MULTIPLEXED GENOTYPING ASSAYS WITH A SINGLE PROBE USING FLUORESCENT AMPLITUDE TUNING
20220389488 · 2022-12-08
Inventors
- Sarah KANE (Fort Collins, CO, US)
- Rose NASH (Fort Collins, CO, US)
- Christopher McKEE (Fort Collins, CO, US)
Cpc classification
International classification
Abstract
Provided are methods and kits for detecting and quantifying a sequence difference relative to a target polynucleotide sequence, and methods for developing assays. Target polynucleotide sequences are examined to determine if any of the sequences vary by at least one nucleotide difference. Promiscuous probes that have on and off-target binding at different binding efficiencies at permissive temperature are used, so that differences in polynucleotide sequences are reliably detected and quantified in a single well with fewer types of labeled probes, including by polymerase chain reaction of any of a range of sequences where there is interest in detecting an at least one nucleotide difference relative. The target sequences may be a reference polynucleotide sequence indicative of a first state, such as “normal” and another sequence that varies by at least one polynucleotide indicative of a different second state, such as a mutation, disease condition, or predisposition thereto.
Claims
1. A method for detecting the presence or absence of an at least one nucleotide difference in a target polynucleotide sequence, the method comprising the steps of: a) providing a set of PCR primers comprising a forward amplification primer and a reverse amplification primer which, when hybridized to the respective primer annealing sites, flank the location of the target polynucleotide sequence, wherein the set of PCR primers are configured to generate in a PCR reaction a first amplicon comprising at least a portion of the target polynucleotide sequence and a second amplicon comprising at least a portion of the target polynucleotide with the at least one nucleotide difference; b) providing a promiscuous probe that at a permissive temperature hybridizes at a first hybridization efficiency to the first amplicon and a second hybridization efficiency to the second amplicon, wherein the first hybridization efficiency is different than the second hybridization efficiency; c) preparing a sample PCR reaction mixture comprising: a test sample having a sample polynucleotide, the PCR primers, the promiscuous probe, and PCR reagents; d) performing at least one PCR reaction on the sample PCR reaction mixture at the permissive temperature to generate sample amplicons; and e) measuring a fluorescence output generated by the promiscuous probe bound to the sample amplicons, wherein the difference between the first and second hybridization efficiencies results in a promiscuous probe fluorescence amplitude difference between promiscuous probe bound to target polynucleotide sequences with and without the at least one nucleotide difference; thereby detecting the presence or absence of the at least one nucleotide difference in the target polynucleotide sequence.
2. The method of claim 1, wherein the measuring step further comprises quantifying the amount of the target polynucleotide sequence having the at least one nucleotide difference.
3. The method of claim 1, further comprising the steps of preparing a positive control reaction mixture comprising the following constituents: a positive control mixture comprising a first polynucleotide having the target polynucleotide sequence without the at least one nucleotide difference; a positive control mixture comprising a second polynucleotide having the target polynucleotide sequence and the at least one nucleotide difference; and a positive control mixture comprising the first polynucleotide and the second polynucleotide; contacting each of the positive control reaction mixture constituents individually with the set of PCR primers and the promiscuous probe; performing at least one PCR reaction on each of the contacted control reaction mixture constituents to generate a first and/or a second positive amplicon for each of the three constituent positive control reaction mixtures; and validating the method by measuring a positive control fluorescence output generated by the promiscuous probe bound to the first and/or second positive amplicons, wherein a positive validation corresponds to positive clustering of fluorescence output.
4. The method of claim 3, further comprising the step of: defining a target threshold from the positive control mixture.
5. The method of claim 3, wherein the validating provides: (i) validation of each component of the method; and (ii) threshold definitions for each of the first polynucleotide and the second polynucleotide.
6. (canceled)
7. The method of claim 1, wherein the target polynucleotide sequence is from an organism selected from the group consisting of a virus, a bacteria, a fungus, a parasite, a plant cell, an animal cell, or a cancer cell.
8. The method of claim 1, wherein the target polynucleotide comprises RNA, and the method further comprises the step performing a reverse transcription reaction to produce a DNA target polynucleotide.
9. The method of claim 1, wherein the at least one nucleotide difference is from a mutation of one or more nucleotides in the target polynucleotide sequence, including an insertion mutation, a deletion mutation and/or a single nucleotide polymorphism (SNP).
10. The method of claim 1, wherein the target polynucleotide sequence has a length selected from a range of 60 bps to 1500 bps.
11. The method of claim 1, wherein the test sample comprises an environmental sample, soil, seed, plant material, wastewater sample, industrial water sample, natural water sample (including river, lake, stream, ocean, groundwater, well water, aquifer), a biological sample such as a gut/stool sample, a liquid or tumor biopsy from a cancer patient, a swab or saliva sample, an animal sample (veterinary/animal husbandry).
12. The method of claim 1, wherein the test sample is analyzed for short or single nucleotide polymorphisms (SNPs) whether associated with disease, drug resistance, multidrug resistance, herbicide resistance or not, insertions or deletions (indels) whether associated with a disease, the presence, absence, and/or abundance of viruses and viral variants, favorable or pathogenic bacterial, fungi, a non-invasive species, soil biome characterization (see if conducive/harmful to certain types of crops), and/or gut biome
13. The method of claim 1, wherein the promiscuous probe has a length that is between 20-35 bps without a locked nucleic acid or other melting temperature (T.sub.m) increasing modification, or between 10-35 bps with a locked nucleic acid or other T.sub.m increasing modification; the promiscuous probe optionally further comprising one or more of: between 35%-80% GC content; a T.sub.m between 55° C.-62° C.; a binding site to the at least one nucleotide difference that is positioned either: in a middle region of the promiscuous probe length, wherein the middle region is defined in a central 50% portion of the probe length, or at an alternative location at least partially outside the middle region so long as promiscuous binding at a permissive temperature is maintained; and/or a locked nucleic acid at the at least one nucleotide difference.
14. The method of claim 1, wherein the promiscuous probe has a higher binding efficiency to the target polynucleotide sequence with the at least one nucleotide difference, or has a higher binding efficiency to the target polynucleotide sequence without the at least one nucleotide difference.
15. The method of claim 1, comprising a plurality of promiscuous probes for multiplex detection of a plurality of nucleotide differences in the target polynucleotide sequence.
16. The method of claim 1, wherein the promiscuous probe is a fluorescent or fluorescently-labelled probe, including a labelled probe comprising a locked nucleic acid.
17. The method of claim 1, wherein the promiscuous probe has greater than 98% binding region sequence complementary to a binding site of the target polynucleotide sequence for a high-hybridization efficiency condition, and less than 98% binding region sequence complementary to a binding site of the target polynucleotide sequence for a lower-hybridization efficiency condition.
18. The method of claim 1, wherein the promiscuous probe has a sequence configured to provide an at least 10% difference in amplitude of optical output for promiscuous probe bound to the first and second amplicons.
19. The method of claim 1, further comprising the step of determining the permissive temperature by: contacting the positive control reaction mixture comprising an about 50:50 mixture of the first polynucleotide and the second polynucleotide with the primers and the promiscuous probe; performing at least one PCR reaction on the control reaction mixture at a plurality of different temperatures spanning a low temperature that is below the permissive temperature and a high temperature that is above the permissive temperature; and identifying a temperature or temperature range in which both the first and the second polynucleotides are amplified and optically detected with a magnitude shift of fluorescent output between the first and second polynucleotides due to lower efficiency off-target binding of the promiscuous probe compared to higher efficiency on-target binding of the promiscuous probe.
20. The method of claim 1, wherein the target polynucleotide sequence is from a SARS-CoV-2 virus, and the at least one nucleotide sequence difference corresponds to a variant of the SARS-CoV-2 virus.
21. (canceled)
22. (canceled)
23. The method of claim 20, wherein the variant comprises at least two mutations at different loci and the promiscuous probe comprises at least two promiscuous probes each having a distinct fluorescence emission maximum.
