COMPOSITIONS AND METHODS FOR SCREENING MUTATIONS IN THYROID CANCER
20190112653 ยท 2019-04-18
Assignee
Inventors
- Shih-Min CHENG (San Juan Capistrano, CA, US)
- Joseph J. CATANESE (San Juan Capistrano, CA, US)
- Andrew GRUPE (San Juan Capistrano, CA, US)
- Feras Hantash (Mission Viejo, CA)
- Frederic M. WALDMAN (San Juan Capistrano, CA, US)
- Kevin QU (San Juan Capistrano, CA, US)
Cpc classification
C12Q2565/514
CHEMISTRY; METALLURGY
C12Q2600/106
CHEMISTRY; METALLURGY
C12N15/1068
CHEMISTRY; METALLURGY
C12Q2565/514
CHEMISTRY; METALLURGY
C12Q1/6874
CHEMISTRY; METALLURGY
International classification
C12Q1/6874
CHEMISTRY; METALLURGY
Abstract
The present technology relates to methods for determining whether a patient having thyroid nodules with indeterminate cytology will benefit from diagnostic surgery, e.g., lobectomy. These methods are based on screening a patient's thyroid nodules and detecting alterations in target nucleic acid sequences corresponding to a specific set of thyroid cancer-related genes. Kits for use in practicing the methods are also provided.
Claims
1. A method for detecting at least one mutation in a plurality of thyroid cancer-related genes in a subject comprising (a) extracting DNA from a FFPE thyroid sample or a FNA thyroid sample obtained from the subject; (b) generating a DNA library of a first plurality of amplicons using a hot start DNA polymerase that substantially lacks 5-3 exonuclease activity, wherein at least one amplicon corresponds to each of the plurality of thyroid cancer-related genes, said plurality of thyroid cancer-related genes comprising BRAF, NRAS, HRAS, KRAS, PIK3CA, TP53, CTNNB1, PTEN, TSHR, AKT1, GNAS, RET, TERT, and EIF1AX; (c) incorporating an adapter sequence on to the ends of the first plurality of amplicons via polymerase chain reaction; and (d) detecting at least one mutation in at least one of the first plurality of amplicons using high throughput massive parallel sequencing.
2. The method of claim 1, wherein the first plurality of amplicons is generated using at least two primer pairs disclosed in Table 1.
3. The method of claim 1, wherein the first plurality of amplicons is generated using no more than 1 ng of extracted DNA from the FFPE thyroid sample or the FNA thyroid sample.
4. The method of claim 1, wherein the first plurality of amplicons is generated using 1-25 ng of extracted DNA from the FFPE thyroid sample or the FNA thyroid sample.
5. The method of claim 1, wherein the first plurality of amplicons further comprises a unique index sequence.
6. The method of claim 1, wherein the hot start DNA polymerase that substantially lacks 5-3 exonuclease activity is Z05-Gold polymerase.
7. The method of claim 1, further comprising detecting a gene fusion product in one or more of RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, THADA, FGFR2 and ALK in the subject comprising (a) extracting RNA from the FFPE thyroid sample or the FNA thyroid sample obtained from the subject; (b) reverse-transcribing the extracted RNA into cDNA; (c) generating a cDNA library of a second plurality of amplicons using a hot start DNA polymerase with 5-3 exonuclease activity, wherein at least one amplicon corresponds to each of RET PPAR, NTRK1, NTRK3, BRAF, MET, LTK, THADA, FGFR2 and ALK; (d) incorporating an adapter sequence on to the ends of the second plurality of amplicons via polymerase chain reaction; and (e) detecting at least one gene fusion product in at least one of the second plurality of amplicons using high throughput massive parallel sequencing.
8. The method of claim 7, wherein the second plurality of amplicons is generated using at least two or more primers disclosed in Table 2.
9. The method of claim 7, wherein the second plurality of amplicons further comprises a unique index sequence.
10. The method of claim 7, wherein the hot start DNA polymerase with 5-3 exonuclease activity is AmpliTaq Gold.
11. The method of claim 7, wherein the at least one gene fusion product detected is selected from the group consisting of CCDC6 (PTC1) Exon 1/RET Exon 12, PRKAR1A Exon 8/RET Exon 12, NCOA4 Exon 10/RET Exon 12, NCOA4 Exon 9/RET Exon 12, GOLGA5 Exon 7/RET Exon 12, TRIM24 Exon 9/RET Exon 12, TRIM33 (PTC7) Exon 16/RET Exon 12, ERC1 (ELKS) Exon 11/RET Exon 12, KTN1 Exon 30/RET Exon 12, PCM1 Exon 29/RET Exon 12, TRIM27 Exon 3/RET Exon 12, HOOKS Exon 11/RET Exon 12, CREB3L2 Exon 2/PPAR Exon 5, PAX8 Exon 7/PPAR Exon 5, PAX8 Exon 8/PPAR Exon 5, PAX8 Exon 9/PPAR Exon 5, PAX8 Exon 10/PPAR Exon 5, ETV6 Exon 4/NTRK3 Exon 14, BRAF Exon 8/MACF1 Exon 15, AKAP9 Exon 8/BRAF Exon 9, AGK Exon 2/BRAF Exon 8, TFG Exon 5/NTRK1 Exon 12, TPM3 Exon 10/NTRK1 Exon 12, TPR Exon 21/NTRK1 Exon 12, ETV6 Exon 5/NTRK3 Exon 14, STRN Exon 3/ALK Exon 20, EML4 Exon 13/ALK Exon 20, EML4 Exon 20/ALK Exon 20, EML4 Exon 6/ALK Exon 20, TFG Exon 5/MET Exon 15, UACA Exon 17/LTK Exon 10, AGGF1 Exon 5/RAF1 Exon 8, MACF1 Exon 60/BRAF Exon 9, THADA Exon 27/PPARG Intron 2a, THADA Exon 27/PPARG Intron 2b, THADA Exon 27/Chr 7p non-coding (FUS7p), THADA Exon 28/IGF2BP3 Exon 4, TRA2A Exon 7/THADA Exon 37, FGFR2 Exon 16/OFD1 Exon 3, VCL Exon 1/FGFR2 Exon 18, and SND1 Exon 10/BRAF Exon 9.
12. The method of claim 1, wherein the FNA thyroid sample has been diagnosed as AUS/FLUS, FN/SFN or SUSP.
13. A method for selecting a subject having thyroid nodules with indeterminate cytology for diagnostic surgery comprising: (a) extracting DNA from a FNA thyroid sample obtained from the subject; (b) generating a DNA library of a first plurality of amplicons using a hot start DNA polymerase that substantially lacks 5-3 exonuclease activity, wherein at least one amplicon corresponds to each of the plurality of thyroid cancer-related genes, said plurality of thyroid cancer-related genes comprising BRAF, NRAS, HRAS, KRAS, PIK3CA, TP53, CTNNB1, PTEN, TSHR, AKT1, GNAS, RET, TERT, and EIF1AX; (c) incorporating an adapter sequence on to the ends of the first plurality of amplicons via polymerase chain reaction; and (d) selecting the subject for diagnostic surgery, if a mutation in at least one of the first plurality of amplicons corresponding to BRAF, NRAS, HRAS, KRAS, PIK3CA, TP53, CTNNB1, PTEN, TSHR, AKT1, RET, TERT, and EIF1AX is detected.
14. The method of claim 13, wherein the first plurality of amplicons is generated using at least two primer pairs disclosed in Table 1.
15. The method of claim 13, wherein the at least one mutation detected is selected from the group consisting of AKT1 E17K, BRAF V600E, BRAF K601E, KRAS G13D, KRAS G12V, KRAS Q61R, KRAS G12D, NRAS Q61R, NRAS Q61K, PIK3CA E545K, PIK3CA H1047R, PIK3CA G914R, HRAS Q61R, RET M918T, TSHR R274W, TSHR A581S, TERT 124 C>T and TERT 146 C>T.
16. The method of claim 13, wherein the first plurality of amplicons is generated using no more than 1 ng of extracted DNA from the FNA thyroid sample.
17. The method of claim 13, wherein the first plurality of amplicons is generated using 1-25 ng of extracted DNA from the FNA thyroid sample.
18. The method of claim 13, wherein the first plurality of amplicons further comprises a unique index sequence.
19. The method of claim 13, wherein the hot start DNA polymerase that substantially lacks 5-3 exonuclease activity is Z05-Gold polymerase.
20. The method of claim 13, further comprising detecting a gene fusion product in one or more of RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, THADA, FGFR2 and ALK in the subject comprising (a) extracting RNA from the FNA thyroid sample obtained from the subject; (b) reverse-transcribing the extracted RNA into cDNA; (c) generating a cDNA library of a second plurality of amplicons using a hot start DNA polymerase with 5-3 exonuclease activity, wherein at least one amplicon corresponds to each of RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, THADA, FGFR2 and ALK; (d) incorporating an adapter sequence on to the ends of the second plurality of amplicons via polymerase chain reaction; and (e) selecting the subject for diagnostic surgery, if a gene fusion product in at least one of the second plurality of amplicons corresponding to RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, THADA, FGFR2 and ALK is detected.
21. The method of claim 20, wherein the second plurality of amplicons is generated using at least two primers disclosed in Table 2.
22. The method of claim 20, wherein the gene fusion product detected is selected from the group consisting of CCDC6 (PTC1) Exon 1/RET Exon 12, PRKAR1A Exon 8/RET Exon 12, NCOA4 Exon 10/RET Exon 12, NCOA4 Exon 9/RET Exon 12, GOLGA5 Exon 7/RET Exon 12, TRIM24 Exon 9/RET Exon 12, TRIM33 (PTC7) Exon 16/RET Exon 12, ERC1 (ELKS) Exon 11/RET Exon 12, KTN1 Exon 30/RET Exon 12, PCM1 Exon 29/RET Exon 12, TRIM27 Exon 3/RET Exon 12, HOOK3 Exon 11/RET Exon 12, CREB3L2 Exon 2/PPAR Exon 5, PAX8 Exon 7/PPAR Exon 5, PAX8 Exon 81 PPAR Exon 5, PAX8 Exon 9/PPAR Exon 5, PAX8 Exon 10/PPAR Exon 5, ETV6 Exon 4/NTRK3 Exon 14, BRAF Exon 8/MACF1 Exon 15, AKAP9 Exon 8/BRA F Exon 9, AGK Exon 2/BRAF Exon 8, TFG Exon 5/NTRK1 Exon 12, TPM3 Exon 10/NTRK1 Exon 12, TPR Exon 21/NTRK1 Exon 12, ETV6 Exon 5/NTRK3 Exon 14, STRN Exon 3/ALK Exon 20, EML4 Exon 13/ALK Exon 20, EML4 Exon 20/ALK Exon 20, EML4 Exon 6/ALK Exon 20, TFG Exon 5/MET Exon 15, UACA Exon 17/LTK Exon 10, AGGF1 Exon 51 RAF1 Exon 8, MACF1 Exon 60/BRAF Exon 9, THADA Exon 27/PPARG Intron 2a, THADA Exon 27 PPARG Intron 2b, THADA Exon 27/Chr 7p non-coding (FUS7p), THADA Exon 28/IGF2BP3 Exon 4, TRA2A Exon 7/THADA Exon 37, FGFR2 Exon 16/OFD1 Exon 3, VCL Exon 1/FGFR2 Exon 18, and SND1 Exon 10/BRAF Exon 9.
23. The method of claim 20, wherein the second plurality of amplicons further comprises a unique index sequence.
24. The method of claim 20, wherein the hot start DNA polymerase with 5-3 exonuclease activity is AmpliTaq Gold.
25. The method of claim 13, wherein the FNA thyroid sample has been diagnosed as AUS/FLUS, FN/SFN or SUSP.
26. The method of claim 13, wherein the diagnostic surgery is lobectomy.
27. A method for predicting the risk of malignancy in a subject with inconclusive thyroid FNA cytology results comprising: (a) extracting DNA from a FNA thyroid sample obtained from the subject; (b) generating a DNA library of a first plurality of amplicons using a hot start DNA polymerase that substantially lacks 5-3 exonuclease activity, wherein at least one amplicon corresponds to each of the plurality of thyroid cancer-related genes, said plurality of thyroid cancer-related genes comprising BRAF, NRAS, HRAS, KRAS, PIK3CA, TP53, CTNNB1, PTEN, TSHR, AKT1, GNAS, RET, TERT, and EIF1AX; (c) incorporating an adapter sequence on to the ends of the first plurality of amplicons via polymerase chain reaction; and (d) identifying the subject as having a high risk of malignancy when a mutation in at least one of the first plurality of amplicons corresponding to BRAF, NRAS, HRAS, KRAS, PIK3CA, TP53, CTNNB1, PTEN, TSHR, AKT1, RET, TERT, and EIF1AX is detected.
28. The method of claim 27, wherein the first plurality of amplicons is generated using at least two primer pairs disclosed in Table 1.
29. The method of claim 27, further comprising detecting a gene fusion product in one or more of RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, THADA, FGFR2 and ALK in the subject comprising (a) extracting RNA from a FNA thyroid sample obtained from the subject; (b) reverse-transcribing the extracted RNA into cDNA; (c) generating a cDNA library of a second plurality of amplicons using a hot start DNA polymerase with 5-3 exonuclease activity, wherein at least one amplicon corresponds to each of RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, THADA, FGFR2 and ALK; (d) incorporating an adapter sequence on to the ends of the second plurality of amplicons via polymerase chain reaction; and (e) identifying the subject as having a high risk of malignancy when a gene fusion product in at least one of the second plurality of amplicons corresponding to RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, THADA, FGFR2 and ALK is detected.
30. The method of claim 29, wherein the second plurality of amplicons is generated using at least two primers disclosed in Table 2.
31. A kit comprising one or more primer pairs disclosed in Table 1 and instructions for use.
32. A kit comprising one or more primer pairs disclosed in Table 2 and instructions for use.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
DETAILED DESCRIPTION
[0049] The present disclosure provides methods for determining whether a patient having thyroid nodules with indeterminate cytology will benefit from diagnostic surgery, e.g., lobectomy. These methods are based on screening a patient's thyroid nodules and detecting alterations in target nucleic acid sequences corresponding to a specific set of thyroid cancer-related genes using a highly sensitive PCR-based NGS assay. Kits for use in practicing the methods are also provided.
