METHOD FOR MASS PRODUCTION OF GINSENOSIDE RH2-MIX

20190112629 ยท 2019-04-18

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to a method for mass production of ginsenoside Rh.sub.2-Mix. The present invention includes treating PPD-Mix with an organic acid and heat to obtain Rg.sub.3-Mix and treating the obtained Rg.sub.3-Mix using a recombinant GRAS strain in the Rg.sub.3-Mix to produce Rh.sub.2-Mix, and thereby facilitates the mass production of ginsenoside Rh.sub.2-Mix using -glucosidase, which has been known to be difficult. Further, the present invention is advantageous in that the Rh.sub.2-Mix can be produced in high yield even at high temperatures, and mass production thereof for industrial purposes is practical as the production process is simple and more economical than direct use of an enzyme.

    Claims

    1. A method for mass production of ginsenoside Rh.sub.2-Mix, comprising: a) treating PPD-Mix with an organic acid to obtain Rg.sub.3-Mix; and b) treating the Rg.sub.3-Mix obtained in step a) with -glucosidase.

    2. The method of claim 1, wherein the ginsenoside Rh.sub.2-Mix consists of 20(S)Rh.sub.2, 20(R)Rh.sub.2, Rk.sub.2, and Rh.sub.3.

    3. The method of claim 1, wherein the PPD-Mix consists of Rb.sub.1, Rb.sub.2, Rc, and Rd.

    4. The method of claim 1, wherein the Rg.sub.3-Mix consists of 20(S)-Rg.sub.3, 20(R)-Rg.sub.3, Rk.sub.1, and Rg.sub.5.

    5. The method of claim 1, wherein step a) further comprises heat treatment.

    6. The method of claim 5, wherein the heat treatment is performed at a high temperature of 100 C. to 140 C.

    7. The method of claim 1, wherein the -glucosidase is obtained from a recombinant Generally Recognized As Safe (GRAS) strain.

    8. The method of claim 7, wherein the GRAS strain is one selected from the group consisting of Corynebacterium sp., Saccharomyces sp., and Lactococcus sp.

    9. The method of claim 8, wherein the Corynebacterium sp. strain is Corynebacterium glutamicum.

    10. The method of claim 7, wherein the GRAS strain is a transformant into which a vector comprising a nucleic acid encoding the -glucosidase is introduced.

    11. The method of claim 1, wherein step b) is performed at pH 6.0 to pH 7.0.

    12. Rh.sub.2-Mix prepared according to the method of claim 1.

    13-14. (canceled)

    15. A method for converting PPD-mix into ginsenoside Rh.sub.2-Mix, wherein the method comprises: a) treating PPD-Mix with an organic acid to obtain Rg.sub.3-Mix; and b) treating the Rg.sub.3-Mix obtained in step a) with -glucosidase.

    16. The method of claim 15, wherein the Rg.sub.3-Mix consists of 20(S)-Rg.sub.3, 20(R)-Rg.sub.3, Rk.sub.1, and Rg.sub.5.

    17. The method of claim 15, wherein the -glucosidase is obtained from a Generally Recognized As Safe (GRAS) strain.

    Description

    DESCRIPTION OF THE DRAWINGS

    [0085] FIGS. 1A-B shows the result of SDS-PAGE analysis for confirmation of protein expression of the recombinant E. coli and GRAS host strains; A: lane 1, molecular weight standard; lane 2, soluble crude extract of recombinant E. coli without induction; lane 3, BglPm of recombinant E. coli after induction; lane 4, purified soluble fraction of recombinant E. coli (BglPm); lane 5, non-inducible fraction of Corynebacterium glutamicum harboring pCES208; lane 6, inducible BglPm_C; lane 7, purified BglPm_C (C. glutamicum); lane 8, molecular weight standard. B: lane 9, molecular weight standard; lane 10, non-inducible fraction of Saccharomyces cerevisiae; lane, 11 inducible BglPm_S; lane 12, BglPm_S protein of S. cerevisiae after purification; lane, 13-14, non-inducible and inducible fraction of Lactococcus lactis; lane 15, molecular weight standard.

    [0086] FIGS. 2A-D are graphs showing the effect of sonication on the enzyme activity of each recombinant enzyme of: 2a, E. coli; 2b, C. glutamicum; 2c, S. cerevisiae; 2d, Lactococcus lactis.

