METHODS FOR DIFFERENTIATION
20190106677 ยท 2019-04-11
Assignee
Inventors
Cpc classification
C12N5/0606
CHEMISTRY; METALLURGY
International classification
Abstract
Described herein are methods relating to the differentiation of stem cells to more differentiated phenotypes, e.g. to terminally differentiated cell types and/or precursors thereof. In some embodiments, the methods relate to contacting the stem cells with differentiation factors and halting the cell cycle, thereby increasing the rate of differentiation.
Claims
1. A method of differentiating a stem cell, the method comprising: i) contacting the stem cell with one or more differentiation factors; and ii) inhibiting the cell cycle of the stem cell; wherein steps i) and ii) occur within 15 days of each other.
2. The method of claim 1, wherein steps i) and ii) occur within 14 days of each other.
3. The method of claim 1, wherein steps i) and ii) occur within 7 days of each other.
4. The method of claim 1, wherein steps i) and ii) occur within 2 days of each other.
5. The method of claim 1, wherein steps i) and ii) occur within 24 hours of each other.
6. The method of claim 1, wherein steps i) and ii) occur simultaneously.
7. The method of claim 1, wherein the differentiation factor is a terminal transcription factor.
8. The method of claim 1, wherein the cell cycle is inhibited by one or more of the following: reducing or removing growth factors; reducing serum levels; reducing serum levels below 5%; contacting the cell with a PI3K inhibitor; contacting the cell with an E2F family transcription factor inhibitor; contacting the cell with a Myc inhibitor; contacting the cell with a MAPK inhibitor; contacting the cell with a MEK1/2 inhibitor; contacting the cell with a CDK inhibitor; contacting the cell with an Id inhibitor; contacting the cell with a Rb agonist; contacting the cell with a Ink family agonist; contacting the cell with a Cip/Kip family agonist; and culturing the cell in a media lacking a factor selected from the group consisting of: LIF; Bmp; Fgf; Activin; or TGF.
9. The method of claim 1, wherein the cell cycle is inhibited by one or more of the following reducing or removing growth factors; reducing serum levels; reducing serum levels below 5%; contacting the cell with a PI3K inhibitor; contacting the cell with a Myc inhibitor; contacting the cell with a MAPK inhibitor; contacting the cell with a MEK1/2 inhibitor; contacting the cell with a CDK inhibitor; contacting the cell with an Id inhibitor; contacting the cell with a Rb agonist; contacting the cell with a Ink family agonist; contacting the cell with a Cip/Kip family agonist; culturing the cell in a media lacking factors that promote the cell cycle; and culturing the cell in a media lacking a factor selected from the group consisting of: LIF; Bmp; Fgf; Activin; or TGF
10. The method of claim 8, wherein the cell cycle is inhibited by reducing or removing growth factors.
11. The method of claim 8, wherein the cell cycle is inhibited by culturing the cell in a media lacking a factor selected from the group consisting of: LIF; Bmp; Fgf; Activin; or TGF.
12. The method of claim 8, wherein the cell cycle is inhibited by culturing the cell in a media lacking LIF.
13. The method of claim 8, wherein the PI3K inhibitor is LY294002.
14. The method of claim 8, wherein the E2F transcription factor inhibitor is HLM006474.
15. The method of claim 8, wherein the Myc inhibitor is JQ1 or 10058-F4.
16. The method of claim 8, wherein the MAPK inhibitor is PD98059.
17. The method of claim 8, wherein the CDK inhibitor is a CDK4 inhibitor, a CDK2 inhibitor, p16, p15, p18, p19, p21, p27, or p57.
18. The method of claim 1, wherein the stem cell is an embryonic stem cell.
19. The method of claim 1, wherein the stem cell is an pluripotent stem cell.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
DETAILED DESCRIPTION
[0028] As described herein, the inventors's have found that inhibiting the cell cycle and introducing differentiation factors, when both steps are performed early in the differentiation process, significantly increases the rate of differentiation (e.g. the differentiation of stem cells to terminally differentiated cells). In one aspect, described herein is a method of differentiating a stem cell, the method comprising (i) contacting the stem cell with one or more ectopic differentiation factors and (ii) inhibiting the cell cycle of the stem cell. In some embodiments, the stem cell can be an embryonic stem cell. In some embodiments, the stem cell can be an adult stem cell. In some embodiments, the stem cell can be an induced pluripotent stem cell.
[0029] Accordingly, in some embodiments, step (i) (i.e., contacting the stem cell with one or more ectopic differentiation factors) and step (ii) (i.e., inhibiting the cell cycle of the stem cell) are performed within about 15 days or less of each other, e.g. within about 14 days or less of each other, within about 13 days or less of each other, within about 12 days or less of each other, within about 11 days or less of each other, within about 10 days or less of each other, within about 9 days or less of each other, within about 8 days or less of each other, within about 7 days or less of each other, within about 6 days or less of each other, within about 5 days or less of each other, within about 4 days or less of each other, within about 3 days or less of each other, within about 2 days or less of each other, or within about 1 day or less of each other. In some embodiments, steps (i) and (ii) can be performed about simultaneously.
[0030] In some embodiments, step (i) (i.e., contacting the stem cell with one or more ectopic differentiation factors) and step (ii) (i.e., inhibiting the cell cycle of the stem cell) are performed within 15 days of each other, e.g. within 14 days of each other, within 13 days of each other, within 12 days of each other, within 11 days of each other, within 10 days of each other, within 9 days of each other, within 8 days of each other, within 7 days of each other, within 6 days of each other, within 5 days of each other, within 4 days of each other, within 3 days of each other, within 2 days of each other, or within 1 day (e.g. within 24 hours) of each other. In some embodiments, steps (i) and (ii) can be performed simultaneously.
[0031] In some embodiments, steps (i) and (ii) can both be performed before the stem cell differentiates to an intermediate and/or terminally differentiated cell, e.g. while the stem cell still evidences a stem cell phenotype. In some embodiments, a stem cell can be an undifferentiated cell exhibiting both pluripotency (or totipotent) and capable of self-renewal. In some embodiments, a stem cell can be a cell expressing stem cell markers. Stem cell markers are known in the art and can include, by way of non-limiting example, Nanog, SSEA-1, TDGF-1, Sox2, Oct4, (for further detail see, e.g., Pazhianisamy MATER METHODS 2013 3:200 and Zhao et al. Molecules 2013 17:6196-6236; each of which is incorporated by reference herein in its entirety). Kits for determining if a cell expresses stem cell markers are commercially available, e.g. Cat No. ab109884 from AbCam, Cambridge, Mass.
[0032] As used herein, ectopic differentiation factor refers to an ectopic agent that increases and/or promotes the process of differentiation. Ectopic differentiation factors are known in the art and can include, e.g. nucleic acids encoding polypeptides, polypeptides, small molecules, growth factors, cytokines, and the like. The identity of the ectopic differentiation factor will vary according to the type of differentiated cell that is desired. Appropriate ectopic differentiation factors that permit the differentiation of specific differentiated cell types are known in the art, see, e.g. Examples of various differentiation agents are disclosed in U.S. patent application Ser. No. 2003/0022367, or Gimble et al., 1995; Lennon et al., 1995; Majumdar et al., 1998; Caplan and Goldberg, 1999; Ohgushi and Caplan, 1999; Pittenger et al., 1999; Caplan and Bruder, 2001; Fukuda, 2001; Worster et al., 2001; Zuk et al., 2001; Rosenbauer and Tenen Nature Reviews Immunology 2007 7:105-117; Hughes et al. Periodontology 2006 41:48-72; Loregger et al. Placenta 2003 A:S104-110; Florini et al. Ann Rev of Physiology 1991 53:201-216; Yamamizu et al. Stem Cell Reports 2013 1:545-559; James. Scientifica 2013 684736; and Mummery et al. Circulation Research 2012 111:344-358; each of which is incorporated by reference herein in its entirety.
[0033] In some embodiments, the ectopic differentiation factor can be a terminal transcription factor. As used herein, the term terminal transcription factor refers to a transcription factor that promotes the differentiation of a stem cell and/or intermediate or partially differentiated cell into a terminally differentiated cell. A cell that is contacted with a terminal transcription factor can be contacted with either an ectopic nucleic acid encoding a terminal transcription factor and/or an ectopic terminal transcription factor polypeptide.
[0034] Terminal transcription factors, and the differentiated phenotypes they promote are known in the art. Non-limiting examples of terminal transcription factors can include MyoD; MyoG, Myf5, Mrf4, Ngn family (e.g. Ngn1-3), NeuroD family (e.g. NeuroD1-3), Ascl family (e.g. Asc11-2), Hb9, Zic1,Brn2, Myt11, Nurr1, Lmx1a, Gata family (e.g. Gatal, 2, 4, 5, 6), Tbx5, Mef2 family (e.g. Mef2a,b,c), Mesp1, Hnf/FoxA family (e.g. Hnf4, FoxA2), Pdx1, MafA, Runx family (e.g. Runx2, Runx1t1), Mitf, Spi1, Nkx family (e.g. Nkx2.1, 2.2), C/EBP family (e.g. C/EBP, ), Prdm family (e.g. Prdm1, 16), PPAR, Sc1, Lmo2, Ldb1, E2A, Ebf, Sox9, Hlf, Prdm5, Pbx1, Zfp37, Isl1, Lhx3, Phox2a, Fezf2, Olig family (e.g. 1 and 2), Elf5, Irf2, Elf1, Tgif1, Ets1, Sox family (e.g. Sox4, 6, 9, 17), Bach2, Cdx2, Smyd1, Pax family (e.g. Pax3, 6, 7), Klf family (e.g. Klf4), basic helix-loop-helix factors. A non-limiting list of exemplary terminal transcription factors is provided in Table 1.
TABLE-US-00001 TABLE 1 Exemplary Terminal Transcription Factors Exemplary Associated Terminal Transcription NCBI Gene ID for Differentiated Cell Type Factor Human Gene Myoblast MyoD 4654 MyoG 4656 Myf5 4617 Mrf4 4618 Gata4 2626 Tbx5 6910 Mef2a 4205 Mef2b 100271849 Mef2c 4208 Mesp1 55897 Pax7 5081 Smyd1 150572 Neuron Ngn1 4762 Ngn2 63973 Ngn3 50674 NeuroD1 4760 NeuroD2 4761 NeuroD3 4762 Ascl1 429 Ascl2 430 Zic1 7545 Brn2 5454 Nurr1 4929 Mytl1 23040 Lmx1a 4009 Hlf 3131 Zfp37 7539 Phox2a 401 Fezf2 55079 Motor neurons/Pancreatic Hb9 3110 cells Isl1 3670 Erythroid Gata1 2623 Ldb1 8861 Haemotopoietic and Gata2 2624 Endocrine lineages Myocardial and endodermal Gata5 140628 lineages Endodermal and Gata6 2627 Mesodermal lineages Hepatocyte (also liver, Hnf4 3172 kidney, & intestinal cells) Hepatocytes FoxA2 3170 Pancreatic Pdx1 3651 MafA 389692 Osteoblast Runx2 860 Prdm5 11107 Pbx1 5087 Melanocytes Mitf 4286 Myeloid, B lymphoid Spi1 6688 Thyroid Nkx2.1 7080 Central Nervous System Nkx2.2 4821 Adipocytes C/EBP 1050 Prdm16 63976 C/EBP 1051 PPAR 5468 Trophoblasts, plasma cells Prdm1 639 Osteoblast, neurons, Scl 6886 haemotopoietic lineages Haemotopoietic Lmo2 4005 Runx1t1 862 Bach2 60468 Irf2 3660 Sox4 6659 Lymphocytes E2A 6929 Elf1 1997 B cells Ebf 1879 Chondrocytes Sox9 6662 Motor Neurons Lhx3 8022 Oligodendrocytes Olig1 116448 Olig2 10215 Epithelial lineage Elf5 2001 Klf4 9314 Myeloid Tgif1 7050 Haemotopoietic and Ets1 2113 Epithelial lineages Neurons and chondrocytes Sox6 55553 Endoderm and Sox17 64321 Haemotopoietic lineages Intestinal Cdx2 1045 Muscle cells Pax3 5077 Nervous system and eye Pax6 5080 cells Skeletal muscle cells MyoD 4654 Spinal motor neurons Ngn2 63973 Isl1 3670 Lhx3 8022 Cardiomyocytes Gata5 140628 Hepatocytes/Hepatoblasts Hnf4 3172
[0035] In some embodiments, the stem cell is to be differentiated to a skeletal muscle phenotype and is contacted with the terminal transcription factor MyoD. In some embodiments, the stem cell is to be differentiated to a skeletal muscle phenotype and is contacted with the terminal transcription factor MyoD and the cell cycle is inhibited by reducing or removing growth factors. In some embodiments, the stem cell is to be differentiated to a skeletal muscle phenotype and is contacted with the terminal transcription factor MyoD and the cell cycle is inhibited by culturing the cell in a media lacking a factor selected from the group consisting of: LIF; Bmp; Fgf; Activin; or TGF. In some embodiments, the stem cell is to be differentiated to a skeletal muscle phenotype and is contacted with the terminal transcription factor MyoD and the cell cycle is inhibited by culturing the cell in a media lacking LIF.
[0036] In some embodiments, the stem cell is to be differentiated to a spinal motor neuron phenotype and is contacted with a terminal transcription factor selected from the group consisting of: Ngn2; Isl1; and Lhx3. In some embodiments, the stem cell is to be differentiated to a spinal motor neuron phenotype and is contacted with a terminal transcription factor selected from the group consisting of: Ngn2; Isl1; and Lhx3 and the cell cycle is inhibited by reducing or removing growth factors. In some embodiments, the stem cell is to be differentiated to a spinal motor neuron phenotype and is contacted with a terminal transcription factor selected from the group consisting of: Ngn2; Isl1; and Lhx3 and the cell cycle is inhibited by culturing the cell in a media lacking a factor selected from the group consisting of: LIF; Bmp; Fgf; Activin; or TGF. In some embodiments, the stem cell is to be differentiated to a spinal motor neuron phenotype and is contacted with a terminal transcription factor selected from the group consisting of: Ngn2; Isl1; and Lhx3 and the cell cycle is inhibited by culturing the cell in a media lacking LIF. In some embodiments, the stem cell is to be differentiated to a spinal motor neuron phenotype and is contacted with the terminal transcription factors Ngn2; Isl1; and Lhx3. In some embodiments, the stem cell is to be differentiated to a spinal motor neuron phenotype and is contacted with the terminal transcription factors Ngn2; Isl1; and Lhx3 and the cell cycle is inhibited by reducing or removing growth factors. In some embodiments, the stem cell is to be differentiated to a spinal motor neuron phenotype and is contacted with the terminal transcription factors Ngn2; Isl1; and Lhx3 and the cell cycle is inhibited by culturing the cell in a media lacking a factor selected from the group consisting of: LIF; Bmp; Fgf; Activin; or TGF. In some embodiments, the stem cell is to be differentiated to a spinal motor neuron phenotype and is contacted with the terminal transcription factors Ngn2; Isl1; and Lhx3 and the cell cycle is inhibited by culturing the cell in a media lacking LIF.
