FLOW CELLS AND METHODS
20220390348 · 2022-12-08
Inventors
- Eric M. Brustad (San Diego, CA, US)
- Craig Michael Ciesla (Mountain View, CA, US)
- Jeffrey S. Fisher (San Diego, CA, US)
- Sahngki Hong (San Diego, CA, US)
- Lewis J. Kraft (San Diego, CA, US)
Cpc classification
C12Q2563/159
CHEMISTRY; METALLURGY
B01J2219/00621
PERFORMING OPERATIONS; TRANSPORTING
C12Q2565/513
CHEMISTRY; METALLURGY
C12Q1/6874
CHEMISTRY; METALLURGY
B01J2219/00637
PERFORMING OPERATIONS; TRANSPORTING
C12Q2565/513
CHEMISTRY; METALLURGY
B01J19/0046
PERFORMING OPERATIONS; TRANSPORTING
C12Q1/6806
CHEMISTRY; METALLURGY
B01J2219/00644
PERFORMING OPERATIONS; TRANSPORTING
C12Q2563/159
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
International classification
Abstract
An example of a flow cell includes a substrate; a plurality of reactive regions extending along the substrate; and a non-reactive region separating one of the plurality of reactive regions from an adjacent one of the plurality of reactive regions. Each of the plurality of reactive regions includes alternating first and second areas positioned along the reactive region. Each of the first areas includes a first primer set and each of the second areas includes a second primer set that is different than the first primer set. Either adjacent first and second areas directly abut each other, or) the first areas are positioned on protrusions and the second areas are positioned in depressions adjacent to the protrusions.
Claims
1. A flow cell, comprising: a substrate; a plurality of reactive regions extending along the substrate; and a non-reactive region separating one of the plurality of reactive regions from an adjacent one of the plurality of reactive regions; wherein: each of the plurality of reactive regions includes alternating first and second areas positioned along the reactive region; each of the first areas includes a first primer set and each of the second areas includes a second primer set that is different than the first primer set; and i) adjacent first and second areas directly abut each other or ii) the first areas are positioned on protrusions and the second areas are positioned in depressions adjacent to the protrusions.
2. The flow cell as defined in claim 1, wherein: the first primer set includes P5 and P7 primers; and the second primer set includes any combination of PA, PB, PC and/or PD primers.
3. The flow cell as defined in claim 1, wherein: the first primer set includes unblocked P5 and P7 primers; and the second primer set includes 3′ blocked P5 and P7 primers.
4. The flow cell as defined in claim 1, wherein the non-reactive region is an exposed portion of the substrate.
5. The flow cell as defined in claim 1, wherein each of the first and second areas includes a polymeric hydrogel to which the respective first and second primer sets are attached.
6. The flow cell as defined in claim 1, wherein: the first area includes a first polymeric hydrogel to which the first primer set is attached; the second area includes a second polymeric hydrogel to which the second primer set is attached; and the first polymeric hydrogel and the second polymeric hydrogel include orthogonal functional groups to respectively attach the first primer set and the second primer set.
7. The flow cell as defined in claim 1, wherein: the first areas are positioned on the protrusions and the second areas are positioned in the depressions adjacent to the protrusions; and a sidewall of each of the depressions defines a respective interstitial region.
8. A flow cell, comprising: a substrate; and rows and columns of alternating first and second areas; wherein: each of the first areas includes a first primer set and each of the second areas includes a second primer set that is different than the first primer set; and i) adjacent first and second areas directly abut each other or ii) the first areas are positioned on protrusions and the second areas are positioned in depressions adjacent to the protrusions.
9. The flow cell as defined in claim 8, wherein a shape of each of the first and second areas is a circle or a diamond.
10. The flow cell as defined in claim 8, wherein: the first primer set includes P5 and P7 primers; and the second primer set includes any combination of PA, PB, PC and/or PD primers.
11. The flow cell as defined in claim 8, wherein: the first primer set includes unblocked P5 and P7 primers; and the second primer set includes 3′ blocked P5 and P7 primers.
12. The flow cell as defined in claim 8, wherein each of the first and second areas includes a polymeric hydrogel to which the respective first and second primer sets are attached.
13. The flow cell as defined in claim 8, wherein: the first area includes a first polymeric hydrogel to which the first primer set is attached; the second area includes a second polymeric hydrogel to which the second primer set is attached; and the first polymeric hydrogel and the second polymeric hydrogel include orthogonal functional groups to respectively attach the first primer set and the second primer set.
14. A flow cell, comprising: a substrate having alternating regions of a first height and regions of a second height; and alternating first and second areas extending along the regions of the first height and extending along the regions of the second height; wherein each of the first areas includes a first primer set, and each of the second areas includes a second primer set that is different than the first primer set.
15. The flow cell as defined in claim 14, wherein a difference between the first height and the second height is at least 150 nm.
16. The flow cell as defined in claim 14, wherein: the first primer set includes P5 and P7 primers; and the second primer set includes any combination of PA, PB, PC and/or PD primers.
17. The flow cell as defined in claim 14, wherein: the first primer set includes unblocked P5 and P7 primers; and the second primer set includes 3′ blocked P5 and P7 primers.
18. The flow cell as defined in claim 14, further comprising a non-reactive region located at at least a portion of the perimeter of the substrate, wherein the non-reactive region is an exposed portion of the substrate.
19. The flow cell as defined in claim 14, wherein each of the first and second areas includes a polymeric hydrogel to which the respective first and second primer sets are attached.
20. The flow cell as defined in claim 14, wherein: the first area includes a first polymeric hydrogel to which the first primer set is attached; the second area includes a second polymeric hydrogel to which the second primer set is attached; and the first polymeric hydrogel and the second polymeric hydrogel include orthogonal functional groups to respectively attach the first primer set and the second primer set.
44. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0005] Features of examples of the present disclosure will become apparent by reference to the following detailed description and drawings, in which like reference numerals correspond to similar, though perhaps not identical, components. For the sake of brevity, reference numerals or features having a previously described function may or may not be described in connection with other drawings in which they appear.
[0006]
[0007]
[0008]
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
DETAILED DESCRIPTION
[0024] Some of the flow cells disclosed herein include orthogonal primer sets at adjacent reactive areas. Orthogonal primer sets enable different template strands to be amplified on the respective reactive areas, without enabling a template strand from an adjacent reactive area to seed and amplify. As such, orthogonal primers reduce or eliminate index or pad hopping. Orthogonal primers also increase the reactive area density, and thus signal intensity during sequencing.
[0025] Other flow cells disclosed herein include orthogonal capture primers arranged in rows and offset columns across the substrate. Orthogonal capture primers enable different template strands to be seeded at respective areas across the substrate surface, and a surrounding primer set enables the seeded template strands to be amplified.
Definitions
[0026] It is to be understood that terms used herein will take on their ordinary meaning in the relevant art unless specified otherwise. Several terms used herein and their meanings are set forth below.
[0027] The singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise.
[0028] The terms comprising, including, containing and various forms of these terms are synonymous with each other and are meant to be equally broad.
[0029] The terms top, bottom, lower, upper, on, etc. are used herein to describe the flow cell and/or the various components of the flow cell. It is to be understood that these directional terms are not meant to imply a specific orientation, but are used to designate relative orientation between components. The use of directional terms should not be interpreted to limit the examples disclosed herein to any specific orientation(s).
[0030] The terms first, second, etc. also are not meant to imply a specific orientation or order, but rather are used to distinguish one component from another.
##STR00001##
[0031] An “acrylamide monomer” is a monomer with the structure or a monomer including an acrylamide group. Examples of the monomer including an acrylamide group include azido acetamido pentyl acrylamide:
##STR00002##
and N-isopropylacrylamide:
[0032] ##STR00003##
Other acrylamide monomers may be used.
[0033] The term “activation,” as used herein, refers to a process that generates reactive groups at the surface of a base support or an outermost layer of a multi-layered structure. Activation may be accomplished using silanization or plasma ashing. While activation may be performed in each of the methods disclosed herein, the figures do not depict the reactive groups. It is to be understood, however, that a silanized layer or —OH groups (from plasma ashing) are present to covalently attach the polymeric hydrogels to the underlying support or layer. Suitable silanes that may be used in a silanization process include amino silanes, such as (3-aminopropyl)trimethoxysilane) (APTMS), (3-aminopropyl)triethoxysilane) (APTES), N-(6-aminohexyl)aminomethyltriethoxysilane (AHAMTES), N-(2-aminoethyl)-3-aminopropyltriethoxysilane (AEAPTES), and N-(2-aminoethyl)-3-aminopropyltrimethoxysilane (AEAPTMS); alkynyl silanes, such as O-propargyl)-N-(triethoxysilylpropyl)carbamate, cyclooctyne, a cyclooctyne derivative, or bicyclononynes (e.g., bicyclo[6.1.0]non-4-yne or derivatives thereof, bicyclo[6.1.0]non-2-yne, or bicyclo[6.1.0]non-3-yne); or norbornene silanes, such as [(5-bicyclo[2.2.1]hept-2-enyl)ethyl]trimethoxysilane.
[0034] An aldehyde, as used herein, is an organic compound containing a functional group with the structure —CHO, which includes a carbonyl center (i.e., a carbon double-bonded to oxygen) with the carbon atom also bonded to hydrogen and an R group, such as an alkyl or other side chain. The general structure of an aldehyde is:
##STR00004##
[0035] As used herein, “alkyl” refers to a straight or branched hydrocarbon chain that is fully saturated (i.e., contains no double or triple bonds). The alkyl group may have 1 to 20 carbon atoms. Example alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tertiary butyl, pentyl, hexyl, and the like. As an example, the designation “C1-4 alkyl” indicates that there are one to four carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from the group consisting of methyl, ethyl, propyl, iso-propyl, n-butyl, isobutyl, sec-butyl, and t-butyl.
[0036] As used herein, “alkenyl” refers to a straight or branched hydrocarbon chain containing one or more double bonds. The alkenyl group may have 2 to 20 carbon atoms. Example alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl, and the like.
[0037] As used herein, “alkyne” or “alkynyl” refers to a straight or branched hydrocarbon chain containing one or more triple bonds. The alkynyl group may have 2 to 20 carbon atoms.
[0038] As used herein, “aryl” refers to an aromatic ring or ring system (i.e., two or more fused rings that share two adjacent carbon atoms) containing only carbon in the ring backbone. When the aryl is a ring system, every ring in the system is aromatic. The aryl group may have 6 to 18 carbon atoms. Examples of aryl groups include phenyl, naphthyl, azulenyl, and anthracenyl.
[0039] An “amino” functional group refers to an —NR.sub.aR.sub.b group, where R.sub.a and R.sub.b are each independently selected from hydrogen (e.g.,
##STR00005##
C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7 carbocycle, C6-10 aryl, 5-10 membered heteroaryl, and 5-10 membered heterocycle, as defined herein.