    [0087] FIGS. 3A-B are results showing TCL analysis of a time course of ginsenosides by acid and enzyme treatments; A, transformation of ginsenoside PPD-Mix; B, transformation of Rg.sub.3-Mix.

    [0088] FIGS. 4A-D are results showing HPLC analysis of the transformation of the ginsenosides PPD-Mix and Rg.sub.3-Mix by acid and enzyme treatments; A, ginsenosides standard; B, PPD-Mix as a substrate; C, converted Rg.sub.3-Mix 15 min after acid treatment in PPD-Mix at 121 C.; D, converted Rh.sub.2-Mix after 24 h of the reaction of BglPm_C with Rg.sub.3-Mix.

    [0089] FIG. 5 is a schematic view of transformation pathways for Rh.sub.2-Mix production and the relative structures of ginsenosides.

    [0090] FIG. 6 is a schematic diagram showing the entire process of Rh.sub.2-Mix production from PPD-Mix as a substrate using the combined method of acid treatment and enzyme treatment.

    MODE FOR INVENTION

    [0091] Hereinbelow, the present invention will be described in detail with accompanying exemplary embodiments. However, the exemplary embodiments disclosed herein are only for illustrative purposes and should not be construed as limiting the scope of the present invention.

    Example 1. Preparation of Recombinant Expression Vector and Transformed Microorganism

    [0092] Ginsenosides standards, Rb.sub.1, Rc, Rb.sub.2, Rd, 20(S)-Rg.sub.3, 20(R)-Rg.sub.3, 20(S)Rh.sub.2, F.sub.2, and CK, were bought from Nanjing Zelang Medical Technology Co., Ltd. (China), while ginsenosides 20(R)Rh.sub.2, Rk.sub.1, Rg.sub.5, Rk.sub.2, and Rh.sub.3 were purchased from Chengdu Biopurify Phytochemicals Co., Ltd. (China).

    [0093] The PPD-Mix-type ginsenosides mixture from the root of American root saponins Panax quinquefolius, containing Rb.sub.1 (328 mg/g), Rc (173 mg/g), Rd (107 mg/g) and small amounts of Rb.sub.2 (25 mg/g) and Rb.sub.3 (25 mg/g), acquired from Hongjiou Biotech Co. Ltd. (China), was used as the initial substrate. The genomic DNA from Paenibacillus mucilaginosus KCTC 3870.sup.T, E. coli, and pGEX 4T-1 plasmid (GE Healthcare, USA) were used for the -glucosidase gene, host, and expression vector sources, respectively. P. mucilaginosus KCTC 3870.sup.T was grown in aerobic conditions at 37 C. on nutrient agar (NA, BD, USA). The recombinant E. coli for protein expression was cultivated in a Luria-Bertani (LB) medium supplemented with ampicillin (100 mg/L). C. glutamicum and the pCES208 plasmid, S. cerevisiae and pYES 2.1 plasmid, L. lactis strain NZ9000 and PNZ8148 plasmid (MoBiTec GmbH, Germany) were used as hosts and expression vector sources, respectively (Table 1).

    TABLE-US-00001 TABLE 1 Sources or Relevant genotype or description references Hosts BL21 (DE3) fhuA2 [Ion] ompT gal ( DE3) [dcm] hsdS DE3 = NEB strain catalog sBamHlo EcoRl-B int::(lacl::PlacUV5::T7 gene1) i21 nin no. C2527 BL21(DE3) harboring Cloned with glucoside hydrolyzed (BglPm) gene for pGEX-BglPm ginsenosides transformation C. glutamicum ATCC Biotin-auxotrophic wild type ATCC 13032 C. glutamicum WJ001 ATCC 13032, cloning host for ginsenosides transformation This study S. cerevisiae CEN. MATa ura3-52 MAL2-8.sup.c SUC2 PK113-5D S. cerevisiae CEN. Cloning host for ginsenosides transformation This study PK113-5D L. lactis pNZ8148 Cloning host for ginsenosides transformation MoBiTec Plasmids pGEX-BglPm Harboring -glucosidase (BglPm) gene pCES208 E. coli/C. glutamicum shuttle vector, 5.93 kb, Kan.sup.R pCES208 Expression vector for His-tag fusion in C. glutamicum This study ATCC 13032 with -glucosidase (BglPm) gene; Kan.sup.R pYES2 Ap.sup.R URA3 GALp Invitrogen Corporation pYES2.1 pYES2.1 TOPO TA vector pYES2.1 Expression vector for BglPm gene in S. cerevisiae 1389 This study pNZ8148 Broad-host-range vector; Cm.sup.R, PnisA MoBiTec pNZ8148 Expression vector for BglPm gene in L. lactis This study CECT, Coleccion Espanola de Cultivos Tipo; YGSC, Yeast Genetic Stock Center, Berkeley, Ca, USA. Kan.sup.R, kanamycin resistance Cm.sup.R, chloroampinicol resistance

