L, Benini C, Lognay G, du Jardin P, Focant J F. 2013. Improvement of Ylang-Ylang Essential Oil Characterization by GCXGC-TOFMS. Molecules 18, 1783-1797. Burdock G A, Carabin L G. 2008. Safety assessment of ylang-ylang oil as a food ingredient. Food and Chemical Toxicology 46, 433-445. Chang Y T, Chu F H. 2011. Molecular cloning and characterization of monoterpene synthases from Litsea cubeba. Tree Genetics and Genomes 7, 835-844. Chen F, Tholl D, Bohlmann J, Pichersky E. 2011. The family of terpene synthases in plants: a mid-size family of genes for specialized metabolism that is highly diversified throughout the kingdom. The Plant Journal 66, 212-229. Chiu, W. et al. 1996. Engineered GFP as a vital reporter in plants. Current Biology 6:325-330. Christensen, A. H. and Quail, P. H. 1989. Sequence analysis and transcriptional regulation by heat shock of polyubiquitin transcripts from maize. Plant Mol Biol 12:619-632. Christensen, A. H. et al. 1992. Maize polyubiquitin genes: structure, thermal perturbation of expression and transcript splicing, and promoter activity following transfer to protoplasts by electroporation. Plant Mol Biol 18:675-689. Cordoba E, Porta H, Arroyo A, San Roman C, Medina L, Rodriguez-Concepcion M, Leon P. 2011. Functional characterization of the three genes encoding 1-deoxy-D-xylulose 5-phosphate synthase in maize. Journal of Experimental Botany 62, 2023-2038. Degenhardt J, Kllner T G, Gershenzon J. 2009. Monoterpene and sesquiterpene synthases and the origin of terpene skeletal diversity in plants. Phytochemistry 70, 1621-1637. De Wet, J. R. et al. 1987. Firefly luciferase gene: structure and expression in mammalian cells. Mol Cell Biol 7:725-737. Dudareva N, Cseke L, Blanc V M, Pichersky E. 1996. Evolution of floral scent in Clarkia: novel patterns of S-linalool synthase gene expression in the C. breweri flower. The Plant Cell 8, 1137-1148. Dudareva N, Murfitt L M, Mann C J, Gorenstein N, Kolosova N, Kish C M, Bonham C, Wood K. 2000. Developmental regulation of methyl benzoate biosynthesis and emission in snapdragon flowers. The Plant Cell 12, 949-961.\ Dudareva N, Martin D, Kish C M, Kolosova N, Gorenstein N, Faldt J, Miller B, Bohlmann J. 2003. (E)--Ocimene and myrcene synthase genes of floral scent biosynthesis in snapdragon: function and expression of three terpene synthase genes of a new terpene synthase subfamily. The Plant Cell 15, 1227-1241. Dudareva N, Klempien A, Muhlemann J K, Kaplan I. 2013. Biosynthesis, function and metabolic engineering of plant volatile organic compounds. New Phytologist 198, 16-32. Falara V, Akhtar T A, Nguyen T T, et al. 2011. The tomato terpene synthase gene family. Plant Physiology 157, 770-789. Fuentes, A. et al. 2006. Intron-hairpin RNA derived from replication associated protein C1 gene confers immunity to tomato yellow leaf curl virus infection in transgenic tomato plants. Transgenic Res 15:291-304. Gaydou E M, Randriamiharisoa R, Bianchini J P. 1986. Composition of the essential oil of Ylang-Ylang (Cananga odorata Hook Fil. et Thomson forma genuina) from Madagascar. Journal of Agricultural and Food Chemistry 34, 481-487. Goff, S. A. et al. 1990. Transactivation of anthocyanin biosynthetic genes following transfer of B regulatory genes into maize tissues. EMBO J 9:2517-2522. Grabherr M G, Haas B J, Yassour M, et al. 2011. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nature Biotechnology 29, 644-652. Guo, H. S. et al. 2003. A chemical-regulated inducible RNAi system in plants. Plant J 34:383-392. Harju A T, Pennanen S M, Liesivuori J. 2004. The efficacy of benzyl benzoate sprays in killing the storage mite Tyrophagus putrescentiae (Acari: Acaridae). Annals of Agricultural and Environmental Medicine 11, 115-119. Hoballah M E, Stuurman J, Turlings T C, Guerin P M, Conntable S, Kuhlemeier C. 2005. The composition and timing of flower odour emission by wild Petunia axillaris coincide with the antennal perception and nocturnal activity of the pollinator Manduca sexta. Planta 222, 141-150. Huber F K, Kaiser R, Sauter W, Schiestl F P. 2005. Floral