[0050] FFPE specimens are integral to the diagnosis of virtually every suspected cancer case, and the estimated millions of archived samples can provide a wealth of molecular information about disease progression and treatment. While FFPE techniques are the standard for protecting tissues for downstream molecular analysis and ease of archiving, storage of tissues in formaldehyde solution results in extensive crosslinking of proteins to other proteins and to nucleic acids and in nucleic acid fragmentation. FFPE techniques can result in the partial denaturation of the DNA and may cause damage to the DNA base pairs themselves, thereby compromising the accuracy of NGS assays. Moreover, the amount of total nucleic acid material available in thyroid biopsy specimens is often limited (<10 ng DNA and RNA combined), thereby making the detection of genetic alterations in FFPE tissues or FNA samples extremely difficult. Traditional NGS protocols generally require at least 10-50 ng of nucleic acid input.
[0051] One objective of the present technology was to develop a highly sensitive PCR-based NGS screening assay that is economical in terms of its total nucleic acid input requirement from FFPE samples and FNA samples, and can simultaneously detect a broad range of mutations in specifically targeted exons, promoter regions, or other gene regions of a preselected set of thyroid cancer-related genes.
[0052] In one aspect, the methods disclosed herein require less DNA input from FFPE specimens or FNA samples, compared to other existing NGS PCR-based thyroid cancer screening assays.
[0053] The methods disclosed herein are useful in predicting whether a patient is at risk for having thyroid cancer, or predicting whether a patient risk for having suspected of having thyroid cancer will benefit from diagnostic surgery, e.g., lobectomy. Further, the methods of the present technology are useful in predicting the risk of malignancy in a subject having thyroid nodules with indeterminate cytology. Accordingly, DNA degradation/partial DNA denaturation during the FFPE process does not appear to influence the sensitivity of the screening assay of the present technology.
Definitions
[0054] As used herein, the term about in reference to a number is generally taken to include numbers that fall within a range of +/1%-5% (greater than or less than 1%-5%) of the number unless otherwise stated or otherwise evident from the context.
[0055] As used herein, the terms amplify or amplification with respect to nucleic acid sequences, refer to methods that increase the representation of a population of nucleic acid sequences in a sample. Nucleic acid amplification methods, such as PCR, isothermal methods, rolling circle methods, etc., are well known to the skilled artisan. Copies of a particular nucleic acid sequence generated in vitro in an amplification reaction are called amplicons or amplification products.
[0056] The term adapter refers to a short, chemically synthesized, nucleic acid sequence which can be used to ligate to the end of a nucleic acid sequence in order to facilitate attachment to another molecule. The adapter can be single-stranded or double-stranded. An adapter can incorporate a short (typically less than 50 base pairs) sequence useful for PCR amplification or sequencing.
[0057] As used herein, an alteration of a gene or gene product (e.g., a marker gene or gene product) refers to the presence of a mutation or mutations within the gene or gene product, e.g., a mutation, which affects the quantity or activity of the gene or gene product, as compared to the normal or wild-type gene. The genetic alteration can result in changes in the quantity, structure, and/or activity of the gene or gene product in a cancer tissue or cancer cell, as compared to its quantity, structure, and/or activity, in a normal or healthy tissue or cell (e.g., a control). For example, an alteration which is associated with thyroid cancer, can have an altered nucleotide sequence (e.g., a mutation), amino acid sequence, chromosomal translocation, intra-chromosomal inversion, copy number, expression level, protein level, protein activity, in a cancer tissue or cancer cell, as compared to a normal, healthy tissue or cell. Exemplary mutations include, but are not limited to, point mutations (e.g., silent, missense, or nonsense), deletions, insertions, inversions, linking mutations, duplications, translocations, inter- and intra-chromosomal rearrangements. Mutations can be present in the coding or non-coding region of the gene. In certain embodiments, the alterations are associated with a phenotype, e.g., a cancerous phenotype (e.g., one or more of thyroid cancer risk, progression, or responsiveness to treatment). In one embodiment, the alteration is associated with one or more of: a genetic risk factor for thyroid cancer, a positive treatment response predictor, a negative treatment response predictor, a positive prognostic factor, a negative prognostic factor, or a diagnostic factor.
[0058] The terms cancer or tumor are used interchangeably and refer to the presence of cells possessing characteristics typical of cancer-causing cells, such as uncontrolled proliferation, immortality, metastatic potential, rapid growth and proliferation rate, and certain characteristic morphological features. Cancer cells are often in the form of a tumor, but such cells can exist alone within an animal, or can be a non-tumorigenic cancer cell. As used herein, the term cancer includes premalignant, as well as malignant cancers. In some embodiments, the cancer is thyroid cancer.
[0059] The terms complementary or complementarity as used herein with reference to polynucleotides (i.e., a sequence of nucleotides such as an oligonucleotide or a target nucleic acid) refer to the base-pairing rules. The complement of a nucleic acid sequence as used herein refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5 end of one sequence is paired with the 3 end of the other, is in antiparallel association. For example, the sequence 5-A-G-T-3 is complementary to the sequence 3-T-C-A-5. Certain bases not commonly found in naturally-occurring nucleic acids may be included in the nucleic acids described herein. These include, for example, inosine, 7-deazaguanine, Locked Nucleic Acids (LNA), and Peptide Nucleic Acids (PNA). Complementarity need not be perfect; stable duplexes may contain mismatched base pairs, degenerative, or unmatched bases. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the oligonucleotide, base composition and sequence of the oligonucleotide, ionic strength and incidence of mismatched base pairs. A complement sequence can also be an RNA sequence complementary to the DNA sequence or its complement sequence, and can also be a cDNA.
[0060] As used herein, a control is an alternative sample used in an experiment for comparison purpose. A control can be positive or negative. A control nucleic acid sample or reference nucleic acid sample as used herein, refers to nucleic acid molecules from a control or reference sample. In certain embodiments, the reference or control nucleic acid sample is a wild type or a non-mutated DNA or RNA sequence. In certain embodiments, the reference nucleic acid sample is purified or isolated (e.g., it is removed from its natural state). In other embodiments, the reference nucleic acid sample is from a non-tumor sample, e.g., a normal adjacent tumor (NAT), or any other non-cancerous sample from the same or a different subject.
[0061] Detecting as used herein refers to determining the presence of a mutation or alteration in a nucleic acid of interest in a sample. Detection does not require the method to provide 100% sensitivity.
[0062] Gene as used herein refers to a DNA sequence that comprises regulatory and coding sequences necessary for the production of an RNA, which may have a non-coding function (e.g., a ribosomal or transfer RNA) or which may include a polypeptide or a polypeptide precursor. The RNA or polypeptide may be encoded by a full length coding sequence or by any portion of the coding sequence so long as the desired activity or function is retained. Although a sequence of the nucleic acids may be shown in the form of DNA, a person of ordinary skill in the art recognizes that the corresponding RNA sequence will have a similar sequence with the thymine being replaced by uracil, i.e., T is replaced with U.
[0063] A hot start, in the context of a nucleic acid amplification reaction, refers to a protocol, where at least one critical reagent is withheld from the reaction mixture (or, if present in the reaction mixture, the reagent remains inactive) until the temperature is raised sufficiently to provide the necessary hybridization specificity of the primer or primers. A hot start enzyme is an enzyme, typically a nucleic acid polymerase, capable of acting as the withheld or inactive reagent in a hot start protocol. For example, some hot start enzymes can be obtained by chemically modifying the enzyme. Examples of hot-start enzymes include Z05-Gold polymerase, KAPA HiFi and AmpliTaq Gold.
[0064] The term 5-3 exonuclease activity refers to an activity of a nucleic acid polymerase, typically associated with the nucleic acid strand synthesis, whereby nucleotides are removed from the 5 end of nucleic acid strand, e.g., E. coli DNA polymerase I has this activity, whereas the Klenow fragment does not.
[0065] A polymerase that substantially lacks 5-3 exonuclease activity refers to a polymerase that has 50% or less (e.g., <25%, <20%, <15%, <10%) 5-3 exonuclease activity than Taq DNA polymerase. Methods of measuring 5-3 exonuclease activity and conditions for measurement are described in, for example, U.S. Pat. No. 5,466,591. Examples of DNA polymerases substantially lacking 5 to 3 exonuclease activity include the Klenow fragment of E. coli DNA polymerase I; a Thermus aquaticus DNA polymerase (Taq) lacking the N-terminal 235 amino acids (e.g., as described in U.S. Pat. No. 5,616,494 and commonly referred to in the art as the Stoffel fragment). Other examples include a thermostable DNA polymerase having sufficient deletions (e.g., N-terminal deletions), mutations, or modifications so as to eliminate or inactivate the domain responsible for the 5-3 exonuclease activity, such as 705 polymerase, 705-Gold polymerase etc. See, e.g., U.S. Pat. No. 5,795,762.
[0066] The term hybridize as used herein refers to a process where two substantially complementary nucleic acid strands (at least about 65% complementary over a stretch of at least 14 to 25 nucleotides, at least about 75%, or at least about 90% complementary) anneal to each other under appropriately stringent conditions to form a duplex or heteroduplex through formation of hydrogen bonds between complementary base pairs. Hybridizations are typically and preferably conducted with probe-length nucleic acid molecules, preferably 15-100 nucleotides in length, more preferably 18-50 nucleotides in length. Nucleic acid hybridization techniques are described in Sambrook, et al., 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, N.Y. Hybridization and the strength of hybridization (i.e., the strength of the association between the nucleic acids) is influenced by such factors as the degree of complementarity between the nucleic acids, stringency of the conditions involved, and the thermal melting point (T.sub.m) of the formed hybrid. Those skilled in the art understand how to estimate and adjust the stringency of hybridization conditions such that sequences having at least a desired level of complementarity will stably hybridize, while those having lower complementarity will not. For examples of hybridization conditions and parameters, see, e.g., Sambrook, et al., 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, N.Y.; Ausubel, F. M. et al. 1994, Current Protocols in Molecular Biology, John Wiley & Sons, Secaucus, N.J. In some embodiments, specific hybridization occurs under stringent hybridization conditions. An oligonucleotide or polynucleotide (e.g., a probe or a primer) that is specific for a target nucleic acid will hybridize to the target nucleic acid under suitable conditions.
[0067] As used herein, the terms individual, patient, or subject are used interchangeably and refer to an individual organism, a vertebrate, a mammal, or a human. In a preferred embodiment, the individual, patient or subject is a human.
[0068] As used herein, the term library refers to a collection of nucleic acid sequences, e.g., a collection of nucleic acids derived from whole genomic, subgenomic fragments, cDNA, cDNA fragments, RNA, RNA fragments, or a combination thereof. In one embodiment, a portion or all of the library nucleic acid sequences comprises an adapter sequence. The adapter sequence can be located at one or both ends. The adapter sequence can be useful, e.g., for a sequencing method (e.g., an NGS method), for amplification, for reverse transcription, or for cloning into a vector.
[0069] The library can comprise a collection of nucleic acid sequences, e.g., a target nucleic acid sequence (e.g., a tumor nucleic acid sequence), a reference nucleic acid sequence, or a combination thereof). In some embodiments, the nucleic acid sequences of the library can be derived from a single subject. In other embodiments, a library can comprise nucleic acid sequences from more than one subject (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30 or more subjects). In some embodiments, two or more libraries from different subjects can be combined to form a library having nucleic acid sequences from more than one subject. In one embodiment, the subject is human having, or at risk of having, a cancer or tumor.
[0070] A library nucleic acid sequence refers to a nucleic acid molecule, e.g., a DNA, RNA, or a combination thereof, that is a member of a library. Typically, a library nucleic acid sequence is a DNA molecule, e.g., genomic DNA or cDNA. In some embodiments, a library nucleic acid sequence is fragmented, e.g., sheared or enzymatically prepared, genomic DNA. In certain embodiments, the library nucleic acid sequences comprise sequence from a subject and sequence not derived from the subject, e.g., adapter sequence, a primer sequence, or other sequences that allow for identification, e.g., barcode sequences.
[0071] The term multiplex PCR as used herein refers to amplification of two or more PCR products or amplicons which are each primed using a distinct primer pair.
[0072] Next-generation sequencing or NGS as used herein, refers to any sequencing method that determines the nucleotide sequence of either individual nucleic acid molecules (e.g., in single molecule sequencing) or clonally expanded proxies for individual nucleic acid molecules in a high throughput parallel fashion (e.g., greater than 10.sup.3, 10.sup.4, 10.sup.5 or more molecules are sequenced simultaneously). In one embodiment, the relative abundance of the nucleic acid species in the library can be estimated by counting the relative number of occurrences of their cognate sequences in the data generated by the sequencing experiment. Next generation sequencing methods are described, e.g., in Metzker, M. Nature Biotechnology Reviews 11:31-46 (2010).
[0073] As used herein, oligonucleotide refers to a molecule that has a sequence of nucleic acid bases on a backbone comprised mainly of identical monomer units at defined intervals. The bases are arranged on the backbone in such a way that they can bind with a nucleic acid having a sequence of bases that are complementary to the bases of the oligonucleotide. The most common oligonucleotides have a backbone of sugar phosphate units. A distinction may be made between oligodeoxyribonucleotides that do not have a hydroxyl group at the 2 position and oligoribonucleotides that have a hydroxyl group at the 2 position. Oligonucleotides may also include derivatives, in which the hydrogen of the hydroxyl group is replaced with organic groups, e.g., an allyl group. Oligonucleotides of the method which function as primers or probes are generally at least about 10-15 nucleotides long and more preferably at least about 15 to 25 nucleotides long, although shorter or longer oligonucleotides may be used in the method. The exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. The oligonucleotide may be generated in any manner, including, for example, chemical synthesis, DNA replication, restriction endonuclease digestion of plasmids or phage DNA, reverse transcription, PCR, or a combination thereof. The oligonucleotide may be modified e.g., by addition of a methyl group, a biotin or digoxigenin moiety, a fluorescent tag or by using radioactive nucleotides.