[0040] As used herein, the term “attached” refers to the state of two things being joined, fastened, adhered, connected or bound to each other, either directly or indirectly. For example, a nucleic acid can be attached to a polymeric hydrogel by a covalent or non-covalent bond. A covalent bond is characterized by the sharing of pairs of electrons between atoms. A non-covalent bond is a physical bond that does not involve the sharing of pairs of electrons and can include, for example, hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions and hydrophobic interactions.
[0041] An “azide” or “azido” functional group refers to —N.sub.3.
[0042] As used herein, a “bonding region” refers to an area of a patterned structure that is to be bonded to another material, which may be, as examples, a spacer layer, a lid, another patterned structure, etc., or combinations thereof (e.g., a spacer layer and a lid, or a spacer layer and another patterned structure). The bond that is formed at the bonding region may be a chemical bond (as described above), or a mechanical bond (e.g., using a fastener, etc.).
[0043] As used herein, “carbocycle” means a non-aromatic cyclic ring or ring system containing only carbon atoms in the ring system backbone. When the carbocycle is a ring system, two or more rings may be joined together in a fused, bridged or spiro-connected fashion. Carbocycles may have any degree of saturation, provided that at least one ring in a ring system is not aromatic. Thus, carbocycles include cycloalkyls, cycloalkenyls, and cycloalkynyls. The carbocycle group may have 3 to 20 carbon atoms. Examples of carbocycle rings include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, 2,3-dihydro-indene, bicyclo[2.2.2]octanyl, adamantyl, and spiro[4.4]nonanyl.
[0044] As used herein, the term “carboxylic acid” or “carboxyl” as used herein refers to —COOH.
[0045] As used herein, “cycloalkylene” means a fully saturated carbocycle ring or ring system that is attached to the rest of the molecule via two points of attachment.
[0046] As used herein, “cycloalkenyl” or “cycloalkene” means a carbocycle ring or ring system having at least one double bond, wherein no ring in the ring system is aromatic. Examples include cyclohexenyl or cyclohexene and norbornenyl or norbornene. Also as used herein, “heterocycloalkenyl” or “heterocycloalkene” means a carbocycle ring or ring system with at least one heteroatom in ring backbone, having at least one double bond, wherein no ring in the ring system is aromatic.
[0047] As used herein, “cycloalkynyl” or “cycloalkyne” means a carbocycle ring or ring system having at least one triple bond, wherein no ring in the ring system is aromatic. An example is cyclooctyne. Another example is bicyclononyne. Also as used herein, “heterocycloalkynyl” or “heterocycloalkyne” means a carbocycle ring or ring system with at least one heteroatom in ring backbone, having at least one triple bond, wherein no ring in the ring system is aromatic.
[0048] The term “depositing,” as used herein, refers to any suitable application technique, which may be manual or automated, and, in some instances, results in modification of the surface properties. Generally, depositing may be performed using vapor deposition techniques, coating techniques, grafting techniques, or the like. Some specific examples include chemical vapor deposition (CVD), spray coating (e.g., ultrasonic spray coating), spin coating, dunk or dip coating, doctor blade coating, puddle dispensing, flow through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, or the like.
[0049] As used herein, the term “depression” refers to a discrete concave feature in a base support or a layer of a multi-layer stack. Depressions can have any of a variety of shapes at their opening in a surface including, as examples, round, elliptical, square, polygonal, star shaped (with any number of vertices), etc. The cross-section of a depression taken orthogonally with the surface can be curved, square, polygonal, hyperbolic, conical, angular, etc.
[0050] The term “each,” when used in reference to a collection of items, is intended to identify an individual item in the collection, but does not necessarily refer to every item in the collection. Exceptions can occur if explicit disclosure or context clearly dictates otherwise.
[0051] The term “epoxy” (also referred to as a glycidyl or oxirane group) as used herein refers to
##STR00006##
[0052] As used herein, the term “flow cell” is intended to mean a vessel having a flow channel where a reaction can be carried out, an inlet for delivering reagent(s) to the flow channel, and an outlet for removing reagent(s) from the flow channel. In some examples, the flow cell accommodates the detection of the reaction that occurs in the flow cell. For example, the flow cell can include one or more transparent surfaces allowing for the optical detection of arrays, optically labeled molecules, or the like.
[0053] As used herein, a “flow channel” or “channel” may be an area defined between two bonded components, which can selectively receive a liquid sample. In some examples, the flow channel may be defined between two patterned structures, and thus may be in fluid communication with the surface chemistry of each of the patterned structures. In other examples, the flow channel may be defined between a patterned structure and a lid, and thus may be in fluid communication with the surface chemistry of the one patterned structure.
[0054] As used herein, “heteroaryl” refers to an aromatic ring or ring system (i.e., two or more fused rings that share two adjacent atoms) that contain(s) one or more heteroatoms, that is, an element other than carbon, including but not limited to, nitrogen, oxygen and sulfur, in the ring backbone. When the heteroaryl is a ring system, every ring in the system is aromatic. The heteroaryl group may have 5-18 ring members.
[0055] As used herein, “heterocycle” means a non-aromatic cyclic ring or ring system containing at least one heteroatom in the ring backbone. Heterocycles may be joined together in a fused, bridged or spiro-connected fashion. Heterocycles may have any degree of saturation provided that at least one ring in the ring system is not aromatic. In the ring system, the heteroatom(s) may be present in either a non-aromatic or aromatic ring. The heterocycle group may have 3 to 20 ring members (i.e., the number of atoms making up the ring backbone, including carbon atoms and heteroatoms). In some examples, the heteroatom(s) are O, N, or S.
[0056] The term “hydrazine” or “hydrazinyl” as used herein refers to a —NHNH.sub.2 group.
[0057] As used herein, the term “hydrazone” or “hydrazonyl” as used herein refers to a
##STR00007##
group in which R.sub.a and R.sub.b are each independently selected from hydrogen, C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7 carbocycle, C6-10 aryl, 5-10 membered heteroaryl, and 5-10 membered heterocycle, as defined herein.
[0058] As used herein, “hydroxy” or “hydroxyl” refers to an —OH group.
[0059] As used herein, the term “interstitial region” refers to an area, e.g., of a base support or a layer of a multi-layer stack that separates depressions (concave regions) or protrusions (convex regions). In the examples disclosed herein, some of the depressions and/or protrusions directly abut one another and thus there is no interstitial region present between the two abutting depressions and/or protrusions. In other examples, an interstitial region may be formed between depressions and/or protrusions that are positioned at a diagonal to one other, or may be formed at the intersection of three of four abutting depressions and/or protrusions. Interstitial regions have a surface material that differs from the surface material of the depressions or the protrusions. For example, the depressions and/or protrusions can have a polymeric hydrogel and a primer set thereon, while the interstitial region is free of this surface chemistry.
[0060] As used herein, a “negative photoresist” refers to a light-sensitive material in which a portion that is exposed to light of particular wavelength(s) becomes insoluble to a developer. In these examples, the insoluble negative photoresist has less than 5% solubility in the developer. With the negative photoresist, the light exposure changes the chemical structure so that the exposed portions of the material becomes less soluble (than non-exposed portions) in the developer. While not soluble in the developer, the insoluble negative photoresist may be at least 99% soluble in a remover that is different from the developer. The remover may be a solvent or solvent mixture used, e.g., in a lift-off process.
[0061] In contrast to the insoluble negative photoresist, any portion of the negative photoresist that is not exposed to light is at least 95% soluble in the developer. In some examples, the portion of the negative photoresist not exposed to light is at least 98%, e.g., 99%, 99.5%, 100%, soluble in the developer.
[0062] “Nitrile oxide,” as used herein, means a “R.sub.aC≡N.sup.+O.sup.−” group in which R.sub.a is defined herein. Examples of preparing nitrile oxide include in situ generation from aldoximes by treatment with chloramide-T or through action of base on imidoyl chlorides [RC(Cl)═NOH] or from the reaction between hydroxylamine and an aldehyde.
##STR00008##
[0063] “Nitrone,” as used herein, means a group in which R.sup.1, R.sup.2, and R.sup.3 may be any of the R.sub.a and R.sub.b groups defined herein, except that R.sup.3 is not hydrogen (H).
[0064] As used herein, a “nucleotide” includes a nitrogen containing heterocyclic base, a sugar, and one or more phosphate groups. Nucleotides are monomeric units of a nucleic acid sequence. In RNA, the sugar is a ribose, and in DNA, the sugar is a deoxyribose, i.e. a sugar lacking a hydroxyl group that is present at the 2′ position in ribose. The nitrogen containing heterocyclic base (i.e., nucleobase) can be a purine base or a pyrimidine base. Purine bases include adenine (A) and guanine (G), and modified derivatives or analogs thereof. Pyrimidine bases include cytosine (C), thymine (T), and uracil (U), and modified derivatives or analogs thereof. The C-1 atom of deoxyribose is bonded to N-1 of a pyrimidine or N-9 of a purine. A nucleic acid analog may have any of the phosphate backbone, the sugar, or the nucleobase altered. Examples of nucleic acid analogs include, for example, universal bases or phosphate-sugar backbone analogs, such as peptide nucleic acid (PNA).
[0065] In some examples, the term “over” may mean that one component or material is positioned directly on another component or material. When one is directly on another, the two are in contact with each other. In
[0066] In other examples, the term “over” may mean that one component or material is positioned indirectly on another component or material. By indirectly on, it is meant that a gap or an additional component or material may be positioned between the two components or materials. In
[0067] A “patterned resin” refers to any polymer that can have depressions and/or protrusions defined therein. Specific examples of resins and techniques for patterning the resins will be described further below.
[0068] A “patterned structure” refers to a single layer base support that includes, or a multi-layer stack with a layer that includes surface chemistry in a pattern, e.g., in depressions, on protrusions, or otherwise positioned on the support or layer surface. The surface chemistry may include a polymeric hydrogel and primers. In some examples, the single layer base support or the layer of the multi-layer stack have been exposed to patterning techniques (e.g., etching, lithography, etc.) in order to generate the pattern for the surface chemistry. However, the term “patterned structure” is not intended to imply that such patterning techniques have to be used to generate the pattern. For example, a base support may be a substantially flat surface having a pattern of the polymeric hydrogel thereon. The patterned structure may be generated via any of the methods disclosed herein.
[0069] As used herein, the “primer” is defined as a single stranded nucleic acid sequence (e.g., single strand DNA). Some primers, referred to herein as capture primers, serve as a seed for a library template. Some other primers, referred to herein as amplification primers, serve as a starting point for template amplification and cluster generation. In some instances, an amplification primer may also serve as a capture primer for seeding a library template. Still other primers, referred to herein as sequencing primers, serve as a starting point for DNA synthesis. The 5′ terminus of the primer may be modified to allow a coupling reaction with a functional group of a polymer. The primer length can be any number of bases long and can include a variety of non-natural nucleotides. In an example, the sequencing primer is a short strand, ranging from 10 to 60 bases, or from 20 to 40 bases.