[0037] In some embodiments, the stem cell is to be differentiated to a cardiomyocyte phenotype and is contacted with the terminal transcription factor Gata5. In some embodiments, the stem cell is to be differentiated to a cardiomyocyte phenotype and is contacted with the terminal transcription factor Gata5 and the cell cycle is inhibited by reducing or removing growth factors. In some embodiments, the stem cell is to be differentiated to a cardiomyocyte phenotype and is contacted with the terminal transcription factor Gata5 and the cell cycle is inhibited by culturing the cell in a media lacking a factor selected from the group consisting of: LIF; Bmp; Fgf; Activin; or TGF. In some embodiments, the stem cell is to be differentiated to a cardiomyocyte phenotype and is contacted with the terminal transcription factor Gata5 and the cell cycle is inhibited by culturing the cell in a media lacking LIF.
[0038] In some embodiments, the stem cell is to be differentiated to a hepatocyte or hepatoblast phenotype and is contacted with the terminal transcription factor Hnf4. In some embodiments, the stem cell is to be differentiated to a hepatocyte or hepatoblast phenotype and is contacted with the terminal transcription factor Hnf4 and the cell cycle is inhibited by reducing or removing growth factors. In some embodiments, the stem cell is to be differentiated to a hepatocyte or hepatoblast phenotype and is contacted with the terminal transcription factor Hnf4 and the cell cycle is inhibited by culturing the cell in a media lacking a factor selected from the group consisting of: LIF; Bmp; Fgf; Activin; or TGF. In some embodiments, the stem cell is to be differentiated to a hepatocyte or hepatoblast phenotype and is contacted with the terminal transcription factor Hnf4 and the cell cycle is inhibited by culturing the cell in a media lacking LIF.
[0039] In some embodiments, the ectopic differentiation factor can be a polypeptide. In some embodiments, the ectopic differentiation factor can be a terminal transcription factor polypeptide. In some embodiments, the ectopic differentiation factor can be a variant of a terminal transcription factor polypeptide. In some embodiments, the ectopic differentiation factor can be a functional fragment of a terminal transcription factor polypeptide.
[0040] As used herein, a given polypeptide can include the human polypeptide, as well as homologs from other species, including but not limited to bovine, dog, cat chicken, murine, rat, porcine, ovine, turkey, horse, fish, baboon and other primates. The terms also refer to fragments or variants of a polypeptide that maintain at least 50% of the activity or effect, e.g. transcriptional activation and/or suppression of a full-length polypeptide. Conservative substitution variants that maintain the activity of wildtype polypeptides will include a conservative substitution as defined herein. The identification of amino acids most likely to be tolerant of conservative substitution while maintaining at least 50% of the activity of the wildtype is guided by, for example, sequence alignment with homologs or paralogs from other species. Amino acids that are identical between homologs are less likely to tolerate change, while those showing conservative differences are obviously much more likely to tolerate conservative change in the context of an artificial variant. Similarly, positions with non-conservative differences are less likely to be critical to function and more likely to tolerate conservative substitution in an artificial variant. Variants, fragments, and/or fusion proteins can be tested for activity, for example, by transcriptional activity assays and/or differentiation assays.
[0041] In some embodiments, the variant is a conservative substitution variant. Variants can be obtained by mutations of native nucleotide sequences, for example. A variant, as referred to herein, is a polypeptide substantially homologous to a native or reference polypeptide, but which has an amino acid sequence different from that of the native or reference polypeptide because of one or a plurality of deletions, insertions or substitutions. Polypeptide-encoding DNA sequences encompass sequences that comprise one or more additions, deletions, or substitutions of nucleotides when compared to a native or reference DNA sequence, but that encode a variant protein or fragment thereof that retains the relevant biological activity relative to the reference protein, e.g., at least 50% of an activity of the wildtype polypeptide. As to amino acid sequences, one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters a single amino acid or a small percentage, (i.e. 5% or fewer, e.g. 4% or fewer, or 3% or fewer, or 1% or fewer) of amino acids in the encoded sequence is a conservatively modified variant where the alteration results in the substitution of an amino acid with a chemically similar amino acid. It is contemplated that some changes can potentially improve the relevant activity, such that a variant, whether conservative or not, has more than 100% of the activity of the wildtype polypeptide, e.g. 110%, 125%, 150%, 175%, 200%, 500%, 1000% or more.
[0042] One method of identifying amino acid residues which can be substituted is to align, for example, a human polypeptide with a homolog from one or more non-human species. Alignment can provide guidance regarding not only residues likely to be necessary for function but also, conversely, those residues likely to tolerate change. Where, for example, an alignment shows two identical or similar amino acids at corresponding positions, it is more likely that that site is important functionally. Where, conversely, alignment shows residues in corresponding positions to differ significantly in size, charge, hydrophobicity, etc., it is more likely that that site can tolerate variation in a functional polypeptide. The variant amino acid or DNA sequence can be at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more, identical to a native or reference sequence, or a nucleic acid encoding one of those amino acid sequences. The degree of homology (percent identity) between a native and a mutant sequence can be determined, for example, by comparing the two sequences using freely available computer programs commonly employed for this purpose on the world wide web. The variant amino acid or DNA sequence can be at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more, similar to the sequence from which it is derived (referred to herein as an original sequence). The degree of similarity (percent similarity) between an original and a mutant sequence can be determined, for example, by using a similarity matrix. Similarity matrices are well known in the art and a number of tools for comparing two sequences using similarity matrices are freely available online, e.g. BLASTp (available on the world wide web at http://blast.ncbi.nlm.nih.gov), with default parameters set.
[0043] A given amino acid can be replaced by a residue having similar physiochemical characteristics, e.g., substituting one aliphatic residue for another (such as Ile, Val, Leu, or Ala for one another), or substitution of one polar residue for another (such as between Lys and Arg; Glu and Asp; or Gln and Asn). Other such conservative substitutions, e.g., substitutions of entire regions having similar hydrophobicity characteristics, are well known. Polypeptides comprising conservative amino acid substitutions can be tested in any one of the assays described herein to confirm that a desired activity of a native or reference polypeptide is retained. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles consistent with the disclosure. Typically conservative substitutions for one another include: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8) Cysteine (C), Methionine (M) (see, e.g., Creighton, Proteins (1984)).
[0044] Any cysteine residue not involved in maintaining the proper conformation of the polypeptide also can be substituted, generally with serine, to improve the oxidative stability of the molecule and prevent aberrant crosslinking. Conversely, cysteine bond(s) can be added to the polypeptide to improve its stability or facilitate oligomerization.
[0045] In some embodiments, a polypeptide, can comprise one or more amino acid substitutions or modifications. In some embodiments, the substitutions and/or modifications can prevent or reduce proteolytic degradation and/or prolong half-life of the polypeptide. In some embodiments, a polypeptide can be modified by conjugating or fusing it to other polypeptide or polypeptide domains such as, by way of non-limiting example, transferrin (WO06096515A2), albumin (Yeh et al., 1992), growth hormone (US2003104578AA); cellulose (Levy and Shoseyov, 2002); and/or Fc fragments (Ashkenazi and Chamow, 1997). The references in the foregoing paragraph are incorporated by reference herein in their entireties.
[0046] In some embodiments, a polypeptide as described herein can comprise at least one peptide bond replacement. A polypeptide as described herein can comprise one type of peptide bond replacement or multiple types of peptide bond replacements, e.g. 2 types, 3 types, 4 types, 5 types, or more types of peptide bond replacements. Non-limiting examples of peptide bond replacements include urea, thiourea, carbamate, sulfonyl urea, trifluoroethylamine, ortho-(aminoalkyl)-phenylacetic acid, para-(aminoalkyl)-phenylacetic acid, meta-(aminoalkyl)-phenylacetic acid, thioamide, tetrazole, boronic ester, olefinic group, and derivatives thereof.
[0047] In some embodiments, a polypeptide, as described herein can comprise naturally occurring amino acids commonly found in polypeptides and/or proteins produced by living organisms, e.g. Ala (A), Val (V), Leu (L), Ile (I), Pro (P), Phe (F), Trp (W), Met (M), Gly (G), Ser (S), Thr (T), Cys (C), Tyr (Y), Asn (N), Gln (Q), Asp (D), Glu (E), Lys (K), Arg (R), and His (H). In some embodiments, a polypeptide as described herein can comprise alternative amino acids. Non-limiting examples of alternative amino acids include, D-amino acids; beta-amino acids; homocysteine, phosphoserine, phosphothreonine, phosphotyrosine, hydroxyproline, gamma-carboxyglutamate; hippuric acid, octahydroindole-2-carboxylic acid, statine, 1,2,3,4,-tetrahydroisoquinoline-3-carboxylic acid, penicillamine (3-mercapto-D-valine), ornithine, citruline, alpha-methyl-alanine, para-benzoylphenylalanine, para-amino phenylalanine, p-fluorophenylalanine, phenylglycine, propargylglycine, sarcosine, and tert-butylglycine), diaminobutyric acid, 7-hydroxy-tetrahydroisoquinoline carboxylic acid, naphthylalanine, biphenylalanine, cyclohexylalanine, amino-isobutyric acid, norvaline, norleucine, tert-leucine, tetrahydroisoquinoline carboxylic acid, pipecolic acid, phenylglycine, homophenylalanine, cyclohexylglycine, dehydroleucine, 2,2-diethylglycine, 1-amino-1-cyclopentanecarboxylic acid, 1-amino-1-cyclohexanecarboxylic acid, amino-benzoic acid, amino-naphthoic acid, gamma-aminobutyric acid, difluorophenylalanine, nipecotic acid, alpha-amino butyric acid, thienyl-alanine, t-butylglycine, trifluorovaline; hexafluoroleucine; fluorinated analogs; azide-modified amino acids; alkyne-modified amino acids; cyano-modified amino acids; and derivatives thereof.
[0048] In some embodiments, a polypeptide can be modified, e.g. by addition of a moiety to one or more of the amino acids that together comprise the peptide. In some embodiments, a polypeptide as described herein can comprise one or more moiety molecules, e.g. 1 or more moiety molecules per polypeptide, 2 or more moiety molecules per polypeptide, 5 or more moiety molecules per polypeptide, 10 or more moiety molecules per polypeptide or more moiety molecules per polypeptide. In some embodiments, a polypeptide as described herein can comprise one more types of modifications and/or moieties, e.g. 1 type of modification, 2 types of modifications, 3 types of modifications or more types of modifications. Non-limiting examples of modifications and/or moieties include PEGylation; glycosylation; HESylation; ELPylation; lipidation; acetylation; amidation; end-capping modifications; cyano groups; phosphorylation; albumin, and cyclization. In some embodiments, an end-capping modification can comprise acetylation at the N-terminus, N-terminal acylation, and N-terminal formylation. In some embodiments, an end-capping modification can comprise amidation at the C-terminus, introduction of C-terminal alcohol, aldehyde, ester, and thioester moieties. The half-life of a polypeptide can be increased by the addition of moieties, e.g. PEG, albumin, or other fusion partners (e.g. Fc fragment of an immunoglobin).
[0049] In some embodiments, the polypeptide can be a functional fragment of one of the amino acid sequences described herein. As used herein, a functional fragment is a fragment or segment of a polypeptide which retains the activity, e.g. the transcriptional activity, of the wildtype polypeptide. A functional fragment can comprise conservative substitutions of the sequences disclosed herein.
[0050] Alterations of the original amino acid sequence can be accomplished by any of a number of techniques known to one of skill in the art. Mutations can be introduced, for example, at particular loci by synthesizing oligonucleotides containing a mutant sequence, flanked by restriction sites permitting ligation to fragments of the native sequence. Following ligation, the resulting reconstructed sequence encodes an analog having the desired amino acid insertion, substitution, or deletion. Alternatively, oligonucleotide-directed site-specific mutagenesis procedures can be employed to provide an altered nucleotide sequence having particular codons altered according to the substitution, deletion, or insertion required. Techniques for making such alterations include those disclosed by Khudyakov et al. Artificial DNA: Methods and Applications CRC Press, 2002; Braman In Vitro Mutagenesis Protocols Springer, 2004; and Rapley The Nucleic Acid Protocols Handbook Springer 2000; which are herein incorporated by reference in their entireties. In some embodiments, a polypeptide as described herein can be chemically synthesized and mutations can be incorporated as part of the chemical synthesis process.
[0051] In some embodiments, a cell can be contacted with multiple ectopic differentiation factors, e.g. two or more terminal transcription factors, or a terminal transcription factor and cytokine.
[0052] As used herein cell cycle refers to the series of events involving the growth, replication, and division of a eukaryotic cell. A phase of a cell cycle or cell cycle phase refers to a distinct phase or period of the cell cycle, such as the mitosis phase (M phase), the first gap phase (G1 phase), the DNA synthesis phase (S phase), and the second gap phase (G2 phase). A complete cell cycle refers to entire single cell cycle including a G1 phase, S phase, G2 phase, and an M phase. Analysis of a complete cell cycle does not require beginning at a particular phase within the cell cycle. For example, a complete cellcycle phase may begin with an S phase and end at completion of G1 phase, or likewise, a complete cell cycle phase may begin with an M phase and end with completion of G2 phase. Inhibition of the cell cycle can comprise slowing the progression of a cell through the cycle, slowing the progression of a cell through a particular stage of the cell cycle, and/or arresting the cell at a particular point in the cell cycle. Slowing the progression of the cell constitutes a decrease in the rate at which the cell progresses through the cell cycle.