[0074] As used herein, the term primer refers to an oligonucleotide, which is capable of acting as a point of initiation of nucleic acid sequence synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a target nucleic acid strand is induced, i.e., in the presence of different nucleotide triphosphates and a polymerase in an appropriate buffer (buffer includes pH, ionic strength, cofactors etc.) and at a suitable temperature. One or more of the nucleotides of the primer can be modified for instance by addition of a methyl group, a biotin or digoxigenin moiety, a fluorescent tag or by using radioactive nucleotides. A primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5 end of the primer, with the remainder of the primer sequence being substantially complementary to the strand. The term primer as used herein includes all forms of primers that may be synthesized including peptide nucleic acid primers, locked nucleic acid primers, phosphorothioate modified primers, labeled primers, and the like. The term forward primer as used herein means a primer that anneals to the anti-sense strand of dsDNA. A reverse primer anneals to the sense-strand of dsDNA.
[0075] As used herein, primer pair refers to a forward and reverse primer pair (i.e., a left and right primer pair) that can be used together to amplify a given region of a nucleic acid of interest.
[0076] As used herein, a sample refers to a substance that is being assayed for the presence of a mutation in a nucleic acid of interest. Processing methods to release or otherwise make available a nucleic acid for detection may include steps of nucleic acid manipulation. A biological sample may be a body fluid or a tissue sample. In some cases, a biological sample may consist of or comprise blood, plasma, sera, urine, feces, epidermal sample, vaginal sample, skin sample, cheek swab, sperm, amniotic fluid, cultured cells, bone marrow sample, tumor biopsies, aspirate and/or chorionic villi, cultured cells, and the like. Fresh, fixed or frozen tissues may also be used. In one embodiment, the sample is preserved as a frozen sample or as formaldehyde- or paraformaldehyde-fixed paraffin-embedded (FFPE) tissue preparation. For example, the sample can be embedded in a matrix, e.g., an FFPE block or a frozen sample. Whole blood samples of about 0.5 to 5 ml collected with EDTA, ACD or heparin as anti-coagulant are suitable. In some embodiments, the sample is a FNA sample.
[0077] The term sensitivity, as used herein in reference to the methods of the present technology, is a measure of the ability of a method to detect a preselected sequence variant in a heterogeneous population of sequences. A method has a sensitivity of S % for variants of F % if, given a sample in which the preselected sequence variant is present as at least F % of the sequences in the sample, the method can detect the preselected sequence at a preselected confidence of C %, S % of the time. By way of example, a method has a sensitivity of 90% for variants of 5% if, given a sample in which the preselected variant sequence is present as at least 5% of the sequences in the sample, the method can detect the preselected sequence at a preselected confidence of 99%, 9 out of 10 times (F=5%; C=99%; S=90%).
[0078] The term specific as used herein in reference to an oligonucleotide primer means that the nucleotide sequence of the primer has at least 12 bases of sequence identity with a portion of the nucleic acid to be amplified when the oligonucleotide and the nucleic acid are aligned. An oligonucleotide primer that is specific for a nucleic acid is one that, under the stringent hybridization or washing conditions, is capable of hybridizing to the target of interest and not substantially hybridizing to nucleic acids which are not of interest. Higher levels of sequence identity are preferred and include at least 75%, at least 80%, at least 85%, at least 90%, at least 95% and more preferably at least 98% sequence identity.
[0079] Specificity, as used herein, is a measure of the ability of a method to distinguish a truly occurring preselected sequence variant from sequencing artifacts or other closely related sequences. It is the ability to avoid false positive detections. False positive detections can arise from errors introduced into the sequence of interest during sample preparation, sequencing error, or inadvertent sequencing of closely related sequences like pseudo-genes or members of a gene family. A method has a specificity of X % if, when applied to a sample set of N.sub.Total sequences, in which X.sub.True sequences are truly variant and X.sub.Not true are not truly variant, the method selects at least X % of the not truly variant as not variant. E.g., a method has a specificity of 90% if, when applied to a sample set of 1,000 sequences, in which 500 sequences are truly variant and 500 are not truly variant, the method selects 90% of the 500 not truly variant sequences as not variant. Exemplary specificities include 90, 95, 98, and 99%.
[0080] The term stringent hybridization conditions as used herein refers to hybridization conditions at least as stringent as the following: hybridization in 50% formamide, 5SSC, 50 mM NaH.sub.2PO.sub.4, pH 6.8, 0.5% SDS, 0.1 mg/mL sonicated salmon sperm DNA, and 5Denhart's solution at 42 C. overnight; washing with 2SSC, 0.1% SDS at 45 C.; and washing with 0.2SSC, 0.1% SDS at 45 C. In another example, stringent hybridization conditions should not allow for hybridization of two nucleic acids which differ over a stretch of 20 contiguous nucleotides by more than two bases.
[0081] As used herein, the terms target sequence and target nucleic acid sequence refer to a specific nucleic acid sequence to be detected and/or quantified in the sample to be analyzed.
[0082] As used herein, the terms treat, treating or treatment refer, to an action to obtain a beneficial or desired clinical result including, but not limited to, alleviation or amelioration of one or more signs or symptoms of a disease or condition (e.g., regression, partial or complete), diminishing the extent of disease, stability (i.e., not worsening, achieving stable disease) state of disease, amelioration or palliation of the disease state, diminishing rate of or time to progression, and remission (whether partial or total).
[0083] Thyroid Cancer
[0084] The most common mutations that occur in papillary thyroid cancer (PTC) are point mutations in BRAF and RAS, and RET/PTC and NTRK1 rearrangements, all of which are capable of activating the mitogen-activated protein kinase (MAPK) pathway. These mutually exclusive mutations are found in more than 70% of PTC. Adeniran A J et al., Am J Surg Pathol. 30:216-222 (2006); Kimura E T et al., Cancer Res. 63:1454-1457 (2003); Soares P et al., Oncogene 22:4578-4580 (2003); Frattini M et al., Oncogene 23:7436-7440 (2004). The most common aberrations in follicular thyroid cancer are either RAS mutations or PAX8/PPAR rearrangements. These mutations are also mutually exclusive and manifest in 70%-75% of follicular carcinomas. Nikiforova M N et al., J Clin Endocrinol Metab. 88:2318-2326 (2003).
[0085] Genetic alterations involving the PI3K/AKT signaling pathway also occur in thyroid tumors, particularly in advanced and dedifferentiating tumors. Garcia-Rostan G et al., Cancer Res. 65:10199-10207 (2005); Santarpia L et al., J Clin Endocrinol Metab. 93:278-284 (2008); Hou P et al., Clin Cancer Res. 13:1161-1170 (2007). Additional mutations known to occur in poorly differentiated and anaplastic carcinomas involve TP53, AKT1 and CTNNB1. Kondo T et al., Nat Rev Cancer 6:292-306 (2006). Medullary thyroid carcinomas, both familial and sporadic, frequently carry point mutations located in RET and RAS. de Groot J W et al., Endocr Rev. 27:535-560 (2006); Moura M M et al., J Clin Endocrinol Metab. 96:E863-868 (2011). Other somatic mutations, such as those in the TSHR gene, have been reported in some thyroid nodules, although their prevalence and diagnostic utility remain unclear. Garcia-Jimenez C & Santisteban P. Arq Bras Endocrinol Metabol. 51:654-671 (2007); Nishihara E et al., Endocr J. 56:791-798 (2009).
[0086] NGS Platforms
[0087] In some embodiments, high throughput, massively parallel sequencing employs sequencing-by-synthesis with reversible dye terminators. In other embodiments, sequencing is performed via sequencing-by-ligation. In yet other embodiments, sequencing is single molecule sequencing. Examples of Next Generation Sequencing techniques include, but are not limited to pyrosequencing, Reversible dye-terminator sequencing, SOLiD sequencing, Ion semiconductor sequencing, Helioscope single molecule sequencing etc.
[0088] The Ion Torrent (Life Technologies, Carlsbad, Calif.) amplicon sequencing system employs a flow-based approach that detects pH changes caused by the release of hydrogen ions during incorporation of unmodified nucleotides in DNA replication. For use with this system, a sequencing library is initially produced by generating DNA fragments flanked by sequencing adapters. In some embodiments, these fragments can be clonally amplified on particles by emulsion PCR. The particles with the amplified template are then placed in a silicon semiconductor sequencing chip. During replication, the chip is flooded with one nucleotide after another, and if a nucleotide complements the DNA molecule in a particular microwell of the chip, then it will be incorporated. A proton is naturally released when a nucleotide is incorporated by the polymerase in the DNA molecule, resulting in a detectable local change of pH. The pH of the solution then changes in that well and is detected by the ion sensor. If homopolymer repeats are present in the template sequence, multiple nucleotides will be incorporated in a single cycle. This leads to a corresponding number of released hydrogens and a proportionally higher electronic signal.
[0089] The 454TM GS FLX sequencing system (Roche, Germany), employs a light-based detection methodology in a large-scale parallel pyrosequencing system. Pyrosequencing uses DNA polymerization, adding one nucleotide species at a time and detecting and quantifying the number of nucleotides added to a given location through the light emitted by the release of attached pyrophosphates. For use with the 454 system, adapter-ligated DNA fragments are fixed to small DNA-capture beads in a water-in-oil emulsion and amplified by PCR (emulsion PCR). Each DNA-bound bead is placed into a well on a picotiter plate and sequencing reagents are delivered across the wells of the plate. The four DNA nucleotides are added sequentially in a fixed order across the picotiter plate device during a sequencing run. During the nucleotide flow, millions of copies of DNA bound to each of the beads are sequenced in parallel. When a nucleotide complementary to the template strand is added to a well, the nucleotide is incorporated onto the existing DNA strand, generating a light signal that is recorded by a CCD camera in the instrument.
[0090] Sequencing technology based on reversible dye-terminators: DNA molecules are first attached to primers on a slide and amplified so that local clonal colonies are formed. Four types of reversible terminator bases (RT-bases) are added, and non-incorporated nucleotides are washed away. Unlike pyrosequencing, the DNA can only be extended one nucleotide at a time. A camera takes images of the fluorescently labeled nucleotides, then the dye along with the terminal 3 blocker is chemically removed from the DNA, allowing the next cycle.
[0091] Helicos's single-molecule sequencing uses DNA fragments with added polyA tail adapters, which are attached to the flow cell surface. At each cycle, DNA polymerase and a single species of fluorescently labeled nucleotide are added, resulting in template-dependent extension of the surface-immobilized primer-template duplexes. The reads are performed by the Helioscope sequencer. After acquisition of images tiling the full array, chemical cleavage and release of the fluorescent label permits the subsequent cycle of extension and imaging.
[0092] Sequencing by synthesis (SBS), like the old style dye-termination electrophoretic sequencing, relies on incorporation of nucleotides by a DNA polymerase to determine the base sequence. A DNA library with affixed adapters is denatured into single strands and grafted to a flow cell, followed by bridge amplification to form a high-density array of spots onto a glass chip. Reversible terminator methods use reversible versions of dye-terminators, adding one nucleotide at a time, detecting fluorescence at each position by repeated removal of the blocking group to allow polymerization of another nucleotide. The signal of nucleotide incorporation can vary with fluorescently labeled nucleotides, phosphate-driven light reactions and hydrogen ion sensing having all been used. Examples of SBS platforms include Illumina GA and HiSeq 2000. The MiSeq personal sequencing system (Illumina, Inc.) also employs sequencing by synthesis with reversible terminator chemistry.
[0093] In contrast to the sequencing by synthesis method, the sequencing by ligation method uses a DNA ligase to determine the target sequence. This sequencing method relies on enzymatic ligation of oligonucleotides that are adjacent through local complementarity on a template DNA strand. This technology employs a partition of all possible oligonucleotides of a fixed length, labeled according to the sequenced position. Oligonucleotides are annealed and ligated and the preferential ligation by DNA ligase for matching sequences results in a dinucleotide encoded color space signal at that position (through the release of a fluorescently labeled probe that corresponds to a known nucleotide at a known position along the oligo). This method is primarily used by Life Technologies' SOLiD sequencers. Before sequencing, the DNA is amplified by emulsion PCR. The resulting beads, each containing only copies of the same DNA molecule, are deposited on a solid planar substrate.
[0094] SMRT sequencing is based on the sequencing by synthesis approach. The DNA is synthesized in zero-mode wave-guides (ZMWs)-small well-like containers with the capturing tools located at the bottom of the well. The sequencing is performed with use of unmodified polymerase (attached to the ZMW bottom) and fluorescently labeled nucleotides flowing freely in the solution. The wells are constructed in a way that only the fluorescence occurring at the bottom of the well is detected. The fluorescent label is detached from the nucleotide at its incorporation into the DNA strand, leaving an unmodified DNA strand.
[0095] Thyroid Cancer Screening Methods of the Present Technology
[0096] Disclosed herein are methods and assays that are based, at least in part, on a pre-selected set of genes that are associated with thyroid cancer. Such pre-selected genes enable the application of sequencing methods, particularly methods that rely on massively parallel sequencing of a large number of diverse genes, e.g., from thyroid tumor samples or control samples.
[0097] In one embodiment, the methods featured in the present technology are used in a multiplex, multi-gene assay format, e.g., assays that incorporate multiple signals from a large number of diverse genetic alterations in a large number of genes.
[0098] The methods of the present technology are based on the principle that screening a patient's thyroid nodules for the presence of one or more alterations in a preselected set of thyroid cancer-related genes is useful in determining whether a patient will benefit from diagnostic surgery (e.g., lobectomy), wherein the preselected set of thyroid cancer-related genes corresponds to BRAF, NRAS, HRAS, KRAS, PIK3CA, TP53, CTNNB1, PTEN, TSHR, AKT1, GNAS, RET, TERT, and EIF1AX. In some embodiments of the method, the presence of one or more mutations in BRAF, NRAS, HRAS, KRAS, PIK3CA, TP53, CTNNB1, PTEN, TSHR, AKT1, GNAS, RET, TERT, and EIF1AX is detected by assaying a plurality of amplicons, wherein at least one amplicon corresponds to each of BRAF, NRAS, HRAS, KRAS, PIK3CA, TP53, CTNNB1, PTEN, TSHR, AKT1, GNAS, RET, TERT, and EIF1AX. Additionally or alternatively, in some embodiments, the method comprises screening a patient's thyroid nodules for the presence of translocations in one or more genes selected from the group consisting of RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, THADA, FGFR2 and ALK.