[0070] As used herein, a “positive photoresist” refers to a light-sensitive material in which a portion that is exposed to light of particular wavelength(s) becomes soluble to a developer. In these examples, any portion of the positive photoresist exposed to light is at least 95% soluble in the developer. In some examples, the portion of the positive photoresist exposed to light is at least 98%, e.g., 99%, 99.5%, 100%, soluble in the developer. With the positive photoresist, the light exposure changes the chemical structure so that the exposed portions of the material become more soluble (than non-exposed portions) in the developer.
[0071] In contrast to the soluble positive photoresist, any portion of the positive photoresist not exposed to light is insoluble (less than 5% soluble) in the developer. While not soluble in the developer, the insoluble positive photoresist may be at least 99% soluble in a remover that is different from the developer. In some examples, insoluble positive photoresist is at least 98%, e.g., 99%, 99.5%, 100%, soluble in the remover. The remover may be a solvent or solvent mixture used in a lift-off process.
[0072] A “spacer layer,” as used herein refers to a material that bonds two components together. In some examples, the spacer layer can be a radiation-absorbing material that aids in bonding, or can be put into contact with a radiation-absorbing material that aids in bonding.
[0073] The term “substrate” refers to the single layer base support or a multi-layer structure upon which surface chemistry is introduced.
[0074] The term “surface chemistry” refers to a polymeric hydrogel and a primer set attached to the polymeric hydrogel. The surface chemistry may be arranged in a variety of architectures in the examples disclosed herein. The surface chemistry makes up a reactive area or region of the substrate, and areas or regions of the substrate that are free of the surface chemistry may be referred to as non-reactive areas or regions.
[0075] The term “tantalum pentoxide” refers to the inorganic compound with the formula Ta.sub.2O.sub.5. This compound is transparent, having a transmittance ranging from about 0.25 (25%) to 1 (100%), to wavelengths ranging from about 0.35 μm (350 nm) to at least 1.8 μm (1800 nm). A “tantalum pentoxide base support” or “tantalum pentoxide layer” may comprise, consist essentially of, or consist of Ta.sub.2O.sub.5.
[0076] A “thiol” functional group refers to —SH.
[0077] As used herein, the terms “tetrazine” and “tetrazinyl” refer to six-membered heteroaryl group comprising four nitrogen atoms. Tetrazine can be optionally substituted.
[0078] “Tetrazole,” as used herein, refer to five-membered heterocyclic group including four nitrogen atoms. Tetrazole can be optionally substituted.
[0079] Primers
[0080] In some of the examples set forth herein, the flow cell includes different primer sets attached to immediately adjacent reactive areas. In one example, immediately adjacent reactive areas are those that are next to each other on a substrate surface and that abut one another. In another example, immediately adjacent reactive areas are those that are next to each on a substrate surface, but that do not abut one another because they are positioned at different heights.
[0081] Examples of different primer sets attached to immediately adjacent reactive areas are shown in
[0082] Each primer set 14A, 14B, 14C includes two different primers 16A, 18A, or 16B, 18B, or 16C, 18C, such as forward and reverse amplification primers. The primers 16A, 18A of the first set, e.g., 14A, together enable the amplification of a library template having end adapters that are complementary to the two different primers 16A, 18A in that first set 14A. The primers 16B, 18B of a second set, e.g., 16B, together enable the amplification of a different library template having end adapters that are complementary to the two different primers 16B, 18B in the second set 14B, but do not enable the library template associated with the first primer set 14A to be seeded or amplified. In some examples, a third primer set 14C is used. In these examples, the primers 16C, 18C of the third set 14C together enable the amplification of a different library template having end adapters that are complementary to the two different primers 16C, 18C in the third set 14C, but do not enable the library template associated with the first primer set 14A or the second primer set 14B to be seeded or amplified.
[0083] As examples, the first primer set 12 includes P5 and P7 primers; and the second primer set 14 includes any combination of the PA primers, the PB primers, the PC primers, and the PD primers set forth herein. In other examples, P15 and P7 may be used in the first primer set 12. As examples, the second primer set 14 may include any two (or three) PA, PB, PC, and PD primers, or any combination of one PA primer and one PB, PC, or PD primer, or any combination of one PB primer and one PC or PD primer, or any combination of one PC primer and one PD primer.
[0084] Examples of P5 and P7 primers are used on the surface of commercial flow cells sold by Illumina Inc. for sequencing, for example, on HISEQ™, HISEQX™, MISEQ™, MISEQDX™, MINISEQ™, NEXTSEQ™, NEXTSEQDX™, NOVASEQ™, ISEQ™, GENOME ANALYZER™, and other instrument platforms. The P5 primer is:
TABLE-US-00001 P5: 5′.fwdarw.3′ (SEQ. ID. NO. 1) AATGATACGGCGACCACCGAGAUCTACAC The P7 primer may be any of the following: P7 #1: 5′.fwdarw.3′ (SEQ. ID. NO. 2) CAAGCAGAAGACGGCATACGAnAT P7 #2: 5′.fwdarw.3′ (SEQ. ID. NO. 3) CAAGCAGAAGACGGCATACnAGAT
where “n” is 8-oxoguanine or uracil in each of these sequences.
The P15 primer is:
TABLE-US-00002 P15: 5′.fwdarw.3′ (SEQ. ID. NO. 4) AATGATACGGCGACCACCGAGAnCTACAC
where “n” is allyl-T.
The other primers (PA-PD) mentioned above include:
TABLE-US-00003 PA 5′.fwdarw.3′ (SEQ. ID. NO. 5) GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG cPA (PA′) 5′.fwdarw.3′ (SEQ. ID. NO. 6) CTCAACGGATTAACGAAGCGTTCGGACGTGCCAGC PB 5′.fwdarw.3′ (SEQ. ID. NO. 7) CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT cPB (PB′) 5′.fwdarw.3′ (SEQ. ID. NO. 8) AGTTCATATCCACCGAAGCGCCATGGCAGACGACG PC 5′.fwdarw.3′ (SEQ. ID. NO. 9) ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT cPC (PC′) 5′.fwdarw.3′ (SEQ. ID. NO. 10) AGTTGCGGATTCGACGCGTTGATATTAGCGGCCGT PD 5′.fwdarw.3′ (SEQ. ID. NO. 11) GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC cPD (PD′) 5′.fwdarw.3′ (SEQ. ID. NO. 12) GCTGCATCGAATAGTCCGGCTAACGTAACGCGGC
While not shown in the example sequences for PA-PD, it is to be understood that any of these primers may include a cleavage site, such as uracil, 8-oxoguanine, allyl-T, etc. at any point in the strand.
[0085] As other examples, the first primer set 14A includes unblocked P5 and P7 primers (SEQ. ID. NO. 1, SEQ. ID. NO. 2 or SEQ. ID. NO. 3); and the second primer set 14B includes 3′ blocked P5 and P7 primers. In this example, a blocking group (e.g., a 3′ phosphate) may be added that attaches to the exposed 3′ ends of the primers 16B, 18B of the second primer set 14B. The blocking group prevents undesired extension at these primers 16B, 18B during the amplification of the first primer set 14A. The blocking group may then be removed to perform a round of amplification with a newly added library template and the second primer set 14B.
[0086] In still other examples, one primer set 14A, 14B, 14C described herein may be used with another primer set which enables simultaneous paired end sequencing. Primer sets that enable simultaneous paired end sequencing include primer subsets on different regions of the polymeric hydrogel.
[0087] Each of the first primer subsets 13A, 13B, 13C, and 13D includes an un-cleavable first primer 17 or 17′ and a cleavable second primer 19 or 19′; and each of the second primer subsets 15A, 15B, 15C, and 15D includes a cleavable first primer 25 or 25′ and an un-cleavable second primer 27 or 27′.
[0088] The un-cleavable first primer 17 or 17′ and the cleavable second primer 19 or 19′ are oligonucleotide pairs, e.g., where the un-cleavable first primer 17 or 17′ is a forward amplification primer and the cleavable second primer 19 or 19′ is a reverse amplification primer or where the cleavable second primer 19 or 19′ is the forward amplification primer and the un-cleavable first primer 17 or 17′ is the reverse amplification primer. In each example of the first primer subset 13A, 13B, 13C, and 13D, the cleavable second primer 19 or 19′ includes a cleavage site 29, while the un-cleavable first primer 17 or 17′ does not include a cleavage site 29.
[0089] The cleavable first primer 25 or 25′ and the un-cleavable second primer 27 or 27′ are also oligonucleotide pairs, e.g., where the cleavable first primer 25 or 25′ is a forward amplification primer and the un-cleavable second primer 27 or 27′ is a reverse amplification primer or where the un-cleavable second primer 27 or 27′ is the forward amplification primer and the cleavable first primer 25 or 25′ is the reverse amplification primer. In each example of the second primer subset 15A, 15B, 15C, and 15D, the cleavable first primer 25 or 25′ includes a cleavage site 29′ or 31, while the un-cleavable second primer 27 or 27′ does not include a cleavage site 29′ or 31.
[0090] It is to be understood that the un-cleavable first primer 17 or 17′ of the first primer subset 13A, 13B, 13C, and 13D and the cleavable first primer 25 or 25′ of the second primer subset 15A, 15B, 15C, and 15D have the same nucleotide sequence (e.g., both are forward amplification primers), except that the cleavable first primer 25 or 25′ includes the cleavage site 29′ or 31 integrated into the nucleotide sequence or into a linker 33′ attached to the nucleotide sequence. Similarly, the cleavable second primer 19 or 19′ of the first primer subset 13A, 13B, 13C, and 13D and the un-cleavable second primer 27 or 27′ of the second primer subset 15A, 15B, 15C, and 15D have the same nucleotide sequence (e.g., both are reverse amplification primers), except that the cleavable second primer 19 or 19′ includes the cleavage site 29 integrated into the nucleotide sequence or into a linker 33 attached to the nucleotide sequence.
[0091] It is to be understood that when the first primers 17 and 25 or 17′ and 25′ are forward amplification primers, the second primers 19 and 27 or 19′ and 27′ are reverse primers, and vice versa.
[0092] The un-cleavable primers 17, 27 or 17′, 27′ may be any primers with a universal sequence for capture and/or amplification purposes, such as the P5, P7, and P15 primers or any combination of the PA, PD, PC, PD primers (e.g., PA and PB or PA and PD, etc.). It is to be understood that these primers 17, 27 or 17′, 27′ would not include the cleavage site (e.g., uracil, 8-oxoguanine, etc.) shown in the sequences. In some examples, the P5 and P7 primers are un-cleavable primers 17, 27 or 17′, 27′ because they do not include, respectively, the uracil and 8-oxoguanine. It is to be understood that any suitable universal sequence can be used as the un-cleavable primers 17, 27 or 17′, 27′.
[0093] Examples of cleavable primers 19, 25 or 19′, 25′ include the P5 and P7 primers or other universal sequence primers (e.g., the PA, PB, PC, PD primers) with the respective cleavage sites 29, 29′, 31 incorporated into the respective nucleic acid sequences (e.g.,
[0094] Each primer subset 13A and 15A or 13B and 15B or 13C and 15C or 13D and 15D is attached to a polymeric hydrogel region 12A1, 12A2. The polymeric hydrogel regions 12A1, 12A2 may include different functional groups that can selectively react with the respective primers 17, 19 or 17′, 19′ or 25, 27 or 25′, 27′.