24. The method of claim 1, wherein the probes and primers comprise any one or more of: SEQ ID NO:1, optionally at a concentration of approximately 500 nM; SEQ ID NO:2, optionally at a concentration of approximately 500 nM; SEQ ID NO:3 optionally at a concentration of approximately 125 nM; SEQ ID NO:4 optionally at a concentration of approximately 125 nM; SEQ ID NO:5 optionally at a concentration of approximately 500 nM; SEQ ID NO:6 optionally at a concentration of approximately 500 nM; SEQ ID NO:7 optionally at a concentration of approximately 125 nM; SEQ ID NO:8, optionally at a concentration of approximately 500 nM; SEQ ID NO:9, optionally at a concentration of approximately 500 nM; SEQ ID NO:10 optionally at a concentration of approximately 125 nM; SEQ ID NO:11 optionally at a concentration of approximately 125 nM; SEQ ID NO:12 optionally at a concentration of approximately 500 nM; SEQ ID NO:13 optionally at a concentration of approximately 500 nM; SEQ ID NO:14 optionally at a concentration of approximately 125 nM; SEQ ID NO:15 optionally at a concentration of approximately 125 nM;
25. (canceled)
26. The method of claim 1, having an at least 2-plex in one channel, with two channels in a single well, thereby providing a 4-plex per well.
27. The method of claim 1, further comprising: discriminating single-nucleotide polymorphism (SNP), cancerous mutation, pathological mutation, a deletion mutation, an insertion mutation, drug resistance mutation, multi-drug resistance mutation, herbicide mutation, multi-herbicide resistance mutation, reassortment mutation, or a biomarker mutation.
28. (canceled)
29. The method of claim 1, wherein the target polynucleotide is obtained from a virus in wastewater, the method further comprising the steps of: filtering the wastewater; concentrating the virus; extracting RNA; and determining a relative concentration of a wildtype virus and a variant virus in the wastewater.
30. A method of making an assay to detect a first polynucleotide target sequence having a variant sequence differing from a second polynucleotide target sequence by at least one nucleotide, the method comprising the steps of: a) identifying the first and second polynucleotide target sequences; b) identifying an upstream flanking region and a downstream flanking region that are upstream and downstream from the polynucleotide target sequences; c) designing a forward primer and a reverse primer that specifically bind to the upstream and downstream flanking regions of the first and second polynucleotide sequences, with a separation distance between the upstream and downstream primer binding regions that is between 50 bps and 1500 bps, wherein the primers are configured to generate a first and a second amplicon product corresponding to at least a portion of the first polynucleotide target sequence and at least a portion of the second polynucleotide sequence; d) designing a promiscuous probe that will bind to the first and second amplicons with different hybridization efficiencies at a permissive temperature of between about 55° C. and 65° C.
31. The method of claim 30, wherein the design of primers is by selecting a flanking binding region of between 50 and 1500 nucleotides and the primer has at least 90% sequence complementarity to the flanking binding region.
32. The method of claim 30 or 31, wherein the design of the discriminatory probe comprises: performing a thermal gradient dPCR on a target mixture comprising a mixture of the first polynucleotide target sequence and the second polynucleotide target sequence; selecting a temperature of maximal separation of output fluorescent amplitudes between the first and second polynucleotide target sequence amplicons in the target mixture, thereby identifying for any promiscuous probe the permissive temperature.
33. The method of claim 30, further comprising the step of: performing the thermal gradient dPCR on: a first target that is 95%-100% a parent polynucleotide sequence; and a second target that is 95%-100% the variant polynucleotide sequence.
34. (canceled)
35. The method of claim 30 34, that is a 5-plex 417/484 assay for a SARS-CoV-2 virus and variants thereof, wherein the positive control mixture comprises approximately equal concentrations of parental, alpha, beta , or gamma variant polynucleotide sequences corresponding to the S gene.
36. A kit for distinguishing a first target polynucleotide sequence from a second target polynucleotide sequence by dPCR, wherein the first target polynucleotide sequence comprises at least one nucleotide difference not found in the second target polynucleotide sequence, the kit comprising: a) for each location in the first target polynucleotide target sequence corresponding a nucleotide(s) difference: a set of PCR primers comprising a forward amplification primer and a reverse amplification primer which, when hybridized to the respective primer annealing sites, flank the location of the nucleotide(s) difference, wherein the set of PCR primers is capable of PCR amplification of corresponding regions of both the first polynucleotide target sequence and the second target polynucleotide sequence; b) a labeled promiscuous probe designed at a permissive temperature to hybridize at a first hybridization efficiency to the site of the at least one nucleotide difference of the first polynucleotide and at a second hybridization efficiency to the corresponding site lacking the at least nucleotide difference of the second polynucleotide, wherein the first hybridization efficiency is different than the second hybridization efficiency; c) a control mixture comprising a nucleic acid corresponding to the sequence of the first target polynucleotide; d) a control mixture comprising a nucleic acid corresponding to the sequence of the second target polynucleotide; and e) a control mixture comprising a nucleic acid mixture corresponding to the sequence of the first target polynucleotide and the sequence of the second target polynucleotide.
37. The kit of claim 36 for detecting a variant comprising primers and probes selected from the group consisting of: TABLE-US-00013 a forward primer that is SEQ ID NO: 5- (CGTGGTGTTTATTACCCTGAC); a probe that is SEQ ID NO: 7 (TACTTGGTTCCATGCTATCTCTGGGACC); a reverse primer that is SEQ ID NO: 6 (ATGGTAGGACAGGGTTATCAA); a second forward primer that is SEQ ID NO: 1 (CCGGTAGCACACCTTGTAAT); a second probe that is SEQ ID NO: 3 (TGGTTTCCAACCCACT + TATGGTGT); and a second reverse primer that is SEQ ID NO: 2 (AGTTGCTGGTGCATGTAGAA).
38. The kit of claim 37 for detecting an oncogene mutation, including in one or more of: BRAF600; TP53; EGFR, comprising one or more probes and primers selected from the group consisting of: SEQ ID NOs: 16-27.
39. The kit of claim 37 for detecting a herbicide resistance mutation in a plant gene.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0047]
[0048]
[0049] The ability of the assay to distinguish Parental from mutant S gene sequences was tested by generating a four-plex assay where ParentalN501 is detected at low amplitude in FAM, N501Y is detected at high amplitude in FAM, Parental HV 69-70 is detected at low amplitude in HEX, and del69-70 is detected at high amplitude in HEX. This technique affords four-plexing ability within a single well. See, e.g.,
[0050]
[0051]
[0052]
[0053]
[0054] Both mutations have been found independently of one another. For example, the del69-70 mutations accounts for 2.5% of all sequences reported in the Europe. The N501Y mutation has been found in the beta variant of concern. The presence of both of these mutations together, however, is a strong indicator that the alpha variant or possibly another, related and yet to be defined hyper-transmissible variant is circulating within a community. The quantification of the N1 region is identical in all strains and does not differentiate. In one aspect, a variant wastewater test—quantifies two regions in the spike gene containing 2 key mutations known to drive hyper-transmissible function.
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
DETAILED DESCRIPTION OF THE INVENTION
[0069] While the present disclosure may be applied in many different forms, for the purpose of promoting an understanding of the principles of the disclosure, reference will now be made to aspects illustrated in the drawings and specific language will be used to describe the same. It will nevertheless be understood that no limitation of the scope of the disclosure is thereby intended. Any alterations and further modifications of the described aspects, and any further applications of the principles of the disclosure as described herein are contemplated as would normally occur to one skilled in the art to which the disclosure relates.
[0070] As used herein “amplitude” refers to a magnitude or amplitude of fluorescence, also referred generally as fluorescence intensity. In certain aspects, amplitude may be used in reference to increased or decreased relative fluorescence.
