HSV VECTORS WITH ENHANCED REPLICATION IN CANCER CELLS
20190106709 ยท 2019-04-11
Inventors
- William Jia (Burnaby, CA)
- Dmitry Chouljenko (Vancouver, CA)
- Xuexian Bu (Surrey, CA)
- Guoyu Liu (Richmond, CA)
Cpc classification
C12N2710/16643
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
C12N2830/002
CHEMISTRY; METALLURGY
A61K35/768
HUMAN NECESSITIES
C12N2710/16621
CHEMISTRY; METALLURGY
C12N2710/16633
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
C12N15/86
CHEMISTRY; METALLURGY
A61K35/768
HUMAN NECESSITIES
Abstract
An oncolytic HSV vector comprising an NF-B response element or an Oct-3/4-SOX2 response element in a regulatory region of a viral gene that affects viral replication efficiency.
Claims
1. An HSV vector comprising an NF-
2. A HSV vector comprising an Oct-3/4-SOX2 response element in a regulatory region of viral gene that affects viral replication efficiency.
3. The vector of claim 1 or 2, wherein the viral gene encodes ICP4, ICP27, US11 or ICP8.
4. The vector of claim 1, wherein the NF-
5. The vector of claim 4, wherein the tandem sequences are identical or a mix of identical and different sequences or all different sequences.
6. The vector of claim 4, wherein the NF-
7. The vector of claim 2, where the OCT-3/4-SOX2 complex response element comprises SEQ ID NO: 2 or a variant thereof, wherein the variant has at least 90% identical nucleotides.
8. The HSV vector of claims 1-7, further comprising a sequence encoding a therapeutic substance for cancer treatment.
9. The HSV vector of claim 8, wherein the therapeutic substance is ID 2, IL15, OX40L, PDL-1 blocker or a PD-1 blocker.
10. A method of treating cancer, comprising administering an HSV vector according to claims 1-9 to a patient in need.
11. A method of treating cancer stem cells and treatment-resistant cancer, comprising administering an HSV vector according to claims 1-9 to a patient with a treatment resistant cancer or a cancer having cancer stem cells.
12. The method of claims 10-11, wherein the cancers are colon cancer, lung cancer, breast cancer, prostate cancer, brain cancer, or bladder cancer.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0011] Exemplary features of the present disclosure, its nature and various advantages will be apparent from the accompanying drawings and the following detailed description of various embodiments. Non-limiting and non-exhaustive embodiments are described with reference to the accompanying drawings, wherein like labels or reference numbers refer to like parts throughout the various views unless otherwise specified. The sizes and relative positions of elements in the drawings are not necessarily drawn to scale. For example, the shapes of various elements are selected, enlarged, and positioned to improve drawing legibility. The particular shapes of the elements as drawn have been selected for ease of recognition in the drawings. One or more embodiments are described hereinafter with reference to the accompanying drawings in which:
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
DETAILED DESCRIPTION OF THE INVENTION
[0036] The present invention may be understood more readily by reference to the following detailed description of preferred embodiments of the invention and the Examples included herein. Briefly stated, the present disclosure provides compositions and methods for treating cancer using HSV vectors that comprise sequences that are responsive to NF-
[0037] Within certain embodiments of the invention, the present disclosure provides methods and compositions, to cancer cells, typically in vivo to a subject in need of cancer treatment. The term cancer, as used herein, refers to a cancer of any kind and origin, including treatment resistant cancers (e.g., resistant to conventional radiation and/or chemotherapy); cancer stem cells, tumor-forming cells, blood cancers, and transformed cells. The term cancer cell, as used herein, includes cancer or tumor-forming cells, transformed cells, or a cell that is susceptible to becoming a cancer or tumor-forming cell. Representative forms of cancer include carcinomas, sarcomas, myelomas, leukemia's, lymphomas, and mixed types of the above. Further examples include, but are not limited to those discussed in more detail below.
[0038] Some cancer cells, especially cancer stem cells, are relatively resistant to oncolytic HSV-1 virus induced oncolysis. To increase the therapeutic efficacy of oHSV-1, the viral genes that regulate viral replication can be modified in their regulatory region to insert an NFkB response element or an Oct3/4-SOX2 response element or both to make the gene expression particularly responsive to activation of NFkB in infected cells. Since NFkB pathway is often upregulated in cancer cells and cancer stem cells, this modification will enhance viral production and oncolytic activity of oHSV for more effective cell killing.