[0095] While not shown in
[0096]
[0097] In the example shown in
[0098] Also, in the example shown in
[0099] In the example shown in
[0100] Examples of suitable linkers 33, 33′ may include nucleic acid linkers (e.g., 10 nucleotides or less) or non-nucleic acid linkers, such as a polyethylene glycol chain, an alkyl group or a carbon chain, an aliphatic linker with vicinal diols, a peptide linker, etc. An example of a nucleic acid linker is a polyT spacer, although other nucleotides can also be used. In one example, the spacer is a 6T to 10T spacer. The following are some examples of nucleotides including non-nucleic acid linkers with terminal alkyne groups (where B is the nucleobase and “oligo” is the primer):
##STR00009##
[0101] In the example shown in
[0102] The example shown in
[0103] The example shown in
[0104] In still other examples, the flow cell includes different capture primers arranged in rows and offset columns across the substrate. The capture primers are orthogonal, in that they enable different template strands (i.e., library templates) to be seeded at respective areas across the substrate surface. In an example, the capture primers are PX primers. The PX primers described herein may be used as capture primers that seed a library template molecule, but that do not otherwise participate in amplification as they are orthogonal to all of the other primers. For sequential paired end sequencing using the primers sets 14A, 14B, 14C, different PX primers may be included with the different primer sets 14A, 14B, 14C to capture different library template molecules.
[0105] The PX capture primers may be:
TABLE-US-00004 PX 5′.fwdarw.3′ (SEQ. ID. NO. 13) AGGAGGAGGAGGAGGAGGAGGAGG cPX (PX′) 5′.fwdarw.3′ (SEQ. ID. NO. 14) CCTCCTCCTCCTCCTCCTCCTCCT
[0106] Each of the primers disclosed herein may also include a polyT sequence at the 5′ end of the primer sequence. In some examples, the polyT region includes from 2 T bases to 20 T bases. As specific examples, the polyT region may include 3, 4, 5, 6, 7, or 10 T bases.
[0107] Any of the primers 16A, 18A or 16B, 18B, or 16C, 18C (including the capture primers) may be terminated, at the 5′ end, with a functional group that is capable of single point covalent attachment with a functional group of the polymeric hydrogel 12A, 12B, 12C. Examples of terminated primers that may be used include an alkyne terminated primer, a tetrazine terminated primer, an azido terminated primer, an amino terminated primer, an epoxy or glycidyl terminated primer, a thiophosphate terminated primer, a thiol terminated primer, an aldehyde terminated primer, a hydrazine terminated primer, a phosphoramidite terminated primer, and a triazolinedione terminated primer. In one example, the primers are terminated with hexynyl. In some specific examples, a succinimidyl (NHS) ester terminated primer may be reacted with an amine of the polymeric hydrogel 12A, 12B, 12C, an aldehyde terminated primer may be reacted with a hydrazine of the polymeric hydrogel 12A, 12B, 12C, or an alkyne terminated primer may be reacted with an azide of the polymeric hydrogel 12A, 12B, 12C, or an azide terminated primer may be reacted with an alkyne or DBCO (dibenzocyclooctyne) of the polymeric hydrogel 12A, 12B, 12C, or an amino terminated primer may be reacted with an activated carboxylate group or NHS ester of the polymeric hydrogel 12A, 12B, 12C, or a thiol terminated primer may be reacted with an alkylating reactant (e.g., iodoacetamine or maleimide) of the polymeric hydrogel 12A, 12B, 12C, or a phosphoramidite terminated primer may be reacted with a thioether of the polymeric hydrogel 12A, 12B, 12C. While several examples have been provided, it is to be understood that any functional group that can be attached to the primer 16A, 18A or 16B, 18B, or 16C, 18C and/or the capture primers and that can attach to a functional group of the polymeric hydrogel 12A, 12B, 12C may be used. Similar functional group may be included at the 5′ end of any of the primers 17, 17′, 19, 19′, 25, 25′, 27, 27′.
[0108] Polymeric Hydrogel
[0109] In any of the examples set forth herein, the primer set(s) 14A, 14B, 14C is/are attached to a polymeric hydrogel 12A, 12B, 12C. The attachment of the primer set(s) 14A, 14B, 14C leaves a template-specific portion of the primers 16A, 18A, or 16B, 18B, or 16C, 18C free to anneal to its cognate template and the 3′ hydroxyl group free for primer extension. It is to be understood that in the examples disclosed herein, the primer subset 13A, 15A or 13B, 15B, or 13C, 15C, or 13D, 15D may be used instead of one of the primer set(s) 14A, 14B, 14C. In these instances, the particular reactive area 10A, 10B, or 10C would include the primers 17, 19, 25, 27 or 17′, 19′, 25′, 27′ attached to the polymeric hydrogel 12A, 12B, or 12C (in the manner described in reference to
[0110] In some examples, the polymeric hydrogel 12A, 12B, 12C is the same in each of the reactive areas 10A, 10B, 10C. In these examples, the polymeric hydrogel 12A, 12B, 12C is chemically the same, and any technique disclosed herein may be used to sequentially attach the primers 16A, 18A, or 16B, 18B, or 16C, 18C of the respective sets 14A, 14B, 14C to the respective reactive areas 10A, 10B, 10C. When the primer subset 13A, 15A or 13B, 15B, or 13C, 15C, or 13D, 15D is used in one of the areas 10A, 10B, 10C, the primers 17, 19 or 17′ 19′ and 25, 27 or 25′, 27′ of the subsets 13A, 15A or 13B, 15B, or 13C, 15C, or 13D, 15D are sequentially attached using the example techniques disclosed herein.
[0111] In other examples, the polymeric hydrogel 12A, 12B, 12C is different in each of the reactive areas 10A, 10B, 10C. For example, the polymeric hydrogel 12A, 12B, 12C in each of the reactive areas 10A, 10B, 10C may include different functional groups that are able to attach to the terminal functional group of the respective primers 16A, 18A, or 16B, 18B, or 16C, 18C. When the primer subset 13A, 15A or 13B, 15B, or 13C, 15C, or 13D, 15D is used in one of the areas 10A, 10B, 10C, the polymeric hydrogel regions 12A1, 12A2 include respective functional groups for attaching the primers 17, 19 or 17′ 19′ and 25, 27 or 25′, 27′ of the particular subset 13A, 15A or 13B, 15B, or 13C, 15C, or 13D, 15D. In some instances, the different functional groups are functional groups that have been introduced to the polymeric hydrogel that is deposited on the substrate.
[0112] The polymeric hydrogel 12A, 12B, 12C may be any gel material that can swell when liquid is taken up and can contract when liquid is removed, e.g., by drying. In an example, the polymeric hydrogel includes an acrylamide copolymer. Some examples of the acrylamide copolymer are represented by the following structure (I):
##STR00010##
wherein:
[0113] R.sup.A is selected from the group consisting of azido, optionally substituted amino, optionally substituted alkenyl, optionally substituted alkyne, halogen, optionally substituted hydrazone, optionally substituted hydrazine, carboxyl, hydroxy, optionally substituted tetrazole, optionally substituted tetrazine, nitrile oxide, nitrone, sulfate, and thiol;
[0114] R.sup.B is H or optionally substituted alkyl;
[0115] R.sup.C, R.sup.D, and R.sup.E are each independently selected from the group consisting of H and optionally substituted alkyl;
[0116] each of the —(CH.sub.2).sub.p— can be optionally substituted;
[0117] p is an integer in the range of 1 to 50;
[0118] n is an integer in the range of 1 to 50,000; and
[0119] m is an integer in the range of 1 to 100,000.
[0120] One specific example of the acrylamide copolymer represented by structure (I) is poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide, PAZAM.
[0121] One of ordinary skill in the art will recognize that the arrangement of the recurring “n” and “m” features in structure (I) are representative, and the monomeric subunits may be present in any order in the polymer structure (e.g., random, block, patterned, or a combination thereof).
[0122] The molecular weight of the acrylamide copolymer may range from about 5 kDa to about 1500 kDa or from about 10 kDa to about 1000 kDa, or may be, in a specific example, about 312 kDa.
[0123] In some examples, the acrylamide copolymer is a linear polymer. In some other examples, the acrylamide copolymer is a lightly cross-linked polymer.
[0124] In other examples, the gel material may be a variation of structure (I). In one example, the acrylamide unit may be replaced with N,N-dimethylacrylamide
##STR00011##
In this example, the acrylamide unit in structure (I) may be replaced with
##STR00012##
where R.sup.D, R.sup.E, and R.sup.F are each H or a C1-C6 alkyl, and R.sup.G and R.sup.H are each a C1-C6 alkyl (instead of H as is the case with the acrylamide). In this example, q may be an integer in the range of 1 to 100,000. In another example, the N,N-dimethylacrylamide may be used in addition to the acrylamide unit. In this example, structure (I) may include
##STR00013##
in addition to the recurring “n” and “m” features, where R.sup.D, R.sup.E, and R.sup.F are each H or a C1-C6 alkyl, and R.sup.G and R.sup.H are each a C1-C6 alkyl. In this example, q may be an integer in the range of 1 to 100,000.
[0125] As another example of the polymeric hydrogel 12A, 12B, 12C, the recurring “n” feature in structure (I) may be replaced with a monomer including a heterocyclic azido group having structure (II):
##STR00014##
wherein R.sup.1 is H or a C1-C6 alkyl; R.sub.2 is H or a C1-C6 alkyl; L is a linker including a linear chain with 2 to 20 atoms selected from the group consisting of carbon, oxygen, and nitrogen and 10 optional substituents on the carbon and any nitrogen atoms in the chain; E is a linear chain including 1 to 4 atoms selected from the group consisting of carbon, oxygen and nitrogen, and optional substituents on the carbon and any nitrogen atoms in the chain; A is an N substituted amide with an H or a C1-C4 alkyl attached to the N; and Z is a nitrogen containing heterocycle. Examples of Z include 5 to 10 carbon-containing ring members present as a single cyclic structure or a fused structure. Some specific examples of Z include pyrrolidinyl, pyridinyl, or pyrimidinyl. As still another example, the polymeric hydrogel 12A, 12B, 12C may include a recurring unit of each of structure (III) and (IV):
##STR00015##
wherein each of R.sup.1aR.sup.2a, R.sup.1b and R.sup.2b is independently selected from hydrogen, an optionally substituted alkyl or optionally substituted phenyl; each of R.sup.1a and R.sup.2b is independently selected from hydrogen, an optionally substituted alkyl, an optionally substituted phenyl, or an optionally substituted C7-C14 aralkyl; and each L.sup.1 and L.sup.2 is independently selected from an optionally substituted alkylene linker or an optionally substituted heteroalkylene linker.