[0071] As used herein “amplitude tuning” refers to harnessing that when a mis-match occurs within a probe binding region, a change in fluorescent amplitude can be detected due to a difference in hybridization efficiency. Probes are designed to have different hybridization efficiency between two amplicon sequences sharing less than 100% sequence identity. In certain aspects, the difference in hybridization efficiency is tuned to PCR parameters such as temperature and/or probe concentration. In this manner, a probe is characterized as promiscuous in that the probe is specifically configured to bind to both the “original” sequence and to the sequence sharing less than 100% sequence identity (also referred herein as having at least one nucleotide difference) at a permissive temperature, but at different hybridization efficiencies.
[0072] An “at least one nucleotide difference” refers to a pair of corresponding polynucleotide sequences that have at least one difference between two otherwise identical sequence regions. More specifically, the region corresponds to a region recognized by the probe, or the “probe recognition sequence”. The phrase at least one nucleotide difference is used broadly to encompass any type of difference, including by insertion, deletion, or a change in nucleotide. The difference may correspond to a single nucleotide difference or more than one nucleotide difference. The difference may be a contiguous difference in nucleotide differences. The difference may be at multiple distinct positions along the polynucleotide sequence. For convenience, the sequences may be referred to generally as a “target” or a “reference” polynucleotide sequence, from which that at least one nucleotide difference is desirably detected from a to-be-tested “test sample.”
[0073] As used herein, “Clustering” refers to a measure of fluorescence output for a target on a two channel output plot that is confined within a defined area, including an area distinct from another target. Accordingly, a “positive clustering” corresponds to an expected output plot that is clustered within an expected area. “Negative clustering” corresponds to output having a significant fraction of events that falls outside the expected area. Significant fraction may correspond to 10%, 5% or 1% of output falling outside the expected area. For example, the plot in
[0074] As used herein, “color channel” refers to a region of the light spectrum, including visible light, infrared light, and ultraviolet light. A color channel may be specified to be as broad a set of wavelengths or as narrow a set of wavelengths as useful to an individual practicing the methods disclosed herein. The color channel is generally matched to a probe label, such as the fluorescent emission wavelength of the probe label.
[0075] “Detecting” is used broadly herein to refer to methods that can identify and/or quantify within a target polynucleotide sequence. The methods herein preferably detect whether a difference is found from a sample and also quantify the differences. For example, for an application where the target polynucleotide is from a virus, one (e.g., a “first”) target polynucleotide sequence may correspond to a wild-type (e.g., “parental”) sequence, and another (e.g., a “second”) target polynucleotide sequence may correspond to a variant, wherein there is at least one mutation in the target polynucleotide sequence. Similarly, for a disease such as cancer, a first target polynucleotide sequence may correspond to a “normal” sequence and the second target polynucleotide sequence having a mutation that is associated with cancer. In this manner, the methods and kits are compatible with any polynucleotide sequence of interest that, with a change in sequence, there is an attendant impact or change in a state from a first state to a second state, including associated with function, a mutation conferring resistivity, disease, pathogenicity, risk factor, efficacy, diagnostic outcome, and the like.
[0076] As used herein, “permissive” refers to a condition, such as temperature, which allows hybridization of a probe to more than one polynucleotide sequence, but at different hybridization efficiency, thereby accommodating at least one mismatch.
[0077] As used herein, “probe” refers to a labeled oligonucleotide designed to be at least partially complimentary to a target DNA sequence of interest such that when combined with a hybridization reaction it can bind to and detect the target. A probe may have more than one possible hybridization target and depending on reaction conditions, e.g. temperature, may bind to only one target, two targets with different hybridization efficiency or no targets.
[0078] As used herein, “promiscuous probe” refers to a probe which hybridizes to more than one polynucleotide sequence at a permissive temperature. In certain aspects, a promiscuous probe can hybridize to a polynucleotide despite one or more than one sequence mismatch. Of courses, exact 100% match provides a higher hybridization efficiency than less than 100% match. Generally, the more percentage mismatch, the lower the hybridization efficiency. In certain aspects, a promiscuous probe hybridizes to two or more polynucleotides with less than 100% sequence identity and the hybridization efficiency of the promiscuous probe is different between the two or more polynucleotides depending on the base sequence of the polynucleotides. Furthermore, temperature is an independent parameter for also affecting hybridization, with higher temperatures requiring higher sequence matching for hybridization. The permissive temperature can be selected from a range of permissive temperatures. In this manner, the permissive temperature used in the method may be optimized so as to maximize fluorescent intensity output differences between on- and off-target binding.
[0079] The promiscuous probe, as desired, may comprise a locked nucleic acid (LNA). A LNA has a chemical modification, such as an extra bridge associated with the ring structure (including between the 2′-O and 4′-C carbon atoms), that effectively locks the conformation and generally provides increased stability against enzymatic degradation, and improves specificity and affinity of the probe (as reflected by an increase in Tm by about 2° C.-4° C. per LNA. This provides another means of adjustment of probe hybridization properties to ensure appropriate affinity characteristics to a target (wild-type) and the off-target (e.g., mutation) at an appropriate temperature range.
[0080] As used herein, “PCR” or “Polymerase chain reaction” refers to the well-known technique of enzymatic replication of nucleic acids which uses thermal cycling for example to denature, extend and anneal the nucleic acids.
[0081] As used herein, “Sample polynucleotide” refers to a biological sample having a target polynucleotide sequence that is detected, including without and/or with the difference in target polynucleotide sequence. For example, the sample may comprise a mixture of polynucleotides containing different sequences at the loci of interest.
[0082] As used herein, “Target polynucleotide of interest” refers to a portion of a longer polynucleotide, including a portion that may or may not contain a relevant at least one nucleotide difference. The polynucleotide may comprise RNA or DNA. Optionally, RT-PCR may be performed on the RNA to generate DNA that is then subject to PCR.
[0083] As used herein, “Target threshold” refers to use of a PCR reaction on a positive control reaction mixture to identify fluorescent amplitude output ranges associated with the respect target polynucleotide sequence. This thresholding aspect may be implemented in software that is used to identify and quantify target polynucleotide sequences, including a plurality of targets. The implementation may be in terms of creating a model file with attendant edge definition, such as an edge shape that is ellipsoid to include all relevant target within the edges. In this manner, automatic thresholding of signals/results for each target is obtained. See, e.g.,
[0084] Probes may be of any functional length. Without limitation to any particular embodiment, probes may be of 10 to 100 nucleotides in length, 15 to 90 nucleotides in length, 25 to 75 nucleotides in length, 30 to 50 nucleotides in length, 37 to 43 nucleotides in length or any combination thereof.
[0085] Probes may be labeled by any means known in the art. The label on the probes may be fluorescent. The light emitted by the label on the probes may be detectable in the visible light spectrum, in the infra-red light spectrum, in the ultra-violet light spectrum, or any combination thereof.
[0086] In certain aspects, a promiscuous probe has a length that is between 20-35 bps without a locked nucleic acid or other melting temperature (T.sub.m) increasing modification, or between 10-35 bps with a locked nucleic acid or other T.sub.m increasing modification; the promiscuous probe may optionally be further characterized by one or more of a GC content between 35%-80% and a T.sub.m between 57° C.-62° C.:
[0087] In certain aspects, a promiscuous probe has greater than 98% binding region sequence complementary to a binding site of the target polynucleotide sequence for a high-hybridization efficiency condition, and less than 98% binding region sequence complementary to a binding site of the target polynucleotide sequence for a lower-hybridization efficiency condition.
[0088] Any of the methods and kits may be used with a PBNJ, including for RT-qPCT applications. The PBNJ may contain a locked nucleic acid (LNA) at a SNP position. The PBNJ has a reference binding region and an extension blocker that prevents elongation by a polymerase. In this manner, the PBNJ at a competitive concentration relative to the promiscuous probe suppresses promiscuous probe binding to one the sequences with amplification to further discriminate the sequences via PCR.
[0089] In certain aspects, the presently disclosed methods and kits can be used for discriminating single-nucleotide polymorphism (SNP), cancerous mutation, pathological mutation, a deletion mutation, an insertion mutation, drug resistance mutation, multi-drug resistance mutation, herbicide mutation, multi-herbicide resistance mutation, reassortment mutation, or a biomarker mutation.