    Example 2. Preparation of Ginsenoside Rg.SUB.3.-Mix Through Acid Treatment of PPD-Mix

    [0094] In order to prepare Rg.sub.3-Mix for use in the enzyme reaction, heat treatment with an organic acid was used. The PPD-Mix was dissolved in distilled water at a concentration of 50 g/L and included citric acid (2%, w/v) and heat-treated (121 C. for 15 min) to prepare the ginsenosides Rg.sub.3-Mix [20(S)-Rg.sub.3 (118.6 mg/g), 20(R)-Rg.sub.3 (108.8 mg/g), Rk.sub.1 (144.9 mg/g), and Rg.sub.5 (170.5 mg/g)] from PPD-Mix. After the reaction, the resultant Rg.sub.3-Mix was used as the substrate for the subsequent enzyme reaction.

    Example 3. Preparation of GRAS Strain Having Recombinant BglPm

    [0095] The genomic DNA from Paenibacillus mucilaginosus KCTC 3870.sup.T was extracted using a genomic DNA extraction kit (Solgent, Korea). The gene encoding -glucosidase, which has ginsenoside-transforming activity, was amplified from the extracted genomic DNA as a template via polymerase chain reaction (PCR) using Pfu DNA polymerase (Solgent, Korea). The sequence of the oligonucleotide primers used for the gene cloning was based on the DNA sequence of BglPm (-glucosidase; GenBank accession number: AEI42200). Four sets of primers (Table 2) were designed and synthesized to amplify the gene of BglPm for E. coli and three kinds of GRAS strains. The amplified DNA fragment obtained from the PCR was purified and inserted into the pGEX 4T-1 GST fusion vector, pYES2.1 His-tag combined vector, pCES208 His-tag combined vector, and pNZ8148 vector, respectively, using an EzCloning Kit (Enzynomics Co. Ltd., Korea). By introducing the resulting recombinant pGEX-BglPm, pYES2.1-BglPm, pCES208-BglPm, and pNZ8148-BglPm into E. coli BL21 (DE3), C. glutamicum, S. cerevisiae, and L. lactis strains, respectively, E. coli strain BL21 and the three GRAS hosts strains were constructed with different vector systems.

    TABLE-US-00002 TABLE2 Functionandprimer Sequence GST-pGEX4T-1fusionconstruction pGEX-4T-1-F GGTTCCGCCGTGGATCCGAATATATTTTTCCA CAGCAATTTCATGCGGCCGCTCGAGTTACAG CACTTTCGT pGEX-4T-1-R GGATGCGAT Histag-pCES208andpYES2.1fusion construction pCES208-F GACTAGAGTCGGATCCATGGAATATATTTTTCCACAG pCES208-R CCGCGGTGGCGGCCGCTTACAGCACTTTCGTGGATGC pYES2.1-F TATTAAGCTCGCCCTTATGGAATATATTTTTCCACAGCAATTT pYES2.1-R CTCGAAGCTCGCCCTTTTACAGCACTTTCGTGGATGC -glucosidasefusionconstruction pNZ8148-F GCAGGCATGCGGTACCATGGAATATATTTTTCCACAG pNZ8148-R GCTTGAGCTCTCTAGATTACAGCACTTTCGTGGATGC (Top to Bottom: SEQ ID NOS: 1-8)

    Example 4. Expression and Purification of BglPm within the GRAS Strain

    [0096] To determine the expression level of the GRAS host strains and amount of soluble protein, the induction of expression of recombinant E. coli and the three GRAS hosts was studied. The recombinant E. coli was cultivated in LBA (Luria-Bertani with ampicillin [100 mg/L final concentration]) and induced by 0.15 mM IPTG at 28 C. Similarly, C. glutamicum, S. cerevisiae, and L. lactis were cultivated in LBK (Luria-Bertani with kanamycin [50 mg/L final concentration] induced by glucose [10 g/L final]), YPD (galactose inducible [18 g/L final concentration]), and GM-17 [glucose 10 g/L and induced by nisin, 10 L/L final concentration)] at 30 C., respectively, and were then induced.