[0053] Methods of inhibiting the cell cycle can comprise contacting the cell with an agent that inhibits the cell cycle and/or removing an agent that promotes progression through the cell cycle. Agents for promoting or inhibiting cell cycle progression are known in the art. By way of non-limiting example, the cell cycle can be inhibited by: reducing or removing growth factors; reducing serum levels; reducing serum levels below about 5%; reducing serum levels below 5%; contacting the cell with a PI3K inhibitor; contacting the cell with an E2F family transcription factor inhibitor; contacting the cell with a Myc inhibitor; contacting the cell with a MAPK inhibitor; contacting the cell with a MEK1/2 inhibitor; contacting the cell with a CDK inhibitor; contacting the cell with an Id inhibitor; contacting the cell with a Rb agonist; contacting the cell with a Ink family agonist; contacting the cell with a Cip/Kip family agonist; culturing the cell in a media lacking a factor selected from the group consisting of: LIF; Bmp; Fgf; Activin; or TGF.
[0054] As used herein, the term inhibitor refers to an agent which can decrease the expression and/or activity of the targeted expression product (e.g. mRNA encoding the target or a target polypeptide), e.g. by at least 10% or more, e.g. by 10% or more, 50% or more, 70% or more, 80% or more, 90% or more, 95% or more, or 98% or more. The efficacy of an inhibitor, e.g. its ability to decrease the level and/or activity of the target, can be determined, e.g. by measuring the level of an expression product of and/or the activity of the target. Methods for measuring the level of a given mRNA and/or polypeptide are known to one of skill in the art, e.g. RTPCR can be used to determine the level of RNA and Western blotting with an antibody can be used to determine the level of a polypeptide. The activity of a target can be determined using methods known in the art and described herein, e.g. transcriptional activity assays. In some embodiments, the inhibitor can be an inhibitory nucleic acid; an aptamer; an antibody reagent; an antibody; or a small molecule.
[0055] As used herein, the term agonist refers to any agent that increases the level and/or activity of the target, e.g., of Rb, Ink family polypeptides, and/or Cip/Kip family polypeptides. As used herein, the term agonist refers to an agent which increases the expression and/or activity of the target by at least 10% or more, e.g. by 10% or more, 50% or more, 100% or more, 200% or more, 500% or more, or 1000% or more.
[0056] Phosphoinositide 3-kinases are a family of related enzymes that are capable of phosphorylating the 3 position hydroxyl group of the inositol ring of phosphatidylinositol. They are also known as phosphatidylinositol-3-kinases. PI3Ks interact with the IRS (Insulin receptor substrate) in order to regulate glucose uptake through a series of phosphorylation events. The phosphoinositol-3-kinase family is composed of Class I, II and Class III , with Class I the only ones able to convert PI(4,5)P2 to PI(3,4,5)P3 on the inner leaflet of the plasma membrane. As used herein, a PI3K inhibitor refers to an agent that inhibits the activity of PI3K, as measured by the level of phosphorylation of the 3 position hydroxyl group of the inositol ring of phosphatidylinositol, or as measured by the activity and/or phosphorylation (where increased phosphorylation indicates PI3K activity) of molecules downstream of PI3K. Examples of such downstream molecules are known in the art and can include, but are not limited to AKT, SGK, mTOR, GSK3, PSD-95, S6, and 4EBP1. Methods of measuring the activity of PI3K, directly or indirectly are well known in the art, and include, by way of non-limiting example determining the level of phosphorylation of a molecule downstream of PI3K using phospho-isoform specific antibodies, which are commercially available (e.g. anti-phospho-AKT antibody, Cat No. ab66138 Abcam, Cambridge, Mass.). Non-limiting examples of PI3K inhibitors can include LY294002; BGT226; BEZ235; PI103, PI828. wortmannin, demethoxyviridin, IC486068, IC87114, GDC-0941, perifosine, CAL101, PX-866, IPI-145, BAY 80-6946, P6503, TGR1202, SF1126, INK1117, BKM120, IL147, XL765, Palomid 529, GSK1059615, ZSTK474, PWT33597, TG100-115, CAL263, GNE-447, CUDC-907, and AEZS-136.
[0057] An inhibitor of E2F family transcription factors can be an agent that inhibits the activity of a E2F transcription factor, as measured by the level of transcription of E2F targets (e.g. CCNA1, MYB, EB1, BRCA1, and TP53). Assays for E2F activity are known in the art and are commercially available (e.g. Cat. No. CCS-003L, Qiagen Valencia, Calif.). Non-limiting examples of E2F family transcription factors can include HLM006474.
[0058] An inhibitor of Myc can be an agent that inhibits the activity and/or level of Myc. Myc is a transcription factor that participates in cell proliferation and DNA replication. The sequence of Myc is known in a number of species, e.g. human Myc (NCBI Gene ID: 4609) mRNA (NCBI Ref Seq: NM_002467 (SEQ ID NO: 85)) and polypeptide (NP_002458 (SEQ ID NO: 86)) sequences. Myc activity can be measured, e.g. by the level of transcription of genes activated (e.g. CDK or MNT) or suppressed (e.g. Miz1) by Myc. Assays for Myc activity are known in the art and are commercially available (e.g. Cat. No. CCS-012L; Qiagen Valencia, Calif.). Non-limiting examples of Myc inhibitors can include JQ1; 10058-F4; and CAS 403811-55-21.
[0059] An inhibitor of MAPK can be an agent that inhibits the activity of a mitogen-activated protein kinase (MAPK), as measured by the level of phosphorylation of MAPK targets (e.g. ELK1 is a substrate of ERK1 and MK2 and MK3 are targets of p38 kinases). Assays for MAPK activity are known in the art and are commercially available (e.g. Cat. No. CS0250 from Sigma-Aldrich, St. Louis, Mo.). Non-limiting examples of MAPK inhibitors can include PD98059; SB203580; SB202190; and SP600125.
[0060] An inhibitor of CDK can be an agent that inhibits the activity of a cyclin-dependent kinase (CDK), as measured by the level of phosphorylation of CDK targets (e.g. CDK2 targets Rb, p53 and E2F are substrates of CDK2 and RB1 and MEP50 are substrates of CDK4). Assays for CDK activity are known in the art and are commercially available (e.g. Cat. No. PV3343 Invitrogen, Carlsbad, Calif.). In some embodiments, an inhibitor of CDK can inhibit CDK4 and/or CDK2. In some embodiments, an inhibitor of CDK can specifically inhibit CDK4 and/or CDK2. Non-limiting examples of CDK inhibitors can include p16; p15; p18; p19; p21; p27; p57; p1446A-05; PD-0332991; flavopiridol; aloisine A; AT7519; BS-181; butyrolactone I; purvalanol A; pruvalanol B; roscovitine; and WHI-P 180.
[0061] An inhibitor of Id can be an agent that inhibits the level and/or activity of inhibitor of DNA binding 1 (Id). Id forms heterodimers with helix-loop-helix transcription factors and inhibits their activyt. The sequence of Id is known in a number of species, e.g. human Id (NCBI Gene ID: 3397) mRNA (NCBI Ref Seq: NM_002165 (SEQ ID NO: 87)) and polypeptide (NP_002156 (SEQ ID NO: 88)) sequences. Id activity can be measured, e.g. by measuring the inhibition of DNA binding and/or transcriptional activation of helix-loop-helix transcription factors that can bind with Id. Non-limiting examples of Id inhibitors can include caveolin-1.
[0062] An agonist of Rb can be an agent that increases the level and/or activity of retinoblastoma 1 (Rb). Rb binds to and inhibits E2F transcription factors, thereby preventing progress through the cell cycle. The sequence of Rb is known in a number of species, e.g. human Rb (NCBI Gene ID: 5925) mRNA (NCBI Ref Seq: NM_000321 (SEQ ID NO: 89)) and polypeptide (NP_000312 (SEQ ID NO: 90)) sequences. Rb activity can be measured, e.g., by measuring binding to E2F transcription factors and/or transcription of E2F factors. Non-limiting examples of agonists of Rb can include Rb polypeptides or agonist fragments thereof and nucleic acids encoding a Rb polypeptide.
[0063] An agonist of Ink family proteins can be an agent that increase the level and/or activity of Ink family proteins (e.g. INK4 family, INK4A (NCBI Gene ID: 1029 (SEQ ID NOS 91-92)), INK4B (NCBI Gene ID: 1030 (SEQ ID NOS 93-94)), INK4C (NCBI Gene ID: 1031 (SEQ ID NOS 95-96)), and INK4D (NCBI Gene ID: 1032 (SEQ ID NOS 97-98))). INK family proteins bind and inhibit CDK4 and CDK6. Ink protein activity can be measured by measuring, e.g. the activity of CDK4 and/or CDK6 as described elsewhere herein and/or binding to CDK4 and/or CDK6. Non-limiting examples of agonists of Ink family polypeptides can include Ink family polypeptides or agonist fragments thereof and nucleic acids encoding an Ink family polypeptide.
[0064] An agonist of Cip/Kip family proteins can be an agent that increase the level and/or activity of Cip/Kip family proteins (e.g. Cip/Kip family, KIP1 (NCBI Gene ID: 1027 (SEQ ID NOS 99-100)), KIP2 (NCBI Gene ID: 1028 (SEQ ID NOS 101-102)), and CIP1 (NCBI Gene ID: 1026 (SEQ ID NOS 103-104))). Cip/Kip family proteins bind and inhibit CDK2. Cip/Kip protein activity can be measured by measuring, e.g. the activity of CDK2 as described elsewhere herein. Non-limiting examples of agonists of Cip/Kip family polypeptides can include Cip/Kip family polypeptides or agonist fragments thereof and nucleic acids encoding an Cip/Kip family polypeptide.
[0065] In some embodiments, inhibition of the cell cycle can be accomplished by removing and/or reducing the level of growth and/or signaling factors, e.g. by culturing the cell in media lacking or having reduced levels of one or more growth and/or signaling factors that promote the cell cycle. Non-limiting examples of such growth and/or signaling factors can include LIF (e.g., NCBI Gene ID: 3976 (SEQ ID NOS 105-106)), Bmp (e.g. NCBI Gene ID: 649 (SEQ ID NOS 107-108), 650 (SEQ ID NOS 109-110), 651 (SEQ ID NOS 111-112), 652 (SEQ ID NOS 113-114), 653 (SEQ ID NOS 115-116), 654 (SEQ ID NOS 117-118), 655 (SEQ ID NOS 119-120), 6565 (SEQ ID NOS 121-122), 51423 (SEQ ID NOS 123-124), and 27302 (SEQ ID NOS 125-126)), Fgf (e.g. one or more of NCBI Gene IDs: 2252 (SEQ ID NOS 127-128), 2255 (SEQ ID NOS 129-130), 9965 (SEQ ID NOS 131-132), 2249 (SEQ ID NOS 133-134), 2248 (SEQ ID NOS 135-136), 2257 (SEQ ID NOS 137-138), 8822 (SEQ ID NOS 139-140), 2251 (SEQ ID NOS 141-142), 27006 (SEQ ID NOS 143-144), 2256 (SEQ ID NOS 145-146), 2247 (SEQ ID NOS 147-148), 8074 (SEQ ID NOS 149-150), 2246 (SEQ ID NOS 151-152), 26291 (SEQ ID NOS 153-154), 2253 (SEQ ID NOS 155-156), 2254 (SEQ ID NOS 157-158), 2250 (SEQ ID NOS 159-160), 2258 (SEQ ID NOS 161-162), 8817 (SEQ ID NOS 163-164), 26281 (SEQ ID NOS 165-166), and 2259 (SEQ ID NOS 167-168)) Avtivin (e.g., NBCI Gene ID: 3624 (SEQ ID NOS 169-170)), and TGFI3 (e.g. one or more of NCBI Gene IDs: 7040 (SEQ ID NOS 171-172), 7042 (SEQ ID NOS 173-174), 7043 (SEQ ID NOS 175-176), and 7044 (SEQ ID NOS 177-178)). In some embodiments, inhibiting the cell cycle can comprise culturing the cell in a media lacking one or more factors selected from the group consisting of: LIF; Bmp; Fgf; Activin; or TGF, e.g. lacking 1 of the factors, 2 of the factors, 3 of the factors, 4 of the factors, 5 of the factors, or more of the factors.
[0066] In some embodiments, contacting a cell with an agent can comprise contacting the cell with one dose of the agent. In some embodiments, contacting a cell with an agent can comprise contacting the cell with repeated doses of the agent. In some embodiments, contacting a cell with an agent can comprise maintaining a given concentration of the agent in the cell's environment, e.g. in the culture media. In some embodiments, contacting a cell with an agent can comprise maintaining at least a given minimum concentration of the agent in the cell's environment, e.g. in the culture media.
[0067] In some embodiments, the methods described herein can result in a population of cells comprising one or more terminally-differentiated cell types, e.g. 1 terminally-differentiated cell type, 2 terminally-differentiated cell types, 3 terminally-differentiated cell types, 4 terminally-differentiated cell types, 5 terminally-differentiated cell types, or more terminally-differentiated cell types. When discussing a population of cells that results from the methods described herein, the resulting population can be the population of cells existing at about 1 day to about 30 days after both steps (i) and (ii) have been performed.
[0068] In some embodiments, the methods described herein can result in a population of cells comprising no more than 2 terminally-differentiated cell types, e.g. 1 terminally-differentiated cell type or 2 terminally-differentiated cell types.
[0069] In some embodiments, the methods described herein can result in a population of cells of which at least about 50% of the cells are terminally-differentiated cell, e.g. about 50% or more of the cells are terminally-differentiated cells, about 60% or more of the cells are terminally-differentiated cells, about 70% or more of the cells are terminally-differentiated cells, about 80% or more of the cells are terminally-differentiated cells, about 90% or more of the cells are terminally-differentiated cells, about 95% or more of the cells are terminally-differentiated cells, or about 98% or more of the cells are terminally-differentiated cells. In some embodiments, the methods described herein can result in a population of cells of which at least 50% of the cells are terminally-differentiated cell, e.g. 50% or more of the cells are terminally-differentiated cells, 60% or more of the cells are terminally-differentiated cells, 70% or more of the cells are terminally-differentiated cells, 80% or more of the cells are terminally-differentiated cells, 90% or more of the cells are terminally-differentiated cells, 95% or more of the cells are terminally-differentiated cells, or 98% or more of the cells are terminally-differentiated cells.