[0090] The present disclosure describes methods and kits for the targeted collection of polynucleotide sequence information. In certain aspects, methods and kits are disclosed wherein labeled probes provide for the detection of the presence or absence of at least one nucleotide difference between a first polynucleotide sequence and a second polynucleotide sequence. In certain aspects, methods and kits disclosed herein provide for multiplexing of molecular assays which result in efficiencies in the utilization of testing supplies, such as PCR reagents, as well as containers in which PCR reactions are run.
[0091] The methods and kits provided herein are useful for detecting and quantifying a sequence difference relative to a reference polynucleotide sequence. Generally, target polynucleotide sequences are examined to determine if any of the sequences vary by an at least one nucleotide difference. The methods provided herein can, as desired, detect and quantify these differences. This can be of particular use when the target polynucleotide sequence is from a virus, because viruses can have relatively high rate of mutation. In such a situation, the at least one nucleotide difference may correspond to a variant, and it is desirable to quantify the amount of variant relative to a parent or wild-type target polynucleotide sequence.
[0092] In certain aspects, the need for fluorescently labeled probes is reduced by up to 67% or half in comparison to common utilized molecular assays. In one aspect, the reduction in assay required probes is achieved by application of amplitude tuning which can be achieved through, primer and probe design with respect to hybridization targets. In some aspects, when a mis-match occurs between target and the probe, that mis-match can be assessed in terms of a fluorescent amplitude change from an output signal. PCR parameters can be fine-tuned such that at a specified permissive temperature one probe is capable of recognizing both on and off-target nucleic acids.
[0093] In some aspects, the ability to provide individual probes for what may be considered multiple hybridization targets (e.g., “promiscuous probes”), albeit of different hybridization efficiencies, provides for multiplexing of reactions. In one aspect, a 4-Plex dPCR method is enabled to run four targets in one well of a dPCR plate instead of two wells (two targets in each well). Depending on the number of targets a promiscuous probe is able to quantify, there is significant savings associate with reagent costs and decrease in the number of wells. Accordingly, relevant features and benefits of the methods, kits and assays, include, savings of up to 67% on all reagent costs which are a significant part of the operational costs of digital droplet PCR; use up to one-third of the wells so one can run more samples through one machine, thereby doubling or tripling output without having to purchase an additional ddPCR machine; rapid assay development because one probe per well may recognize up to three targets, instead of having three probes per well for three targets.
[0094] Samples of polynucleotides which can be analyzed by the presently disclosed methods and kits can be derived from any source comprising a polynucleotide of interest. Possible sources of samples include but are not limited to an organism selected from the group consisting of a virus, a bacteria, a fungus, a parasite, a plant cell, an animal cell, or a cancer cell. Further, possible sources of samples include but are not limited to an environmental sample, soil, seed, plant material, wastewater sample, industrial water sample, natural water sample (including river, lake, stream, ocean, groundwater, well water, aquifer), a biological sample such as a gut/stool sample, a liquid or tumor biopsy from a cancer patient, a swab or saliva sample, an animal sample (veterinary/animal husbandry).
[0095] In certain aspects, a test sample is analyzed for short or single nucleotide polymorphisms (SNPs) whether associated with disease, drug resistance, multidrug resistance, herbicide resistance or not, insertions or deletions (indels) whether associated with a disease, the presence, absence, and/or abundance of viruses and viral variants, favorable or pathogenic bacterial, fungi, a non-invasive species, soil biome characterization (see if conducive/harmful to certain types of crops), and/or gut biome.
[0096] Kits are disclosed herein, including for providing a PCR multiplexing approach—based on PCR efficiency, including but not limited to dPCR and ddPCR. In certain aspects, the presently disclosed kits provide for a 4-plex in one channel with two probes, thus saving 50% in reagents used in conventional assays having one fluorescent probe type per individual nucleotide sequence of interest.
[0097] In certain aspects, a kit comprises validated RNA or DNA standards, primer/probe mix, and validated conditions. The kit may contain the standard PCR reagents, including enzymes (DNA polymerase), deoxynucleotide triphosphates (dNTPs) and PCR buffers.
EXAMPLES
[0098] The following examples are presented in order to more fully illustrate some embodiments of the invention. They should in no way be construed, however, as limiting the broad scope of the invention. Those of ordinary skill in the art can readily adopt the underlying principles of this discovery to design various compounds without departing from the spirit of the current invention.
Example 1
Probe and Primers
[0099] Probes were designed to contain a viral mutation of interest at the center of the probe. The ends of the probe on either side of center may then have sequences corresponding to the polynucleotide sequence, which may be identical for both polynucleotide sequences (e.g., parent v. variant; normal v. mutant; etc.). Primers were designed to flank the region that is targeted by the probe. Primer and probe solutions were formulated at either 500 nM primers/125 nM probes or 900 nM primers/250 nM probes. DNA or RNA control template containing sequences of interest was utilized comprising an equal mixture of wildtype and mutant sequences and a thermal gradient ddPCR experiment was performed spanning strict temperatures (high temperatures that drive specificity and thus amplification on mutant templates is seen) to permissive temperatures (low temperatures in which the probe that is specific to mutant sequence also binds the wildtype sequence). A temperature was identified in which both targets (wildtype and mutant) were amplified. Because ‘off target’ probe binding (in the case of the wildtype sequence) causes the reactions to be less efficient, the amplitude was shifted down allowing for differentiation of wildtype and mutant(s).
[0100] For each mutation of interest, ‘permissive’ temperatures are identified that allow multiplexing the wildtype and mutant targets using a single probe. To be able to multiplex 2 different genome locations (thus four targets total) temperatures and tune melting temperatures are identified such that the probes are each ‘promiscuous’ at the same temperature. As desired, LNA can be added, including to the N501Y probe, thereby ensuring the probe is permissive for both wildtype and mutant at the same temperature as another probe, including a del69-70 probe.
Example 2
Wastewater Test Kit
[0101] In one aspect, the assays of the present disclosure have been developed in the form of the GT RT-ddPCR (Parental+B.1.1.7) 4-plex wastewater test kit which is a molecular reagent kit containing all primers, probes, and controls for absolute quantification of strains containing both the Parental sequence and the B.1.1.7 mutated sequences at two viral genome locations, those coding for the del69-70 and N501Y mutations. This embodiment targets 2 key mutations that have been previously described to have biological effects that drive the hyper-transmissibility of the lineage. Both mutations have been found independently of one another. For example, the del69-70 mutations accounts for 2.5% of all sequences reported in the Europe2. The N501Y mutation has been found in the beta, gamma, and mu variants of concern, interest, or being monitored. The presence of both mutations together, however, is a strong indicator that the alpha variant or possibly another, related and yet to be defined hyper-transmissible variant is circulating within a community.
[0102] The user of the wastewater test kit can utilize only two wells with only two fluorophores/probes per well to be able to test for a WT and two other mutations in the WT.
[0103] Many conventional assays require the use of more probes and reagents and two wells in a plate for each sample. In some aspects, the presently disclosed methods save up to 67% on all reagent costs which are a significant part of the operational costs of PCR, e.g. droplet PCR. Further the presently disclosed methods all usage of just half of the wells of conventional techniques so that one can run more samples through one machine, thereby doubling output.
[0104] The presently disclosed assay can also promote rapid assay development because only one probe per well can recognize two or more targets, instead of convention methods requiring two probes per well for two targets.
[0105] The presently disclosed methods also reduce multiple targets effects due to non-specific amplification due to very minor changes between nucleic acids. The present methods harness the off-target amplification, albeit at less efficiency, to discriminate these nucleotide mismatches. The presently disclosed methods can also be used in contexts, including but not limited to, multiplexing liquid biopsy assays (for cancer and others), custom genotyping assays, and viral mutation assays.
Example 3
Detection of SARS-CoV-2 B.1.1.7 Lineage Signatures in Wastewater
[0106] Wastewater pathogen monitoring provides community-wide surveillance to estimate disease prevalence and tracking. This surveillance paradigm affords the opportunity to assess viral load within a community without the need for large-scale diagnostic testing. Further, monitoring viral load over time provides communities with actionable data for local economy decision making. Several industry and academic groups successfully implemented and deployed SARS-CoV-2 wastewater monitoring services as a tool to combat the COVID-19 pandemic.