A. NF-
[0039] Oct-3/4-SOX2 complex (also designated Oct-3, Oct4 and Pou5f1) and NF-
[0040] Response elements for NF
[0041] Some known NF
TABLE-US-00001 TABLE1 SEQUENCE SEQIDNO. GGGGATTTCC 10 GGGAGATTCC 11 GGGAATCTCC 12 GGGAGATTCC 13 GGGGATTCCCC 14 GGGGAATCCC 15 GGGAATCCCC 16 GGGGAAGGCC 17 GGGAATTTCC 18 GGGAAATTCC 19 GGGAACTACC 20 GGGATTTTCC 21 GGGATTTCAC 22 GGGGCTTTCC 23 GGGAAAGCCC 24 GGGAATTCAC 25 GGGGGCTTCC 26 GGGGCTTCCC 27 GGGAAGCCCC 28 GGGGAAGCCC 29 GGGAAATCCC 30 GGGACTTTCC 31 GGGGCTTTCC 32 GGGGAATCCC 33 GGGATTCCCC 34
[0042] The NF-
[0043] Oct-3/4 binds an octameric sequence ATTTGCAT. Sox2 binds to an octameric sequence CTTTTGTC. It has been found that Oct4/Sox2 heterodimer binds to CTACAGAGGTGCATATTAACAGAGCTTTTGTCC-TGGAGA [SEQ ID No. 2] or variants of the sequence. (Wang et al. J Biol Chem 282: 12822, 2007). Variants will generally be at least 90% identical to this sequence, or at least 95% identical, or at least 98% identical.
[0044] The Oct-3/4-Sox2 response element comprises at least one of the binding sequences and may comprise from 2 up to 15 binding sequences in tandem array. When more than one sequence is present, the more than one sequence may be identical or different. For example, a response element comprising five binding sequences may have all five sequences identical, or four identical and one different, or three identical and two different, or two identical and three different, or five different sequences. As well, the tandem response elements may have nucleotides in between the elements. There may be from one to about ten additional nucleotides.
[0045] Some possible variants of the sequence for binding the Oct4/Sox2 complex can be found in MOLECULAR AND CELLULAR BIOLOGY (July 2005, p. 6031-6046), and include:
TABLE-US-00002 SEQIDNO.35 CTTTGTTATGCATCT SEQIDNO.36 CATTGTGATGCATAT SEQIDNO.37 CATTGTAATGCAAAA SEQIDNO.38 CATTGTTATGCTAGT SEQIDNO.39 CATTGTTATGATAAA SEQIDNO.40 CTTTGTTTGGATGCTAAT.
[0046] The vectors may contain a mixture of NF-
B. HSV Vector Constructs
[0047] An oncolytic virus is a virus that will lyse cancer cells (oncolysis), preferably in a selective manner. Viruses that selectively replicate in dividing cells over non-dividing cells are often oncolytic.
[0048] Herpes Simplex Virus (HSV) 1 and 2 are members of the Herpesviridae family, which infect humans. The HSV genome contains two unique regions, which are designated unique long (UL) and unique short (US) region. Each of these regions is flanked by a pair of inverted terminal repeat sequences. There are about 75 known open reading frames. The viral genome has been engineered to develop oncolytic viruses for use in e.g. cancer therapy. Tumor-selective replication of HSV is conferred by mutation of the HSV ICP34.5 (also called 34.5) gene. HSV contains two copies of ICP34.5. Mutants inactivating one or both copies of the ICP34.5 gene are known to lack neurovirulence, i.e. be avirulent/non-neurovirulent and be oncolytic.
[0049] Suitable oncolytic HSV may be derived from either HSV-1 or HSV-2, including any laboratory strain or clinical isolate. In some embodiments, the oHSV may be or may be derived from one of laboratory strains HSV-1 strain 17, HSV-1 strain F, or HSV-2 strain HG52. In other embodiments, it may be of or derived from non-laboratory strain JS-1. Other suitable HSV-1 viruses are in the table 2 below.
TABLE-US-00003 TABLE 2 Virus Name references HSV-1 HrrR3 [1] G2O7 [2, 3] G47Delta [4] HSV 1716 [5, 6] HF10 [7] NV1020 [8] T-VEC [9] J100 [10] M002 [11] NV1042 [12] G2O7-IL2 [13] rQNestin34.5 [14] G47-mIL-18 [15]
[0050] In some embodiments, the oHSV has one or both of the 34.5 genes are modified such that it is incapable of expressing a functional ICP34.5 protein. The genes may be modified by mutation of one or more nucleotides, insertions, deletions, substitutions, etc. The alteration may be in the coding sequence, non-coding sequence (e.g., promoter) or both. In some embodiments, both copies of the 34.5 genes are mutated.