[0099] A significant advantage of the methods of the present technology over other comparable PCR-based NGS screening panels is that the minimal DNA input required for the screening assays disclosed herein is about five to ten times lower than other comparable thyroid cancer screening panels. For example, the minimal DNA input for the methods disclosed herein is 1 ng, whereas other NGS protocols require at least 10 ng (e.g., ThyroSeq panel). The 2-step PCR approach employed in the methods of the present technology permits improved enrichment of the limited genetic material (DNA and RNA) that can be isolated from FFPE or FNA thyroid samples, and is highly sensitive in detecting clinically relevant genetic alterations that are implicated in thyroid cancer. The methods of the present technology also forego the need to perform nick translation and adapter ligation steps during DNA or cDNA library generation, thereby making the disclosed methods less time consuming and more cost-effective.
[0100] In one aspect, the present disclosure provides methods for detecting at least one mutation in a plurality of thyroid cancer-related genes in a subject comprising (a) extracting DNA from a FFPE thyroid sample or a FNA thyroid sample obtained from the subject; (b) generating a DNA library of a first plurality of amplicons using a hot start DNA polymerase that substantially lacks 5-3 exonuclease activity, wherein at least one amplicon corresponds to each of the plurality of thyroid cancer-related genes, said plurality of thyroid cancer-related genes comprising BRAF, NRAS, HRAS, KRAS, PIK3CA, TP53, CTNNB1, PTEN, TSHR, AKT1, GNAS, RET, TERT, and EIF1AX; (c) incorporating an adapter sequence on to the ends of the first plurality of amplicons via polymerase chain reaction; and (d) detecting at least one mutation in at least one of the first plurality of amplicons using high throughput massive parallel sequencing.
[0101] In some embodiments of the method, the at least one mutation detected is a mutation in BRAF, NRAS, HRAS, KRAS, PIK3CA, TP53, CTNNB1, PTEN, TSHR, AKT1, GNAS, RET, TERT, and EIF1AX In one embodiment, the at least one mutation detected is selected from the group consisting of AKT1 E17K, BRAF V600E, BRAF K601E, KRAS G13D, KRAS G12V, KRAS Q61R, KRAS G12D, NRAS Q61R, NRAS Q61K, PIK3CA E545K, PIK3CA H1047R, PIK3CA G914R, HRAS Q61R, RET M918T, TSHR R274W, TSHR A581S, TERT 124 C>T and TERT 146 C>T.
[0102] In some embodiments, the first plurality of amplicons is generated using no more than 1 ng of extracted DNA from the FFPE thyroid sample or the FNA thyroid sample. In some embodiments of the method, the first plurality of amplicons is generated using 1-5 ng, 5-10 ng, 10-15 ng, 15-20 ng, 20-25 ng, 1-10 ng, or 1-20 ng of extracted DNA from the FFPE thyroid sample or the FNA thyroid sample. In some embodiments of the method, the first plurality of amplicons is generated using 1-25 ng of extracted DNA from the FFPE thyroid sample or the FNA thyroid sample. In some embodiments of the method, the first plurality of amplicons is generated using at least 25 ng of extracted DNA from the FFPE thyroid sample or the FNA thyroid sample.
[0103] In some embodiments of the method, the FNA thyroid sample has been diagnosed as AUS/FLUS, FN/SFN or SUSP. In some embodiments of the method, the hot start DNA polymerase that substantially lacks 5-3 exonuclease activity is Z05-Gold polymerase or KAPA HiFi.
[0104] In some embodiments of the method, the first plurality of amplicons is generated using primer pairs that recognize and specifically hybridize to one or more of exon 15 of BRAF, exon 2, 3 or 4 of NRAS, exon 2, 3 or 4 of HRAS, exon 2, 3 or 4 of KRAS, exon 10 or 21 of PIK3CA, exon 5, 6, 7, 8 or 9 of TP53, exon 3 of CTNNB1, exon 5, 6, 7, or 8 of PTEN, exon 9 or 10 of TSHR, exon 3 of AKT1, exon 8 or 9 of GNAS, exon 10, 11, 12, 13 or 15 of RET, the promoter of TERT, and exon 2, 5 or 6 of EIF1AX.
[0105] In some embodiments of the method, the first plurality of amplicons is generated using at least two, at least three, at least four, at least five, at least ten, at least fifteen, at least twenty, or at least twenty-five or more pairs of primers disclosed in Table 1.
TABLE-US-00001 TABLE1 PrimerPairsforDNALibrary PrimerName Sequence(5.fwdarw.3) AKT1_01B_FWD_TAG CGACGCTCTTCCGATCTTCACGTTGGTCCACATC AKT1_01B_REV_TAG AGACGTGTGCTCTTCCGATCTGGTCTGACGGGTAGAGT BRAF_01_FWD_TAG CGACGCTCTTCCGATCTTGGAAAAATAGCCTCAATTCT BRAF_01_REV_TAG AGACGTGTGCTCTTCCGATCTTGTTTTCCTTTACTTACTACACC BRAF_02_FWD_TAG CGACGCTCTTCCGATCTAGACAACTGTTCAAACTGAT BRAF_02_REV_TAG AGACGTGTGCTCTTCCGATCTATGCTTGCTCTGATAGGA CTNNB1_04_FWD_TAG CGACGCTCTTCCGATCTGCGGCTGTTAGTCACT CTNNB1_04_REV_TAG AGACGTGTGCTCTTCCGATCTTCCCTGTTCCCACTCATA EIF1AX_01_FWD_TAG CGACGCTCTTCCGATCTCTGACCATCCTCTTTGAATAC EIF1AX_01_REV_TAG AGACGTGTGCTCTTCCGATCTTTCATTTTATTTCATACTGTTTTACAGA EIF1AX_02_FWD_TAG CGACGCTCTTCCGATCTGTGAGCACTAAAGTAAATAAGC EIF1AX_02_REV_TAG AGACGTGTGCTCTTCCGATCTCAGACGAAGCTAGAAGTCT EIF1AX_03_FWD_TAG CGACGCTCTTCCGATCTAAACACAAGGTACATCTACTTAC EIF1AX_03_REV_TAG AGACGTGTGCTCTTCCGATCTTTACAGTGCTGACTTATGAGT GNAS_01_FWD_TAG CGACGCTCTTCCGATCTCCAGACCTTTGCTTTAGATT GNAS_01_REV_TAG AGACGTGTGCTCTTCCGATCTGCTTACTGGAAGTTGACTTT GNAS_02_FWD_TAG CGACGCTCTTCCGATCTCCAGTCCCTCTGGAATAA GNAS_02_REV_TAG AGACGTGTGCTCTTCCGATCTAGAAGCAAAGCGTTCTTTAC HRAS_01_FWD_TAG CGACGCTCTTCCGATCTAAAGACTTGGTGTTGTTGAT HRAS_01_REV_TAG AGACGTGTGCTCTTCCGATCTGGAAGCAGGTGGTCATT HRAS_02A_FWD_TAG CGACGCTCTTCCGATCTCTCTATAGTGGGGTCGTAT HRAS_02A_REV_TAG AGACGTGTGCTCTTCCGATCTAGACCCTGTAGGAGGAC HRAS_03_FWD_THY_TAG CGACGCTCTTCCGATCTTCCCTGGCTAGCTGT HRAS_03_REV_THY_TAG AGACGTGTGCTCTTCCGATCTGGACTCGGATGACGTG HRAS_04_FWD_THY_TAG CGACGCTCTTCCGATCTAGCCTGCCGAGATTC HRAS_04_REV_THY_TAG AGACGTGTGCTCTTCCGATCTGTCCTGGATGCCGC HRAS_05_FWD_THY_TAG CGACGCTCTTCCGATCTTGCGCAGAGAGGACA HRAS_05_REV_THY_TAG AGACGTGTGCTCTTCCGATCTCGGGGAGGGCTTCC HRAS_06_FWD_THY_TAG CGACGCTCTTCCGATCTCCGGTGCGCATGT HRAS_06_REV_THY_TAG AGACGTGTGCTCTTCCGATCTCCACGGAAGGTCCTGA HRAS_07_FWD_THY_TAG CGACGCTCTTCCGATCTCACCATGCAGGGGAC HRAS_07_REV_THY_TAG AGACGTGTGCTCTTCCGATCTCTGACCATCCAGCTGATC HRAS_08_FWD_THY_TAG CGACGCTCTTCCGATCTCCAGCTTATATTCCGTCATC HRAS_08_REV_THY_TAG AGACGTGTGCTCTTCCGATCTGGGTTTGCCCTTCAGAT KRAS_03_FWD_TAG CGACGCTCTTCCGATCTGGATCATATTCGTCCACAAA KRAS_03_REV_TAG AGACGTGTGCTCTTCCGATCTGTGTGACATGTTCTAATATAGTCA KRAS_06_FWD_THY_TAG CGACGCTCTTCCGATCTCATAAACATTATTTAAAAATTTTTATTAAATATTATATGC KRAS_06_REV_THY_TAG AGACGTGTGCTCTTCCGATCTTGTATTTGCCATAAATAATACTAAATCA KRAS_07_FWD_THY_TAG CGACGCTCTTCCGATCTACCCACCTATAATGGTGAATA KRAS_07_REV_THY_TAG AGACGTGTGCTCTTCCGATCTAACCTGTCTCTTGGATATTCT KRAS_08_FWD_THY_TAG CGACGCTCTTCCGATCTGGTCCTGCACCAGTAATAT KRAS_08_REV_THY_TAG AGACGTGTGCTCTTCCGATCTGCTGAAAATGACTGAATATAAACTTG KRAS_10_FWD_THY_TAG CGACGCTCTTCCGATCTCAGATCTGTATTTATTTCAGTGTTAC KRAS_10_REV_THY_TAG AGACGTGTGCTCTTCCGATCTAGTTAAGGACTCTGAAGATGTAC KRAS_11_FWD_THY_TAG CGACGCTCTTCCGATCTGGAATTCCATAACTTCTTGCTA KRAS_11_REV_THY_TAG AGACGTGTGCTCTTCCGATCTGTGTTACTAATGACTGTGCTATAA NRAS_01_FWD_TAG CGACGCTCTTCCGATCTATAATGCTCCTAGTACCTGTAG NRAS_01_REV_TAG AGACGTGTGCTCTTCCGATCTACCTGTTTGTTGGACATACT NRAS_02_FWD_TAG CGACGCTCTTCCGATCTGGTGGGATCATATTCATCTAC NRAS_02_REV_TAG AGACGTGTGCTCTTCCGATCTCGCCAATTAACCCTGATTA NRAS_04_FWD_THY_TAG CGACGCTCTTCCGATCTGTGGGCTTGTTTTGTATCA NRAS_04_REV_THY_TAG AGACGTGTGCTCTTCCGATCTGTACCCAGCCTAATCTTGT NRAS_05_FWD_THY_TAG CGACGCTCTTCCGATCTTCTTCCCTAGTGTGGTAAC NRAS_05_REV_THY_TAG AGACGTGTGCTCTTCCGATCTGAAGGCTTCCTCTGTGTATT NRAS_06B_FWD_THY_TAG CGACGCTCTTCCGATCTCGCCTGTCCTCATGTAT NRAS_06B_REV_THY_TAG AGACGTGTGCTCTTCCGATCTTCCCTGCCCCCTTAC NRAS_07_FWD_THY_TAG CGACGCTCTTCCGATCTTCAGCGGGCTACCA NRAS_07_REV_THY_TAG AGACGTGTGCTCTTCCGATCTTGCTGGTGTGAAATGACT PIK3CA_08A_FWD_TAG CGACGCTCTTCCGATCTTATTATTTTATTTTACAGAGTAACAGACTAG PIK3CA_08A_REV_TAG AGACGTGTGCTCTTCCGATCTTTTAGCACTTACCTGTGACT PIK3CA_09A_FWD_TAG CGACGCTCTTCCGATCTGATGTGTTACAAGGCTTATCTA PIK3CA_09A_REV_TAG AGACGTGTGCTCTTCCGATCTGCCTCTTGCTCAGTTTTATC PIK3CA_09BFWD_TAG CGACGCTCTTCCGATCTTGGAATGCCAGAACTACA PIK3CA_09BREV_TAG AGACGTGTGCTCTTCCGATCTGTGGAAGATCCAATCCATTTT PIK3CA_10_FWD_TAG CGACGCTCTTCCGATCTGAGGCTTTGGAGTATTTCA PIK3CA_10_REV_TAG AGACGTGTGCTCTTCCGATCTCTGCTGAGAGTTATTAACAGT PIK3CA_14_FWD_TAG CGACGCTCTTCCGATCTGTCTACGAAAGCCTCTCTA PIK3CA_14_REV_TAG AGACGTGTGCTCTTCCGATCTGGCATGCTGTCGAATAG PTEN_06_FWD_TAG CGACGCTCTTCCGATCTACAATCATGTTGCAGCA PTEN_06_REV_TAG AGACGTGTGCTCTTCCGATCTAAAAACATCAAAAAATAACTTACCTTTT PTEN_08A_FWD_TAG CGACGCTCTTCCGATCTCAATTTAGTGAAATAACTATAATGGAAC PTEN_08A_REV_TAG AGACGTGTGCTCTTCCGATCTAGTGCCACTGGTCTATAAT PTEN_10B_FWD_TAG CGACGCTCTTCCGATCTCTGCCAGCTAAAGGTGAAGATA PTEN_10B_REV_TAG AGACGTGTGCTCTTCCGATCTGCATCTTGTTCTGTTTGTGGAA PTEN_13_FWD_TAG CGACGCTCTTCCGATCTTAGAGCGTGCAGATAATGA PTEN_13_REV_TAG AGACGTGTGCTCTTCCGATCTTCAACAACCCCCACAAA PTEN_16_FWD_TAG CGACGCTCTTCCGATCTGCACAATATCCTTTTGAAGAC PTEN_16_REV_TAG AGACGTGTGCTCTTCCGATCTGCACATATCATTACACCAGTTC RET_01_FWD_TAG CGACGCTCTTCCGATCTCCCGGGGGATTAAAGC RET_01_REV_TAG AGACGTGTGCTCTTCCGATCTTCAGATGTGCTGTTGAGAC RET_02_FWD_TAG CGACGCTCTTCCGATCTCCATGAGGCAGAGCATA RET_02_REV_TAG AGACGTGTGCTCTTCCGATCTGCACCGAGACGATGAA RET_04_FWD_TAG CGACGCTCTTCCGATCTGGCCATGGCCTGAC RET_04_REV_TAG AGACGTGTGCTCTTCCGATCTGCACCTGGCTCCTCT RET_05_FWD_TAG CGACGCTCTTCCGATCTCCCCTCCTTCCTAGAGA RET_05_REV_TAG AGACGTGTGCTCTTCCGATCTGAGCAACACCCACACTTA RET_06A_FWD_TAG CGACGCTCTTCCGATCTTATGGTCATGGAAGGGG RET_06A_REV_TAG AGACGTGTGCTCTTCCGATCTCCCCATACAATTTGATGACA RET_07_FWD_TAG CGACGCTCTTCCGATCTGTGCGACGAGCTGT RET_07_REV_TAG AGACGTGTGCTCTTCCGATCTTCCGGAAGGTCATCTCA RET_08_FWD_TAG CGACGCTCTTCCGATCTGGATCCAAAGTGGGAATTC RET_08_REV_TAG AGACGTGTGCTCTTCCGATCTAGGTACCTTTCAGCATCTTC TERT_02_FWD_TAG: CGACGCTCTTCCGATCTGGGCCGCGGAAAGGAA TERT_02_REV_TAG: AGACGTGTGCTCTTCCGATCTTGGCGGAGGGACTGG TP53_03_FWD_TAG CGACGCTCTTCCGATCTGAAACTTTCCACTTGATAAGAG TP53_03_REV_TAG AGACGTGTGCTCTTCCGATCTCCAAGGGTGCAGTTATG TP53_05_FWD_TAG CGACGCTCTTCCGATCTTTACCTCGCTTAGTGCT TP53_05_REV_TAG AGACGTGTGCTCTTCCGATCTTGCCTCTTGCTTCTCTT TP53_06_FWD_TAG CGACGCTCTTCCGATCTTGCAGGGTGGCAA TP53_06_REV_TAG AGACGTGTGCTCTTCCGATCTGCACTGGCCTCATCTTG TP53_07_FWD_TAG CGACGCTCTTCCGATCTCCCAGAGACCCCAGT TP53_07_REV_TAG AGACGTGTGCTCTTCCGATCTCCTCACTGATTGCTCTTAGG TP53_08B_FWD_TAG CGACGCTCTTCCGATCTAGCCCTGTCGTCTCT TP53_08B_REV_TAG AGACGTGTGCTCTTCCGATCTGCAGCTGTGGGTTGAT TP53_08C_FWD_TAG CGACGCTCTTCCGATCTCGTCATGTGCTGTGAC TP53_08C_REV_TAG AGACGTGTGCTCTTCCGATCTGCCCTGACTTTCAACTCT TSHR_01_FWD_TAG CGACGCTCTTCCGATCTAAGGAACTGATAGCAAGAAAC TSHR_01_REV_TAG AGACGTGTGCTCTTCCGATCTGGTCCCTGCCACTTAC TSHR_02_FWD_TAG CGACGCTCTTCCGATCTAGTGAAGACATGGTGTGTA TSHR_02_REV_TAG AGACGTGTGCTCTTCCGATCTTGGCTGGTGAGGAGAATA TSHR_03_FWD_TAG CGACGCTCTTCCGATCTGTCTTTGTCCTGCTTATTCT TSHR_03_REV_TAG AGACGTGTGCTCTTCCGATCTGGCATGGTTGTAGTACTCA TSHR_04A_FWD_TAG CGACGCTCTTCCGATCTTGAGTACTACAACCATGCCA TSHR_04A_REV_TAG AGACGTGTGCTCTTCCGATCTGAAGGTGATGGCATACCA TSHR_05_FWD_TAG CGACGCTCTTCCGATCTGTTTGCTGCTTCCTTCTC TSHR_05_REV_TAG AGACGTGTGCTCTTCCGATCTTGACGAAGGCAACTATGT TSHR_06_FWD_TAG CGACGCTCTTCCGATCTCGAAATCCGCAGTACAA TSHR_06_REV_TAG AGACGTGTGCTCTTCCGATCTTGGAGTTGCTAACAGTGAT FWD = forward primer; REV = reverse primer