[0107] Wastewater pathogen monitoring provides various levels of resolution. For example, samples collected from individual dormitories identify localized outbreaks and thus highly tuned quarantine strategies. At a larger scale, testing samples from wastewater treatment facilities allows monitoring communities larger scale disease outbreaks.
[0108] A SARS-CoV-2 wastewater monitoring service was expanded to include a molecular assay targeting mutations found in the hyper-transmissible B.1.1.7/alpha variant strain. SARS-CoV-2 entry into human cells is dictated by interactions between the viral Spike protein and the human ACE2 protein. The B.1.1.7 strain contains six mutations within the Spike protein, thereby hinting these mutations may render a virus that either a) evades immune system recognition or b) has a higher affinity for ACE2. While testing a sample for the presence of all 6 mutations is complex, costly, and potentially redundant, we narrowed our strategy to include two mutations likely involved in promoting hyper-transmissibility.
[0109] Lessons learned from the Denmark mink outbreak helped inform testing strategy. Between June and November 2020, SARS-CoV-2 spread to over 200 mink farms and ultimately led to the culling of all Danish mink herds. We noted two similar mutations between the mink strain and B1.1.7: deletion of HV residues at positions 69-70 of the Spike protein, as well as an amino acid substitution within the receptor binding domain at residue 501. Further, the recent beta and gamma variant strain thought to emerge independently of the alpha Variant strain also contains the N501Y mutation. It was postulated that the independent emergence of these mutations indicate selective advantage that render hyper-transmissibility. Thus, we selected del69-70 and N501Y as our targets.
[0110] Presently described is a novel multiplexed design strategy to detect both parental and B.1.1.7 signatures, namely del69-70 and N501Y, within a single digital PCR well. This approach was coupled the molecular tools provided by the permissive probes with a SARS-CoV-2 wastewater testing service and detected these two mutations in United States wastewater samples obtained from a wastewater treatment facility serving a community known to contain the alpha Variant.
[0111] The presently disclosed molecular tool can in some aspects be used to monitor viral loads over time to determine if wastewater monitoring mirrors hyper-transmissibility seen within a community. Monitoring wastewater for these mutations will ultimately provide a multi-disciplinary approach to translate molecular biology to sewer genotyping to epidemiology.
[0112] COVID and COVID variants: B1.1.7 (alpha varian) mutations—all in spike gene; South African (beta variant)—all in spike gene; E484K; K417N.
[0113] This ddPCR method in which we obtain a readout on both mutant and wildtype sequences using a single probes may be used for any genotyping tests in which ultrasensitivity is required. Examples include, but are not limited to, circulating tumor DNA, viral mutants, non-invasive prenatal testing.
[0114] Find example genome sequences that have the mutation of interest, align with parental sequence, find flanking regions around mutation, design primers that will flank the mutation and design probe to either parental or mutant sequence. Try to get the mutation in the perfect center of the probe. Target Tms around 60 degrees. Once we have primers and probes, formulate to 22× such that our final standard concentrations are achieved adding 1 uL (500 nM primers, 125 nM probe; or 900 nM primers, 250 nM probe). Perform a thermal gradient on three different targets, a target that is 100% parent/wt/Wuhan, a target that is 100% mutant/alpha/B.1.1.7 in this case, and a target that is a 50-50 mixture of the two.
[0115] Select condition in which we see maximal separation of amplitudes for mutant and parental and negative droplet populations in the 50-50 mix control. This condition also must be specific for both parent and mutant sequences and thus the parent/wt population is absent in the 100% mutant and mutant population is absent in the 100% mutant sample.
Example 4
Storage, Stability and Methodology
[0116] Store at −20° C. and minimize freeze/thaw cycles. The Controls are composed of DNA or RNA. Aliquoting and refreezing solution to avoid freeze/thaws is highly recommended.
[0117] The GT-ddPCR Mutation Detection Assay comprises pre-mixed primer probe solution for 4-plex quantification of parental and variant viral sequences and appropriate controls. Each kit comes with 200 μL of the 20× assay mix sufficient for 200×20 μL reactions.
TABLE-US-00001 TABLE 1 Kit Contents Qty Volume Storage Reagent (Tube) (uL) (° C.) GT-4plex Primer-Probe 1 200 −20 Solution GT - Variant Positive 1 100 −20 Control GT- parental Positive 1 100 −20 Control GT-Mixture-Control 1 100 −20
Reagents and Equipment
[0118] 1-Step RT-ddPCR Advanced Kit for Probes (Bio-Rad catalog #1864021); QX100™ or QX200™ Droplet Generator (Bio-Rad catalog #1863002 or 1864002, respectively) or Automated Droplet Generator (catalog #1864101); QX100 or QX200 Droplet Reader (Bio-Rad catalog #1863003 or 1864003, respectively); C1000 Touch™ Thermal Cycler with 96-Deep Well Reaction Module (Bio-Rad catalog #1851197); PX1™ PCR Plate Sealer (Bio-Rad catalog #1814000).
[0119] Reagents for RNA Purification: The QIAGEN QlAamp Viral Mini Kit (Catalog #52906, #52904) is validated for use with all GTddPCR Mutation Detection Assays per the manufacturer's instructions. Alternative isolation kits that generate high quality, purified RNA are likely compatible.
TABLE-US-00002 TABLE 2 GT-ddPCR (parental + B.1.1.7) 4-plex Wastewater Test Kit Workflow Workflow Step 1 Isolation of viral RNA Step 2 Prepare PCR-Ready Samples Step 3 Generate Droplets Step 4 Perform PCR Step 5 Read Droplets Step 6 Analyze Results
TABLE-US-00003 TABLE 3 General Laboratory Equipment (Not Provided) Description Source Single and multichannel adjustable pipettors Rainin or Eppendorf (1.00 μL to 1,000 μL) Microcentrifuge Multiple Suppliers Microwell plate centrifuge, with a rotor that Multiple Suppliers accommodates standard microplates Laboratory freezers −20° C. and −70° C. Multiple Suppliers 96-well or 384-well cold block or ice Multiple Suppliers Nonstick, RNase-free microcentrifuge tubes (1.5 Multiple Suppliers mL and 2.0 mL) Sterile aerosol barrier (filtered) pipette tips Multiple Suppliers
Use of Control Materials
[0120] A no-template control (NTC) should be run on every plate to detect reagent and/or environmental contamination. An NTC should consist of RNase/DNase-free water in place of a wastewater-extracted RNA specimen.
[0121] A GT-Variant Positive Control should be run to detect any variant-specific reagent failures and to aid in gridding the samples during analysis (see steps 14-16)
[0122] A GT-Parental Positive Control should be run to detect any Wuhan-specific reagent failures and to aid in gridding the samples during analysis (see steps 14-16).
[0123] A GT-Mixture—Control should be run to detect any multiplexing failures and to aid in gridding the samples during analysis (see steps 14-16).
Protocol
[0124] 1. Ensure extracted RNA sample(s) are stored on ice prior to analysis.
[0125] 2. Bring the kit components to room temperature. Make sure to thaw the control materials (RNA) on ice.
[0126] 3. Mix each component by brief vortexing to ensure homogeneity, then pulse centrifuge to collect contents at the bottom of the tube.
[0127] 4. ddRT-PCR master mix preparation: [0128] a. Prepare a master mix according to the number of samples and controls to be tested (Table 4) [0129] b. Vortex the master mix briefly and pulse centrifuge to collect the contents to the bottom of the tube.