scent emission and pollinator attraction in two species of Gymnadenia (Orchidaceae). Oecologia 142, 564-575. Iijima Y, Gang D R, Fridman E, Lewinsohn E, Pichersky E. 2004. Characterization of geraniol synthase from the peltate glands of sweet basil. Plant Physiology 134, 370-379. Jang I C, Yang J Y, Seo H S, Chua N H. 2005. HFR1 is targeted by COP1 E3 ligase for post-translational proteolysis during phytochrome A signalling. Genes and Development 19, 593-602. Jefferson R A, Kavanagh T A, Bevan M W. 1987. GUS fusion: -glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J 6, 3901-39. Jin J, Panicker D, Wang Q, Kim M J, Liu J, Yin J-L, Wong L, Jang I C, Chua N H, Sarojam R. 2014. Next generation sequencing unravels the biosynthetic ability of Spearmint (Mentha spicata) peltate glandular trichomes through comparative transcriptomics. BMC genomics 14, 292 Jones C G, Moniodis J, Zulak K G, Scaffidi A, Plummer J A, Ghisalberti E L, Barbour E L, Bohlmann J. 2011. Sandalwood fragrance biosynthesis involves sesquiterpene synthases of both the terpene synthase (TPS)-a and TPS-b subfamilies, including santalene synthases. Journal of Biological Chemistry 286, 17445-17454. Kain, S. R. et al. 1995. Green fluorescent protein as a reporter of gene expression and protein localization. Biotechniques 19:650-655. Kessler A, Baldwin I T. 2001. Defensive function of herbivore-induced plant volatile emissions in nature. Science 291, 2104-2105. Knudsen J T, Tollsten L, Bergstrm L G. 1993. Floral scentsa checklist of volatile compounds isolated by head-space techniques. Phytochemistry 33, 253-280. Knudsen J T, Eriksson R, Gershenzon J, Stahl B. 2006. Diversity and distribution of floral scent. The Botanical Review 72, 1-120. Kramer W, Fritz H J. 1987. Oligonucleotide-directed construction of mutations via gapped duplex DNA. Methods Enzymology 154, 350-367. Landmann C, Fink B, Festner M, Dregus M, Engel K H, Schwab W. 2007. Cloning and functional characterization of three terpene synthases from lavender (Lavandula angustifolia). Archives of Biochemistry and Biophysics 465, 417-429. Last, D. I. et al. 1991. pEmu: an improved promoter for gene expression in cereal cells. Theor Appl Genet 81:581-588. Lee S, Chappell J. 2008. Biochemical and genomic characterization of terpene synthases in Magnolia grandiflora. Plant Physiology. 147, 1017-1033. Lopez-Gallego F, Waerzyn G T, Schmidt-Dannert C. 2010. Selectivity of fungal seaquiterpene synthases: Role of the active site's H-1 Loop in Catalysis. Applied Environmental Microbiology 76, 7723-7733. Martin D M, Fldt J, Bohlmann J. 2004. Functional characterization of nine Norway Spruce TPS genes and evolution of gymnosperm terpene synthases of the TPS-d subfamily. Plant Physiology 135, 1908-1927. Martin D M, Aubourg S, Schouwey M B, Daviet L, Schalk M, Toub O, Lund S T, Bohlmann, J. 2010. Functional annotation, genome organization and phylogeny of the grapevine (Vitis vinifera) terpene synthase gene family based on genome assembly, FLcDNA cloning, and enzyme assays. BMC Plant Biology 10, 226. McElroy, D. et al. 1990. Isolation of an efficient actin promoter for use in rice transformation. Plant Cell 2:163-171. McGarvey D J, Croteau R. 1995. Terpenoid metabolism. The Plant Cell 7, 1015-1026. Mercke P, Crock J, Croteau R, Brodelius P E. 1999. Cloning expression, and characterization of epi-cedrol synthase, a sesquiterpene cyclase from Artemisia annua L. Archives of Biochemistry and Biophysics 369, 213-222. Muhlemann J K, Klempien A, Dudareva N. 2014. Floral volatiles: from biosynthesis to function. Plant, Cell & Environment 37, 1936-1949. Munck S L, Croteau R. 1990. Purification and characterization of the sesquiterpene cyclase patchoulol synthase from Pogostemon cablin. Archives of Biochemistry and Biophysics 282, 58-64. Mysara, M. et al. 2011. MysiRNA-designer: a workflow for efficient siRNA design. PLOS one 6(10):e25642. Nieuwenhuizen N J, Wang M Y, Matich A J, Green S A, Chen X, Yauk Y K, Beuning L L, Nagegowda D A, Dudareva N, Atkinson R G. 2009. Two terpene synthases are responsible for the major sesquiterpenes emitted from the flowers of kiwifruit (Actinidia deliciosa). Journal of Experimental Botany 60, 3203-3219. Nishida R., Shelly T E, Whittier T S, Kaneshiro K Y. 2000. -Copaene, A Potential Rendezvous Cue for the Mediterranean Fruit Fly, Ceratitis Capitata? Journal of Chemical Ecology 26, 87-100. Odell, J. T. et al. 1985. Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter. Nature 313:810-812. Orlova I, Marshall-Colon A, Schnepp J, et al. 2006. Reduction of benzenoid synthesis in petunia flowers reveals multiple pathways to benzoic acid and enhancement in auxin transport. The Plant Cell 18, 3458-3475. Quevillon E, Silventoinen V, Pillai S, Harte N, Mulder N, Apweiler R, Lopez R. 2005. InterProScan: protein domains identifier. Nucleic Acids Research 33, W116-W120. Phillips M A, Walter M H, Ralph S G, et al. 2007. Functional identification and differential expression of 1-deoxy-D-xylulose 5-phosphate synthase in induced terpenoid resin formation of Norway spruce (Picea abies). Plant Molecular Biology 65, 243-257. Samakradhamrongthai R, Utama-Ang M, Thakeow P. 2009. Identification of volatile compounds released from dry scented Thai flowers and their potential application in flower-mixed tea. Asian Journal of Food and Agro-Industry 2, 525-534. Simkin A J, Miettinen K, Claudel P, et al. 2013. Characterization of the plastidial geraniol synthase from Madagascar periwinkle which initiates the monoterpenoid branch of the alkaloid pathway in internal phloem associated parenchyma. Phytochemistry 85, 36-43. Song A A, Abdullah J O, Abdullah M P, Shafee N, Othman R, Tan E F, Noor N M, Raha A R. 2012. Overexpressing 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) in the lactococcal mevalonate pathway for heterologous plant sesquiterpene production. PLOS ONE 7, e52444. Steele C L, Crock J, Bohlmann J, Croteau R. 1998. Sesquiterpene synthases from grand fir (Abies grandis): Comparison of constitutive and wound-induced activities, and cDNA isolation, characterization, and bacterial expression of 5-selinene synthase and -humulene synthase. Journal of Biological Chemistry 273, 2078-2089. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28, 2731-2739. Vanderschuren, H. et al. 2007a. Transgenic cassava resistance to African cassava mosaic virus is enhanced by viral DNA-A bidirectional promoter-derived siRNAs. Plant Mol Biol 64:549-557. Vanderschuren, H. et al. 2007b. Engineering resistance to geminivirusesreview and perspectives. Plant Biotechnology Journal 5:207-220. Vogt T. 2010. Phenylpropanoid biosynthesis. Molecular Plant 3, 2-20. Velten, J. et al. 1984. Isolation of a dual plant promoter fragment from the Ti plasmid of Agrobacterium tumefaciens. EMBO J 3:2723-2730. Voinnet O, Rivas S, Mestre P, Baulcombe D. 2003. An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. The Plant Journal 9, 949-956. Walter M, Hans J, Strack D. 2002. Two distantly-related genes encoding 1-deoxy-D-xylulose 5-phosphate synthases: differential regulation in shoots and apocarotenoid-accumulating mycorrhizal roots. The Plant Journal 31, 243-254. Wang, M. B. et al. 2000. A single copy of a virus-derived transgene encoding hairpin RNA gives immunity to barley yellow dwarf virus. Mol Plant Pathol 1:347-356. Wesley, S. V. et al. 2001. Construct design for efficient, effective and high-throughput gene silencing in plants. Plant J 27:581-590. Yan, P. et al. 2012. High-throughput construction of intron-containing hairpin RNA vectors for RNAi in plants. PLOS one 7(5):e38186. Yuan J S, Kllner T G, Wiggins G, Grant J, Degenhardt J, Chen F. 2008. Molecular and genomic basis of volatile-mediated indirect defense against insects in rice. The Plant Journal 55, 491-503. Zhang X, Garreton V, Chua N H. 2005. The AIP2 E3 ligase acts as a novel negative regulator of ABA signaling by promoting ABI3 degradation. Genes and Development 19, 1532-1543. Zrachya, A. et al. 2007. Production of siRNA targeted against TYLCV coat protein transcripts leads to silencing of its expression and resistance to the virus. Transgenic Res 16:385-398.