[0126] In still another example, the acrylamide copolymer is formed using nitroxide mediated polymerization, and thus at least some of the copolymer chains have an alkoxyamine end group. In the copolymer chain, the term “alkoxyamine end group” refers to the dormant species —ONR.sub.1R.sub.2, where each of R.sub.1 and R.sub.2 may be the same or different, and may independently be a linear or branched alkyl, or a ring structure, and where the oxygen atom is attached to the rest of the copolymer chain. In some examples, the alkoxyamine may also be introduced into some of the recurring acrylamide monomers, e.g., at position R.sup.A in structure (I). As such, in one example, structure (I) includes an alkoxyamine end group; and in another example, structure (I) includes an alkoxyamine end group and alkoxyamine groups in at least some of the side chains.
[0127] It is to be understood that other molecules may be used to form the polymeric hydrogel 12A, 12B, 12C, as long as they are functionalized to graft one of the oligonucleotide primer sets 14A, 14B, 14C or subsets 13A, 15A or 13B, 15B or 13C, 15C or 13D, 15D thereto. Some examples of suitable polymeric hydrogel 12A, 12B, 12C materials include functionalized silanes, such as norbornene silane, azido silane, alkyne functionalized silane, amine functionalized silane, maleimide silane, or any other silane having functional groups that can attach the respective primer set 14A, 14B, 14C or subset 13A, 15A or 13B, 15B or 13C, 15C or 13D, 15D. Other examples of suitable polymeric hydrogel 12A, 12B, 12C materials include those having a colloidal structure, such as agarose; or a polymer mesh structure, such as gelatin; or a cross-linked polymer structure, such as polyacrylamide polymers and copolymers, silane free acrylamide (SFA), or an azidolyzed version of SFA. Examples of suitable polyacrylamide polymers may be synthesized from acrylamide and an acrylic acid or an acrylic acid containing a vinyl group, or from monomers that form [2+2] photo-cycloaddition reactions. Still other examples of suitable polymeric hydrogel 12A, 12B, 12C materials include mixed copolymers of acrylamides and acrylates. A variety of polymer architectures containing acrylic monomers (e.g., acrylamides, acrylates etc.) may be utilized in the examples disclosed herein, such as branched polymers, including dendrimers (e.g., multi-arm or star polymers), star-shaped or star-block polymers, and the like. For example, the monomers (e.g., acrylamide, acrylamide containing the catalyst, etc.) may be incorporated, either randomly or in block, into the branches (arms) of a dendrimer.
[0128] The polymeric hydrogel 12A, 12B, 12C may be formed using any suitable copolymerization process, such as nitroxide mediated polymerization (NMP), reversible addition-fragmentation chain-transfer (RAFT) polymerization, etc. The polymeric hydrogel 12A, 12B, 12C may also be deposited using any of the methods disclosed herein.
[0129] The attachment of the polymeric hydrogel 12A, 12B, 12C to the underlying substrate may be through covalent bonding. In some instances, the underlying substrate may first be activated, e.g., through silanization or plasma ashing. Covalent linking is helpful for maintaining the primer sets 14A, 14B, 14C and/or subsets 13A, 15A or 13B, 15B or 13C, 15C or 13D, 15D in the desired regions throughout the lifetime of the flow cell during a variety of uses.
[0130] Substrate
[0131] The substrate of the flow cell may be a single layer base support or a multi-layer structure upon which the reactive areas 10A, 10B, 10C are formed.
[0132] Examples of suitable single layer base supports include epoxy siloxane, glass, modified or functionalized glass, plastics (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, polytetrafluoroethylene (such as TEFLON® from Chemours), cyclic olefins/cyclo-olefin polymers (COP) (such as ZEONOR® from Zeon), polyimides, etc.), nylon (polyamides), ceramics/ceramic oxides, silica, fused silica, or silica-based materials, aluminum silicate, silicon and modified silicon (e.g., boron doped p+ silicon), silicon nitride (Si.sub.3N.sub.4), silicon oxide (SiO.sub.2), tantalum pentoxide (Ta.sub.2O.sub.5) or other tantalum oxide(s) (TaO.sub.x), hafnium oxide (HfO.sub.2), carbon, metals, inorganic glasses, or the like.
[0133] Examples of the multi-layered structure include the base support and at least one other layer thereon. Some examples of the multi-layered structure include glass or silicon as the base support, with a coating layer of tantalum oxide (e.g., tantalum pentoxide or another tantalum oxide(s) (TaO.sub.x)) or another ceramic oxide at the surface. Other examples of the multi-layered structure include the base support (e.g., glass, silicon, tantalum pentoxide, or any of the other base support materials) and a patterned resin as the coating layer. It is to be understood that any material that can be selectively deposited, or deposited and patterned to form depressions, regions of different heights, etc. may be used for the patterned resin.
[0134] In one example, the patterned resin is an inorganic oxide that may be selectively applied to the base support via vapor deposition, aerosol printing, or inkjet printing. Examples of suitable inorganic oxides include tantalum oxide (e.g., Ta.sub.2O.sub.5), aluminum oxide (e.g., Al.sub.2O.sub.3), silicon oxide (e.g., SiO.sub.2), hafnium oxide (e.g., HfO.sub.2), etc.
[0135] In another example, the patterned resin is a polymeric resin that may be applied to the base support and then patterned. Suitable deposition techniques include chemical vapor deposition, dip coating, dunk coating, spin coating, spray coating, puddle dispensing, ultrasonic spray coating, doctor blade coating, etc. Suitable patterning techniques include photolithography, nanoimprint lithography (NIL), stamping techniques, embossing techniques, molding techniques, microetching techniques, etc. Some examples of suitable resins include a polyhedral oligomeric silsesquioxane based resin (e.g., POSS® from Hybrid Plastics), a non-polyhedral oligomeric silsesquioxane epoxy resin, a poly(ethylene glycol) resin, a polyether resin (e.g., ring opened epoxies), an acrylic resin, an acrylate resin, a methacrylate resin, an amorphous fluoropolymer resin (e.g., CYTOP® from Bellex), and combinations thereof.
[0136] As used herein, the term “polyhedral oligomeric silsesquioxane” refers to a chemical composition that is a hybrid intermediate (e.g., RSiO.sub.1.5) between that of silica (SiO.sub.2) and silicone (R.sub.2SiO). An example of polyhedral oligomeric silsesquioxane may be that described in Kehagias et al., Microelectronic Engineering 86 (2009), pp. 776-778, which is incorporated by reference in its entirety. In an example, the composition is an organosilicon compound with the chemical formula [RSiO.sub.3/2].sub.n, where the R groups can be the same or different. Example R groups for polyhedral oligomeric silsesquioxane include epoxy, azide/azido, a thiol, a poly(ethylene glycol), a norbornene, a tetrazine, acrylates, and/or methacrylates, or further, for example, alkyl, aryl, alkoxy, and/or haloalkyl groups. The resin composition disclosed herein may include one or more different cage or core structures as monomeric units.
[0137] In an example, the substrate may be fabricated using a round wafer having a diameter ranging from about 2 mm to about 300 mm, or from a rectangular sheet or panel having its largest dimension up to about 10 feet (˜3 meters). In an example, the substrate is fabricated using a round wafer having a diameter ranging from about 200 mm to about 300 mm. In another example, a panel may be used that is a rectangular support, which has a greater surface area than a 300 mm round wafer. Wafers, panels and other large substrate materials may be diced into the individual flow cell substrates. In another example, the substrate is a die having a width ranging from about 0.1 mm to about 10 mm. While example dimensions have been provided, it is to be understood that a substrate material with any suitable dimensions may be used to fabricate the substrate.
[0138] Flow Cell Architecture
[0139] A top view of a flow cell 20 is shown in
[0140] The flow channel 21 is at least partially defined by a patterned structure. The patterned structure may include a substrate, such as a single layer base support or a multi-layered structure.
[0141] In an example, the flow channel 21 has a rectangular or substantially rectangular configuration. The length and width of the flow channel 21 may be selected so a portion of the substrate surrounds the flow channel 21 and is available for attachment to a lid (not shown) or another patterned structure.
[0142] The depth of the flow channel 21 can be as small as a monolayer thick when microcontact, aerosol, or inkjet printing is used to deposit a separate material that defines the flow channel 21 walls. For other examples, the depth of the flow channel 21 can be about 1 μm, about 10 μm, about 50 μm, about 100 μm, or more. In an example, the depth may range from about 10 μm to about 100 μm. In another example, the depth may range from about 10 μm to about 30 μm. In still another example, the depth is about 5 μm or less. It is to be understood that the depth of the flow channel 21 may be greater than, less than or between the values specified above.
[0143]
[0144] Two examples of the patterned structure 23A, 23B of the flow cell 20 are shown in
[0145] In
[0146] In both
[0147] In the example shown in
[0148] The protrusions 28 extend a first height H.sub.1 from the bottom of the substrate 22 and the depressions 30 extend a second height H.sub.2 from the bottom of the substrate 22, where the first height H.sub.1 is greater than the second height H.sub.2. The surface of each of the protrusions 28 may be coplanar with the surface of the non-reactive regions 26, 26′. In this example, the surface of the non-reactive regions 26, 26′ is also the surface of the substrate 22. The surface of each of the depressions 30 is positioned at a depth measured from the protrusion/non-reactive region/substrate surface (e.g., surface of layer 44). The depth is at least 150 nm. This depth is particularly suitable for library templates that are 500 base pairs (bp) long (e.g., assuming 0.35 nm/bp). The depth should not exceed a height (depth) to width ratio of about 10:1. In some examples, the depth can range from about 150 nm to about 100 μm, e.g., about 0.5 μm, about 1 μm, about 10 μm, or more.
[0149] The shape of the protrusions 28 and the depressions 30 in the x-y plane of the substrate 22 may be a square or a rectangle. The protrusions 28 and the depressions 30 may have the same shape, and thus the same x-y dimensions. Each of the length and the width can be about 150 nm or more. In an example, the length and the width may each range from about 150 nm to about 100 μm, e.g., about 0.5 μm, about 2 μm, about 10 μm, or more. The length and width may be selected so they do not exceed a length to width aspect ratio of about 10:1. The width of each of the protrusions 28 and the depressions 30 is equal to the width of the reactive regions 24, 24′, 24″.
[0150] The size of each protrusion 28 and depression 30 may be characterized by its surface and opening area, respectively. The surface area of the protrusion 28 and the opening area of the depression 30 may range from about 1×10.sup.−3 μm.sup.2 to about 100 μm.sup.2, e.g., about 1×10.sup.−2 μm.sup.2, about 0.1 μm.sup.2, about 1 μm.sup.2, at least about 10 μm.sup.2, or more, or less.
[0151] The depression 30 may also be characterized by its volume. For example, the volume can range from about 1×10.sup.−3 μm.sup.3 to about 100 μm.sup.3, e.g., about 1×10.sup.−2 μm.sup.3, about 0.1 μm.sup.3, about 1 μm.sup.3, about 10 μm.sup.3, or more, or less.
[0152] As shown in
[0153] In the examples shown in
[0154] In this example, the active areas 10A, 10B are next to one another, but do not directly abut one another as one (10A) is positioned on the protrusion 28 and the other (10B) is positioned within the depression 30.