TABLE-US-00004 TABLE 4 ddPCR Master Mix Component Volumes Volume for 1 Volume for 96 Volume for sample (+4 samples (+5 1 sample safety rxns) safety rxns) Component (μL) (μL) (μL) One-Step RT-ddPCR 5.5 286 555.5 Supermix Reverse Transcriptase 2.2 114.4 222.2 300 mM DTT 1.1 57.2 111.1 GT-4-plex Primer-Probe 1 52 101 Solution RNA sample 9* n/a n/a Rnase/Dnase free water 3.2** 166.4 323.2 *Alternative RNA sample volumes can be run **Adjust water for alternative RNA sample volumes
[0130] 5. Add 13 uL of the master mix into the appropriate wells of a 96 well plate or PCR strip tube. Add 9 uL* of the extracted RNA sample per your planned plate layout.
[0131] *Alternative RNA sample volumes can be run, make sure to adjust compensating water volume.
[0132] 6. Add 9 uL of the NTC, GT-Variant Positive Control, GTParental Positive Control, and GT-Mixture-Control to four separate wells reserved for controls in your planned plate layout.
[0133] We recommend keeping the plate or PCR tubes on ice or a plate cooler while loading.
[0134] 7. Generate and transfer droplets per the manufacturer's recommendation to a 96-well ddPCR plate.
[0135] 8. Heat seal the plate per the manufacturer's recommendation.
[0136] 9. Place the sealed droplet-containing plate into the thermal cycler for reverse transcription and PCR amplification and run the following GT-RTddPCR Variant Test Thermal Cycling Protocol (Table 5).
TABLE-US-00005 TABLE 5 Recommended thermal cycling parameters Temperature Number of Cycling Step ° C. Time Cycles Reverse Transcription 50 60 min 1 Enzyme activation 95 10 min 1 Denaturation 94 30 sec 45 Annealing/Extension 60 60 sec Enzyme deactivation 98 10 min 1 Droplet Stabilization 4 30 min 1 Hold (optional) 4 24 hrs 1
[0137] 10. Upon thermal cycling completion, transfer the plate to the Droplet Reader.
[0138] 11. Open QuantaSoft™ software and double click on any well to open Well Editor. Select the wells used in the run and choose the following: [0139] a. Experiment: ABS [0140] b. Supermix: One-step RT-ddPCR Kit for Probes [0141] c. Target 1 Type: Ch1 Unknown [0142] d. Target 2 Type: Ch2 Unknown
[0143] 12. Add well-names and sample types if desired (optional).
[0144] 13. Click Run, save template, and select FAM/HEX to begin reading.
Analysis
[0145] 14. When viewing data, please reference the example data below and use the three GT-Molecular provided controls for proper thresholding. [0146] a. For the N501Y locus which is measured in Channel 1 [0147] i. the high droplet population consists of droplets positive for the N501Y mutation [0148] ii. the middle droplet population consists of droplets positive for the Parental or parental sequence at the N501Y loci [0149] iii. the low droplet population consists of droplets with no target [0150] b. For the Del69-70 locus which is measured in Channel 2 (HEX) [0151] i. the high droplet population consists of droplets positive for the Del69-70 mutation [0152] ii. the middle droplet population consists of droplets positive for the parental sequence at the del69-70 loci [0153] iii. the low droplet population consists of droplets with no target
[0154] 15. In both channels, apply thresholds between the negative droplet populations and the middle Parental populations and export to .csv. This CSV contains data for all positive droplets.
[0155] 16. In both channels, apply thresholds between the middle parental populations and the upper B.1.1.7 populations and export to .csv. This CSV contains data for the B.1.1.7 mutant population droplets for both targets.
[0156] 17. Lastly, subtract the data exported in the second thresholding (B.1.1.7 mutant populations, step 16) from the first data export (all positive droplets, step 15) to isolate data for the Wuhan/Parental population.
[0157] An exemplary Plate Layout containing samples and various controls is provided in
[0158] Proper aseptic technique should always be used when working with RNA. Always wear powder-free latex, vinyl, or nitrile gloves while handling reagents, tubes and RNA samples to prevent RNase contamination from the surface of the skin or from dust in the environment. Change gloves frequently and keep tubes closed.
[0159] During the procedure, work quickly and keep everything on cold blocks when possible to avoid degradation of RNA by endogenous or residual RNases. Clean working surfaces, pipettes, etc. with 20% bleach or other solution that can destroy nucleic acids and RNases.
[0160] The following Examples 5-6 represent illustrative output test results that can be communicated to an individual or entity who requested testing of a sample using a method or kit described herein. For example, relative amounts of detected variants can be provided.
Example 5
Hyper Transmissible SARS-CoV-2 Variant in Sample: Not Detected
[0161] Hyper Transmissible Variant Quantification: The alpha Variant of the B.1.1.7 lineage accounts for an alarming increase in cases in parts of England. Viruses in this lineage have an unusually large number of mutations, particularly in the Spike protein, which is the part of the virus that binds human cells and initiates infection. Our test does not test for every mutation present in the alpha variant, instead we target 2 key mutations that have been previously described to have biological effects that drive the hypertransmissibility of that alpha variant. The presence of both of these mutations is a strong indicator that the alpha variant or possibly another, related and yet to be defined hyper—transmissible variant is circulating within a community.
[0162] Mutation: Spike Protein del69-70: The deletion of amino acid residues 69 and 70 in the spike protein has been shown to cause a confirmation change to the spike protein and enhance viral infectivity and virus fitness.
[0163] Percentage of detected viruses with variant mutation: 0.000%
[0164] Parental Viral Copies per Liter wastewater at del69-70 location: 436,105 copies/L
[0165] Mutated Viral Copies per Liter wastewater at del69-70 location: 0 copies/L
[0166] Mutation: Spike Protein N501Y: Viruses containing the N501Y mutation demonstrate higher affinity for receptors found on human cells (2). This mutation, also found in the beta variant, has profound effects on infectivity and is potentially involved in immune system evasion (1).
[0167] Percentage of detected viruses with variant mutation: 0.000%
[0168] Parental (“wt”) Viral Copies per L wastewater at N501Y location: 432,650 copies/L Mutated Viral Copies per L wastewater at N501Y location: 0 copies/L
TABLE-US-00006 TABLE 6 Quality Control Data Pass Pass or Metric Criteria Measured Fail F+ Prophage Concentration Detection 2.62E+07 Pass (copies/L) Internal Process Control >5% 12% Pass (% Viral Recovery) ddPCR Positive Control >20 2780 Pass (Copies/Rxn) ddPCR Negative Control <1 0 Pass (Positive Droplets in NTC)
[0169] In this example, no viral sequences were detected with the key mutations that define the B.1.1.7 hyper transmissible lineage of viruses that includes the hyper-transmissible UK variant. This suggests there is a very low probability that this virus is circulating in your community at this time.
Example 6
Hyper Transmissible SARS-CoV-2 Variant in Sample: Detected
[0170] Hyper Transmissible Variant Quantification: The alpha Variant of the B.1.1.7 lineage accounts for an alarming increase in cases in parts of England. Viruses in this lineage have an unusually large number of mutations, particularly in the Spike protein, which is the part of the virus that binds human cells and initiates infection. 2 key mutations are targeted that have been previously described to have biological effects that drive the hypertransmissibility of that alpha variant. The presence of both of these mutations is a strong indicator that the alpha variant or possibly another, related and yet to be defined hyper-transmissible variant is circulating within a community.
[0171] Mutation: Spike Protein del69-70: The deletion of amino acid residues 69 and 70 in the spike protein has been shown to cause a confirmation change to the spike protein and enhance viral infectivity and virus fitness.
[0172] Percentage of detected viruses with variant mutation: 4.366%
[0173] Parental Viral Copies per Liter wastewater at del69-70 location: 743,749 copies/L
[0174] Mutated Viral Copies per Liter wastewater at del69-70 location: 32,475 copies/L
[0175] Mutation: Spike Protein N501Y: Viruses containing the N501Y mutation demonstrate higher affinity for receptors found on human cells (2). This mutation, also found in the beta variant, has profound effects on infectivity and is potentially involved in immune system evasion (1).