[0070] Differentiated cells obtained in accordance with the methods described herein can be used, e.g. for cell therapy, autologous cell therapy, transplantation, wound healing or repair, in vitro studies of cell function, cell growth, cell differentiation, and/or screens for modulators of cell function and behavior (e.g. therapeutics, drug candidates, inhibitors or agonists of growth, function, and differentiation).
[0071] For convenience, the meaning of some terms and phrases used in the specification, examples, and appended claims, are provided below. Unless stated otherwise, or implicit from context, the following terms and phrases include the meanings provided below. The definitions are provided to aid in describing particular embodiments, and are not intended to limit the claimed invention, because the scope of the invention is limited only by the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. If there is an apparent discrepancy between the usage of a term in the art and its definition provided herein, the definition provided within the specification shall prevail.
[0072] For convenience, certain terms employed herein, in the specification, examples and appended claims are collected here.
[0073] The terms decrease, reduced, reduction, or inhibit are all used herein to mean a decrease by a statistically significant amount. In some embodiments, reduce, reduction or decrease or inhibit typically means a decrease by at least 10% as compared to a reference level (e.g. the absence of a given treatment) and can include, for example, a decrease by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99% , or more. As used herein, reduction or inhibition does not encompass a complete inhibition or reduction as compared to a reference level. Complete inhibition is a 100% inhibition as compared to a reference level. A decrease can be preferably down to a level accepted as within the range of normal for an individual without a given disorder.
[0074] The terms increased, increase, enhance, or activate are all used herein to mean an increase by a statically significant amount. In some embodiments, the terms increased, increase, enhance, or activate can mean an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level. In the context of a marker or symptom, an increase is a statistically significant increase in such level.
[0075] As used herein, contacting refers to any suitable means for delivering, or exposing, an agent to at least one cell. Exemplary delivery methods include, but are not limited to, direct delivery to cell culture medium, perfusion, injection, or other delivery method well known to one skilled in the art.
[0076] The term agent refers generally to any entity which is normally not present or not present at the levels being administered to a cell, tissue or subject. An agent can be selected from a group including but not limited to: polynucleotides; polypeptides; small molecules; and antibodies or antigen-binding fragments thereof. A polynucleotide can be RNA or DNA, and can be single or double stranded, and can be selected from a group including, for example, nucleic acids and nucleic acid analogues that encode a polypeptide. A polypeptide can be, but is not limited to, a naturally-occurring polypeptide, a mutated polypeptide or a fragment thereof that retains the function of interest. Further examples of agents include, but are not limited to a nucleic acid aptamer, peptide-nucleic acid (PNA), locked nucleic acid (LNA), small organic or inorganic molecules; saccharide; oligosaccharides; polysaccharides; biological macromolecules, peptidomimetics; nucleic acid analogs and derivatives; extracts made from biological materials such as bacteria, plants, fungi, or mammalian cells or tissues and naturally occurring or synthetic compositions. An agent can be applied to the media, where it contacts the cell and induces its effects. Alternatively, an agent can be intracellular as a result of introduction of a nucleic acid sequence encoding the agent into the cell and its transcription resulting in the production of the nucleic acid and/or protein environmental stimuli within the cell. In some embodiments, the agent is any chemical, entity or moiety, including without limitation synthetic and naturally-occurring non-proteinaceous entities. In certain embodiments the agent is a small molecule having a chemical moiety selected, for example, from unsubstituted or substituted alkyl, aromatic, or heterocyclyl moieties including macrolides, leptomycins and related natural products or analogues thereof. Agents can be known to have a desired activity and/or property, or can be selected from a library of diverse compounds. As used herein, the term small molecule can refer to compounds that are natural product-like, however, the term small molecule is not limited to natural product-like compounds. Rather, a small molecule is typically characterized in that it contains several carboncarbon bonds, and has a molecular weight more than about 50, but less than about 5000 Daltons (5 kD). Preferably the small molecule has a molecular weight of less than 3 kD, still more preferably less than 2 kD, and most preferably less than 1 kD. In some cases it is preferred that a small molecule have a molecular mass equal to or less than 700 Daltons.
[0077] As used herein, ectopic refers to a substance that is found in an unusual location and/or amount. An ectopic substance can be one that is normally found in a given cell, but at a much lower amount and/or at a different time.
[0078] As used herein, the terms protein and polypeptide are used interchangeably herein to designate a series of amino acid residues, connected to each other by peptide bonds between the alpha-amino and carboxy groups of adjacent residues. The terms protein, and polypeptide refer to a polymer of amino acids, including modified amino acids (e.g., phosphorylated, glycated, glycosylated, etc.) and amino acid analogs, regardless of its size or function. Protein and polypeptide are often used in reference to relatively large polypeptides, whereas the term peptide is often used in reference to small polypeptides, but usage of these terms in the art overlaps. The terms protein and polypeptide are used interchangeably herein when referring to a gene product and fragments thereof. Thus, exemplary polypeptides or proteins include gene products, naturally occurring proteins, homologs, orthologs, paralogs, fragments and other equivalents, variants, fragments, and analogs of the foregoing.
[0079] The polypeptides of the present invention can be synthesized by using well known methods including recombinant methods and chemical synthesis. Recombinant methods of producing a polypeptide through the introduction of a vector including nucleic acid encoding the polypeptide into a suitable host cell are well known in the art, e.g., as described in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d Ed, Vols 1 to 8, Cold Spring Harbor, N.Y. (1989); M. W. Pennington and B. M. Dunn, Methods in Molecular Biology: Peptide Synthesis Protocols, Vol 35, Humana Press, Totawa, N.J. (1994), contents of both of which are herein incorporated by reference. Peptides can also be chemically synthesized using methods well known in the art. See for example, Merrifield et al., J. Am. Chem. Soc. 85:2149 (1964); Bodanszky, M., Principles of Peptide Synthesis, Springer-Verlag, New York, N.Y. (1984); Kimmerlin, T. and Seebach, D. J. Pept. Res. 65:229-260 (2005); Nilsson et al., Annu. Rev. Biophys. Biomol. Struct. (2005) 34:91-118; W. C. Chan and P. D. White (Eds.) Fmoc Solid Phase Peptide Synthesis: A Practical Approach, Oxford University Press, Cary, N.C. (2000); N. L. Benoiton, Chemistry of Peptide Synthesis, CRC Press, Boca Raton, Fla. (2005); J. Jones, Amino Acid and Peptide Synthesis, 2.sup.nd Ed, Oxford University Press, Cary, N.C. (2002); and P. Lloyd-Williams, F. Albericio, and E. Giralt, Chemical Approaches to the synthesis of peptides and proteins, CRC Press, Boca Raton, Fla. (1997), contents of all of which are herein incorporated by reference. Peptide derivatives can also be prepared as described in U.S. Pat. Nos. 4,612,302; 4,853,371; and 4,684,620, and U.S. Pat. App. Pub. No. 2009/0263843, contents of all which are herein incorporated by reference.
[0080] As used herein, the term nucleic acid or nucleic acid sequence refers to any molecule, preferably a polymeric molecule, incorporating units of ribonucleic acid, deoxyribonucleic acid or an analog thereof. The nucleic acid can be either single-stranded or double-stranded. A single-stranded nucleic acid can be one nucleic acid strand of a denatured double- stranded DNA. Alternatively, it can be a single-stranded nucleic acid not derived from any double-stranded DNA. In one aspect, the nucleic acid can be DNA. In another aspect, the nucleic acid can be RNA. Suitable nucleic acid molecules are DNA, including genomic DNA or cDNA. Other suitable nucleic acid molecules are RNA, including mRNA.
[0081] In some embodiments, the technology described herein relates to a nucleic acid encoding a polypeptide as described herein. As used herein, the term nucleic acid or nucleic acid sequence refers to any molecule, preferably a polymeric molecule, incorporating units of ribonucleic acid, deoxyribonucleic acid or an analog thereof. The nucleic acid can be either single-stranded or double-stranded. A single-stranded nucleic acid can be one strand nucleic acid of a denatured double-stranded DNA. Alternatively, it can be a single-stranded nucleic acid not derived from any double-stranded DNA. In one aspect, the template nucleic acid is DNA. In another aspect, the template is RNA. Suitable nucleic acid molecules include DNA, including genomic DNA or cDNA. Other suitable nucleic acid molecules include RNA, including mRNA. The nucleic acid molecule can be naturally occurring, as in genomic DNA, or it may be synthetic, i.e., prepared based upon human action, or may be a combination of the two. The nucleic acid molecule can also have certain modification(s) such as 2-deoxy, 2-deoxy-2-fluoro, 2-O-methyl, 2-O-methoxyethyl (2-O-MOE), 2-O-aminopropyl (2-O-AP), 2-O-dimethylaminoethyl (2-O-DMAOE), 2-O-dimethylaminopropyl (2-O-DMAP), 2-O-dimethylaminoethyloxyethyl (2-O-DMAEOE), or 2-O--N-methylacetamido (2-O-NMA), cholesterol addition, and phosphorothioate backbone as described in US Patent Application 20070213292; and certain ribonucleoside that are linked between the 2-oxygen and the 4-carbon atoms with a methylene unit as described in U.S. Pat. No. 6,268,490, wherein both patent and patent application are incorporated herein by reference in their entirety.
[0082] In some embodiments, a nucleic acid encoding a polypeptide as described herein is comprised by a vector. In some of the aspects described herein, a nucleic acid sequence encoding a polypeptide as described herein is operably linked to a vector. The term vector, as used herein, refers to a nucleic acid construct designed for delivery to a host cell or for transfer between different host cells. As used herein, a vector can be viral or non-viral. The term vector encompasses any genetic element that is capable of replication when associated with the proper control elements and that can transfer gene sequences to cells. A vector can include, but is not limited to, a cloning vector, an expression vector, a plasmid, phage, transposon, cosmid, chromosome, virus, virion, etc.
[0083] As used herein, the term expression vector refers to a vector that directs expression of an RNA or polypeptide from sequences linked to transcriptional regulatory sequences on the vector. The sequences expressed will often, but not necessarily, be heterologous to the cell. An expression vector may comprise additional elements, for example, the expression vector may have two replication systems, thus allowing it to be maintained in two organisms, for example in human cells for expression and in a prokaryotic host for cloning and amplification. The term expression refers to the cellular processes involved in producing RNA and proteins and as appropriate, secreting proteins, including where applicable, but not limited to, for example, transcription, transcript processing, translation and protein folding, modification and processing. Expression products include RNA transcribed from a gene, and polypeptides obtained by translation of mRNA transcribed from a gene. The term gene means the nucleic acid sequence which is transcribed (DNA) to RNA in vitro or in vivo when operably linked to appropriate regulatory sequences. The gene may or may not include regions preceding and following the coding region, e.g. 5 untranslated (5UTR) or leader sequences and 3 UTR or trailer sequences, as well as intervening sequences (introns) between individual coding segments (exons).
[0084] As used herein, the term viral vector refers to a nucleic acid vector construct that includes at least one element of viral origin and has the capacity to be packaged into a viral vector particle. The viral vector can contain a nucleic acid encoding a polypeptide as described herein in place of non-essential viral genes. The vector and/or particle may be utilized for the purpose of transferring nucleic acids into cells either in vitro or in vivo. Numerous forms of viral vectors are known in the art.
[0085] By recombinant vector is meant a vector that includes a heterologous nucleic acid sequence, or transgene that is capable of expression in vivo. It should be understood that the vectors described herein can, in some embodiments, be combined with other suitable compositions and therapies. In some embodiments, the vector is episomal. The use of a suitable episomal vector provides a means of maintaining the nucleotide of interest in the subject in high copy number extra chromosomal DNA thereby eliminating potential effects of chromosomal integration.
[0086] The term progenitor cell is used herein to refers to cells that have a cellular phenotype that is more primitive (e.g., is at an earlier step along a developmental pathway or progression than is a fully differentiated cell) relative to a cell which it can give rise to by differentiation. Often, progenitor cells also have significant or very high proliferative potential. Progenitor cells can give rise to multiple distinct differentiated cell types or to a single differentiated cell type, depending on the developmental pathway and on the environment in which the cells develop and differentiate.
[0087] The term stem cell as used herein, refers to an undifferentiated cell which is capable of proliferation and giving rise to more progenitor cells having the ability to generate a large number of mother cells that can in turn give rise to differentiated, or differentiable daughter cells. The daughter cells themselves can be induced to proliferate and produce progeny that subsequently differentiate into one or more mature cell types, while also retaining one or more cells with parental developmental potential. The term stem cell refers to a subset of progenitors that have the capacity or potential, under particular circumstances, to differentiate to a more specialized or differentiated phenotype, and which retains the capacity, under certain circumstances, to proliferate without substantially differentiating. In one embodiment, the term stem cell refers generally to a naturally occurring mother cell whose descendants (progeny) specialize, often in different directions, by differentiation, e.g., by acquiring completely individual characters, as occurs in progressive diversification of embryonic cells and tissues. Cellular differentiation is a process typically occurring through many cell divisions. A differentiated cell may derive from a multipotent cell which itself is derived from a multipotent cell, and so on. While each of these multipotent cells may be considered stem cells, the range of cell types each can give rise to may vary considerably. Some differentiated cells also have the capacity to give rise to cells of greater developmental potential. Such capacity may be natural or may be induced artificially upon treatment with various factors. In many biological instances, stem cells are also multipotent because they can produce progeny of more than one distinct cell type, but this is not required for stem-ness. Self-renewal is the other classical part of the stem cell definition, and it is essential as used in this document. In theory, self-renewal can occur by either of two major mechanisms. Stem cells may divide asymmetrically, with one daughter retaining the stem state and the other daughter expressing some distinct other specific function and phenotype. Alternatively, some of the stem cells in a population can divide symmetrically into two stems, thus maintaining some stem cells in the population as a whole, while other cells in the population give rise to differentiated progeny only.