[0106] Additionally or alternatively, the methods disclosed herein are useful in detecting a gene fusion product in one or more of RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, THADA, FGFR2 and ALK in a subject comprising (a) extracting RNA from a FFPE thyroid sample or a FNA thyroid sample obtained from a subject; (b) reverse-transcribing the extracted RNA into cDNA; (c) generating a cDNA library of a second plurality of amplicons using a hot start DNA polymerase with 5-3 exonuclease activity, wherein at least one amplicon corresponds to each of RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, THADA, FGFR2 and ALK; (d) incorporating an adapter sequence on to the ends of the second plurality of amplicons via polymerase chain reaction; and (e) detecting at least one gene fusion product in at least one of the second plurality of amplicons using high throughput massive parallel sequencing.
[0107] Additionally or alternatively, in some embodiments of the method, the at least one gene fusion product detected is a translocation in RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, THADA, FGFR2 and ALK. In certain embodiments, the at least one gene fusion product detected is selected from the group consisting of CCDC6 (PTC1) Exon 1/RET Exon 12, PRKAR1A Exon 8/RET Exon 12, NCOA4 Exon 10/RET Exon 12, NCOA4 Exon 9/RET Exon 12, GOLGA5 Exon 7/RET Exon 12, TRIM24 Exon 9/RET Exon 12, TRIM33 (PTC7) Exon 16/RET Exon 12, ERC1 (ELKS) Exon 11/RET Exon 12, KTN1 Exon 30/RET Exon 12, PCM1 Exon 29/RET Exon 12, TRIM27 Exon 3/RET Exon 12, HOOK3 Exon 11/RET Exon 12, CREB3L2 Exon 2/PPAR Exon 5, PAX8 Exon 7/PPAR Exon 5, PAX8 Exon 8/PPAR Exon 5, PAX8 Exon 9/PPAR Exon 5, PAX8 Exon 10/PPAR Exon 5, ETV6 Exon 4/NTRK3 Exon 14, BRAF Exon 8/MACF1 Exon 15, AKAP9 Exon 8/BRAF Exon 9, AGK Exon 2/BRAF Exon 8, TFG Exon 5/NTRK1 Exon 12, TPM3 Exon 10/NTRK1 Exon 12, TPR Exon 21/NTRK1 Exon 12, ETV6 Exon 5/NTRK3 Exon 14, STRN Exon 3/ALK Exon 20, EML4 Exon 13/ALK Exon 20, EML4 Exon 20/ALK Exon 20, EML4 Exon 6/ALK Exon 20, TFG Exon 5/MET Exon 15, UACA Exon 17/LTK Exon 10, AGGF1 Exon 5/RAFT Exon 8, MACF1 Exon 60/BRAF Exon 9, THADA Exon 27/PPARG Intron 2a, THADA Exon 27/PPARG Intron 2b, THADA Exon 27/Chr 7p non-coding (FUS7p), THADA Exon 28/IGF2BP3 Exon 4, TRA2A Exon 7/THADA Exon 37, FGFR2 Exon 16/OFD1 Exon 3, VCL Exon 1/FGFR2 Exon 18, and SND1 Exon 10/BRAF Exon 9.
[0108] In some embodiments of the method, the FNA thyroid sample has been diagnosed as AUS/FLUS, FN/SFN or SUSP. In some embodiments of the method, the hot start DNA polymerase with 5-3 exonuclease activity is AmpliTaq Gold.
[0109] Additionally or alternatively, in some embodiments of the method, the second plurality of amplicons is generated using at least two, at least three, at least four, at least five, at least six, at least eight, at least ten, or at least twelve or more primers disclosed in Table 2.
TABLE-US-00002 TABLE2 PrimerPairsforRNALibrary PrimerName Sequence(5.fwdarw.3) Fwd_ABL1_Exon2_F_ABL1_Exon3_R_TAG CGACGCTCTTCCGATCTTGGAGATAACACTCTAAGCATAAC TAAAGGT Fwd_AGGF1_Exon5_F-RAF1_Exon8_R_TAG CGACGCTCTTCCGATCTGCAACCTTATCCGACTTCTA Fwd_AGK_Exon2_F-BRAF_Exon8_R_TAG CGACGCTCTTCCGATCTGAGGCCATTGGCTCTAT Fwd_AKAP9_Exon8_F-BRAF_Exon9_R_TAG CGACGCTCTTCCGATCTCAGTTGATTTTGGATCACTTAC Fwd_BRAF_Exon8_F-MACF1_Exon15_R_TAG CGACGCTCTTCCGATCTGCTCCCAATGTGCATATAA Fwd_CREB3L2_Exon2_F-PPARG_Exon5_R_TAG CGACGCTCTTCCGATCTGCCCTTCACCCACATTA Fwd_EML4_Exon13_F-ALK_Exon20_R_TAG CGACGCTCTTCCGATCTCTGGGAAAGGACCTAAAG Fwd_EML4_Exon20_F-ALK_Exon20_R_TAG CGACGCTCTTCCGATCTCGGGAGACTATGAAATATTGT Fwd_ERC1_Exon11_F-RET_Exon12_R_TAG CGACGCTCTTCCGATCTAAGGACTCACGGCTTAAG Fwd_ETV6_Exon5_F-NTRK3_Exon14_R_TAG_B CGACGCTCTTCCGATCTCATGGTCTCTGTCTCCC Fwd_FGFR2_OFD1_1 CGACGCTCTTCCGATCTTCGAATTCTCACTCTCACAACC Fwd_GAPDHL_Exon1_F_GAPDH_Exon3_R_TAG CGACGCTCTTCCGATCTAGTCAGCCGCATCTTCTTT Fwd_GOLGA5_Exon7_F-RET_Exon12_R_TAG CGACGCTCTTCCGATCTCATGGAGCTGGAAGAACT Fwd_HOOK3_Exon11_F-RET_Exon12_R_TAG CGACGCTCTTCCGATCTTATGCAGAATACTGTCAGTCTA Fwd_KRT20L_Exon1_F_KRT20_Exon2_R_TAG CGACGCTCTTCCGATCTGAAGAGCTGCGAAGTCAGATTA Fwd_KRT7_Exon4_F-KRT7_Exon5_R_TAG CGACGCTCTTCCGATCTTGGATGCTGCCTACAT Fwd_KTN1_Exon30_F-RET_Exon12_R_TAG CGACGCTCTTCCGATCTGAAAAGGAAAATGAATTGAAGAG G Fwd_MACF1_Exon60_F-BRAF_Exon9_R_TAG CGACGCTCTTCCGATCTAGAAGGGCTGGATAAACT Fwd_NCOA4_Exon10_F-RET_Exon12_R_TAG CGACGCTCTTCCGATCTCCCCAGGACTGGCTTACCC Fwd_NCOA4_Exon9_F-RET_Exon12_R_TAG CGACGCTCTTCCGATCTCAAATTCCTGAGCACTTGA Fwd_PAX8_Exon10_F-PPARG_Exon5_R_TAG CGACGCTCTTCCGATCTCAGCTATGCCTCCTCT Fwd_PAX8_Exon7_F-PPARG_Exon5_R_TAG CGACGCTCTTCCGATCTAGCGGCAGCACTAC Fwd_PAX8_Exon8_F-PPARG_Exon5_R_TAG CGACGCTCTTCCGATCTGCAACCTCTCGACTCA Fwd_PAX8_Exon9_F-PPARG_Exon5_R_TAG CGACGCTCTTCCGATCTGTGTACGGGCAGTTCA Fwd_PCM1_Exon29_F-RET_Exon12_R_TAG CGACGCTCTTCCGATCTTAGTTCACAACAACCTGTAAG Fwd_PRKAR1A_Exon8_F-RET_Exon12_R_TAG CGACGCTCTTCCGATCTTTTGGAGAACTTGCTTTGAT Fwd_PTH_1 CGACGCTCTTCCGATCTACTCAGCATCAGCTACTAACA Fwd_RET/PTC1_TAG CGACGCTCTTCCGATCTCGCGACCTGCGCAAA Fwd_SND1_Exon10_F-BRAF_Exon9_R_TAG CGACGCTCTTCCGATCTATTGTTGTGAAGCTGAACT Fwd_STRN_Exon3_F-ALK_Exon20_R_TAG CGACGCTCTTCCGATCTCCTCCAAGCTATGATTCTG Fwd_TFG_Exon5_F-MET_Exon15_R_TAG CGACGCTCTTCCGATCTAGCGTTTGGCTTAACAG Fwd_TFG_Exon5_F-NTRK1_Exon12_R_TAG CGACGCTCTTCCGATCTTTATGGCAGCAAGTATGTC Fwd_TFRC_1 CGACGCTCTTCCGATCTATACCTTTCGTCCCTGCATTTA Fwd_TG_Exon5_F-TG_Exon6_R_TAG CGACGCTCTTCCGATCTACACCACAGACATGATGAT Fwd_THADA_IGF2BP3_1 CGACGCTCTTCCGATCTCGAACTCTGTTGTCCACACT Fwd_THADA_PPARG_iso1+ 7p_1 CGACGCTCTTCCGATCTCCGATGGATGGTACTTCTTCTG Fwd_THADA_PPARG_iso2_1 CGACGCTCTTCCGATCTCCGATGGATGGTACTTCTTCTG Fwd_TPM3_Exon10_F-NTRK1_Exon12_R_TAG CGACGCTCTTCCGATCTGGAAGAAATCAAGATTCTTACTG Fwd_TPR_Exon21_F-NTRK1_Exon12_R_TAG CGACGCTCTTCCGATCTCAGAGACAAATCTTCATCTTAAC Fwd_TRA2A_THADA_1 CGACGCTCTTCCGATCTGAAGACGATCACCTTCTCCTTATT Fwd_TRIM24_Exon9_F-RET_Exon12_R_TAG CGACGCTCTTCCGATCTCCACCAAGTGGTTTATCAT Fwd_TRIM27_Exon3_F-RET_Exon12_R_TAG CGACGCTCTTCCGATCTCAGTTCTCTTGCAACATCT Fwd_TRIM33_Exon16_F-RET_Exon12_R_TAG CGACGCTCTTCCGATCTGGAAAGCCAGAAGTTGAATA Fwd_UACA_Exon17_F-LTK_Exon10_R_TAG CGACGCTCTTCCGATCTCAGCACCAAGTGAAATCTC Fwd_VCL_FGFR2_1 CGACGCTCTTCCGATCTGATCTCCCACCTGGTGATAATG Fwd_EML4_Exon6_F-ALK_Exon20_R_TAG CGACGCTCTTCCGATCTAAAACTGCAGACAAGCA Fwd_ETV6_Exon4_F-NTRK3_Exon14_R_TAG CGACGCTCTTCCGATCTCAGCCGGAGGTCATA Rev_ABL1_Exon2_F_ABL1_Exon3_R_TAG AGACGTGTGCTCTTCCGATCTGATGTAGTTGCTTGGGACCC A Rev_AGGF1_Exon5_F-RAF1_Exon8_R_TAG AGACGTGTGCTCTTCCGATCTGCTGATTCGCTGTGACT Rev_AGK_Exon2_F-BRAF_Exon8_R_TAG AGACGTGTGCTCTTCCGATCTTCGTTGCCCAAATTGATTTC Rev_AKAP9_Exon8_F-BRAF_Exon9_R_TAG AGACGTGTGCTCTTCCGATCTACGAAATCCTTGGTCTCTA Rev_BRAF_Exon8_F-MACF1_Exon15_R_TAG AGACGTGTGCTCTTCCGATCTAGCCCAGCTCTTCTACA Rev_CREB3L2_Exon2_F-PPARG_Exon5_R_TAG AGACGTGTGCTCTTCCGATCTGGGAGTGGTCTTCCATTAC Rev_ETV6_Exon4_F-NTRK3_Exon14_R_TAG AGACGTGTGCTCTTCCGATCTTGATGCCGTGGTTGAT Rev_ETV6_Exon5_F-NTRK3_Exon14_R_TAG AGACGTGTGCTCTTCCGATCTTGATGCCGTGGTTGAT Rev_FGFR2_OFD1_1 AGACGTGTGCTCTTCCGATCTGGAGCTCCCTTCTACTGAAAT G Rev_GAPDHL_Exon1_F_GAPDH_Exon3_R_TAG AGACGTGTGCTCTTCCGATCTCAATACGACCAAATCCGTTG AC Rev_KRT20L_Exon1_F_KRT20_Exon2_R_TAG AGACGTGTGCTCTTCCGATCTGTCCTCAGCAGCCAGTTTAG Rev_KRT7_Exon4_F-KRT7_Exon5_R_TAG AGACGTGTGCTCTTCCGATCTCTGCAGCTCTGTCAACT Rev_NCOA4_Exon10_F-RET_Exon12_R_TAG CGACGCTCTTCCGATCTTGGAGATAACACTCTAAGCATAAC TAAAGGT Rev_NCOA4_Exon9_F-RET_Exon12_R_TAG AGACGTGTGCTCTTCCGATCTCGAGGGAATTCCCACTTT Rev_PTH_1 AGACGTGTGCTCTTCCGATCTTGCCAACATGACAATCATAA CT Rev_RET/PTC1_TAG AGACGTGTGCTCTTCCGATCTCAAGTTCTTCCGAGGGAATTC C Rev_STRN_Exon3_F-ALK_Exon20_R_TAG AGACGTGTGCTCTTCCGATCTCAGTAGTTGGGGTTGTAGT Rev_TFG_Exon5_F-NTRK1_Exon12_R_TAG AGACGTGTGCTCTTCCGATCTCCAGATGTGCTGTTAGTGT Rev_TFRC_1 AGACGTGTGCTCTTCCGATCTCTGGCAGAAACCTTGAAGTT G Rev_TG_Exon5_F-TG_Exon6_R_TAG AGACGTGTGCTCTTCCGATCTAGTGGCAATACCCAGATAC Rev_THADA_7p_1 AGACGTGTGCTCTTCCGATCTCCCATTGGCCTGAGTTTCT Rev_THADA_IGF2BP3_1 AGACGTGTGCTCTTCCGATCTCAGCACCTCCCACTGTAAAT Rev_THADA_11 AGACGTGTGCTCTTCCGATCTAGCCAGGTCACTGAGTTACT A Rev_THADA_PPARG_iso2_1 AGACGTGTGCTCTTCCGATCTTCTCTTGAACCCAGGAGGT Rev_TRA2A_THADA_1 AGACGTGTGCTCTTCCGATCTGCTGGAGCAGATCACACAG Rev_UACA_Exon17_F-LTK_Exon10_R_TAG AGACGTGTGCTCTTCCGATCTGGGTCTGAGCAGAGTAAC Rev_VCL_FGFR2_1 AGACGTGTGCTCTTCCGATCTGTTGGCTGAGGTCCAAGTAT Rev_TFG_Exon5_F-MET_Exon15_R_TAG AGACGTGTGCTCTTCCGATCTTCAGAGTCCCCACTAGTTA where Fwd = forward primer; Rev = reverse primer; THADA_PPARG_iso1_1 refers to THADA_Exon27_F-PPARG_Intron 2a_R_TAG; THADA_PPARG_iso2_1 refers to THADA_Exon27_F-PPARG_Intron 2b_R_TAG; THADA_7p_1 refers to THADA_Exon27_F-Chr7p_non-coding_R_TAG; THADA_IGF2BP3_1 refers to THADA_Exon28_F-IGF2BP3_Exon4__R_TAG; TRA2A_THADA_1 refers to TRA2A_Exon7_F-THADA_Exon37_R_TAG; FGFR2_OFD1_1 refers to FGFR2_Exon16_F-OFD1_Exon3_R_TAG; and VCL_FGFR2_1 refers to VCL_Exon1_F-FGFR2_Exon18_R_TAG