    [0097] In order to confirm the protein expression of the induced strain, SDS-PAGE analysis was performed using a 10% acrylamide-bis-acrylamide gel (37.5:1 [Qbiogene]). Culture samples were prepared by mixing dye with the samples of each cell suspension at a ratio of 3:1. The solutions were mixed well and heated for 5 min at 100 C. Similarly, 15 L of dye-sample mixture was loaded in each lane of the gel and electrophoresis was performed in SDS-Tris-Glycine buffer at a constant voltage until the dye front reached the bottom of the gel. The protein bands were stained with Coomassie brilliant Blue Ez stain (AQua), and de-stained in distilled water. After de-staining, the results of the GRAS host strains were compared with those of the recombinant E. coli (FIGS. 1a and 1b).

    [0098] As a result of the comparison, the molecular masses of the native -glucosidase, calculated via an amino acid sequence and fusion tag protein expressed in E. coli, C. glutamicum, S. cerevisiae, and L. lactis, were found to be 72 (46+26) kDa, 47 (46+1) kDa, 47 (46+1) kDa, and 46 kDa, respectively (Table 3).

    [0099] The GST-BglPm and His-tag-BglPm were purified using the GST and His-tag binding resin column (Elpis Biotech). After purification of cell lysates, non-induced, induced, and purified protein soluble fractions were analyzed by SDS-PAGE, and the prominent protein bands, with an apparent molecular weight near 72 kDa, 47 kDa, 47 kDa, and 46 kDa, were identified in the three GRAS host strains and recombinant E. coli lysates. In the comparative study of SDS-PAGE assay of the GRAS host strains with E. coli (FIG. 1a, lanes 3 and 4), it was clearly shown that the expected protein bands were more visible and well expressed in the soluble fraction in C. glutamicum than in S. cerevisiae and L. lactis.

    [0100] Based on the comparative analysis of the GRAS host strains with E. coli, the highly expressed -glucosidase enzyme of C. glutamicum was selected for biotransformation of the ginsenoside Rg.sub.3-Mix.

    TABLE-US-00003 TABLE 3 Relative M. wt of fusion tag Name of Specific express Fusion protein/recombinant recombinant Enzymes activity enzymes Hosts Media Vectors Inducers tags protein (kDa) enzyme activity (U/mg) .sup.+ activities E. coli LBA PGEX 4T-1 IPTG GST 26/46 BglPm 0.2619 10.22 0.62 100 C. LBK pCES208 Glucose His tag 1/46 BglPm_C 0.1976 12.54 0.51 75.4 glutamicum S. cerevisiae VPD pYES2.1 Galactose His tag 1/46 BglPm_S 0.03 12.92 0.13 11.5 Lactococcus M-17 pNZ8148 Nisin /46 BglPm_L 0.244 ND 9.3 lactis

    Example 5. Effect of Sonication on Activities of Enzyme from Each Strain

    [0101] After the exponential growth of the strains in the particular media as described above, cells were harvested by centrifugation, and pellets were washed twice with a solution consisting of 100 mM sodium phosphate buffer and 1% Triton X-100 (pH 7.0); cells were then re-suspended to a concentration of 1 g/10 mL in lysis buffer (100 mM sodium phosphate buffer [pH 7.0]), in order to measure the difference in the effects of sonication on the enzyme activities derived from each strain. The sonication was performed for the cell suspension of the recombinant E. coli and GRAS hosts strains in a 1.5 mL tube for 20 min to 30 min using Branson digital sonifier 450 (400 W, 70% power, USA).