[0155] The active area 10A positioned over each of the protrusions 28 includes the polymeric hydrogel 12A and the primer set 14A. Thus, the x-y dimensions of each active area 10A are equal to the x-y dimensions of the protrusion 28 upon which the active area 10A is applied. The active area 10B positioned within each of the depressions 30 includes the polymeric hydrogel 12B and the primer set 14B. Thus, the x-y dimensions of each active area 10B are equal to the x-y dimensions of the depression 30 in which the active area 10B is applied.
[0156] As mentioned herein, the polymeric hydrogels 12A, 12B may be the same or may be different, and the primer sets 14A, 14B are different. In one example, each of the first and second areas 10A, 10B includes the same polymeric hydrogel 12A=12B to which the respective first and second primer sets 14A, 14B are attached. In another example, the first area 10A includes a first polymeric hydrogel 12A to which the first primer set 14A is attached; the second area 10B includes a second polymeric hydrogel 12B to which the second primer set 14B is attached; and the first polymeric hydrogel 12A and the second polymeric hydrogel 12B include orthogonal functional groups to respectively attach the first primer set 14A and the second primer set 14B.
[0157] Referring now to the example shown in
[0158] In the example shown in
[0159] In this example, the shape of the active areas 10A, 10B in the x-y plane of the substrate 22 may be a square or a rectangle. The active areas 10A, 10B may have the same shape, and thus the same x-y dimensions. Each of the length and the width can range from about 150 nm to about 100 μm, e.g., about 0.5 μm, about 1 μm, about 10 μm, or more. The length and width may be selected so they do not exceed a length to width aspect ratio of about 10:1. The width of each of the active areas 10A, 10B is equal to the width of the reactive regions 24, 24′, 24″.
[0160] In the example shown in
[0161] In both of the examples shown in
[0162] Other non-reactive regions 26, 26′ may also be located at the outermost surface of the substrate 22 (e.g., at one or more regions located at the perimeter). These regions 26, 26′ may be available for bonding to non-reactive regions 26, 26′ of another patterned structure 23A or 23B, or to a lid.
[0163] In the examples shown in
[0164] Two additional examples of the patterned structure 23C, 23D of the flow cell 20 are shown in
[0165] In
[0166] In both
[0167] In the example shown in
[0168] The protrusions 28 extend a first height H.sub.1 from the bottom of the substrate 22 and the depressions 30 extend a second height H.sub.2 from the bottom of the substrate 22, where the first height H.sub.1 is greater than the second height H.sub.2. The surface of each of the protrusions 28 may be coplanar with the surface of the substrate 22. The surface of each of the depressions 30 is positioned at a depth measured from the substrate surface (e.g., from the surface of layer 44). The depth can range from about 150 nm to about 100 μm, e.g., about 0.5 μm, about 1 μm, about 10 μm, or more.
[0169] In the example in
[0170] The size of each protrusion 28 and depression 30 may be characterized by its surface and opening area, respectively, as described in reference to
[0171] As shown in
[0172] Because the alternating protrusions 28 and depressions 30 abut one another, there is no interstitial region directly between the abutting portions. The lack of an interstitial region in the x-y plane of the substrate 22 directly between the abutting portions of the protrusions 28 and depressions 30 decreases the average pitch of the active areas 10A, 10B across the substrate 22. In this example, the average pitch is the spacing from the center of one active area 10A to the center of an adjacent active area 10B in the same row 34, 34′, 34″ or column 36, 36′, 36″ (center-to-center spacing). The average pitch may range from about 50 nm to about 100 μm. In an example, the average pitch may range from about 50 nm to about 2 μm. In an example, the average pitch can be, for example, about 0.4 μm.
[0173] In this example, the active areas 10A, 10B are next to one another, but do not directly abut one another as one (10A) is positioned on the protrusion 28 and the other (10B) is positioned within the depression 30.
[0174] The active area 10A positioned over each of the protrusions 28 includes the polymeric hydrogel 12A and the primer set 14A. Thus, the x-y dimensions of each active area 10A are equal to the x-y dimensions of the protrusion 28 upon which the active area 10A is applied. The active area 10B positioned within each of the depressions 30 includes the polymeric hydrogel 12B and the primer set 14B. Thus, the x-y dimensions of each active area 10B are equal to the x-y dimensions of the depression 30 in which the active area 10B is applied.
[0175] As mentioned herein, the polymeric hydrogels 12A, 12B may be the same or may be different, and the primer sets 14A, 14B are different. In one example, each of the first and second areas 10A, 10B includes the same polymeric hydrogel 12A=12B to which the respective first and second primer sets 14A, 14B are attached. In another example, the first area 10A includes a first polymeric hydrogel 12A to which the first primer set 14A is attached; the second area 10B includes a second polymeric hydrogel 12B to which the second primer set 14B is attached; and the first polymeric hydrogel 12A and the second polymeric hydrogel 12B include orthogonal functional groups to respectively attach the first primer set 14A and the second primer set 14B.
[0176] Referring now to the example shown in
[0177] In the example shown in
[0178] In this example, the shape of the active areas 10A, 10B in the x-y plane of the substrate 22 may be a circle, a diamond, or a rotated square. The active areas 10A, 10B may have the same shape, and thus the same x-y dimensions. The diameter (of the circle), or each of the length and the width (of the diamond or rotated square) can range from about 150 nm to about 100 μm, e.g., about 0.5 μm, about 1 μm, about 10 μm, or more.
[0179] In the example shown in
[0180] In both of the examples shown in
[0181] Other non-reactive regions 26 may also be located at the outermost surface (e.g., along the perimeter) of the substrate 22. These regions 26 may be available for bonding to non-reactive regions 26 of another patterned structure 23C or 23D, or to a lid.
[0182] In the examples shown in
[0183] Still another example of the patterned structure 23E of the flow cell 20 is shown in
[0184] In
[0185] In this example, the substrate 22, and in particular the layer 44, is patterned with alternating regions 38, 38′, 38″ of the first height H.sub.3 and regions 40, 40′ of the second height H.sub.4. The layer 44 may be any example of the patterned resin set forth herein, and may be patterned with the varying heights H.sub.3, H.sub.4 using any of the techniques set forth herein. In one example, the layer 44 is patterned such that the regions 38, 38′, 38″ and the regions 40, 40′ extend partially along the length of the substrate 22, and along the entire length of the flow channel 21.
[0186] The first and second heights H.sub.3, H.sub.4 are measured from the bottom of the substrate 22, and the first height H.sub.3 is greater than the second height H.sub.4. In some examples, each of the regions 38, 38′, 38″ has the same height H.sub.3, and each of the regions 40, 40′ has the same height H.sub.4. In other examples, each of the regions 38, 38′, 38″ has a different height H.sub.3, and each of the regions 40, 40′ has a different height H.sub.4, as long as the height of each of the regions 38, 38′, 38″ is greater than the height of each of the regions 40, 40′. In any of the examples, a difference between the first height H.sub.3 and the second height H.sub.4 is at least 150 nm.
[0187] The surface of each of the regions 38, 38′, 38″ may be coplanar with the substrate surface. The surface of each of the regions 40, 40′ is positioned at a depth measured from the substrate/regions 38, 38′, 38″ surface. The depth can range from at least 150 nm to about 100 μm, e.g., about 0.5 μm, about 1 μm, about 10 μm, or more.
[0188] As shown in
[0189] Each of the regions 38, 38′, 38″ and the regions 40, 40′ includes alternating first and second (reactive) areas 10A, 10B. In the example shown in
[0190] In this example, the active areas 10A, 10B in each of the regions 38, 38′, 38″, 40, 40′ (e.g., in the y direction in
[0191] In this example, the shape of the active areas 10A, 10B in the x-y plane of the substrate 22 may be a square or a rectangle. The active areas 10A, 10B may have the same shape, and thus the same x-y dimensions. Each of the length and the width can range from about 150 nm to about 100 μm, e.g., about 0.5 μm, about 1 μm, about 10 μm, or more. The width of each of the active areas 10A, 10B in the regions 38, 38′, 38″ is equal to the width of the respective region 38, 38′, 38″; and the width of each of the active areas 10A, 10B in the regions 40, 40′ is equal to the width of the respective region 40, 40′.
[0192] In the example shown in
[0193] The patterned structure 23E shown in
[0194] In any of the examples shown in
[0195] Still another example of the patterned structure 23F of the flow cell 20 is shown in
[0196] In
[0197] In this example, the substrate 22 is planar, and thus does not include protrusions 28 or depressions 30 or regions 38, 40, etc. of differing heights H.sub.3, H.sub.4. As such, the active areas 10A, 10B, 10C are positioned on the substrate surface.
[0198] In this example, the shape of the active areas 10A, 10B, 10C in the x-y plane of the substrate 22 may be a circle. The active areas 10A, 10B may have the same shape, and thus the same x-y dimensions. The diameter can range from about 150 nm to about 100 μm, e.g., about 0.5 μm, about 1 μm, about 10 μm, or more.
[0199] The active areas 10A, 10B, 10C may be arranged in several rows 46, 46′, 46″ across the substrate 22. In the example shown in
[0200] The active areas 10A, 10B, 10C within a given row 46, 46′, 46″ are next to each other and thus directly abut one another (e.g., in the x direction), such that there is no interstitial region between the active areas 10A, 10B, 10C within a given row 46, 46′, 46″. Each active area 10A, 10B, 10C in the offset row(s) 46′ may directly abut one or two active areas 10A, 10B, 10C in the immediately adjacent row(s) 46, 46″ at a diagonal. In the example shown in
[0201] The offset positioning from one row 46, 46′, 46″ to the next row 46, 46′, 46″ generates a non-reactive region 26 at the intersection of each triangle like configuration. Other non-reactive regions 26 may also be located at the outermost surface of the substrate 22 (e.g., at the perimeter). These regions 26 may be available for bonding to non-reactive regions 26 of another patterned structure 23F, or to a lid.
[0202] In the example shown in
[0203] Still another example of the patterned structure 23G of the flow cell 20 is shown in
[0204] This example of the patterned structure 23G of the flow cell 20 include a substrate 22; a plurality of capture primers 48 arranged in rows 50, 50′, 50″, and offset columns 52, 52′, 52″, 52′″, 52″″ across the substrate 22; a continuous polymeric hydrogel 12 positioned over the substrate 22 and surrounding each of the plurality of capture primers 48; and a primer set 14 attached to the continuous polymeric hydrogel 12.
[0205] The PX primers set forth herein are suitable capture primers 48. Any of the primer sets or subsets set forth herein may be attached to the polymeric hydrogel 12 surrounding the capture primers 48. Each capture primer 48 hybridizes to one library template, which amplifies across the primer set 14. As the different clusters of amplicons physically collide, amplification ceases, creating the different active areas 10A, 10B, 10C.