[0088] The term embryonic stem cell is used to refer to the pluripotent stem cells of the inner cell mass of the embryonic blastocyst (see U.S. Pat. Nos. 5,843,780, 6,200,806, which are incorporated herein by reference). Such cells can similarly be obtained from the inner cell mass of blastocysts derived from somatic cell nuclear transfer (see, for example, U.S. Pat. Nos. 5,945,577, 5,994,619, 6,235,970, which are incorporated herein by reference). The distinguishing characteristics of an embryonic stem cell define an embryonic stem cell phenotype. Accordingly, a cell has the phenotype of an embryonic stem cell if it possesses one or more of the unique characteristics of an embryonic stem cell such that that cell can be distinguished from other cells. Exemplary distinguishing embryonic stem cell characteristics include, without limitation, gene expression profile, proliferative capacity, differentiation capacity, karyotype, responsiveness to particular culture conditions, and the like.
[0089] The term adult stem cell or ASC is used to refer to any multipotent stem cell derived from non-embryonic tissue, including fetal, juvenile, and adult tissue. Stem cells have been isolated from a wide variety of adult tissues including blood, bone marrow, brain, olfactory epithelium, skin, pancreas, skeletal muscle, and cardiac muscle. Each of these stem cells can be characterized based on gene expression, factor responsiveness, and morphology in culture. As indicated above, stem cells have been found resident in virtually every tissue. Accordingly, the technology described herein appreciates that stem cell populations can be isolated from virtually any animal tissue. As used herein, the term adult cell refers to a cell found throughout the body after embryonic development.
[0090] As used herein, the terms iPS cell and induced pluripotent stem cell are used interchangeably and refers to a pluripotent cell artificially derived (e.g., induced by complete or partial reversal) from a differentiated somatic cell (i.e. from a non-pluripotent cell). A pluripotent cell can differentiate to cells of all three developmental germ layers.
[0091] The term derived from used in the context of a cell derived from another cell means that a cell has stemmed from (e.g. changed from or was produced by) a cell which is a different cell type. In some instances, for example, a cell derived from an iPS cell refers to a cell which has differentiated from an iPS cell. Alternatively, a cell can be converted from one cell type to a different cell type by a process referred to as transdifferention or direct reprogramming. Alternatively, in the terms of iPS cells, a cell (e.g. an iPS cell) can be derived from a differentiated cell by a process referred to in the art as dedifferentiation or reprogramming.
[0092] The term pluripotent as used herein refers to a cell that can give rise to any type of cell in the body except germ line cells. The term pluripotency or a pluripotent state as used herein refers to a cell with the ability to differentiate into all three embryonic germ layers: endoderm (gut tissue), mesoderm (including blood, muscle, and vessels), and ectoderm (such as skin and nerve), and typically has the potential to divide in vitro for a long period of time, e.g., greater than one year or more than 30 passages. Pluripotency is also evidenced by the expression of embryonic stem (ES) cell markers, although the preferred test for pluripotency is the demonstration of the capacity to differentiate into cells of all three germ layers, as detected using, for example, a nude mouse teratoma formation assay. iPS cells are pluripotent cells. Pluripotent cells undergo further differentiation into multipotent cells that are committed to give rise to cells that have a particular function. For example, multipotent cardiovascular stem cells give rise to the cells of the heart, including cardiomyocytes, as well as other cells involved in the vasculature of the heart.
[0093] The term phenotype refers to one or a number of total biological characteristics that define the cell or organism under a particular set of environmental conditions and factors, regardless of the actual genotype.
[0094] The term lineages as used herein refers to a term to describe cells with a common ancestry, for example cells that are derived from the same cardiovascular stem cell or other stem cell, or cells with a common developmental fate. By way of an example only, when referring to a cell that is of endoderm origin or is endodermal linage, this means the cell was derived from an endodermal cell and can differentiate along the endodermal lineage restricted pathways, such as one or more developmental lineage pathways which give rise to definitive endoderm cells, which in turn can differentiate into liver cells, thymus, pancreas, lung and intestine.
[0095] In the context of cell ontogeny, the term differentiated, or differentiating is a relative term. A differentiated cell is a cell that has progressed further down the developmental pathway than the cell it is being compared with. Thus, stem cells can differentiate to lineage-restricted precursor cells (such as a mesodermal stem cell), which in turn can differentiate into other types of precursor cells further down the pathway (such as an atrial precursor), and then to an end-stage differentiated cell, such as atrial cardiomyocytes or smooth muscle cells, which play a characteristic role in a certain tissue type, and may or may not retain the capacity to proliferate further. The term differentiated cell refers to any primary cell that is not, in its native form, pluripotent as that term is defined herein. The term a differentiated cell also encompasses cells that are partially differentiated, such as multipotent cells, or cells that are stable non-pluripotent partially reprogrammed cells. In some embodiments, a differentiated cell is a cell that is a stable intermediate cell, such as a non-pluripotent partially reprogrammed cell. It should be noted that placing many primary cells in culture can lead to some loss of fully differentiated characteristics. However, simply culturing such primary cells, e.g., after removal or isolateion from a tissue or organism does not render these cells non-differentated cells (e.g. undifferentiated cells) or pluripotent cells. The transition of a differentiated cell (including stable non-pluripotent partially reprogrammed cell intermediates) to pluripotency requires a reprogramming stimulus beyond the stimuli that lead to partial loss of differentiated character in culture.
[0096] The term differentiation as referred to herein refers to the process whereby a cell moves further down the developmental pathway and begins expressing markers and phenotypic characteristics known to be associated with a cell that are more specialized and closer to becoming terminally differentiated cells. The pathway along which cells progress from a less committed cell to a cell that is increasingly committed to a particular cell type, and eventually to a terminally differentiated cell is referred to as progressive differentiation or progressive commitment. Cell which are more specialized (e.g., have begun to progress along a path of progressive differentiation) but not yet terminally differentiated are referred to as partially differentiated. Differentiation is a developmental process whereby cells assume a more specialized phenotype, e.g., acquire one or more characteristics or functions distinct from other cell types. In some cases, the differentiated phenotype refers to a cell phenotype that is at the mature endpoint in some developmental pathway (a so called terminally differentiated cell). In many, but not all tissues, the process of differentiation is coupled with exit from the cell cycle. In these cases, the terminally differentiated cells lose or greatly restrict their capacity to proliferate. However, in the context of this specification, the terms differentiation or differentiated refer to cells that are more specialized in their fate or function than at one time in their development. For example in the context of this application, a differentiated cell includes a cardiomyocyte which has differentiated from cardiovascular progenitor cell, where such cardiovascular progenitor cell can in some instances be derived from the differentiation of an ES cell, or alternatively from the differentiation of an induced pluripotent stem (iPS) cell, or in some embodiments from a human ES cell line. A cell that is differentiated relative to a progenitor cell has one or more phenotypic differences relative to that progenitor cell and characteristic of a more mature or specialized cell type. Phenotypic differences include, but are not limited to morphologic differences and differences in gene expression and biological activity, including not only the presence or absence of an expressed marker, but also differences in the amount of a marker and differences in the co-expression patterns of a set of markers.
[0097] The term contacting or contact as used herein in connection with contacting a cell with an agent as described herein, includes subjecting the cell to a culture medium which comprises that agent.
[0098] The term statistically significant or significantly refers to statistical significance and generally means a two standard deviation (2SD) or greater difference.
[0099] Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term about. The term about when used in connection with percentages can mean 1%.
[0100] As used herein the term comprising or comprises is used in reference to compositions, methods, and respective component(s) thereof, that are essential to the method or composition, yet open to the inclusion of unspecified elements, whether essential or not.
[0101] The term consisting of refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.
[0102] As used herein the term consisting essentially of refers to those elements required for a given embodiment. The term permits the presence of elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment.
[0103] The singular terms a, an, and the include plural referents unless context clearly indicates otherwise. Similarly, the word or is intended to include and unless the context clearly indicates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below. The abbreviation, e.g. is derived from the Latin exempli gratia, and is used herein to indicate a non-limiting example. Thus, the abbreviation e.g. is synonymous with the term for example.
[0104] Definitions of common terms in cell biology and molecular biology can be found in The Merck Manual of Diagnosis and Therapy, 19th Edition, published by Merck Research Laboratories, 2006 (ISBN 0-911910-19-0); Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); Benjamin Lewin, Genes X, published by Jones & Bartlett Publishing, 2009 (ISBN-10: 0763766321); Kendrew et al. (eds.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8) and Current Protocols in Protein Sciences 2009, Wiley Intersciences, Coligan et al., eds.
[0105] Unless otherwise stated, the present invention was performed using standard procedures, as described, for example in Sambrook et al., Molecular Cloning: A Laboratory Manual (4 ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2012); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (1995); or Methods in Enzymology: Guide to Molecular Cloning Techniques Vol.152, S. L. Berger and A. R. Kimmel Eds., Academic Press Inc., San Diego, USA (1987); Current Protocols in Protein Science (CPPS) (John E. Coligan, et. al., ed., John Wiley and Sons, Inc.), Current Protocols in Cell Biology (CPCB) (Juan S. Bonifacino et. al. ed., John Wiley and Sons, Inc.), and Culture of Animal Cells: A Manual of Basic Technique by R. Ian Freshney, Publisher: Wiley-Liss; 5th edition (2005), Animal Cell Culture Methods (Methods in Cell Biology, Vol. 57, Jennie P. Mather and David Barnes editors, Academic Press, 1st edition, 1998) which are all incorporated by reference herein in their entireties.
[0106] Other terms are defined herein within the description of the various aspects of the invention.
[0107] All patents and other publications; including literature references, issued patents, published patent applications, and co-pending patent applications; cited throughout this application are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the technology described herein. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.
[0108] The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize. For example, while method steps or functions are presented in a given order, alternative embodiments may perform functions in a different order, or functions may be performed substantially concurrently. The teachings of the disclosure provided herein can be applied to other procedures or methods as appropriate. The various embodiments described herein can be combined to provide further embodiments. Aspects of the disclosure can be modified, if necessary, to employ the compositions, functions and concepts of the above references and application to provide yet further embodiments of the disclosure. Moreover, due to biological functional equivalency considerations, some changes can be made in protein structure without affecting the biological or chemical action in kind or amount. These and other changes can be made to the disclosure in light of the detailed description. All such modifications are intended to be included within the scope of the appended claims.
[0109] Specific elements of any of the foregoing embodiments can be combined or substituted for elements in other embodiments. Furthermore, while advantages associated with certain embodiments of the disclosure have been described in the context of these embodiments, other embodiments may also exhibit such advantages, and not all embodiments need necessarily exhibit such advantages to fall within the scope of the disclosure.
[0110] The technology described herein is further illustrated by the following examples which in no way should be construed as being further limiting.
[0111] Some embodiments of the technology described herein can be defined according to any of the following numbered paragraphs: [0112] 1. A method of differentiating a stem cell, the method comprising: [0113] i) contacting the stem cell with one or more ectopic differentiation factors; and [0114] ii) inhibiting the cell cycle of the stem cell; [0115] wherein steps i) and ii) occur within 15 days of each other. [0116] 2. The method of paragraph 1, wherein steps i) and ii) occur within 14 days of each other. [0117] 3. The method of paragraph 1, wherein steps i) and ii) occur within 13 days of each other. [0118] 4. The method of paragraph 1, wherein steps i) and ii) occur within 12 days of each other. [0119] 5. The method of paragraph 1, wherein steps i) and ii) occur within 11 days of each other. [0120] 6. The method of paragraph 1, wherein steps i) and ii) occur within 10 days of each other. [0121] 7. The method of paragraph 1, wherein steps i) and ii) occur within 9 days of each other. [0122] 8. The method of paragraph 1, wherein steps i) and ii) occur within 8 days of each other. [0123] 9. The method of paragraph 1, wherein steps i) and ii) occur within 7 days of each other. [0124] 10. The method of paragraph 1, wherein steps i) and ii) occur within 6 days of each other. [0125] 11. The method of paragraph 1, wherein steps i) and ii) occur within 5 days of each other. [0126] 12. The method of paragraph 1, wherein steps i) and ii) occur within 4 days of each other. [0127] 13. The method of paragraph 1, wherein steps i) and ii) occur within 3 days of each other. [0128] 14. The method of paragraph 1, wherein steps i) and ii) occur within 2 days of each other. [0129] 15. The method of paragraph 1, wherein steps i) and ii) occur within 24 hours of each other. [0130] 16. The method of paragraph 1, wherein steps i) and ii) occur simultaneously. [0131] 17. The method of any of paragraphs 1-16, wherein the differentiation factor is a terminal transcription factor. [0132] 18. The method of paragraph 17, wherein the terminal transcription factor is selected from Table 1. [0133] 19. The method of any of paragraphs 17-18, wherein the stem cell is to be differentiated to a skeletal muscle phenotype and is contacted with the terminal transcription factor MyoD. [0134] 20. The method of any of paragraphs 17-18, wherein the stem cell is to be differentiated to a spinal motor neuron phenotype and is contacted with a terminal transcription factor selected from the group consisting of: Ngn2; Isl1; and Lhx3. [0135] 21. The method of any of paragraphs 17-18, wherein the stem cell is to be differentiated to a spinal motor neuron phenotype and is contacted with the terminal transcription factors Ngn2; Isl1; and Lhx3. [0136] 22. The method of any of paragraphs 17-18, wherein the stem cell is to be differentiated to a cardiomyocyte phenotype and is contacted with the terminal transcription factor Gata5. [0137] 23. The method of any of paragraphs 17-18, wherein the stem cell is to be differentiated to a hepatocyte or hepatoblast phenotype and is contacted with the terminal transcription factor Hnf4. [0138] 24. The method of any of paragraphs 1-23, wherein the cell cycle is inhibited by one or more of the following: [0139] reducing or removing growth factors; reducing serum levels; reducing serum levels below 5%; contacting the cell with a PI3K inhibitor; contacting the cell with an E2F family transcription factor inhibitor; contacting the cell with a Myc inhibitor; [0140] contacting the cell with a MAPK inhibitor; contacting the cell with a MEK1/2 inhibitor; contacting the cell with a CDK inhibitor; contacting the cell with an Id inhibitor; contacting the cell with a Rb agonist; contacting the cell with a Ink family agonist; contacting the cell with a Cip/Kip family agonist; and culturing the cell in a media lacking a factor selected from the group consisting of: [0141] LIF; Bmp; Fgf; Activin; or TGF. [0142] 25. The method of paragraph 24, wherein the cell cycle is inhibited by reducing or removing growth factors. [0143] 26. The method of paragraph 24, wherein the cell cycle is inhibited by culturing the cell in a media lacking a factor selected from the group consisting of: [0144] LIF; Bmp; Fgf; Activin; or TGF. [0145] 27. The method of paragraph 26, wherein the cell cycle is inhibited by culturing the cell in a media lacking LIF. [0146] 28. The method of paragraph 24, wherein the PI3K inhibitor is LY294002. [0147] 29. The method of paragraph 24, wherein the E2F transcription factor inhibitor is HLM006474. [0148] 30. The method of paragraph 24, wherein the Myc inhibitor is JQ1 or 10058-F4. [0149] 31. The method of paragraph 24, wherein the MAPK inhibitor is PD98059. [0150] 32. The method of paragraph 24, wherein the CDK inhibitor is a CDK4 or CDK2 inhibitor. [0151] 33. The method of paragraph 24, wherein the CDK inhibitor is p16, p15, p18, or p19. [0152] 34. The method of paragraph 24, wherein the CDK inhibitor is p21, p27, or p57. [0153] 35. The method of any of paragraphs 1-34, wherein the stem cell is an embryonic stem cell. [0154] 36. The method of any of paragraphs 1-35, wherein steps i) and ii) result in a population of cells comprising one or more terminally-differentiated cell types. [0155] 37. The method of any of paragraphs 1-35, wherein steps i) and ii) result in a population of cells comprising no more than 2 terminally-differentiated cell types. [0156] 38. The method of any of paragraphs 1-35, wherein steps i) and ii) result in a population of cells of which at least 50% are terminally-differentiated cells. [0157] 39. The method of any of paragraphs 1-35, wherein steps i) and ii) result in a population of cells of which at least 60% are terminally-differentiated cells. [0158] 40. The method of any of paragraphs 1-35, wherein steps i) and ii) result in a population of cells of which at least 70% are terminally-differentiated cells. [0159] 41. The method of any of paragraphs 1-35, wherein steps i) and ii) result in a population of cells of which at least 80% are terminally-differentiated cells.