    [0102] The activity of crude recombinant -glucosidase obtained by sonication was determined using 5 mM p-nitrophenyl--D-glucopyranoside (pNPGlc) as a substrate. Crude enzyme (20 L) was incubated in 100 L of 50 mM sodium phosphate buffer (pH 7.0) containing 5 mM pNPGlc at 37 C., then the reaction was stopped by 0.5 M (final concentration) Na.sub.2CO.sub.3 and the release of p-nitrophenol was measured immediately using a microplate reader at 405 nm (Bio-Rad Model 680; Bio-Rad, Hercules, Calif.). One unit of activity was defined as the amount of protein required to generate 1 mol of p-nitrophenol per minute. Specific activity was expressed as units per milligram of protein. Protein concentrations were determined using the bicinchoninic acid (BCA) protein assay (Pierce, Rockford, Ill.), with bovine serum albumin (Sigma Aldrich, USA) as the standard. All assays were performed in triplicate.

    [0103] During the investigation of enzymes activities of the GRAS host and recombinant E. coli, which were reacted with 5 mM pNPG, the maximum enzyme activity was obtained by recombinant E. coli after a 10 min period of sonication (further sonication caused loss of enzyme activity) (FIG. 2a). In the case of the GRAS hosts, comparable results were obtained, which showed optimum enzyme activity at 20 min, 25 min, and 15 min for C. glutamicum pCES208 (FIG. 2b), S. cerevisiae pYES2.1 (FIG. 2c), and L. lactis pNZ8148, respectively.

    [0104] Collectively, these results suggest that the maximum enzyme activity of the GRAS host strains were comparable with recombinant E. coli.

    [0105] On the basis of the data presented here, it was found that BglPm_C expressed by C. glutamicum had an enzyme activity of 75.4% compared with recombinant BglPm expressed by E. coli (as compared to BglPm_S [11.5%] and BglPm_L [9.3%]), as shown in Table 3. -Glucosidase (BglPm_C), which was highly expressed by C. glutamicum, was therefore selected for the mass production of edible Rh.sub.2-Mix ginsenosides from Rg.sub.3-Mix.

    Example 6. Biotransformation Activity of Rg.SUB.3.-Mix Using BglPm_C from C. glutamicum

    [0106] To verify the bioconversion of Rg.sub.3-Mix by BglPm_C expressed by C. glutamicum harboring pCES208, TLC analysis was carried out at regular intervals. BglPm_C (20 mg/mL) was reacted with an Rg.sub.3-Mix solution at a concentration of 5% (w/v, wet base) in 100 mM sodium phosphate buffer (pH 7.0) at 37 C. The samples were taken at regular time intervals and analyzed via thin layer chromatography (TLC) after pre-treatment.

    [0107] As shown in FIG. 3, the TLC results showed that BglPm_C completely transformed ginsenoside Rg.sub.3-Mix into Rh.sub.2-Mix. The Rf values of ginsenosides Rk.sub.1 and Rg.sub.5 was slightly above the 20(S)-Rg.sub.3 and 20(R)-Rg.sub.3 positions, as shown in FIG. 3a. Rh.sub.2-Mix, which has one glucose moiety removed at the C20 position of Rg.sub.3-Mix, was placed in the upper position of control S (Rg.sub.3-Mix), as shown in FIG. 3b.

    Example 7. Confirmation of Transformation into Ginsenoside Rh.SUB.2.-Mix Using HPLC Analysis

    [0108] All of the ginsenosides (PPD-Mix, Rg.sub.3-Mix, and Rh.sub.2-Mix) were compared with the ginsenoside standards used in the present invention by HPLC analysis, as shown in FIG. 4a. The ginsenoside PPD-Mix used as the initial substrate is shown in FIG. 4b. For the enzymatic reaction, the PPD-Mix was transformed to the Rg.sub.3-Mix by acid treatment, as shown in FIG. 4c. After 24 hours, the Rh.sub.2-Mix [20(S)Rh.sub.2, 20(R)Rh.sub.2, Rk.sub.2, and Rh.sub.3] was produced as a final product from the bioconversion of Rg.sub.3-Mix using the BglPm_C enzyme of C. glutamicum (FIG. 4d).

    [0109] The HPLC analysis revealed that the BglPm_C completely hydrolyzed the Rg.sub.3-Mix within 24 hours. The schematic view of the transformation pathway from PPD-Mix to Rh.sub.2-Mix is shown in FIG. 5.