[0051] The oHSV may have additional mutations, which may include disabling mutations e.g., deletions, substitutions, insertions), which may affect the virulence of the virus or its ability to replicate. For example, mutations may be made in any one or more of ICP6, ICPO, ICP4, ICP27, ICP47, ICP 24, ICP56. Preferably, a mutation in one of these genes (optionally in both copies of the gene where appropriate) leads to an inability (or reduction of the ability) of the HSV to express the corresponding functional polypeptide. In some embodiments, the promoter of a viral gene may be substituted with a promoter that is selectively active in target cells or inducible.
[0052] The oHSV may also have genes and nucleotide sequences that are non-HSV in origin. For example, a sequence that encodes a prodrug, a sequence that encodes a cytokine or other immune stimulating factor, a tumor-specific promoter, an inducible promoter, an enhancer, a sequence homologous to a host cell, among others may be in the oHSV genome. Exemplary sequences encode ID 2, ID 5, OX40L, PDL-1 blocker or a PD-1 blocker.
[0053] The regulatory region of viral genes encoding US11, ICP4, ICP27, and ICP8 may be modified to comprise a response element for NF-
C. Therapeutic Compositions
[0054] Therapeutic compositions are provided that may be used to prevent, treat, or ameliorate the effects of a cancer. More particularly, some therapeutic compositions comprise an oncolytic virus as described herein. Within preferred embodiments, the therapeutic composition can comprise an oncolytic virus as described herein.
[0055] In certain embodiments, the compositions will further comprise a pharmaceutically acceptable carrier. The phrase pharmaceutically acceptable carrier is meant to encompass any carrier, diluent or excipient that does not interfere with the effectiveness of the biological activity of the oncolytic virus and that is not toxic to the subject to whom it is administered (see generally Remington: The Science and Practice of Pharmacy, Lippincott Williams & Wilkins; 21st ed. (May 1, 2005 and in The United States PharmacopE1A: The National Formulary (USP 40-NF 35 and Supplements).
[0056] In the case of an oncolytic virus as described herein, non-limiting examples of suitable pharmaceutical carriers include phosphate buffered saline solutions, water, emulsions (such as oil/water emulsions), various types of wetting agents, sterile solutions, and others. Additional pharmaceutically acceptable carriers include gels, bioadsorbable matrix materials, implantation elements containing the oncolytic virus, or any other suitable vehicle, delivery or dispensing means or material(s). Such carriers can be formulated by conventional methods and can be administered to the subject at an effective dose. Additional pharmaceutically acceptable excipients include, but are not limited to, water, saline, polyethyleneglycol, hyaluronic acid and ethanol. Pharmaceutically acceptable salts can also be included therein, e.g., mineral acid salts (such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like) and the salts of organic acids (such as acetates, propionates, malonates, benzoates, and the like). Such pharmaceutically acceptable (pharmaceutical-grade) carriers, diluents and excipients that may be used to deliver the oHSV to a target cancer cell will preferably not induce an immune response in the individual (subject) receiving the composition (and will preferably be administered without undue toxicity).
[0057] The compositions provided herein can be provided at a variety of concentrations. For example, dosages of oncolytic virus can be provided which ranges from about 10.sup.6 to about 10.sup.9 pfu. Within further embodiments, the dosage form can range from about 10.sup.6 to about 10.sup.8 pfu/ml, with up to 4 mls being injected into a patient with large lesions (e.g., >5 cm) and smaller amounts (e.g, up to 0.1 mls) in patients with small lesions (e.g., <0.5 cm) every 2-3 weeks, of treatment.
[0058] Within certain embodiments of the invention, lower dosages than standard may be utilized. Hence, within certain embodiments less than about 10.sup.6 pfu/ml (with up to 4 mls being injected into a patient every 2-3 weeks) can be administered to a patient.
[0059] The compositions may be stored at a temperature conducive to stable shelf-life, and includes room temperature (about 20 C.), 4 C., 20 C., 80 C., and in liquid N2. Because compositions intended for use in vivo generally don't have preservatives, storage will generally be at colder temperatures. Compositions may be stored dry (e.g., lyophilized) or in liquid form.