EXAMPLES
Example 1: Molecular Ties Between the Cell Cycle and Differentiation in Embryonic Stem Cells
[0160] Attainment of the differentiated state during the final stages of somatic cell differentiation is closely tied to cell cycle progression. Much less is known about the role of the cell cycle at very early stages of embryonic development. It is demonstrated herein that molecular pathways involving the cell cycle can be engineered to strongly affect embryonic stem cell differentiation at early stages in vitro. Strategies based on perturbing these pathways can shorten the rate and simplify the lineage path of ES differentiation. These results make it likely that pathways involving cell proliferation intersect at various points with pathways that regulate cell lineages in embryos and demonstrate that this knowledge can be used profitably to guide the path and effectiveness of cell differentiation of pluripotent cells.
[0161] As cells differentiate during embryonic development, they progress through a stereotypical sequence of events, starting from highly potent embryonic precursors to germ layer intermediates, then to lineage-restricted progenitors, and finally, to terminally differentiated cell types. Any of these stages may consist of further states of differentiation and may be difficult to recognize. Most of our knowledge about the differentiation process comes from studies in the latter stages of differentiation (i.e. terminal model systems), where cells are one step away from their final fate and are usually restricted to differentiate to one type of cell. Less is known about what happens during early embryonic stages, where the differentiation process is just beginning and many alternative pathways of differentiation may still be available.
[0162] In terminal somatic cell culture models, inhibition of the cell cycle is almost always a requisite for differentiation. Forced inhibition of the cell cycle very often induces terminal differentiation and vice versa (1-3). The molecular pathways that couple the cell cycle to differentiation involve molecules of the G1/S transition including growth factors, downstream signaling pathways, Myc, the Rb/E2F pathway, and the CDK inhibitors (e.g. p21). The role of G1 length on embryonic stem cell self-renewal was investigated and it was found that in contrast to the terminal stages it did not accelerate the loss of pluripotency or facilitate differentiation (4). Described herein is the state of the cell cycle molecular network in the ES cell system and how the cell cycle may be re-coupled to differentiation to re-direct lineage pathways, e.g., for practical benefit.
Results
[0163] In terminally differentiated cells the cell cycle and differentiation are linked together through a molecular network rooted in the G1/S transition. A wiring diagram summarizing such a network is shown in
[0164] During the process of differentiation, the network changes. For cultured cells at the terminal stage of differentiation, this involves an exit from the cell cycle, activation of terminal transcription factors, and a shift towards insulin signaling away from other growth factors for survival and growth. These changes to the network are shown in
[0165] Guided differentiation and cell cycle manipulation of ES cells. To probe the effect of the cell cycle on differentiation an ES cell line was used that constitutively over-expressed the transcription factor MyoD driven off an EF1alpha promoter (5) activated by tamoxifen-induced Cre recombination. The use of this cell line facilitated the analysis by channeling differentiation away from a diverse collection of phenotypes into a more uniform population of cells expressing muscle genes, such as myosin heavy chain (MHC). The first cell cycle manipulation was growth factor or serum withdrawal. Using the cell line that continuously expressed MyoD, LIF was removed at what is referred to herein as zero time to initiate differentiation and serum was reduced at various times thereafter from the standard 15% serum to 2% with additional insulin (10 g/ml). As shown in
[0166] From the cell cycle summary in
[0167] The lineage from ES cells to terminal differentiation first involves the loss of pluripotency factors, followed by passage through intermediate cell types, identifiable by expression of specific transcription factors. It was found that the decline in Oct4 and Nanog mRNA levels induced by LIF removal was completely unaffected by serum reduction. This is similar to results showing that extension of G1 had no effect on Nanog levels (4).
[0168] By contrast, beyond the loss of pluripotency factors there is a dramatic effect of serum removal on the differentiation cascade toward muscle. From studies in embryos, there is a prescribed sequence of steps in setting up the myogenic lineage involving the specification of the mesoderm, the sub-specification of the myotome, and the steps leading to overt cell differentiation (6-7). When the mRNA levels of genes within this hierarchy were examined using the above protocol of serum reduction, it was found that Pax3, which is expressed in the dermomyotome, rose dramatically (to a peak of 50 fold) and very prematurely within 2 days of serum reduction. The pre-myogenic homeodomain factors Six1 (8) and Six4 (9), which are normally upstream of Pax3, are not affected or modestly suppressed, as was the case for the paired-box domain protein Pax7, which is expressed in the dermomyotome and somites during embryogenesis (10). There are small effects of serum reduction on the myogenic regulatory factor (MRF) genes, like Myf5, MRF4 and endogenous MyoD, but there is a massive (300 fold) upregulation of myogenin (MyoG), which plays a key role in very late-stage skeletal myogenesis during the period of days 3 to 7 (11). Other muscle lineage markers also respond rapidly to serum withdrawal in the presence of MyoD, indicating that the entire suite of terminal muscle lineage is induced very prematurely. Seven of thesedesmin, skeletal muscle actin, troponin, myosin light chain, tropomyosin, the myoblast fusion regulator Dyrk1b (12), and titinare shown in
[0169] Promoting Differentiation by Perturbing Intracellular Pathways. Based on suggestions from the pathway diagrams in
[0170] The effects of inhibiting cyclin-dependent kinases (kinases that are more centrally involved in cell cycle control) and MAP kinase, which very often is involved in cell cycle regulation, were also examined. Roscovitine is a broad CDK inhibitor that blocks a number of family members, including CDK1, CDK2, and CDKS. After continuous treatment throughout the 7 days of differentiation in the time course, roscovitine had no effect on Pax3 expression (
[0171] Induction of Unguided Differentiation. Although forced expression of MyoD nicely served to focus differentiation into the skeletal muscle cell lineage, it was also desired to examine what happens in ES cells that are not guided in their differentiation path by MyoD. When LIF is removed in ES cells without MyoD, there is differentiation into a heterogeneous mixture of cell types. Under standard culture conditions of 15% serum, which promotes expansion, ES cells deprived of LIF normally differentiate first into general mesodermal, endodermal, and ectodermal tissues, and then later into a heterogeneous mixture of terminal cell types (7, 14). The effects of serum withdrawal on this system were examined. When high and low serum time courses in ES cells differentiating without exogenous MyoD were compared over a period of 7 days there was premature expression of genes that are normally associated with multiple cell lineages (
[0172] The early upregulation of such a large number of somatic lineage factors indicates that growth factor/serum reduction is permissive for a wide variety of differentiated gene expression. Many of the upregulated factors have been reported to function in terminal differentiation. Perhaps most interesting is the failure to express many of the markers of the early lineages. As seen in the MyoD-guided system, only Pax3 and MyoG were significantly activated, but not other factors in the muscle lineage hierarchy. In the unguided system, in addition to the terminal factors that were upregulated, there were numerous intermediate lineage factors that were not (e.g. Pax6, C/EBP, C/EBP, Pdx1, Cdx2, etc.)(
Discussion
[0173] Our understanding of cell differentiation comes mainly from two different sources: studies of cell culture systems and studies of embryonic systems. Although the embryo remains the gold standard for the functional process of embryogenesis, there is today a strong incentive to understand alternative in vitro pathways that can be exploited for therapeutic purposes. Furthermore there is no reason why we should consider embryonic lineages as mechanistically the most informative. Embryos have to accomplish feats other than differentiation, such as morphogenesis and cell proliferation, and many intermediate behaviors of cells may reflect those roles.
[0174] Much ingenuity and decades of effort has resulted in the discovery of ways to manipulate cells isolated and cultured from various tissues so that they can differentiate into one or a very few cell types. It is now recognized that these processes take cells from an already determined state and drive them to a state of clear expression of specific markers, rather than starting from a very early precursor state. Such manipulations can drive presumptive myoblasts to muscle, neuroblasts to neurons, fibroblasts to adipocytes, etc. A very different source of cells are pluripotent ES cells of the mouse and now of human. These cells start at an earlier state and can be driven to differentiate either by re-creating some early embryonic state through embryoid bodies or by going through a series of steps in culture, thought to parallel the various intermediate states of differentiation found in the embryo itself. As work in stem cells and ES cells in particular exploded in the last few years there has been a serious effort to identify and recreate in culture the series of signals that drive the pluripotent state to the differentiated state. In the embryo, these include the addition and removal of factors like Wnts, Nodals, BMPs, EGFs, etc. There is both a practical side to this endeavor: to either generate differentiated cells that can generate replacement tissues and organs or to find ways to stimulate the body's regenerative potential to repair worn or diseased cells.
[0175] There has also been a long standing interest in understanding how the cell cycle could further the process of differentiation. Inhibition of cell proliferation in G1 is almost always accompanied by cell differentiation. The work described herein was designed to determine whether this effect of cell cycle inhibition can be observed early in the differentiation process and whether the paths taken are the same as seen in the absence of cell cycle inhibition.
[0176] Described herein are cell cycle perturbations, starting with a reduction or removal of growth factors/serum, change the timing and the course of differentiation to muscle in a model that involves the continuous expression of MyoD. Notably none of the perturbations had an effect on exit from the ES cell state as reflected in the loss of Oct4 and Nanog. Surprisingly, this progression to the differentiated state seemed not to seem to follow the normal sequence of gene expressions seen in ES cells in culture or by embryonic lineages in the embryo. More than one path to differentiation was found, as described herien.
[0177] Described herein are heuristic descriptions of somatic cycling cells, terminally differentiating cells, and embryonic stem cells (
[0178] The results described herein indicate that in the MyoD-guided system there are minimally 3 states and two transitions (
[0179] Though this scheme is likely to be a simplification for any lineage and may differ in different lineages, it nevertheless helped to make sense of a number of observations. The removal of extracellular factors in the form of LIF and Bmp4, and the replacement of serum with insulin leads to activation of MyoD and full induction of terminal myogenesis. When applied early, this leads to a very direct form of ES-to-terminal differentiation, and Pax3 and MyoG upregulation is observed. PI3K inhibition is predicted to activate MyoD by removing the stimulus to Myc, but is also expected to be inhibitory on the last steps of terminal differentiation as it becomes necessary for metabolic cell growth of the final differentiated cell. Accordingly, LY294002 upregulated Pax3 but promoted poor survival, which could have suppressed MyoG expression. This suggests that the step of MyoG upregulation corresponds to what happens in the terminal phase in this model, which is consistent with what is known about myogenin's role from terminal models. From the heuristic description, it is also expected that Myc or E2F suppression would help activate MyoD. JQ1 and HLM006474 both induced Pax3, which is consistent with this prediction. However, it was also noticed that they suppressed MyoG expression.
[0180] The cell cycle schemes also correctly predict that some CDK inhibitors and the MAPK inhibitor would have little effect on Pax3 expression by themselves, but would facilitate MyoG expression. This is due to the fact that in ES cells Myc and Id proteins are highly expressed and can independently repress the expression of endogenous MyoD and other myogenic regulatory factors outside of CDK activity (
[0181] It is described herein that the CDK inhibitors and the MAPK inhibitor promote differentiation only under low serum conditions, as high levels of growth factor/serum conditions are expected to induce higher levels of Myc and Id expression. It is further described herein that different CDK inhibitors can have different effects. The p21 protein is highly effective at promoting MyoG expression, but not roscovitine or PD0332991. Without wishing to be bound by theory, this may have to do with the differing specificities of the kinase inhibitors used.