    Example 8. Scaled-Up Biotransformation of Rg.SUB.3.-Mix into Rh.SUB.2.-Mix

    8-1. Preparation of Recombinant Enzyme (BglPm_C) of C. glutamicum

    [0110] To obtain high cell density of the recombinant BglPm_C, the LB medium supplemented with kanamycin (50 mg/L final) was used to cultivate the C. glutamicum harboring pCES208 in a 10 L stirred-tank reactor (Biotron GX, Hanil Science Co., Korea) with a 6 L working volume at 400 rpm. Using 100 mM sodium phosphate buffer, the pH value of the medium was adjusted to 7.0. The culture was incubated at 30 C. for 24 hours and the protein expression was induced through the addition of glucose with a final concentration of 10 g/L. After cell density reached an OD of 40 to 42 at 600 nm, the cells were harvested via centrifugation at 8,000 rpm for 20 min. The pellets (50 g) were resuspended in 100 mM sodium phosphate buffer (pH 7.0), and the cells were then broken via sonication (Branson Digital Sonifier, Mexico), and the time was adjusted according to the method described in Example 5. In order to obtain a crude soluble enzyme fraction for the conversion of ginsenosides, unwanted cell debris was removed via centrifugation at 5,000 rpm for 10 min at 4 C. For the enzymatic biotransformation of ginsenoside Rg.sub.3-Mix, the crude recombinant BglPm_C was diluted to the desired concentration with 100 mM sodium phosphate buffer (pH 7.0).

    8-2. Preparation of BglPm_C and Mass Production of Rh.SUB.2.-Mix

    [0111] For the mass production of ginsenoside Rh.sub.2-Mix, the reaction mixture was performed in a 10 L stirred-tank reactor (Biotron GX, Hanil Science Co.) with a 3 L working volume. The reaction mixture was started with a composition of 50 mg/mL (final concentration) of substrate ginsenosides (Rg.sub.3-Mix; total 150 g, wet base) and 20 mg/mL of recombinant BglPm_C in 0.1 M sodium phosphate buffer (pH 6.5 to pH 7.0). The reaction was completed under its optimal conditions of pH 6.5 at 300 rpm for 24 hours. After 24 hours, the ginsenoside Rg.sub.3-Mix [20(S)-Rg.sub.3, 20(R)-Rg.sub.3, Rk.sub.1, and Rg.sub.5] was completely converted to the Rh.sub.2-Mix [20(S)Rh.sub.2, 20(R)Rh.sub.2, Rk.sub.2, and Rh.sub.3]. Samples were collected at regular intervals and were analyzed by high performance liquid chromatography (HPLC) in order to determine the time course of the biotransformation of ginsenoside Rg.sub.3-Mix to Rh.sub.2-Mix. In order to remove the unwanted substances, the reaction mixture was centrifuged at 8,000 rpm for 10 min. Most of the ginsenoside Rh.sub.2-Mix precipitated to form a solid, with a small quantity remaining dissolved in the supernatant. 3 L of a 95% ethanol solution was used to dissolve the precipitated ginsenosides Rh.sub.2-Mix thoroughly two times.

    [0112] The ginsenoside Rh.sub.2-Mix in the supernatant was evaporated in vacuo in order to create 24.5 g of powdered Rh.sub.2-Mix [20(S)Rh.sub.2 (116.6 mg/g), 20(R)Rh.sub.2 (107.2 mg/g) Rk.sub.2 (143.1 mg/g), and Rh.sub.3 (165.0 mg/g)]. Finally, in terms of yield, 24.5 g of Rh.sub.2-Mix was obtained via the conversion of 50 g of PPD-Mix as the initial substrate (FIG. 6).

    [0113] Based on the results, the method which involves reacting -glucosidase obtained from recombinant GRAS host strains after the organic acid and heat treatments in PPD-Mix was confirmed to facilitate the mass production of minor ginsenoside Rh.sub.2-Mix.

    [0114] While the present invention has been described with reference to the particular illustrative embodiments, it will be understood by those skilled in the art to which the present invention pertains that the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics. The described embodiments are to be considered in all respects only as illustrative and not restrictive. The scope of the present invention is therefore indicated by the appended claims rather than by the foregoing description. All changes which come within the meaning and range of equivalency of the claims are to be embraced within the scope of the present invention.