[0110] In any of the above embodiments, a single primer or one or both primers of a primer pair comprise a sequence tag ligated to the 5 end of the target specific sequence portion of the primer. This sequence tag is a short oligonucleotide of known sequence that can provide a priming site for a subsequent PCR reaction. In certain embodiments, amplicons corresponding to specific regions of BRAF, NRAS, HRAS, KRAS, PIK3CA, TP53, CTNNB1, PTEN, TSHR, AKT1, GNAS, RET, TERT, and EIF1AX are amplified using primers that contain sequence tags to produce sequence tagged amplicons. In other embodiments, amplicons corresponding to specific regions of RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, THADA, FGFR2 and ALK are amplified using primers that contain sequence tags to produce sequence tagged amplicons.
[0111] In any of the above embodiments, the sequences tags are used as a mechanism to incorporate a specific adapter sequence (also referred to as a sequencing adapter) on to one or both ends of the amplicons via a subsequent PCR reaction.
[0112] In any of the above embodiments, the employed primers do not contain adapter sequences (but contain sequence tags) and an oligonucleotide sequencing adapter is subsequently incorporated on to one or both ends of the resulting sequence tagged amplicons in a subsequent PCR reaction. As shown in
[0113] Sequencing adapters are short oligonucleotides of known sequence that can provide a priming site for both amplification and sequencing of the adjoining, unknown target nucleic acid. As such, adapters allow binding of a fragment to a flow cell for next generation sequencing. Any adapter sequence may be incorporated on to one or both ends of the sequence tagged amplicons in a subsequent PCR reaction.
[0114] In some embodiments, all forward amplicons generated during the subsequent PCR reaction contain the same adapter sequence. In some embodiments when double stranded sequencing is performed, all forward amplicons generated during the subsequent PCR reaction contain the same adapter sequence and all reverse amplicons generated during the subsequent PCR reaction contain an adapter sequence that is different from the adapter sequence of the forward amplicons. In some embodiments, the adapter sequences further comprise an index sequence (also referred to as an index tag, a barcode or a multiplex identifier (MID)).
[0115] In any of the above embodiments, the adapter sequences are P5 and/or P7 adapter sequences that are recommended for Illumina sequencers (MiSeq and HiSeq). See, e.g., Williams-Carrier et al., Plant J., 63(1):167-77 (2010). In some embodiments, the adapter sequences are P1, A, or Ion Xpress barcode adapter sequences that are recommended for Life Technologies sequencers. Other adapter sequences are known in the art. Some manufacturers recommend specific adapter sequences for use with the particular sequencing technology and machinery that they offer.
[0116] Additionally or alternatively, in any of the above embodiments, amplicons corresponding to specific regions of BRAF, NRAS, HRAS, KRAS, PIK3CA, TP53, CTNNB1, PTEN, TSHR, AKT1, GNAS, RET, TERT, and EIF1AX from more than one sample are sequenced. In any of the above embodiments, amplicons corresponding to specific regions of RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, THADA, FGFR2 and ALK from more than one sample are sequenced. In some embodiments, all samples are sequenced simultaneously in parallel.
[0117] In any of the above embodiments, amplicons corresponding to specific regions of BRAF, NRAS, HRAS, KRAS, PIK3CA, TP53, CTNNB1, PTEN, TSHR, AKT1, GNAS, RET, TERT, and EIF1AX from at least 1, 5, 8, 10, 16, 20, 24, 30, 32, 35, 40, 45, 48, 50, 56, 64, 72, 80, 88, 96, 104, 112, 120, 128, 136, 144, 152, 160, 168, 176, 184, 192, 200, 208, 216, 224, 232, 240, 248, 256, 264, 272, 280, 288, 296, 304, 312, 320, 328, 336, 344, 352, 360, 368, 376, or up to 384 different samples are amplified and sequenced using the methods described herein. In any of the above embodiments, amplicons corresponding to specific regions of RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, THADA, FGFR2 and ALK from at least 1, 5, 8, 10, 16, 20, 24, 30, 32, 35, 40, 45, 48, 50, 56, 64, 72, 80, 88, 96, 104, 112, 120, 128, 136, 144, 152, 160, 168, 176, 184, 192, 200, 208, 216, 224, 232, 240, 248, 256, 264, 272, 280, 288, 296, 304, 312, 320, 328, 336, 344, 352, 360, 368, 376, or up to 384 different samples are amplified and sequenced using the methods disclosed herein.
[0118] Additionally or alternatively, in any of the above embodiments, adapter tagged amplicons derived from a single sample may further comprise an identical index sequence that indicates the source from which the amplicon is generated, the index sequence for each sample being different from the index sequences from all other samples. As such, the use of index sequences permits multiple samples to be pooled per sequencing run and the sample source subsequently ascertained based on the index sequence. In some embodiments, the Access Array System (Fluidigm Corp., San Francisco, Calif.) or the Apollo 324 System (Wafergen Biosystems, Fremont, Calif.) is used to generate a barcoded (indexed) amplicon library by simultaneously amplifying the nucleic acids from the samples in one set up.
[0119] In any of the above embodiments, indexed amplicons are generated using primers (for example, forward primers and/or reverse primers) containing the index sequence. Such indexed primers may be included during library preparation as a barcoding tool to identify specific amplicons as originating from a particular sample source. When adapter-ligated and/or indexed primers are employed, the adapter sequence and/or index sequence gets incorporated into the amplicon (along with the sequence tag and the target-specific primer sequence) during amplification. Therefore, the resulting amplicons are sequencing-competent and do not require the traditional library preparation protocol. Moreover, the presence of the index tag permits the differentiation of sequences from multiple sample sources.
[0120] In any of the above embodiments, the amplicons may be amplified with non-adapter-ligated and/or non-indexed primers and a sequencing adapter and/or an index sequence may be subsequently incorporated on to one or both ends of each of the resulting amplicons in a subsequent PCR reaction. In some embodiments, the amplicon library is generated using a multiplexed PCR approach.
[0121] Indexed amplicons from more than one sample source are quantified individually and then pooled prior to high throughput sequencing. As such, the use of index sequences permits multiple samples (i.e., samples from more than one sample source) to be pooled per sequencing run and the sample source subsequently ascertained based on the index sequence. Multiplexing is the pooling of multiple adapter-tagged and indexed libraries into a single sequencing run. When indexed primer sets are used, this capability can be exploited for comparative studies. In some embodiments, amplicon libraries from up to 48 separate sources are pooled prior to sequencing.
[0122] Following the production of an adapter tagged and, optionally indexed, amplicon library, the amplicons are sequenced using high throughput, massively parallel sequencing (i.e., next generation sequencing). In some embodiments of the method, the high throughput massive parallel sequencing is performed using 454TM GS FLX pyrosequencing, reversible dye-terminator sequencing, SOLiD sequencing, Ion semiconductor sequencing, Helioscope single molecule sequencing, sequencing by synthesis, sequencing by ligation, or SMRT sequencing. In some embodiments, high throughput massively parallel sequencing may be performed using a read depth approach.
[0123] Diagnostic and Prognostic Methods of the Present Technology
[0124] In another aspect, the present disclosure provides a method for selecting a subject having thyroid nodules with indeterminate cytology for diagnostic surgery comprising: (a) extracting DNA from a FNA thyroid sample obtained from the subject; (b) generating a DNA library of a first plurality of amplicons using a hot start DNA polymerase that substantially lacks 5-3 exonuclease activity, wherein at least one amplicon corresponds to each of the plurality of thyroid cancer-related genes, said plurality of thyroid cancer-related genes comprising BRAF, NRAS, HRAS, KRAS, PIK3CA, TP53, CTNNB1, PTEN, TSHR, AKT1, GNAS, RET, TERT, and EIF1AX; (c) incorporating an adapter sequence on to the ends of the first plurality of amplicons via polymerase chain reaction; and (d) selecting the subject for diagnostic surgery, if a mutation in at least one of the first plurality of amplicons corresponding to BRAF, NRAS, HRAS, KRAS, PIK3CA, TP53, CTNNB1, PTEN, TSHR, AKT1, RET, TERT, and EIF1AX is detected.
[0125] Additionally or alternatively, in some embodiments, the method for selecting a subject having thyroid nodules with indeterminate cytology for diagnostic surgery comprises detecting a gene fusion product in one or more of RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, THADA, FGFR2 and ALK in the subject comprising (a) extracting RNA from a FNA thyroid sample obtained from the subject; (b) reverse-transcribing the extracted RNA into cDNA; (c) generating a cDNA library of a second plurality of amplicons using a hot start DNA polymerase with 5-3 exonuclease activity, wherein at least one amplicon corresponds to each of RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, THADA, FGFR2 and ALK; (d) incorporating an adapter sequence on to the ends of the second plurality of amplicons via polymerase chain reaction; and (e) selecting the subject for diagnostic surgery, if a gene fusion product in at least one of the second plurality of amplicons corresponding to RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, THADA, FGFR2 and ALK is detected.