D. Administration
[0060] In addition to the compositions described herein, various methods of using such compositions to treat or ameliorate cancer are provided, comprising the step of administering an effective dose or amount of a HSV vector as described herein to a subject.
[0061] The terms effective dose and effective amount refers to amounts of the oncolytic virus that is sufficient to effect treatment of a targeted cancer, e.g., amounts that are effective to reduce a targeted tumor size or load, or otherwise hinder the growth rate of targeted tumor cells. More particularly, such terms refer to amounts of oncolytic virus that is effective, at the necessary dosages and periods of treatment, to achieve a desired result. For example, in the context of treating a cancer, an effective amount of the compositions described herein is an amount that induces remission, reduces tumor burden, and/or prevents tumor spread or growth of the cancer. Effective amounts may vary according to factors such as the subject's disease state, age, gender, and weight, as well as the pharmaceutical formulation, the route of administration, and the like, but can nevertheless be routinely determined by one skilled in the art.
[0062] The therapeutic compositions are administered to a subject diagnosed with cancer or is suspected of having a cancer. Subjects may be human or non-human animals.
[0063] The compositions are used to treat cancer. The terms treat or treating or treatment, as used herein, means an approach for obtaining beneficial or desired results, including clinical results. Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of disease, stabilized (i.e. not worsening) state of disease, preventing spread of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, diminishment of the reoccurrence of disease, and remission (whether partial or total), whether detectable or undetectable. The terms treating and treatment can also mean prolonging survival as compared to expected survival if not receiving treatment.
[0064] Representative forms of cancer include carcinomas, leukemia's, lymphomas, myelomas and sarcomas. Further examples include, but are not limited to cancer of the bile duct cancer, brain (e.g., glioblastoma), breast, cervix, colorectal, CNS (e.g., acoustic neuroma, astrocytoma, craniopharyogioma, ependymoma, glioblastoma, hemangioblastoma, medulloblastoma, menangioma, neuroblastoma, oligodendroglioma, pinealoma and retinoblastoma), endometrial lining, hematopoietic cells (e.g., leukemia's and lymphomas), kidney, larynx, lung, liver, oral cavity, ovaries, pancreas, prostate, skin (e.g., melanoma and squamous cell carcinoma) and thyroid. Cancers can comprise solid tumors (e.g., sarcomas such as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma and osteogenic sarcoma), be diffuse (e.g., leukemia's), or some combination of these (e.g., a metastatic cancer having both solid tumors and disseminated or diffuse cancer cells). Cancers can also be resistant to conventional treatment (e.g. conventional chemotherapy and/or radiation therapy).
[0065] Benign tumors and other conditions of unwanted cell proliferation may also be treated.
[0066] The oHSV as described herein may be given by a route that is e.g. oral, topical, parenteral, systemic, intravenous, intramuscular, intraocular, intrathecal, intratumor, subcutaneous, or transdermal. Within certain embodiments the oncolytic virus may be delivered by a cannula, by a catheter, or by direct injection. The site of administration may be intra-tumor or at a site distant from the tumor. The route of administration will often depend on the type of cancer being targeted.
[0067] The optimal or appropriate dosage regimen of the oncolytic virus is readily determinable within the skill of the art, by the attending physician based on patient data, patient observations, and various clinical factors, including for example a subject's size, body surface area, age, gender, and the particular oncolytic virus being administered, the time and route of administration, the type of cancer being treated, the general health of the patient, and other drug therapies to which the patient is being subjected. According to certain embodiments, treatment of a subject using the oncolytic virus described herein may be combined with additional types of therapy, such as chemotherapy using, e.g., a chemotherapeutic agent such as etoposide, ifosfamide, adriamycin, vincristin, doxicyclin, and others.
[0068] oHSV may be formulated as medicaments and pharmaceutical compositions for clinical use and may be combined with a pharmaceutically acceptable carrier, diluent, excipient or adjuvant. The formulation will depend, at least in part, on the route of administration. Suitable formulations may comprise the virus and inhibitor in a sterile medium. The formulations can be fluid, gel, paste or solid forms. Formulations may be provided to a subject or medical professional
[0069] A therapeutically effective amount is preferably administered. This is an amount that is sufficient to show benefit to the subject. The actual amount administered and time-course of administration will depend at least in part on the nature of the cancer, the condition of the subject, site of delivery, and other factors.
[0070] Within yet other embodiments of the invention the oncolytic virus can be administered intratumorally, or, after surgical resection of a tumor.