[0206] Different configurations of the patterned structure 23G are shown in
[0207] In
[0208] In
[0209] In
[0210] In the examples shown in
[0211] Method for Making the Flow Cell Architectures
[0212] The architectures of the patterned structures 23A, 23C shown in
[0213] While the first polymeric hydrogel 12A and primer set 14A are shown on the protrusions 28 in
[0214] As shown in
[0215] The layer 44 is formed over the base support 42. The layer 44 may be any material that can be selectively deposited, or deposited and patterned to form depressions 30 and protrusions 28. Suitable deposition techniques include chemical vapor deposition, dip coating, dunk coating, spin coating, spray coating, puddle dispensing, ultrasonic spray coating, doctor blade coating, aerosol printing, screen printing, microcontact printing, etc. Suitable patterning techniques include photolithography, nanoimprint lithography (NIL), stamping techniques, embossing techniques, molding techniques, microetching techniques, etc. Some examples of suitable resins include a polyhedral oligomeric silsesquioxane-based resin, a non-polyhedral oligomeric silsesquioxane epoxy resin, a poly(ethylene glycol) resin, a polyether resin (e.g., ring opened epoxies), an acrylic resin, an acrylate resin, a methacrylate resin, an amorphous fluoropolymer resin (e.g., CYTOP® from Bellex), and combinations thereof.
[0216] The arrangement of the depressions 30 and protrusions 28 may be as shown in
[0217] The layer 44 covers the base support 42 (as shown in
[0218] In one example, the exposed portions 60 of the base support 42 may be activated via plasma ashing to introduce surface groups that can attach to the first polymeric hydrogel 12A. The layer 44 may be masked during the plasma etching process so that it is not affected. In another example, the base support 42 may be exposed to activation (e.g., via plasma ashing or silanization) prior to the layer 44 being formed thereon. In either instance, the exposed portions 60 of the base support 42 are functionalized to selectively attach to the polymeric hydrogel 12A, and the layer 44 positioned over the base support 42 is incapable of attaching to the first polymeric hydrogel 12A.
[0219] As shown in
[0220] The layer 44 is then cleaned (e.g., with NaOH) and activated with surface groups to attach a second polymeric hydrogel 12B. The process for activating the layer 44 may depend upon where it is desirable for the second polymeric hydrogel 12B to attach.
[0221] In the example shown in
[0222] In the example shown in
[0223] The other polymeric hydrogel can then be applied, e.g., to the activated protrusions 28. In
[0224] This method also includes attaching respective primer sets 14A, 14B to the polymeric hydrogels 12A, 12B. In some examples, the primer sets 14A, 14B may be pre-grafted to the respective polymeric hydrogels 12A, 12B. In these examples, additional primer grafting is not performed.
[0225] In other examples, the primer sets 14A, 14B are not pre-grafted to the respective polymeric hydrogels 12A, 12B. In these examples, the primer set 14A may be grafted after the polymeric hydrogel 12A is applied (e.g., at
[0226] When grafting is performed during the method, grafting may be accomplished using any suitable grafting techniques. As examples, grafting may be accomplished by flow through deposition (e.g., using a temporarily bound lid), dunk coating, spray coating, puddle dispensing, or by another suitable method. Each of these example techniques may utilize a primer solution or mixture, which may include the primer set 14A or 14B, water, a buffer, and a catalyst. With any of the grafting methods, the primer set 14A or 14B attaches to the reactive groups of the polymeric hydrogel 12A or 12B, and have no affinity for the other layers.
[0227] The architectures of the patterned structures 23A, 23C shown in
[0228] While the first polymeric hydrogel 12A and primer set 14A are shown on the protrusions 28 in
[0229] In the example shown in
[0230] The depressions 30 may be formed in the single layer base support 42 using any suitable technique, such as photolithography, nanoimprint lithography (NIL), stamping techniques, laser-assisted direct imprinting (LADI) embossing techniques, molding techniques, microetching techniques, etc. The technique used will depend, in part, upon the type of material used. As examples, the depressions 30 may be microetched into a glass single layer substrate or nanoimprinted into a nanoimprint lithography resin. When the multi-layer substrate is used, the depressions 30 may be formed in the outermost (top) layer using any suitable technique, such as nanoimprint lithography (NIL) or photolithography, etc. The technique used will depend, in part, upon the type of material used and will be performed such that any underlying layers are not exposed at the bottom of the depressions 30.
[0231] The arrangement of the depressions 30 and protrusions 28 may be as shown in
[0232] This example method continues with the application of a mask material 64 on sidewalls 32 of each depression 30. This is depicted in
[0233] The mask material 64 may be applied to the sidewalls 32 using a photolithography process combined with either a lift-off technique or an etching technique. In other examples, selective deposition techniques, such as chemical vapor deposition (CVD) and variations thereof (e.g., low-pressure CVD or LPCVD), atomic layer deposition (ALD), and angled deposition, may be used to deposit the mask material 64 in the desirable areas. Alternatively, the mask material 64 may be applied across the substrate 22, and then selectively removed (e.g., via masking and etching) from the portions 60 and the regions 62′ to define the pattern on the sidewalls 32.
[0234] The single layer base support 42 may then be activated via plasma ashing. Plasma ashing introduces surface groups for attaching the polymeric hydrogel 12A or 12B to the exposed portions 60 and regions 62′ of the single layer base support 42.
[0235] As shown in
[0236] Also as shown in
[0237] In one example, the photoresist 66 is a negative photoresist (exposed region is insoluble in the developer). An example of suitable negative photoresist includes the NR® series photoresist (available from Futurrex). Other suitable negative photoresists include the SU-8 Series and the KMPR® Series (both of which are available from Kayaku Advanced Materials, Inc.), or the UVN™ Series (available from DuPont). When the negative photoresist is used, it is selectively exposed to certain wavelengths of light to render it insoluble. In these examples, a developer solution is not utilized as there are no soluble portions. In another example, the photoresist 66 is a positive photoresist (exposed region becomes soluble in the developer). Examples of suitable positive photoresists include the MICROPOSIT® S1800 series or the AZ® 1500 series, both of which are available from Kayaku Advanced Materials, Inc. Another example of a suitable positive photoresist is SPR™-220 (from DuPont). When the positive photoresist is used, it is not exposed to certain wavelengths of light to form a soluble region as it is desirable for the entire photoresist 66 to be insoluble.
[0238] A timed dry etching process may then be used to remove portions of the photoresist 66 and the first polymeric hydrogel 12A from the regions 62′ of the single layer base support 42. As shown in
[0239] As mentioned, during the etching of the photoresist 66, the polymeric hydrogel 12A over the regions 62′ may also be removed. A combustion reaction may be taking place, where the polymeric hydrogel 12A is converted to carbon dioxide and water and is evacuated from the etching chamber.
[0240] The regions 62′ of the single layer base support 42 may then be activated with surface groups to attach a second polymeric hydrogel 12B. The process for activating the single layer base support 42 may depend upon where it is desirable for the second polymeric hydrogel 12B to attach.
[0241] In the example shown in
[0242] In the example shown in
[0243] The other polymeric hydrogel can then be applied, e.g., to the activated protrusions 28 (regions 62′). In
[0244] Removal of the photoresist portion 66′ and the mask material 64 may then be performed.
[0245] The photoresist portion 66′ may be lifted off with a positive or negative photoresist remover, such as dimethylsulfoxide (DMSO) using sonication, or acetone, or an NMP (N-methyl-2-pyrrolidone) based stripper. A positive photoresist portion 66′ may also be removed with propylene glycol monomethyl ether acetate. This lift-off process removes i) at least 99% of the insoluble photoresist portion 66′ and ii) the second polymeric hydrogel 12B thereon. This lift-off process exposes the polymeric hydrogel 12A in the depression 30.
[0246] The mask material 64 may also be exposed to a lift-off process. Any suitable wet lift-off process may be used, such as soaking, sonication, or spin and dispensing of a lift-off liquid. This lift-off process removes i) the mask material 64 and ii) the second polymeric hydrogel 12B thereon. When this method is used to form the example shown in
[0247] This method also includes attaching respective primer sets 14A, 14B to the polymeric hydrogels 12A, 12B. In some examples, the primer sets 14A, 14B may be pre-grafted to the respective polymeric hydrogels 12A, 12B. In these examples, additional primer grafting is not performed.
[0248] In other examples, the primer sets 14A, 14B are not pre-grafted to the respective polymeric hydrogels 12A, 12B. In these examples, the primer set 14A may be grafted after the polymeric hydrogel 12A is applied (e.g., at
[0249] The architecture of the patterned structures 23B, 23D shown in
[0250] In this example method, the mask material 64 is applied to the substrate 22 (which may be a single layer base support 42 or a multi-layer structure including both the base support 42 and the layer 44 thereon).
[0251] The arrangement of the mask material 64 depends upon the desired architecture for the active areas 10A, 10B that are to be formed.
[0252] To generate the patterned structure shown in
[0253] In this example, the mask material 64 and the second mask material are different materials that can be lifted off under different conditions. As such, the removal of the mask material 64 will not remove the second mask material. Therefore, the second mask material remains in place during the activation of the second areas 70, and can be lifted off in a separate lift-off process.
[0254] In this example, with the mask material 64 covering the portions 70 and the second mask material covering the lines (corresponding to the regions 26, 26′ in
[0255] To generate the patterned structure shown in
[0256] The deposited polymeric hydrogel 12A is shown in
[0257] In this example method, the mask material 64 is lifted off to expose the second areas 70. When the second mask material is used along the second line(s) (corresponding to the regions 26, 26′ in
[0258] The exposed second areas 70 may then be activated. When the second mask material is still in place over the second line(s) (corresponding to the regions 26, 26′ in
[0259] The other polymeric hydrogel can then be applied, e.g., to the activated areas 70. In
[0260] When the second mask material is used (e.g., to form the architecture shown in
[0261] When the method is used to form the architecture in
[0262] This method also includes attaching respective primer sets 14A, 14B to the polymeric hydrogels 12A, 12B. In some examples, the primer sets 14A, 14B may be pre-grafted to the respective polymeric hydrogels 12A, 12B. In these examples, additional primer grafting is not performed.
[0263] In other examples, the primer sets 14A, 14B are not pre-grafted to the respective polymeric hydrogels 12A, 12B. In these examples, the primer set 14A may be grafted after the polymeric hydrogel 12A is applied (e.g., at
[0264] The architecture of the patterned structure 23E shown in
[0265] The architecture of the patterned structure 23F shown in
[0266] In this example method, the mask materials 64, 64′ are applied to the substrate 22 (which may be a single layer base support 42 or a multi-layer structure including both the base support 42 and the layer 44 thereon).
[0267] The arrangement of the mask materials 64, 64′ depends upon the desired architecture for the active areas 10A, 10B, 10C that are to be formed.
[0268] In this example, the shape of the mask materials 64, 64′ in the x-y plane of the substrate 22 may be a circle. In this example, the mask materials 64, 64′ are different materials that can be lifted off under different conditions. As such, the removal of the mask material 64 will not remove the mask material 64′. Therefore, the mask material 64′ remains in place during the activation of the second areas 70, and can be lifted off in a separate lift-off process.