[0182] It is specifically contemplated herein that the methods described herein can permit the differentiation of other cell types, e.g., with other terminal factors in place of MyoD. Indeed, many terminal cell systems couple cell cycle inhibition with differentiation (1), and many potent transcription factors interact with cell cycle components in ways similar to MyoD, including Ngn2, Pdx1, Smad3, Mitf, Runx2, PU.1, Hnf4, and C/EBP (17-24). Expression of several genes associated with diverse differentiated cell types could be stimulated by cell cycle inhibition in a heterogeneous differentiation system where MyoD was not expressed (
[0183] The forced silencing of proliferative pathways and the resulting rapid differentiation in vitro described herein is a useful strategy to generate terminal cell types as compared to trying to recapitulate embryonic differentiation pathways, which often takes weeks (
Materials and Methods
[0184] ES culture and differentiation. The ES cells contain MyoD (and associated puromycin resistance marker) expressed from a EF1alpha promoter (5). MyoD could be expressed once a loxP segment inserted between the promoter and transgene was excised by a cre recombinase fused to the estrogen receptor. ES cells were cultured in LIF and standard conditions containing 15% FBS, non-essential amino acids, L-glutamine, penicillin/streptomycin, and beta-mercaptoethanol. To induce MyoD, cells were treated for 24 hrs with 1 M 4OHT (Sigma) in ES media. Reduced serum media consisted of DMEM and 2% horse serum (Invitrogen) plus 10 g/ml insulin (to maintain cell survival)(Sigma) with sodium pyruvate and penicillin/streptomycin. During differentiation, cells were treated with 1 g/ml puromycin continuously to select for cells which maintained MyoD expression. N2B27 components/supplements and Knock-out serum replacement were purchased from Invitrogen. LIF was used at a 1000 U/ml and Bmp4 at 10 ng/ml.
[0185] Drugs. The PI3K inhibitor LY294002, Roscovitine, the MEK1/2 inhibitor PD98059, and 10058-F4 were purchased from Sigma. The E2F inhibitor HLM006474 was purchased from Millipore. PD0332991 was purchased from SelleckChem. JQ1 was purchased from ApexBio.
[0186] Immunostaining Myosin heavy chain expression was detected with use of the MF20 antibody (R&D systems). Cells were fixed in 4% PFA, permeabilized in 0.1% Triton-X, and co-stained with antibody and DAPI (Sigma).
[0187] RNA isolation and RT-PCR. RNA was isolated using RNAeasy plus kit (Qiagen). Reverse transcription was performed using iScript cDNA synthesis (Bio-rad). Real-time quantitative PCR was done on a CFX96 PCR machine using SYBR green supermix (Bio-rad). A complete list of primers used is provided in the Supplementary Methods.
[0188] Microarray analysis. RNA time-course samples were hybridized to Illumina Ref8 BeadChip arrays. Data analysis was performed with GenomeStudio software and the help of the BCH IDDRC Molecular Genetics Core.
[0189] Cloning. The mouse p21 open reading frame was cloned into the pmCherry-N1 plasmid (Clontech) with a self-cleaving P2A peptide and mCherry fused to its C-terminus. The plasmid was transfected into the MyoD-inducible ES cell line and selected by G418. The final line was derived from the picking of a single cell clone colony.
REFERENCES
[0190] 1. Muoz-Alonso M, and Len J (2003) G1 phase control and cell differentiation. In G1 Phase Progression, ed Boonstra J (Landes Bioscience, Georgetown, Tex.), pp. 236-264.
[0191] 2. Budirahardja Y, and Gnczy P (2009) Coupling the cell cycle to development. Development 136:2861-2872.
[0192] 3. Hindley C, and Philpott A (2012) Co-ordination of cell cycle and differentiation in the developing nervous system. J. Biochem. 444:375-82.
[0193] 4. Li V C, Ballabeni A, and Kirschner M W (2012) Gap 1 phase length and mouse embryonic stem cell self-renewal. P.N.A.S. 109:12550-12555.
[0194] 5. Thoma E C, Maurus K, Wagner T U, and Schartl M (2012) Parallel differentiation of embryonic stem cells into different cell types by a single gene-based differentiation system. Cellular Reprogramming 14:106-111.
[0195] 6. Bentzinger C F, Wang Y X, and Rudnicki M A (2012) Building muscle: molecular regulation of myogenesis. Cold Spring Harb Perspect Biol. 4:pii:a008342.
[0196] 7. Keller G (2005) Embryonic stem cell differentiation: emergence of a new era in biology and medicine. Genes Dev. 19:1129-55.
[0197] 8. Gianakopoulos P J, et al. (2011) MyoD directly up-regulates premyogenic mesoderm factors during induction of skeletal myogenesis in stem cells. J. Biol. Chem. 286:2517-25.
[0198] 9. Niro C, et al. (2010) Six1 and Six4 gene expression is necessary to activate the fast-type muscle gene program in the mouse primary myotome. Dev. Biol. 338:168-82.
[0199] 10. Galli L M, et al. (2008) Identification and characterization of subpopulations of Pax3 and Pax7 expressing cells in developing chick somites and limb buds. Dev. Dyn. 237:182-74.
[0200] 11. Venuti J M, et al. (1995) Myogenin is required for late but not early aspects of myogenesis during mouse development. J. Cell Biol. 128:563-76.
[0201] 12. Deng X, et al. (2003) Mirk/dyrk1B is a Rho-induced kinase active in skeletal muscle differentiation. J. Biol. Chem. 278:41347-54.
[0202] 13. White J, et al. (2005) Developmental Activation of the Rb-E2F Pahtway and Establishment of Cell Cycle-regulated Cyclin-dependent kinase Activity during Embryonic Stem Cell Differentiation. Mol. Biol. Cell. 16:2018-27.
[0203] 14. Odorico J S, Kaufman D S, and Thomson J A (2001) Multilineage differentiation from human embryonic stem cell lines. Stem cells 19:193-204.
[0204] 15. Hall B K (1981) The induction of neural crest-derived cartilage and bone by embryonic epithelia: an analysis of the mode of action of an epithelial-mesenchymal interaction. J. Embryol. Exp. Morphol. 64:305-20.
[0205] 16. Ordahl C P, and Le Douarin N M (1992) Two myogenic lineages within the developing somite. Development 114:339-53.
[0206] 17. Ali F, et al. (2011) Cell cycle-regulated multi-site phosphorylation of Neurogenin 2 coordinates cell cycling with differentiation during neurogenesis. Development 138:4267-77.
[0207] 18. Kim Y C, et al. (2011) RB regulates pancreas development by stabilizing Pdx1. EMBO J. 30:1563-76.
[0208] 19. Matsuura I, et al. (2004) Cyclin-depedent kinases regulate the antiproliferative function of Smads. Nature 430:226-31.
[0209] 20. Carreira S, et al. (2005) Mitf cooperates with Rb1 and activates p21Cip1 expression to regulate cell cycle progression. Nature 433:764-9.
[0210] 21. Thomas D M, et al. (2001) The retinoblastoma protein acts as a transcriptional coactivator required for osteogenic differentiation. Mol. Cell 8, 303-316
[0211] 22. Rekhtman N, et al. (2003) Pu.1 and pRB interact and cooperate to repress GATA-1 and block erythroid differentiation. Mol. Cell Biol. 23:7460-74,
[0212] 23. Hanse E A, et al. (2012) Cyclin D1 inhibits hepatic lipogenesis via repression of carbohydrate response element binding protein and hepatocyte nuclear factor 4. Cell Cycle 11:2681-90.
[0213] 24. Chen P L, Riley D J, Chen Y, and Lee W H (1996) Retinoblastoma protein positively regulates terminal adipocyte differentiation through direct interaction with C/EBPs. Genes Dev. 10:2794-804.
[0214] 25. Singh A M, and Dalton S (2009) The cell cycle and Myc intersect with mechanisms that regulate pluripotency and reprogramming. Cell Stem Cell 5:141-9.
[0215] 26. Mallanna S K and Duncan S A (2013) Differentiation of Hepatocytes from Pluripotent Stem Cells. Current Protocols in Stem Cell Biology. 26:1G.4.1-1G.4.13.
[0216] 27. Lian X, et al. (2013) Directed cardiomyocyte differentiation from human pluripotent stem cells by modulating Wnt/-catenin signaling under fully defined conditions. Nat. Protoc. 8:162-75.
[0217] 28. Oldershaw R A, et al. (2010) Directed differentiation of human embryonic stem cells toward chondrocytes. Nat. Biotechnol. 28:1187-94.
[0218] 29. Lu S J, Feng Q, Park J S, Lanza R (2010) Direction differentiation of red blood cells from human embryonic stem cells. Methods Mol. Biol. 636:105-21.
[0219] 30. Hosoya M, Kunisada Y, Kurisaki A, Asashima M (2012) Induction of differentiation of undifferentiated cells into pancreatic beta cells in vertebrates. Int. J. Dev. Biol. 56:313-23.
[0220] 31. Albini S, et al. (2013) Epigenetic reprogramming of human embryonic stem cells into skeletal muscle cells and generation of contractile myospheres. Cell Rep. 3:661-670.
References Relevant to Schematics Presented in FIGS. 1A-1C And 7A-7C
[0221] Leone G, et al. (2001) Myc requires distinct E2F activities to induce S phase and apoptosis. Mol. Cell. 8:105-113).
[0222] Lasorella, A., Noseda, M., Beyna, M., Yokota, Y. & Iavarone, A. Id2 is a retinoblastoma protein target and mediates signalling by Myc oncoproteins. Nature 407, 592-598 (2000)
[0223] La Rocca S A, Crouch D H, Gillespie D (1994) c-Myc inhibits myogenic differentiation and myoD expression by a mechanism which can be dissociated from cell transformation. Oncogene 9:3499-508.
[0224] Philipp A, et al. (1994) Repression of cyclin D1: a novel function of Myc? Mol. Cell Biol. 14:4032-4043.
[0225] Watanabe G, et al. (1998) Inhibition of cyclin D1 kinase activity is associated with E2F-mediated inhibition of cyclin D1 promoter activity through E2F and Sp1. Mol. Cell Biol. 18:3212-3222
[0226] Jirmanova L, et al. (2002) Differential contributions of ERK and PI3-kinase to the regulation of cyclin D1 expression and to the control of the G1/S transition in mouse embryonic stem cells. Oncogene 21:5515-5528.
[0227] Oswald F, et al. (1994) E2F-dependent regulation of human Myc: transactivation by Cyclin D1 and Cyclin A overrides tumour suppressor protein functions. Oncogene 9:2029-2036.
[0228] Tintignac L A et al. (2000) Cyclin E-cdk2 phosphorylation promotes late G1-phase degradation of MyoD in muscle cells. Experimental Cell Research 259:300-307
[0229] Lassar A B, Skapek S X, and Novitch B (1994) Regulatory mechanisms that coordinate skeletal muscle differentiation and cell cycle withdrawal. Curr. Opin. Cell Biol. 6:788-794.
[0230] Kitzmann M, and Fernandez A (2001) Crosstalk between cell cycle regulators and the myogenic factor MyoD in skeletal myoblasts. Cell. Mol. Life Sci. 58:571-579.
[0231] Cartwright P, et al. (2005) LIF/STAT3 controls ES-cell self-renewal and pluripotency by a Myc-dependent mechanism. Development 132:885-96.
[0232] Paling N R D, Wheadon H, Bone H K and Welham M J. (2005) Regulation of embryonic stem cell self-renewal by phosphoinositide 3-kinase dependent signalling. J. Biol. Chem. 279:48063-48070.
[0233] Ying Q L, Nichols J, Chambers I, Smith A (2003) BMP induction of Id proteins suppresses differentiation and sustains embryonic stem cell self-renewal in collaboration with STAT3. Cell 115:281-292.
[0234] Sakamuro D and Prendergast G C (1999) New Myc-interacting proteins: a second Myc network emerges. Oncogene 18:2942-2954.