[0126] In another aspect, the present disclosure provides a method for predicting the risk of malignancy in a subject with inconclusive thyroid FNA cytology results comprising: (a) extracting DNA from a FNA thyroid sample obtained from the subject; (b) generating a DNA library of a first plurality of amplicons using a hot start DNA polymerase that substantially lacks 5-3 exonuclease activity, wherein at least one amplicon corresponds to each of the plurality of thyroid cancer-related genes, said plurality of thyroid cancer-related genes comprising BRAF, NRAS, HRAS, KRAS, PIK3CA, TP53, CTNNB1, PTEN, TSHR, AKT1, GNAS, RET, TERT, and EIF1AX; (c) incorporating an adapter sequence on to the ends of the first plurality of amplicons via polymerase chain reaction; and (d) identifying the subject as having a high risk of malignancy when a mutation in at least one of the first plurality of amplicons corresponding to BRAF, NRAS, HRAS, KRAS, PIK3CA, TP53, CTNNB1, PTEN, TSHR, AKT1, RET, TERT, and EIF1AX is detected.
[0127] Additionally or alternatively, in some embodiments, the method for predicting the risk of malignancy in a subject with inconclusive thyroid FNA cytology results comprises detecting a gene fusion product in one or more of RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, THADA, FGFR2 and ALK in the subject comprising (a) extracting RNA from a FNA thyroid sample obtained from the subject; (b) reverse-transcribing the extracted RNA into cDNA; (c) generating a cDNA library of a second plurality of amplicons using a hot start DNA polymerase with 5-3 exonuclease activity, wherein at least one amplicon corresponds to each of RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, THADA, FGFR2 and ALK; (d) incorporating an adapter sequence on to the ends of the second plurality of amplicons via polymerase chain reaction; and (e) identifying the subject as having a high risk of malignancy when a gene fusion product in at least one of the second plurality of amplicons corresponding to RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, THADA, FGFR2 and ALK is detected.
[0128] In any of the above embodiments, the mutation detected is selected from the group consisting of AKT1 E17K, BRAF V600E, BRAF K601E, KRAS G13D, KRAS G12V, KRAS Q61R, KRAS G12D, NRAS Q61R, NRAS Q61K, PIK3CA E545K, PIK3CA H1047R, PIK3CA G914R, HRAS Q61R, RET M918T, TSHR R274W, TSHR A581S, TERT 124 C>T and TERT 146 C>T. In any of the above embodiments, the gene fusion product detected is selected from the group consisting of CCDC6 (PTC1) Exon 1/RET Exon 12, PRKAR1A Exon 8/RET Exon 12, NCOA4 Exon 10/RET Exon 12, NCOA4 Exon 9/RET Exon 12, GOLGA5 Exon 7/RET Exon 12, TRIM24 Exon 9/RET Exon 12, TRIM33 (PTC7) Exon 16/RET Exon 12, ERC1 (ELKS) Exon 11/RET Exon 12, KTN1 Exon 30/RET Exon 12, PCM1 Exon 29/RET Exon 12, TRIM27 Exon 3/RET Exon 12, HOOKS Exon 11/RET Exon 12, CREB3L2 Exon 2/PPAR Exon 5, PAX8 Exon 7/PPAR Exon 5, PAX8 Exon 8/PPAR Exon 5, PAX8 Exon 9/PPAR Exon 5, PAX8 Exon 10/PPAR Exon 5, ETV6 Exon 4/NTRK3 Exon 14, BRAF Exon 8/MACF1 Exon 15, AKAP9 Exon 8/BRAF Exon 9, AGK Exon 2/BRAF Exon 8, TFG Exon 5/NTRK1 Exon 12, TPM3 Exon 10/NTRK1 Exon 12, TPR Exon 21/NTRK1 Exon 12, ETV6 Exon 5/NTRK3 Exon 14, STRN Exon 3/ALK Exon 20, EML4 Exon 13/ALK Exon 20, EML4 Exon 20/ALK Exon 20, EML4 Exon 6/ALK Exon 20, TFG Exon 5/MET Exon 15, UACA Exon 17/LTK Exon 10, AGGF1 Exon 5/RAF1 Exon 8, MACF1 Exon 60/BRAF Exon 9, THADA Exon 27/PPARG Intron 2a, THADA Exon 27/PPARG Intron 2b, THADA Exon 27/Chr 7p non-coding (FUS7p), THADA Exon 28/IGF2BP3 Exon 4, TRA2A Exon 7/THADA Exon 37, FGFR2 Exon 16/OFD1 Exon 3, VCL Exon 1/FGFR2 Exon 18, and SND1 Exon 10/BRAF Exon 9.
[0129] Kits
[0130] The present disclosure also provides kits for detecting alterations in target nucleic acid sequences corresponding to the preselected set of thyroid cancer-related genes described herein.
[0131] Kits of the present technology comprise one or more primer pairs that selectively hybridize and are useful in amplifying one or more genes selected from the group consisting of BRAF, NRAS, HRAS, KRAS, PIK3CA, TP53, CTNNB1, PTEN, TSHR, AKT1, GNAS, RET, TERI, and EIF1AX. Additionally or alternatively, the kits of the present technology comprise one or more primer pairs that are useful in amplifying and detecting translocations in one or more genes selected from the group consisting of RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, THADA, FGFR2 and ALK.
[0132] In some embodiments, the kits of the present technology comprise a single primer pair that hybridizes to a region or exon of a single gene selected from the group consisting of BRAF, NRAS, HRAS, KRAS, PIK3CA, TP53, CTNNB1, PTEN, TSHR, AKT1, GNAS, RET, TERT, and EIF1AX, in other embodiments, the kits of the present technology comprise multiple primer pairs that hybridize to one or more regions or exons of a single gene selected from the group consisting of BRAT, NRAS, HRAS, KRAS, PIK3CA, TP53, CTNNB1, PTEN, TSHR, AKT1, GNAS, RET, TERT, and EIF1AX, In certain embodiments, the kits of the present technology comprise multiple primer pairs comprising a single primer pair that specifically hybridizes to a region or exon of a single gene for each of BRAF, NRAS, HRAS, KRAS, PIK3CA, TP53, CTNNB1, PTEN TSHR, AKT1, GNAS, RET, TERT, and EIF1AX In certain embodiments, the kits of the present technology comprise multiple primer pairs comprising more than one primer pair that hybridizes to one or more regions or exons for each of BRAF, NRAS, HRAS, KRAS, PIK3CA, TP53, CTNNB1, PTEN, TSHR, AKT1, GNAS, RET, TERT, and EIF1AX.
[0133] Thus, it is contemplated herein that the kits of the present technology can comprise primer pairs that recognize and specifically hybridize to one or more regions or exons of one or more genes selected from the group consisting BRAF, NRAS, HRAS, KRAS, PIK3CA, TP53, CTNNB1, PTEN, TSHR, AKT1, GNAS, RET, TERT, and EIF1AX. In some embodiments, the kits of the present technology can comprise primer pairs that recognize and specifically hybridize to one or more of exon 15 of BRAF, exon 2, 3 or 4 of NRAS, exon 2, 3 or 4 of HRAS, exon 2, 3 or 4 of KRAS, exon 10 or 21 of PIK3CA, exon 5, 6, 7, 8 or 9 of TP53, exon 3 of CTNNB1, exon 5, 6, 7, or 8 of PTEN, exon 9 or 10 of TSHR, exon 3 of AKT1, exon 8 or 9 of GNAS, exon 10, 11, 12, 13 or 15 of RET, the promoter of TERT, and exon 2, 5 or 6 of EIF1AX Alternatively, the kit can comprise primer pairs that will detect one or more mutations selected from the group consisting of AKT1 E17K, BRAF V600E, BRAF K601E, KRAS G13D, KRAS G12V, KRAS Q61R, KRAS G12D, NRAS Q61R, NRAS Q61K, PIK3CA E545K, PIK3CA H1047R, PIK3CA G914R, HRAS Q61R, RET M918T, TSHR R274W, TSHR A581S, TERT 124 C>T and TERT 146 C>T.
[0134] Additionally or alternatively, the kits of the present technology may comprise primer pairs that can detect translocations in one or more genes selected from the group consisting of RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, THADA, FGFR2 and ALK. Alternatively, the kit may comprise primer pairs that will detect one or more gene fusion products selected from the group consisting of CCDC6 (PTC1) Exon 1/RET Exon 12, PRKAR1A Exon 8/RET Exon 12, NCOA4 Exon 10/RET Exon 12, NCOA4 Exon 9/RET Exon 12, GOLGA5 Exon 7/RET Exon 12, TRIM24 Exon 9/RET Exon 12, TRIM33 (PTC7) Exon 16/RET Exon 12, ERC1 (ELKS) Exon 11/RET Exon 12, KTN1 Exon 30/RET Exon 12, PCM1 Exon 29/RET Exon 12, TRIM27 Exon 3/RET Exon 12, HOOK3 Exon 11/RET Exon 12, CREB3L2 Exon 2/PPAR Exon 5, PAX8 Exon 7/PPAR Exon 5, PAX8 Exon 8/PPAR Exon 5, PAX8 Exon 9/PPAR Exon 5, PAX8 Exon 10/PPAR Exon 5, ETV6 Exon 4/NTRK3 Exon 14, BRAF Exon 8/MACF1 Exon 15, AKAP9 Exon 8/BRAF Exon 9, AGK Exon 2/BRAF Exon 8, TFG Exon 5/NTRK1 Exon 12, TPM3 Exon 10/NTRK1 Exon 12, TPR Exon 21/NTRK1 Exon 12, ETV6 Exon 5/NTRK3 Exon 14, STRN Exon 3/ALK Exon 20, EML4 Exon 13/ALK Exon 20, EML4 Exon 20/ALK Exon 20, EML4 Exon 6/ALK Exon 20, TFG Exon 5/MET Exon 15, UACA Exon 17/LTK Exon 10, AGGF1 Exon 5/RAFT Exon 8, MACF1 Exon 60/BRAF Exon 9, THADA Exon 27/PPARG Intron 2a, THADA Exon 27/PPARG Intron 2b, THADA Exon 27/Chr 7p non-coding (FUS7p), THADA Exon 28/IGF2BP3 Exon 4, TRA2A Exon 7/THADA Exon 37, FGFR2 Exon 16/OFD1 Exon 3, VCL Exon 1/FGFR2 Exon 18, and SND1 Exon 10/BRAF Exon 9.
[0135] In some embodiments, the kits comprise one or more primer pairs disclosed in Table 1. In certain embodiments, the kits comprise one or more primer pairs disclosed in Table 2. In some embodiments, the kits comprise two or more primer pairs disclosed in Table 1 and/or Table 2.
[0136] In some embodiments, the kits further comprise buffers, enzymes having polymerase activity, enzymes having polymerase activity and lacking 5.fwdarw.3 exonuclease activity or both 5.fwdarw.3 and 3.fwdarw.5 exonuclease activity, enzyme cofactors such as magnesium or manganese, salts, chain extension nucleotides such as deoxynucleoside triphosphates (dNTPs), modified dNTPs, nuclease-resistant dNTPs or labeled dNTPs, necessary to carry out an assay or reaction, such as amplification and/or detection of alterations in target nucleic acid sequences corresponding to the specific set of thyroid cancer-related genes disclosed herein.
[0137] In one embodiment, the kits of the present technology further comprise a positive control nucleic acid sequence and a negative control nucleic acid sequence to ensure the integrity of the assay during experimental runs, A kit may further contain a means for comparing the levels and/or activity of one or more of the preselected set of thyroid cancer-related genes described herein in a tumor sample with a reference nucleic acid sample (e.g., a non-tumor sample). The kit may also comprise instructions for use, software for automated analysis, containers, packages such as packaging intended for commercial sale and the like.
[0138] The kits of the present technology can also include other necessary reagents to perform any of the NGS techniques disclosed herein. For example, the kit may further comprise one or more of: adapter sequences, barcode sequences, reaction tubes, ligases, ligase buffers, wash buffers and/or reagents, hybridization buffers and/or reagents, labeling buffers and/or reagents, and detection means. The buffers and/or reagents are usually optimized for the particular amplification/detection technique for which the kit is intended. Protocols for using these buffers and reagents for performing different steps of the procedure may also be included in the kit.
[0139] The kits of the present technology may include components that are used to prepare nucleic acids from a solid tumor test sample for the subsequent amplification and/or detection of alterations in target nucleic acid sequences corresponding to the specific set of thyroid cancer-related genes disclosed herein. Such sample preparation components can be used to produce nucleic acid extracts from tissue samples. The test samples used in the above-described methods will vary based on factors such as the assay format, nature of the detection method, and the specific tissues, cells or extracts used as the test sample to be assayed. Methods of extracting nucleic acids from samples are well known in the art and can be readily adapted to obtain a sample that is compatible with the system utilized. Automated sample preparation systems for extracting nucleic acids from a test sample are commercially available, e.g., Roche Molecular Systems' COBAS AmpliPrep System, Qiagen's BioRobot 9600, and Applied Biosystems' PRISM 6700 sample preparation system.
EXAMPLES
Example 1: Design of the Thyroid Cancer Screening NGS Assay of the Present Technology
[0140] Experimentation efforts were directed towards designing a highly sensitive PCR-based NGS assay that could provide a more accurate diagnosis of cancer in thyroid nodules with indeterminate cytology, while using extremely small amounts of DNA derived from FFPE samples or FNA samples (1 ng).
[0141] The methods of the present technology detect somatic mutations in 14 target genes and 41 gene fusion products (translocations) in 10 target genes. See Table 3.
TABLE-US-00003 TABLE 3 Thyroid Cancer Screening Panel Somatic Gene Mutations BRAF PTEN NRAS TSHR HRAS AKT1 KRAS GNAS PIK3CA RET TP53 TERT CTNNB1 EIF1AX
[0142] The thyroid cancer screening panel was designed to assay for mutations in target nucleic acid sequences corresponding to specific regions of the 14 genes listed in Table 3 (instead of every exon of the entire gene) and specific gene translocations in one or more of RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, THADA, FGFR2 and ALK. The selection of these particular target nucleic acid sequences (or amplicons) was based in part on data from TCGA and COSMIC databases, reported mutation frequency, known hot spots etc.