[0176] Percentage of detected viruses with variant mutation: 4.332%
[0177] Parental (“wt”) Viral Copies per L wastewater at N501Y location: 728,975 copies/L
[0178] Mutated Viral Copies per L wastewater at N501Y location: 31,580 copies/L
TABLE-US-00007 TABLE 7 Quality Control Data Pass Pass or Metric Criteria Measured Fail F+ Prophage Concentration Detection 2.62E+07 Pass (copies/L) Internal Process Control >5% 11% Pass (% Viral Recovery) ddPCR Positive Control >20 2830 Pass (Copies/Rxn) ddPCR Negative Control <1 0 Pass (Positive Droplets in NTC)
[0179] Both mutations of interest were detected, although at low levels, in this sample. This suggests there are strains in the B.1.1.7 lineage or other strains containing mutations that have been reported to confer increased transmissibility within your community.
Example 7
Exemplary Primer and Probes
[0180]
TABLE-US-00008 TABLE 8 Primers and probes useful in the presently disclosed methods and kits Component GT 4-plex Primer-Probe Solution Subcomponent Item name Item Sequence N501Y Forward CCGGTAGCACACCTTGTAAT (SEQ ID NO: 1) N501Y Reverse AGTTGCTGGTGCATGTAGAA (SEQ ID NO: 2) del69-70 forward CGTGGTGTTTATTACCCTGAC (SEQ ID NO: 5) del69-70 reverse ATGGTAGGACAGGGTTATCAA (SEQ ID NO: 6) DEL69-70 PROBE /5HEX/TACTTGGTT/ZEN/CCATGCTATCTCTGGGACC/ 3IABkFQ/ N501Y_Probe_lna_ /56-FAM/TGGTTTCCAACCCACT + TATGGTGT/3IABkFQ/ version1 (SEQ ID NO: 3) N501Y_Probe_version2 /56-FAM/TGGTTTCCAACCCACTTATGGTGT/3IABkFQ/ (SEQ ID NO: 28)
[0181] Wastewater is received, filtered, and virus is concentrated using ultrafiltiration. RNA is then extracted from concentrated virus.
[0182] Concentrated RNA is then analyzed in replicate of 4 using the GT Molecular 4-plex RT-ddPCR kit for N501Y (Fam channel) and del69-70 (HEX channel)
[0183] Data is thresholded to obtain concentrations of wildtype and mutant in each channel and concentrations of each virus sequence is back calculated to starting wastewater concentration (unit=copies/L of wastewater) and ratios of wildtype to mutant sequence are calculated. All results are summarized in the example reports (one negative and positive) attached.
Kit Composition:
[0184] This kit requires only 1 well to be run for each sample.
[0185] Single well analysis returns a parental (“wt”) measurement and a B.1.1.7 variant measurement (copies/uL) for 2 key B.1.1.7 mutations (del69-70 and N501Y)
Kit Components:
[0186] GT-4-plex primer-probe solution*
TABLE-US-00009 TABLE 9 Kit Composition Concentration N501Y positive primer 500 nM N501Y reverse primer 500 nM N501Y Probe_LNA (FAM)* 125 nM Del69-70 forward primer 500 nM Del69-70 reverse primer 500 nM Del69-70 Probe (HEX) 125 nM *although some configurations lack the LNA on the T at position 17(denoted as a + signed in the probe sequences above)
[0187] GT-Variant Positive Control**
[0188] Consists of synthetic B.1.1.7 viral RNA formulated to approximately 60 copies/uL
[0189] GT-Parental Positive Control**
[0190] Consists of synthetic Parental viral RNA formulated to approximately 60 copies/uL
[0191] GT-Variant-Parental Mix-Control**
[0192] Comprises synthetic Parental viral RNA formulated to approximately 60 copies/uL and synthetic B.1.1.7 viral RNA formulated to approximately 60 copies/uL.
Example 8
dPCR Delta-Omicron Varian Mutational Signature Assay for the Bio-Rad QX200 ddPCR® platform
[0193] The methods and assays provided herein may be used with available dPCR platforms, including the BioRad QX200 Droplet Digital™ system. See, e.g., www.gtmolecular.com/store-1/p/gt-rt-qper-sars-cov-2-variants-of-concern-mutational-signature-assay-kit-5nhg2-j28ng-nesm4-8548x-8arb9-rmf7h. The GT RT-dPCR Delta-Omicron Variant Mutational Signature Assay Kit (for QX200) is a molecular reagent kit containing all primers, probes, and controls for detection of S-gene mutations associated with the Delta (B.1.617.2) and Omicron (B.1.1.529) variant of SARS-CoV-2. While this test does not quantify every mutation present amongst the lineage, it targets key discriminating mutations associated with the Delta (L452R; T478K) and Omicron (N679K; Q954H) variants.
[0194] The kit includes one all-in-one primer probe solution and qualitative control sequences derived from GISAID accession numbers corresponding to the S-gene sequences of parental, Delta, and Omicron variants.
Example 9
RT-qPCR SARS-CoV-2, Delta-Omicron Varian Mutational Signature Assay for the Bio-Rad QX200 ddPCR® Platform
[0195] The methods and assays provided herein may be used with available RT-qPCR platforms, including with PBNJ. See, e.g., www.gtmolecular.com/store-1/p/gt-rt-qper-sars-cov-2-variants-of-concern-mutational-signature-assay-kit-5nhg2-j28ng-nesm4-8548x-8arb9-rmf7h, describing a RT-qPCR, SARS-CoV-2 Delta-Omicron Mutational Signature Assay Kit. The assay kit contains all primers, probes, and controls for detection of the signature mutations within the Spike protein-gene of the Delta (Indian, B.1.617.2) and Omicron (BA.1, BA.2, BA.3) variants. While this test does not target every mutation present in these virus variants, it targets variant-associated genomic sequences corresponding to Spike protein amino acids associated with the Delta (L452R and T478K) and Omicron (N679K and Q954H) variants. Kit includes validated GT-4-plex (L452R, T478K, N769K,Q954H) primer probe solution, plus validated, quantitative assay standards: GT-parental (parental) Standard, GT-Delta Standard and GT-Omicron Standard.
[0196] These examples further illustrate the methods and kits provided herein are compatible with both digital and quantitative real-time PCR. The RT-qPCR is preferable used with PBNJs to limit promiscuous probe hybridization to certain sequences, thereby further increasing discrimination between sequences.
[0197] Furthermore, probes with an LNA positioned at the SNP site dramatically increase specificity (see, e.g.,
[0198]
Example 10
Cancer Mutations
[0199] Oligonucleotides are designed to detect cancer mutations for the presently disclosed methods and kits. Table 10 shows probes and primers for detecting an oncogene mutation, including in one or more of: BRAF600; KRAS, P53; EGFR.
TABLE-US-00010 TABLE 10 Probes and primers for detecting oncogene mutation Oligo Name Sequence (5′.fwdarw.3′) Modifications BRAF_V600E_fwd SEQ ID NO: 16 TGAAGACCTCACAGTAAA BRAF_V600E_probe SEQ ID NO: 17 FAM or TCTAGCTACAGAGAAATCTCGATGGAG HEX, BHQ1 BRAF_V600E_rev SEQ ID NO: 18 CTGTCCAGTCATCAATTC KRAS_G12C_fwd1 SEQ ID NO: 19 TAAGGCCTGCTGAAAATGACTG KRAS_G12C_fwd2 SEQ ID NO: 20 CACGTCTGCAGTCAACTG KRAS_G12C_probe SEQ ID NO: 21 FAM or CCTACGCCACAAGCTCCAACTA HEX, BHQ1 KRAS_G12C_rev1 SEQ ID NO: 22 GGTCCTGCACCAGTAATATGC KRAS_G12C_rev2 SEQ ID NO: 23 GCTGTATCGTCAAGGCACTC KRAS_G12C_fwd1 SEQ ID NO: 29 TAAGGCCTGCTGAAAATGACTG EGFR_L858R_fwd SEQ ID NO: 24 CAAAGGGCATGAACTAC EGFR_L858R_probe SEQ ID NO: 25 FAM or TTTGGGCGGGCCAAACTG HEX, BHQ1 EGFR_L858R_rev SEQ ID NO: 26 CACTCTGGTGGGTATAG p53_R175H_fwd SEQ ID NO: 27 CCCTCAACAAGATGTTT p53_R175H_probe SEQ ID NO: 30 FAM or AGGTTGTGAGGCACTGCCC HEX, BHQ1 p53_R175H_rev SEQ ID NO: 31 CTTCCACTCGGATAAGA
Example 11
Single Probe Multiplex
[0200] The platform described herein is also applicable to detection of three targets with one promiscuous probe. The assay can discriminate parental, alpha variant (the Parental and alpha variant are grouped together because they contain the same sequences at 417 and 484 loci), beta Variant, and gamma variants.