TABLE-US-00002 TABLE2 qRT-PCRPrimerlist.Primersarelabelled (Genename_)(ForR)dependingonforwardor reverse SEQID Primer PrimerSequence NO GAPDH_F GTGTTCCTACCCCCAATGTGT 01 GAPDH_R GTTGAAGTCGCAGGAGACAAC 02 NeuroD1_F ACAGACGCTCTGCAAAGGTTT 03 NeuroD1_R GGACTGGTAGGAGTAGGGATG 04 Pax6_F TACCAGTGTCTACCAGCCAAT 05 Pax6_R TGCACGAGTATGAGGAGGTCT 06 Dll1_F GCAGGACCTTCTTTCGCGTAT 07 Dll1_R AAGGGGAATCGGATGGGGTT 08 Pparg_F TTTTCCGAAGAACCATCCGATT 09 Pparg_R ATGGCATTGTGAGACATCCCC 010 Nkx2.2_F AAGCATTTCAAAACCGACGGA 011 Nkx2.2_R CCTCAAATCCACAGATGACCAGA 012 Ngn3_F CCAAGAGCGAGTTGGCACT 013 Ngn3_R CGGGCCATAGAAGCTGTGG 014 CEBPa_F GATAAGAACAGCAACGAGTACCG 015 CEBPa_R GTCACTGGTCAACTCCAACACC 016 CEBPb_F CATCGACTTCAGCCCCTACC 017 CEBPb_R GGCTCACGTAACCGTAGTCG 018 MeF2c_F TCTCCGCGTTCTTATCCCAC 019 MeF2c_R AGGAGTTGCTACGGAAACCAC 020 Pdx1_F CCCCAGTTTACAAGCTCGCT 021 Pdx1_R CTCGGTTCCATTCGGGAAAGG 022 Nestin_F CCCTGAAGTCGAGGAGCTG 023 Nestin_R CTGCTGCACCTCTAAGCGA 024 Sox6_F TCAACCTGCCAAACAAAAGC 025 Sox6_R GCTGGATCTGTTCTCGCATC 026 Smyd1_F TCCGAGGGTTTGTATCACGAG 027 Smyd1_R CCTCCTGGCATAATGTGAGGC 028 Runx2_F CCAAGGAACAAACCGTCAAA 029 Runx2_R AAGCGGGTCTGCAGAGTGTA 030 EBF_F AGATTCCAGGTCGTGGTGTCTA 031 EBF_R ACAGGGAGTAGCATGTTCCAGA 032 Tal1_F GGTCCTCACACCAAAGTAGTGC 033 Tal1_R CGGAGGATCTCATTCTTGCTTA 034 Gata4_F ATAATCTCCTTCACCCCAGCTC 035 Gata4_R GGGCAGGGCTTCTATGTCTAGT 036 Mrg1_F ATTTGTTGGCTGCATGATCTTT 037 Mrg1_R CGGTATGACTTTTCCTGATCCA 038 Mitf_F AGGCAGAAAAAGGACAATCACA 039 Mitf_R CTTCCGGATGTAGTCCACAGAG 040 Gata2_F AAGCGAAAACCAAACTGCATAA 041 Gata2_R CCAAGAACCACTCAAAGGACTG 042 Gata3_F TCCCATTTGTGAATAAGCCATT 043 Gata3_R TCCTTCATGCCTTTCTTACAGC 044 Runx1_F CTCCCAATAGCCCTTCTCACTT 045 Runx1_R AGCAAGAGAATGGCTGACTCAC 046 PU1_F ACAGATGCACGTCCTCGATACT 047 PU1_R CTTCTCCATCAGACACCTCCAG 048 Sox9_F TCTCCCCCTTTTCTTTGTTGTT 049 Sox9_R ACGCACACATCCACATACAGTC 050 Lbh_F CTTGCTTCCACTCTGCTCTGTT 051 Lbh_R ACGGCAAGACCAAGACAGATAA 052 Gata1_F CAGAATAGCCTTGACCTTGTGG 053 Gata1_R AGGAAAATGTCAGGCATAGCAA 054 Ikaros_F GTTTGTTGCCCAGTAAGACGAG 055 Ikaros_R GCTTTGGCTTCCAAGAAGTTTT 056 Gata6_F CCAAATCATGTGCTTCTTGTGA 057 Gata6_R TATTCTTGTTGAGACCCCAGGA 058 Oct4_F ATGGCATACTGTGGACCTC 059 Oct4_R AGCAGCTTGGCAAACTGTTC 060 Nanog_F CAGCAGATGCAAGAACTCTCC 061 Nanog_R GGATACTCCACTGGTGCTGAG 062 Brachyury_F CTCTAATGTCCTCCCTTGTTGCC 063 Brachyury_R TGCAGATTGTCTTTGGCTACTT 064 Sox17_F ACAACGCAGAGCTAAGCAAGAT 065 Sox17_R GTACTTGTAGTTGGGGTGGTCCT 066 Cdx2_F AAAAGACAAATACCGGGTGGTG 067 Cdx2_R TGATTTTCCTCTCCTTGGCTCT 068 Pax3_F CATCCGACCTGGTGCCATC 069 Pax3_R ATTTCCCAGCTAAACATGCCC 070 Pax7_F TGGGGTCTTCATCAACGGTC 071 Pax7_R ATCGGCACAGAATCTTGGAGA 072 Myf5_F CACCACCAACCCTAACCAGAG 073 Myf5_R AGGCTGTAATAGTTCTCCACCTG 074 MyoG_F GCAGGCTCAAGAAAGTGAATGA 075 MyoG_R TAGGCGCTCAATGTACTGGAT 076 MRF4_F AGAGGGCTCTCCTTTGTATCC 077 MRF4_R CTGCTTTCCGACGATCTGTGG 078 MyoD1endo_F CTGCAGCAGCAGAGGGCGCACCA 079 MyoD1endo_R GAAGAACGGCTTCGAAAGGACAGTTGG 080 Six1_F GAAAGGGAGAACACCGAAAACA 081 Six1_R GTGGCCCATATTGCTCTGGA 082 Six4_F ACCCCAGTACCGAGGATGAAT 083 Six4_R AACTCCAGACGAGCTTAGTGA 084
[0235] Table 3: List of factors affected by cell cycle inhibition during unguided differentiation and the cell type lineages in which they play a role. Lineages refer to differentiation systems in which the factors have been reported to be involved. The effect of low serum compared to high serum is listed as increased, decreased, or same/similar. Over the seven day time course, when the effect of low serum occurs is referred to as the stage. If the effect occurs within Days 1-3, the stage is referred to as early, or else mid (Days 3-4), or late (Days 5-7).
TABLE-US-00003 Increase Gene Lineage orDecrease Stage NeuroD1 Neural Increase Early Dll1 Neural Increase Mid Pax6 Neural Increase Mid Nestin Neural Decrease Mid/Late Sox6 Cardiac Increase Late Smyd1 Cardiac Increase Late Mef2c Cardiac Increase Late Gata4 Cardiac Increase Mid/Late Gata6 Cardiac Increase Mid/Late C/EBP Adipocyte Same N/A PPAR Adipocyte Increase Late CEBP Adipocyte Increase Late Sox17 Pancreatic Increase Late Nkx2.2 Pancreatic Increase Late Pdx1 Pancreatic Same N/A Ngn3 Pancreatic Decrease Mid/Late Runx2 Osteoblast Increase Late Cdx2 Placental Same N/A Cited2 Multiple Increase Late Mitf Melanocyte Increase Late Sox9 Chondrocyte Increase Mid/Late Lbh Chondrocyte Same N/A Runx1 Blood Increase Late Pu1 Blood Decrease Early Gata2 Blood Increase Mid/Late Gata3 Blood Increase Late Tal1 Blood Decrease Late EBF Blood Altered N/A Gata1 Blood Increase Earlytolate Ikaros Blood Similar N/A
Example 2: The Generality of Direct Embryonic Stem Cell Programming
[0236] Described above herein is a principle for the direct programming of cell fates. Further described herein is a demonstration that this programming principle can be extended from skeletal muscle to spinal motor neurons, cardiomyocytes, and hepatoblast-like cells. The broad applicability of this principle to these cell types indicates a common differentiation structure is shared across multiple lineages, and indicates that cell cycle-associated processes serve a fundamental role in regulating the rate and path of embryonic differentiation.
[0237] The induction of cell fates during embryogenesis is orchestrated through the action of developmental signals, such as growth factors (1). Proper exposure to these signals leads to the normal patterning and growth of the embryo. It is described herein that the major point of this signaling, with respect to differentiation, is to align two properties within the cell: 1. its transcriptional state, which determines the lineage and cell type to be specified, and 2. its appropriate cell cycle state, which determines the rate of differentiation (2). Given the alignment of these two properties, it can be possible to induce cells to turn into any fate, even through transformations that do not occur naturally. This decomposition of the normal differentiation process helps us understand the critical elements required for cell fate changes and the roles they play, which cannot be understood by only studying normal embryonic differentiation. Moreover, it could improve our ability to alter cell fates for regenerative medicine
[0238] Described herein are methods relating to the combination of the appropriate transcriptional state with the appropriate cell cycle state to determine a specific cell fate. Neither of these two components is sufficient alone. However, when combined together, these two conditions lead to a rapid and direct conversion. This was first demonstrated in experiments where mouse embryonic stem (ES) cells are rapidly and effectively converted into skeletal muscle. Normally, a standard strategy of differentiating ES cells into skeletal muscle would require sequential treatment of growth factors to recapitulate intermediate embryonic progenitor stages, such as mesoderm (3). This need to reconstitute a series of intermediate stages can be avoided by engineering the ES cell to overexpress MyoD (the transcriptional component, which by itself does not trigger muscle differentiation) and simultaneously using methods of inhibiting the cell cycle (such as growth factor withdrawal)(2). Out of the usual myogenic regulatory hierarchy, which includes Six1, Six4, Pax3, Pax7, MyoG, Myf5, and Mrf4, only Pax3 and MyoG appear to be significantly upregulated in addition to the exogenous MyoD.
[0239] Setting the transcriptional state can be achieved by overexpressing an appropriate transcription factor. Setting the cell cycle state can be achieved by manipulating cell cycle pathways. The pathways that normally connect extracellular growth factors to the intracellular G1/S machinery and their nuclear effectors (e.g. Myc, Rb) are highly involved (summarized in network models in ref. 2). Withdrawing growth factors delivers a strong inhibitory signal, whereas inhibiting downstream pathways has effects that are differentiation stage-specific. The skeletal muscle system has been a model for cell differentiation, and initial studies were performed on this system.
[0240] Described herein is the demonstration that other lineages share a similar capacity to be directly programmed. MyoD was replaced with transcription factors for three additional cell types. The results indicate a much greater generality of the process of direct programming.
RESULTS
Spinal Motor Neurons
[0241] To generate spinal motor neurons, a mouse ES cell line that overexpressed a combination of three transcription factor lineage specifiers (Ngn2, Isl1, Lhx3) was used. This combination was previously shown to specify spinal motor neuron identity (4). These iNIL cells, as they are also called, upon doxycycline stimulation express the three transcription factors from a single open reading frame coupled by 2A peptides. Growth factor withdrawal was used as the method of cell cycle manipulation in the experiments described in this Example.
[0242] As expected from the results on skeletal muscle myotubes, neurons rapidly formed from ES cells upon switching to different types of growth factor-free media. Four days after removing LIF and adding doxycycline (Day 0), ES cells that had been differentiated in growth factor-free (N2B27 or 20% Knockout Serum Replacement/KOSR) or growth factor-reduced media (2% horse serum/HS with insulin) expressed much higher levels of the terminal neuron differentiation marker beta-3 tubulin (Tubb3) than in high growth factor media (15% FBS), and displayed morphological characteristics of neurons, which was not seen in high serum (
[0243] To see which genes are induced during this rapid differentiation process, the mRNA expression of neural lineage genes was profiled across the time course of differentiation (first 5 days). As before, LIF was removed, the media changed to N2B27, and doxycycline added at Day 0. Many neural genes were upregulated in the growth factor-free N2B27 media (
Cardiomyocytes
[0244] Similar experiments were performed on an ES cell line that overexpressed the transcription factor Gata5. The Gata4/5/6 family of transcription factors have been shown to specify cardiomyocytes previously (5). The earliest terminal marker expression for cardiomyocytes in growth factor media could be detected by day 3 after LIF removal and dox addition. Similar to neurons, ES cells differentiated in growth factor-free or growth factor-reduced media displayed higher levels of genes involved with cardiomyocyte terminal differentiation, such as cardiac troponin (Tnnt2) by day 4, compared with high serum (
[0245] Several cardiac lineage genes in N2B27 media were upregulated (
Hepatoblast-Like Cells
[0246] One essential lineage specifying factor for hepatocytes is hepatic nuclear factor 4 (Hnf4)(6). Switching of Hnf4a-overexpressing ES cells to growth factor-free or growth factor-reduced media led to the activation of a subset of hepatic genes. At day 0, LIF and doxycycline were removed and the media was either switched or kept to 15% FBS. By day 4, there were high levels of alphafetoprotein (AFP) that could be detected in the cells differentiated in the growth factor-free or growth factor-reduced media and less than 10% the level of AFP in cells in 15% FBS (
Discussion
[0247] The results presented herein from from skeletal muscle, spinal motor neurons, cardiomyocytes, and hepatocytes show that the effects of perturbing the cell cycle after establishing the proper transcriptional state occurs in more than one cell lineage. For spinal motor neurons and cardiomyocytes, the differentiation appeared to be more complete, including both histological and molecular features. The hepatocytes were less complete, and resembled hepatoblast-like cells. However, in each case direct programming induced characteristic genes in each lineage.
[0248] The ability to directly program cell types suggests an underlying logic of how cell types are normally specified. In normal embryonic development, and in stem cell protocols that seek to mimic this process, proliferation and differentiation are usually simultaneously specified by growth factors. Sequential changes to the composition and concentration of these growth factors specify cell type identity and maintain an expanding embryo. These changes generate numerous intermediate cell types, until cell cycle exit drives cells into terminal differentiation. In contrast, removing growth factors at an early stage can shortcut cells into adopting late, terminal fates. In this sense, proliferative signals may serve as a general rate-limiting step in everyday differentiation. For practical applications, the direct programming process described herein provides an alternative to current strategies of embryonic stem cell differentiation, which seek to mimic the natural differentiation pathways.
Materials and Methods
[0249] ESC culture and cell lines. ESCs were cultured in standard media (DMEM with LIF+15% fetal bovine serum) on 0.1% gelatin-coated dishes. The Tet-Off Hnf4 line was cultured with 0.2 g/ml doxycycline.
[0250] ESC differentiation. Twenty-four hours before starting, ESCs are trypsinized and spread out as monolayer onto gelatin in standard ES media. At day 0 (ESCs), the media was switched from standard ES media to either N2B27 media (Invitrogen), 20% Knockout Serum Replacement (KOSR)(Invitrogen), 2% horse serum (HS)(Invitrogen)+10 g/ml insulin, or just 15% FBS without LIF. Doxycycline was also added at day 0 (3 g/ml) to induce expression or removed entirely for the Hnf4 line. Media was refreshed daily.
[0251] For the neurons, the ES cells were seeded onto plates pre-coated with a mix of poly-d-lysine (100 g/ml) and laminin (50 g/ml) instead of gelatin for adherence. 1000 U/ml of LIF or 10 ng/ml Bmp4 was added when needed. Dexamethasone (Sigma) was used at 0.1 M.
[0252] RNA isolation and qPCR. RNA was isolated using Qiagen Rnaeasy Plus Kit. Purified RNA was then reverse transcribed using Bio-rad's iSCRIPT cDNA synthesis kit. Quantitative PCR was performed using Bio-rad's SYBR green Supermix.
[0253] Immunostaining Antibodies for Tubb3 and AFP were provided respectively by Cell Signaling (D71G9), Sino Biological (clone 27). Cells were fixed in 4% PFA and permeabilized with 0.1% Triton.
REFERENCES
[0254] 1. Freeman M, and Gurdon J B (2002) Regulatory principles of developmental signaling. Annu. Rev. Cell. Dev. Biol. 18:515-39.
[0255] 2. Li V C, and Kirschner M W (2014) Molecular ties between the cell cycle and differentiation in embryonic stem cells. P.N.A.S. 111:9503-8.
[0256] 3. Salani S, Donadoni C, Rizzo F, Bresolin N, Comi G P, Corti S (2012) Generation of skeletal muscle cells from embryonic and induced pluripotent stem cells as an in vitro model and for therapy of muscular dystrophies. J Cell Mol Med. 16:1353-64.
[0257] 4. Mazzoni E O, et al. (2013) Synergistic binding of transcription factors to cell-specific enhancers programs motor neuron identity. Nat. Neurosci. 16:1219-27.
[0258] 5. Turbendian H K, et al. (2013) GATA factors efficiently direct cardiac fate from embryonic stem cells. Development 140:1639-44.
[0259] 6. DeLaForest A, Nagaoka M, Si-Tayeb K, Noto F K, Konopka G, Battle M A, Duncan S A (2011) HNF4A is essential for specification of hepatic progenitors from human pluripotent stem cells. Development 138:4143-53.
[0260] 7. Nishiyama A, et al. (2009) Uncovering early response of gene regulatory networks in ESCs by systematic induction of transcription factors. Cell Stem Cell 5:420-33.