[0143] Experiments focused on the development of an NGS screening assay that was wholly based on PCR (i.e., amplicon-based library preparation followed by NGS) in order to detect genetic alterations in amplicons corresponding to specific regions of BRAF, NRAS, HRAS, KRAS, PIK3CA, TP53, CTNNB1, PTEN, TSHR, AKT1, GNAS, RET, TERT, and EIF1AX, and translocations in one or more of RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, THADA, FGFR2 and ALK. One of the technical challenges that arose while developing the multiplex PCR method described herein was the optimal selection and concentration of over twenty primer pairs that simultaneously hybridize and amplify target nucleic acid sequences corresponding to specific regions of the thyroid cancer-related genes disclosed herein in a single reaction. Achieving the proper balance of primer pairs was a significant concern because differences in annealing efficiency of different primer pairs result in a strong bias in the amplification of the different amplicons, leading to insufficient coverage of some amplicons in a sample and strongly reducing the sensitivity of the assay. In order to maximize the sequencing capacity, the amplification levels should be similar among all amplicons. Furthermore the presence of a large number of different primers results in a strongly increased risk of primer dimer formation diminishing the possibility of reproducible amplifying small amounts of target nucleic acids. The optimal length of the different amplicons corresponding to specific regions of BRAF, NRAS, HRAS, KRAS, PIK3CA, TP53, CTNNB1, PTEN, TSHR, AKT1, GNAS, RET, TERT, and EIF1AX ranges between 100 bp-150 bp. The optimized set of PCR primer pairs useful in the methods of the present technology are disclosed in Tables 1 and 2. Further, as shown in
Example 2: Methods for Validating the Efficacy of the Thyroid Cancer Screening Assay of the Present Technology
[0144] This Example demonstrates that the highly sensitive PCR-based NGS assay of the present technology is useful in methods for detecting mutations in the preselected set of thyroid cancer-related genes disclosed herein.
[0145] Methods. Total nucleic acids were harvested from FNA samples or FFPE samples using the Agencourt Formapure extraction kit. DNA quantification was performed using a Qubit DNA HS assay kit (Life Technologies, Carlsbad, Calif.). Samples with at least 1 ng of DNA were selected for NGS analysis. Samples having a DNA concentration >30 ng/L were diluted down to 5-10 ng/L with Low TE.
[0146] DNA Library.
[0147] A PCR amplicon library was generated from the extracted genomic DNA of each sample. Targeted regions within the 14 genes were amplified (using the primer pairs listed in Table 1) via PCR. Each reaction contained 2 L of sample DNA (minimum DNA input requirement is 0.2 ng/L); forward and reverse primers listed in Table 1 excluding the TERT promoter-specific primers (final concentrations of individual primer pairs are shown in
TABLE-US-00004 Temperature Time #Cycles 95 C. 12 min 1 95 C. 15 sec 30 62 C. 4 min 62 C. 7 min 1 99 C. 10 min 10 C.
[0148] The GC-rich region of the TERT promoter was amplified using the following set up:
TABLE-US-00005 Reagent 1 Rxn (L) 2X PCR Master Mix with Z05 Gold 5 TERT_02 TAG Fwd/Rev 1 (final concentration = 250 nM) Nuclease-free water 2 Sample 2 Total 10
[0149] PCR amplification of the TERT promoter was carried out under the following conditions:
TABLE-US-00006 Temperature Time #Cycles 95 C. 10 min 1 95 C. 15 sec 45 65 C. 1 min 65 C. 10 min 1 4 C.
[0150] RNA Library.
[0151] Extracted RNA (2-4 ng) was reverse transcribed into cDNA using the SuperScript III first-strand Synthesis SuperMix kit (Life Technologies) under the following conditions:
TABLE-US-00007 Temperature Time 25 C. 10 min 50 C. 30 min 85 C. 5 min 4 C. Hold
[0152] A PCR amplicon library was generated from the synthesized cDNA from each sample. Targeted regions within RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, THADA, FGFR2 and ALK were amplified using the primers listed in Table 2 via PCR. Each reaction contained 5 L of sample cDNA; forward and reverse primers listed in Table 2 (final concentrations of individual primer pairs are shown in
TABLE-US-00008 Temperature Time #Cycles 95 C. 10 min 1 95 C. 15 sec 35 60 C. 1 min 72 C. 7 min 1 4 C.
[0153] The PCR amplicon DNA and RNA libraries underwent two rounds of purification using the Apollo Ampure 1.8 protocol (Agencourt). DNA quantification was performed using a Qubit DNA HS assay kit (Life Technologies, Carlsbad, Calif.). P5 and P7 adaptor sequences (along with index sequences) were incorporated on to the ends of the amplicons via a second PCR reaction (see
TABLE-US-00009 Temperature Time #Cycles 98 C. 2 min 1 98 C. 30 sec 15 65 C. 30 sec 72 C. 1 min 72 C. 4 min 1 10 C.
[0154] Amplicons of the second PCR reaction were purified using the Apollo Ampure 1.8 protocol (Agencourt). DNA was quantified using a Qubit DNA HS assay kit. Libraries were pooled by diluting multiple samples. Each library pool contained a positive control DNA sample, harboring multiple variants with known frequencies (Horizon Diagnostics, Waterbeach, Cambridge, UK). Each library pool was sequenced using the MiSeq platform (Illumina) according to the manufacturer's protocol. Specifically, the immobilized templates were clonally amplified to generate millions of molecular clusters each containing 1,000 copies of the same template. The clustered templates were then sequenced using Illumina's sequencing-by-synthesis technology. A single NGS run may generate sequence data of up to 1.2 GB on a Micro Flow cell (2150 cycles) or 4.5 GB on a Flow cell (2150 cycles).
[0155] Data for the completed runs was made available in the IDBS web portal (http://sjcls0134.us.gdx.com:15100/portal/) for QC review. Each batch was reviewed for meeting minimum coverage depth (300), as well as the performance of the positive and negative QC samples.
[0156] Results. As shown in
[0157] Moreover, mutations were also detected in 1 out of 8 clinical samples that were previously classified as mutation negative. For instance, KRAS G12V (2%), BRAF V600E (3%), and AKT1 E17K (3%) mutations were detected in R-10536, which tested negative for BRAF and RAS via BRAF ASO and RAS pyrosequencing. Reevaluation of the RAS pyrosequencing results revealed that a KRAS G12V mutation was indeed present in R-10536, whereas the V600E BRAF mutation remained undetectable when assayed via BRAF ASO.
[0158] Accordingly, these results demonstrate that the thyroid cancer screening assay of the present technology is useful in methods for detecting at least one mutation in the plurality of thyroid cancer-related genes disclosed herein in a subject at risk for or suspected of having thyroid cancer.
Example 3: Evaluation of Precision and Analytical Sensitivity of the Thyroid Cancer Screening Assay of the Present Technology
[0159] Eight specimens with known variants (single nucleotide variant (SNV), insertions/deletions (INDEL), and gene fusions) were assayed three times within a single run, as well as four times between runs. In addition, both FFPE and FNA specimens were included in the precision studies (see table below).
TABLE-US-00010 Sample ID Specimen type Known variant(s) QC1 Extracted DNA AKT1 E17K, BRAF V600E, CTNNB1 S33Y; S45del KRAS G13D, NRAS Q61R PIK3CA E545K, H1047R QC2 FFPE EML4-ALK QC3 FNA Not Detected QC4 FNA NRAS Q61R QC5 FNA BRAF V600E QC6 FFPE BRAF V600E, TERT-228 QC7 FFPE Not Detected QC8 FNA RET-PTC1
[0160] Intra-Assay Precision.
[0161] All known variants (SNVs, INDELs, gene fusion products) were detected in all three Intra-assay replicates. With respect to mutations, the SD of variant frequency in samples QC1 and QC4-6 ranged from 0.1-5.8% (
[0162] Inter-Assay Precision.
[0163] All known variants (SNVs, INDELs, gene fusion products) were detected in all four Inter-assay replicates. With respect to mutations, the SD of variant frequency in samples QC1 and QC4-6 ranged from 0.4-5.4% (
[0164] Analytical Sensitivity.
[0165] To determine the analytic sensitivity of the methods of the present technology, mixing studies were performed using 4 clinical samples (2 FFPE and 2 FNA samples; 2 of which are mutation positive and 2 translocation positive) serially mixed with either normal thyroid FFPE or mutation/translocation negative FNA samples. With respect to detecting mutations, the BRAF V600E and KRAS G12D SNVs and the TP53 12-nucleotide deletion were detectable when were present at frequencies as low as 1%. The TERT-228 SNV (124 C>T) was detected when present at frequencies as low as 2% (
[0166] With respect to detecting gene fusion products, the EML4-ALK translocation was detected in a 1:32 mixed FFPE sample (at 276 reads), while the RET-PTC1 translocation was detected in the 1:32 mixed FNA sample (at 64 reads,
[0167] Detection Limit Studies.
[0168] To determine the minimal sample requirement of the disclosed methods, dilution series studies were performed using four clinical samples (2 FFPE and 2 FNA samples; 2 mutation positive and 2 translocation positive as shown in
[0169] With respect to detecting translocations, the methods of the present technology were able to detect the PAX8-PPARG translocation at the lowest RNA input tested (0.1 ng/L at 21322 reads,
[0170] Accuracy Studies.
[0171] The Horizon reference mixture (i.e., the QC1 sample) was tested in multiple setups to assess the recovery of known variants. The expected variant frequency, based on mixing calculations, and the observed variant frequency are shown in
[0172] Twenty-six synthetic double-stranded gBlock DNA fragments containing select RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, and ALK translocations were designed and assayed using the methods of the present technology to assess the recovery of these fusion variants.
[0173] Improved Diagnostic Performance.
[0174] A total of 34 FNA thyroid specimens and 14 FFPE specimens (6 thyroid, 8 others) that were previously tested by either the 7-gene thyroid panel (BRAF by allele-specific PCR, RAS by pyrosequencing, PAX8-PPARG and RET-PTC1/3 by RT-PCR) or other alternative methods were assayed using the NGS-based thyroid cancer screening methods of the present technology.
[0175] Among the 40 assayed thyroid specimens that generated a valid NGS result, 15 variants (10 SNVs, 5 fusion products) were detected in 15 samples via the 7-gene assay. In contrast, 24 variants (18 SNVs, 6 fusions) were detected in 20 samples using the methods of the present technology (see
[0176] Table 4 demonstrates that the methods of the present technology show enhanced sensitivity in detecting mutations in samples with inconclusive FNA cytology compared to the traditional 7-gene thyroid panel.
TABLE-US-00011 TABLE 4 Detection of Mutations in Samples with Inconclusive FNA Cytology # Positive by 2-step PCR # Positive method of by 7-gene the present Specimen # tested panel technology* Mutation Translocation Normal 13 0 0 Benign 11 0 2 TSHR (n = 2), M453T at 11%; F631L at 10% AUS/FLUS 18 2 4 KRAS (n = 2), G12V at 7%; G13D at 14% TSHR (n = 2), F631L at 5%; T632I at 23% FN/SFN 5 1 3 GNAS (n = 1), PAX8-PPARG R201H at 24% (n = 1) RET (n = 1), H745R at 15% SUSP 4 2 3 BRAF (n = 2), NTRK3 V600E at 24%; (n = 1) V600E at 2% Malignant 8 6 8 BRAF (n = 3), RET-PTC V600E at 33%; (n = 1), V600E at 15%; ALK (n = 1), V600E at 41% RET-PTC + BRAF + TERT TERT (n = 1), (n = 1), TERT-228 at 21% V600E at 25%; TERT-228 at 14%) RET (n = 1), M918T at 33% Total 59 11 20 *The 2-step PCR method screens for mutations in BRAF, NRAS, HRAS, KRAS, PIK3CA, TP53, CTNNB1, PTEN, TSHR, AKT1, GNAS, RET, TERT, and EIF1AX, and translocations in RET, PPAR, NTRK1, NTRK3, BRAF, MET, LTK, and ALK.
[0177] According to Table 4, the NGS PCR-based thyroid cancer screening methods of the present technology detected actionable variants in 15% more samples with abnormal FNA cytology results compared to the 7-gene thyroid panel. As shown in Table 4, the NGS-based methods of the present technology detected actionable variants in twice as many samples having inconclusive FNA cytology (AUS/FLUS, FN/SFN, SUSP) compared to the 7-gene thyroid panel (i.e., 10 samples vs. 5 samples). Moreover, unlike the 7-gene thyroid panel, the methods of the present technology detected TSHR activating mutations in 2 samples having benign FNA cytology. These diagnostic results are significant because the M453T and F631L mutations of TSHR have been previously implicated in thyroid carcinoma and hyperfunctioning thyroid adenoma/toxic multinodular goiter respectively (Iosco & Rhoden, Atlas of Genetics and Cytogenetics in Oncology and Haematology (2009), http://atlasgeneticsoncology.org/Genes/TSHRID290ch14q31.html). Further, the NGS-based methods of the present technology detected actionable variants in 100% of the samples that exhibited malignant FNA cytology. In contrast, the 7-gene thyroid panel detected actionable variants in only 75% of the samples with malignant FNA cytology. Thus, the methods disclosed herein are useful in predicting the risk of malignancy in a subject with inconclusive thyroid FNA cytology results, and guiding treatment decisions (e.g., diagnostic surgery) in such subjects.
[0178] These results demonstrate that the NGS-based thyroid cancer screening methods of the present technology have improved breadth of coverage and sensitivity over the conventional 7-gene thyroid panel. Accordingly, the methods of the present technology are useful for predicting the risk of malignancy in a subject with inconclusive thyroid FNA cytology results. The methods disclosed herein are also useful for selecting a subject having thyroid nodules with indeterminate cytology for diagnostic surgery.
EQUIVALENTS
[0179] The present technology is not to be limited in terms of the particular embodiments described in this application, which are intended as single illustrations of individual aspects of the present technology. Many modifications and variations of this present technology can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. Functionally equivalent methods and apparatuses within the scope of the present technology, in addition to those enumerated herein, will be apparent to those skilled in the art from the foregoing descriptions. Such modifications and variations are intended to fall within the scope of the present technology. It is to be understood that this present technology is not limited to particular methods, reagents, compounds compositions or biological systems, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
[0180] In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.
[0181] As will be understood by one skilled in the art, for any and all purposes, particularly in terms of providing a written description, all ranges disclosed herein also encompass any and all possible subranges and combinations of subranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as up to, at least, greater than, less than, and the like, include the number recited and refer to ranges which can be subsequently broken down into subranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 cells refers to groups having 1, 2, or 3 cells. Similarly, a group having 1-5 cells refers to groups having 1, 2, 3, 4, or 5 cells, and so forth.
[0182] All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.