[0269] In this example, with the mask material 64 covering the portions 70 and the mask material 64′ covering the portions 72, the exposed portions 68 of the substrate 22 (which is layer 44 in
[0270] In this example method, the mask material 64 is lifted off to expose the second areas 70. Examples of suitable lift off conditions for silicon include basic (pH) conditions, for aluminum include acidic or basic conditions, for gold include an iodine and iodide mixture, for silver include an iodine and iodide mixture, for titanium include H.sub.2O.sub.2), or for copper include an iodine and iodide mixture. Removal of the mask material 64 also removes the first polymeric hydrogel 12A positioned thereon.
[0271] The exposed second areas 70 may then be activated, as shown in
[0272] The second polymeric hydrogel 12B can then be applied, e.g., to the activated areas 70. This is shown in
[0273] The second polymeric hydrogel 12B may be deposited on the outer perimeter of the substrate 22 (e.g., region 26 in
[0274] In this example method, the mask material 64′ is lifted off to expose the third areas 72. Any suitable lift off conditions may be used, depending upon the mask material 64′. Removal of the mask material 64′ also removes the second polymeric hydrogel 12B positioned thereon.
[0275] The exposed third areas 72 may then be activated, as shown in
[0276] The third polymeric hydrogel 12C can then be applied, e.g., to the activated areas 72. This is shown in
[0277] The third polymeric hydrogel 12C may be deposited on the outer perimeter of the substrate 22 (e.g., region 26 in
[0278] This method also includes attaching respective primer sets 14A, 14B, 14C to the polymeric hydrogels 12A, 12B, 12C. In some examples, the primer sets 14A, 14B, 14C may be pre-grafted to the respective polymeric hydrogels 12A, 12B, 12C. In these examples, additional primer grafting is not performed.
[0279] In other examples, the primer sets 14A, 14B, 14C are not pre-grafted to the respective polymeric hydrogels 12A, 12B, 12C. In these examples, the primer set 14A may be grafted after the polymeric hydrogel 12A is applied (e.g., at
[0280] The architecture shown in
[0281] In the method of
[0282] While not shown in
[0283] The correlation between UV dose, UV absorption constant, and resin layer thickness can be expressed as:
D.sub.0=D×exp(−kd)
where D.sub.0 is the required UV dose to pattern the resin layer, D is the actual UV dose which has to be applied to the resin layer, k is the absorption constant, and d is the thickness of thinner portion of the resin layer. Thus, the actual UV dose (D) can be expressed as:
D.sub.0=D.sub.0/exp(−kd)
In one example, the resin layer 44′ is the negative photoresist NR9-1000P (from Futurrex), D.sub.0=19 mJ/cm.sup.2 at 0.9 μm of thickness, the UV absorption constant (k) of the photoresist is 3×10.sup.4 cm.sup.−1, the thickness of the thinner portion of photoresist is 150 nm, and D is about 30 mJ/cm.sup.2.
[0284] In
[0285] The multi-depth depression 30′ shown in
[0286] After curing, the working stamp is released. This creates topographic features in the resin layer 44′. In this example, the topographic features of the multi-depth depression 30′ include the shallow portion 78 and the deep portion 76.
[0287] While two multi-depth depressions 30′ are shown in
[0288] As shown in
[0289] To arrive at the structure in
[0290] As mentioned, during the etching of the photoresist 66, the polymeric hydrogel 12A over the interstitial regions 74 and in the shallow portions 78 may also be removed. A combustion reaction may be taking place, where the polymeric hydrogel 12A is converted to carbon dioxide and water and is evacuated from the etching chamber.
[0291] The portion 66′ of the photoresist 66 may then be lifted off. The photoresist portion 66′ may be lifted off with a positive or negative photoresist remover, such as dimethylsulfoxide (DMSO) using sonication, or acetone, or an NMP (N-methyl-2-pyrrolidone) based stripper. A positive photoresist portion 66′ may also be removed with propylene glycol monomethyl ether acetate. This lift-off process removes i) at least 99% of the insoluble photoresist portion 66′, leaving the polymeric hydrogel 12A in the deep portions 76 of the multi-depth depressions 30′ (as shown in
[0292] A negative photoresist 80 is then applied over the resin layer 44′, including over the interstitial regions 74, in the shallow portions 78, and over the first polymeric hydrogel 12A in the deep portions 76. Ultraviolet light is then directed through the backside of the resin layer 44′ to pattern the negative photoresist 80 and generate an insoluble photoresist 80′ and a soluble photoresist 80″. While not shown, any base support that is used is able to transmit the UV light used for the backside exposure.
[0293] The first thickness t.sub.1 of the resin layer 44′ is selected to allow the dose of UV light to transmit through the resin layer 44′ and the second and third thicknesses t.sub.2, t.sub.3 are selected to block the dose of UV light from transmitting through the resin layer 44′. As such, the portion of the negative photoresist 80 overlying the thickness t.sub.1 becomes insoluble (80′) due to the exposure to the UV light, and the portions of the negative photoresist 80 overlying the thicknesses t.sub.2, t.sub.3 become soluble (80″) due to the lack of exposure to the UV light. In other words, when exposed to the ultraviolet light dosage, the insoluble negative photoresist 80′ forms in the deep portions 76 and the soluble negative photoresist 80″ forms in the shallow portions 78 and over the interstitial regions 74.
[0294] The soluble negative photoresist 80″ is then removed using any suitable developer described herein for negative photoresists. The removal of the soluble negative photoresist 80″ exposes the resin layer 44′ at the shallow portions 78 and the interstitial regions 74. This is shown in
[0295] As shown in
[0296]
[0297] To arrive at the structure in
[0298] As mentioned, during the etching of the photoresist 66, the second polymeric hydrogel 12B over the interstitial regions 74 may also be removed. A combustion reaction may be taking place, where the polymeric hydrogel 12B is converted to carbon dioxide and water and is evacuated from the etching chamber.
[0299] The portion 66′ of the photoresist 66 may then be lifted off. The photoresist portion 66′ may be lifted off with a positive or negative photoresist remover, such as dimethylsulfoxide (DMSO) using sonication, or acetone, or an NMP (N-methyl-2-pyrrolidone) based stripper. A positive photoresist portion 66′ may also be removed with propylene glycol monomethyl ether acetate. This lift-off process removes i) at least 99% of the insoluble photoresist portion 66′, leaving the polymeric hydrogel 12A in the deep portions 76 and polymeric hydrogel 12B in the shallow portions 78 of the multi-depth depressions 30′ (as shown in
[0300] Another negative photoresist 80 is then applied over the resin layer 44′, including over the interstitial regions 74, over the second polymeric hydrogel 12B in the shallow portions 78, and over the first polymeric hydrogel 12A in the deep portions 76. This is shown in
[0301] It is to be understood that the UV light dosage used during this process is more intense than the UV light dosage used to pattern the negative photoresist 80 during the process described in reference to
[0302] The soluble negative photoresist 80″ is then removed using any suitable developer described herein for negative photoresists. The removal of the soluble negative photoresist 80″ exposes the resin layer 44′ at the interstitial regions 74. This is shown in
[0303] As shown in
[0304]
[0305] This method also includes attaching respective primer sets 14A, 14B, 14C to the polymeric hydrogels 12A, 12B, 12C. In some examples, the primer sets 14A, 14B, 14C may be pre-grafted to the respective polymeric hydrogels 12A, 12B, 12C. In these examples, additional primer grafting is not performed.
[0306] In other examples, the primer sets 14A, 14B, 14C are not pre-grafted to the respective polymeric hydrogels 12A, 12B, 12C. In these examples, the primer set 14A may be grafted after the polymeric hydrogel 12A is applied (e.g., at
[0307] The architecture shown in
[0308] Methods for Using the Flow Cells
[0309] Some examples of the flow cell 20 disclosed herein including the primer sets 14A, 14B, and in some instances 14C attached to the polymers 12A, 12B, 12C may be used in a sequential paired-end read sequencing method. Different library fragments introduced into the flow cell 20 are able to seed and amplify at each of the active areas 10A, 10B, 10C. Because of the different primers sets 14A, 14B, 14C, the amplification of any given library fragment across a respective active area 10A, 10B, 10C is not able to continue on an adjacent, but different active area 10B, 10C, 10A. In this method, the respective forward strands that are generated on a particular active area 10A, 10B, 10C are sequenced and removed, and then the respective reverse strands are sequenced and removed.
[0310] When the flow cell 20 includes the primer subset 13A, 15A, or 13B, 15B, or 13C, 15C, or 13D, 15D attached to the polymeric hydrogel regions 12A1, 12A2 of an active area 10A, 10B or 10A (instead of one of the primer sets 14A, 14B, 4C), the subset may be used in a simultaneously paired-end read sequencing method. As described herein, the primer subsets 13A, 15A, or 13B, 15B, or 13C, 15C, or 13D, 15D are controlled so that the cleaving (linearization) chemistry is orthogonal at the different polymeric hydrogel regions 12A1, 12A2. This enables a cluster of forward strands to be generated in one region 12A1 of the active area 10A and a cluster of reverse strands to be generated in another region 12A2 of the active area 10A. In an example, the regions 12A1, 12A2 are directly adjacent to one another, and are adjacent to an orthogonal active area 10B, 10C. This enables simultaneous paired-end reads to be obtained on the active area 10A.
ADDITIONAL NOTES
[0311] It should also be appreciated that all combinations of the foregoing concepts and additional concepts discussed in greater detail below (provided such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. In particular, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. Moreover, it is to be understood that any features of any of the examples disclosed herein may be combined together in any desirable manner and/or configuration.
[0312] It should also be appreciated that terminology explicitly employed herein that also may appear in any disclosure incorporated by reference should be accorded a meaning most consistent with the particular concepts disclosed herein.
[0313] Reference throughout the specification to “one example”, “another example”, “an example”, and so forth, means that a particular element (e.g., feature, structure, and/or characteristic) described in connection with the example is included in at least one example described herein, and may or may not be present in other examples. In addition, it is to be understood that the described elements for any example may be combined in any suitable manner in the various examples unless the context clearly dictates otherwise.
[0314] It is to be understood that the ranges provided herein include the stated range and any value or sub-range within the stated range, as if such values or sub-ranges were explicitly recited. For example, a range of about 0.35 μm (350 nm) to at least 1.8 μm (1800 nm), should be interpreted to include not only the explicitly recited limits of about 0.35 μm (350 nm) to at least 1.8 μm (1800 nm), but also to include individual values, such as about 0.708 μm (708 nm), about 0.9 μm (900 nm), etc., and sub-ranges, such as from about 0.425 μm (425 nm) to about 0.825 μm (825 nm), from about 0.550 μm (550 nm) to about 0.940 μm (940 nm), etc. Furthermore, when “about” and/or “substantially” are/is utilized to describe a value, they are meant to encompass minor variations (up to +/−10%) from the stated value.
[0315] While several examples have been described in detail, it is to be understood that the disclosed examples may be modified. Therefore, the foregoing description is to be considered non-limiting.