[0201]
TABLE-US-00011 TABLE 11 Oligo Name Sequence (5′.fwdarw.3′) Modifications K417N/T probe SEQ ID NO: 32 FAM, BHQ1 CAGGGCAAACTGGAACGATTGCTG E484K probe SEQ ID NO: 33 HEX, BHQ1 AGCACACCTTGTAATGGTGTTAAAGGTTT 417_fwd2 SEQ ID NO: 34 TGTAATTAGAGGTGATGAAGTCAGAC 417_rev SEQ ID NO: 13 CAAGCTATAACGCAGCCTG 484-501_fwd2 SEQ ID NO: 35 CAAACCTTTTGAGAGAGATATTTCAACTG 484-501_rev2 SEQ ID NO:36 TTGCTGGTGCATGTAGAAG
STATEMENTS REGARDING INCORPORATION BY REFERENCE AND VARIATIONS
[0202] All references throughout this application, for example patent documents including issued or granted patents or equivalents; patent application publications; and non-patent literature documents or other source material; are hereby incorporated by reference herein in their entireties, as though individually incorporated by reference, to the extent each reference is at least partially not inconsistent with the disclosure in this application (for example, a reference that is partially inconsistent is incorporated by reference except for the partially inconsistent portion of the reference).
[0203] The terms and expressions which have been employed herein are used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred aspects, exemplary aspects and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims. The specific aspects provided herein are examples of useful aspects of the present invention and it will be apparent to one skilled in the art that the present invention may be carried out using a large number of variations of the devices, device components, methods steps set forth in the present description. As will be obvious to one of skill in the art, methods and devices useful for the present methods can include a large number of optional composition and processing elements and steps.
[0204] All patents and publications mentioned in the specification are indicative of the levels of skill of those skilled in the art to which the invention pertains. References cited herein are incorporated by reference herein in their entirety to indicate the state of the art as of their publication or filing date and it is intended that this information can be employed herein, if needed, to exclude specific aspects that are in the prior art. For example, when composition of matter are claimed, it should be understood that compounds known and available in the art prior to Applicant's invention, including compounds for which an enabling disclosure is provided in the references cited herein, are not intended to be included in the composition of matter claims herein.
[0205] As used herein, “comprising” is synonymous with “including,” “containing,” or “characterized by,” and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. As used herein, “consisting of” excludes any element, step, or ingredient not specified in the claim element. As used herein, “consisting essentially of” does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claim. In each instance herein any of the terms “comprising”, “consisting essentially of” and “consisting of” may be replaced with either of the other two terms. The invention illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations which is not specifically disclosed herein.
[0206] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which a disclosed disclosure belongs. The singular terms “a,” “an,” and “the” include plural referents unless context clearly indicates otherwise. Similarly, the word “or” is intended to include “and” unless the context clearly indicates otherwise. “Comprising” means “including”; hence, “comprising A or B” means “including A” or “including B” or “including A and B.” All references cited herein are incorporated by reference.
[0207] One of ordinary skill in the art will appreciate that starting materials, biological materials, reagents, synthetic methods, purification methods, analytical methods, assay methods, and biological methods other than those specifically exemplified can be employed in the practice of the invention without resort to undue experimentation. All art-known functional equivalents, of any such materials and methods are intended to be included in this invention. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred aspects and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims.
REFERENCES
[0208] [1] Rambaut, Loman, Pybus, et al., Preliminary genomic characterisation of an emergent SARS-CoV-2 lineage in the UK defined by a novel set of spike mutations. https://www.cogsconsortium.uk [0209] [2] Kemp. SA, Havery, W T, Datir, R P, et al., Recurrent emergence and transmission of a SARS-CoV-2 Spike Deletion H69/V70., medRxiv
TABLE-US-00012 Table of Sequences: SEQ ID Optional NO: Oligo Name Sequence (5′ -> 3′) Cone Label 1 N501Y forward primer CCGGTAGCACACCTTGTAAT 500 nM 2 N501Y reverse primer AGTTGCTGGTGCATGTAGAA 500 nM 3 N501Y TGGTTTCCAACCCACT+TATGGTGT 125 nM FAM Probe_LNA_version the base containing the LNA is depicted with a ‘+’ 4 N501Y_Probe_version2 TGGTTTCCAACCCACT 125 nM without LNA 5 Del69-70 forward CGTGGTGTTTATTACCCTGAC 500 nM primer 6 Del69-70 reverse CACCATCATTAAATGGTAGGACAG 500 nM HEX primer 7 Del69-70 Probe TACTTGGTTCCATGCTATCTCTGGGACC 125 nM HEX 8 484-501_for CCT GTA TAG ATT GTT TAG GAA GTC 500 nM TAA TCT C 9 484-501_rev AGT TGC TGG TGC ATG TAG AAG 500 nM 10 484K_1 AGCACACCTTGTAATGGTGTTAAAGGTTT 125 nM 5’ FAM and 3’BHQ1 11 484K_2 AGCACACCTTGTAATGGTGTTAAAGG 125 nM 5’FAM and 3’BHQ1 12 417 forward AGGTGATGAAGTCAGACAAATCG 500 nM 13 417 reverse CAA GCT ATA ACG CAG CCT G 500 nM 14 417T CAG GGC AAA CTG GAA CGA TFG CTG 125 nM 5’FAM AT and 3’BHQ1 15 417N CAG GGC AAA CTG GAA ACA TFG CTG 125 nM 5’FAM AT or 5’HEX, 3’BHQ1 16 BRAF_V600E_fwd TGAAGACCTCACAGTAAA 17 BRAF_V600E_probe TCTAGCTACAGAGAAATCTCGATGGAG FAM or HEX, BHQ1 18 BRAF_V600E_rev CTGTCCAGTCATCAATTC 19 KRAS_G12C_fwd1 TAAGGCCTGCTGAAAATGACTG 500 nM 20 KRAS_G12C_fwd2 CACGTCTGCAGTCAACTG 500 nM 21 KRASG12C_probe CCTACGCCACAAGCTCCAACTA 250 nM FAM or HEX, BHQ1 22 KRAS_G12C_rev1 GGTCCTGCACCAGTAATATOC 500 nM 23 KRAS_G12C_rev2 GCTGTATCGTCAAGGCACTC 500 nM 24 EGFR_L858R_fwd CAAAGGGCATGAACTAC 25 EGFR_L858R_probe TTTGGGCGGGCCAAACTG FAM or HEX, BHQ1 26 EGFR_L858R_rev CACTCTGGTGGGTATAG 27 p53_R175H_fwd CCCTCAACAAGATGTTT 28 N501Y_Probe_ TGGTTTCCAACCCACTTATGGTGT FAM version2 29 KRAS_G12C_fwd1 TAAGGCCTGCTGAAAATGACTG 500 nM 30 p53_R175H_probe AGGTTGTGAGGCACTGCCC FAM or HEX, BHQ1 31 p53_R175H_rev CTTCCACTCGGATAAGA 32 K417N/T probe CAGGGCAAACTGGAACGATTGCTG FAM, BHQ1 33 E484K probe AGCACACCTTGTAATGGTGTTAAAGGTTT HEX, BHQ1 34 417_fwd2 TGTAATTAGAGGTGATGAAGTCAGAC 35 484-501_fwd2 CAAGCTATAACGCAGCCTG 36 484-501_rev2 TTGCTGGTGCATGTAGAAG 37 G12 PBNJ + LNA