[0071] The following examples are offered by way of illustration, and not by way of limitation.
[0072] The following examples are offered by way of illustration, and not by way of limitation.
EXAMPLES
Example 1
Enhancement of Viral Production
[0073] In this example, the production of oHSV-1 shown in
Example 2
Exemplary Constructs
[0074] In this example, various constructs and their sequences are presented.
[0075] OS-ICP27 comprises ZTP206 BS1 (Oct4/Sox2 binding site) and a survivin promoter which replace the native intergenic region between UL53 (glycoprotein K) and UL54 (ICP27) (
[0076] NO-ICP27-145 comprises an NF-kB response element and Oct4/Sox2 binding site (ZTP206 BS1) inserted within the intergenic region between UL53 (glycoprotein K) and UL54 (ICP27) at a location downstream of the UL53 (glycoprotein K) poly(A) and upstream of the UL54 (ICP27) TATA box. (
[0077] NO-ICP27-99 comprises an NF-kB response element and Oct4/Sox2 binding site (ZTP206 BS1) inserted within the intergenic region between UL53 (glycoprotein K) and UL54 (ICP27) at a location downstream of the UL53 (glycoprotein K) poly(A) and upstream of the UL54 (ICP27) TATA box. (
[0078] hVG161 comprises a modified ICP34.5 region (
[0079] mVG161 is a functionally identical mouse version of hVG161 except that that mVG161 carries a mouse version of IL-12 and a mouse PD-L1 blocker in the same location on the viral genome where hVG161 carries a human IL-12 and a human PD-L1 blocker.
Example 3
Abbreviations Used in Subsequent Examples
[0080] TF-Fc: PD-L1 blocking peptide (TF) fused to Fc and used for construction of VG161.
[0081] IL-TF-Fc: plasmid carrying IL-12, IL-15, and PD-L1 blocker.
[0082] HSV-345: ICP34.5-deleted virus.
[0083] OS-ICP27 2-11: ICP34.5-deleted virus with Oct4/Sox2 binding site and surviving promoter (OS) inserted within the promoter-regulatory region of ICP27 (OS-ICP27) that was not used for construction of VG161.
[0084] OS-ICP27 5-7: ICP34.5-deleted virus with OS-ICP27 mutation that was not used for construction of VG161.
[0085] NO-ICP27 1-4-4 (also known as NO-ICP27-145): ICP34.5-deleted virus with NF-kB response element and Oct4/Sox2 binding site (NO) inserted within the promoter-regulatory region of ICP27 (NO-ICP27) at a location 145 bp upstream of the transcription start site of ICP27 and that was used for construction of VG161.
[0086] NO-ICP27 5-2-2 (also known as NO-ICP27-99): ICP34.5-deleted virus with NF-kB response element and Oct4/Sox2 binding site (NO) inserted within the promoter-regulatory region of ICP27 (NO-ICP27) at a location 99 bp upstream of the transcription start site of ICP27 and that was not used for construction of VG161.
[0087] VG001 (also known as VG160): backbone virus that was used for construction of VG161 (NO-ICP27 1-4-4 mutant carrying an exogenous promoter and poly(A) flanking an empty MCS within deleted terminal repeat region of the viral genome that is subsequently used for insertion of the IL-12/IL-15 expression cassette).
[0088] VG001-15h (also known as VG161-15h): VG001 carrying human IL-15.
[0089] VG001-1215h (also known as VG161-1215h): VG001 carrying human IL-12 and human IL-15.
[0090] VG001-PLBh (also known as VG161-PLBh): VG001 carrying human PD-L1 blocker inserted within intergenic region between UL3 and UL4.
[0091] 8-8-15RA1-PDL1b: VG001 carrying human IL-15 and human PD-L1 blocker.
[0092] VG161-1215PLBm (also known as mVG161): VG001 carrying mouse IL-12, human IL-15, and mouse PD-L1 blocker.
[0093] VG161-1215PLBh (also known as hVG161 or VG161): VG001 carrying human IL-12, human IL-15, and human PD-L1 blocker.
Example 4
Results of Exemplary Constructs Comprising Mutations in the ICP27 Promoter/Regulatory Region
[0094] In this example, viruses with mutations in the ICP27 promoter-regulatory region were used to infect cells.
[0095] In
[0096] In
[0097] In
Example 5
Expression of IL-12 Following Infection of Cells by hVG161
[0098] In this Example, Western blot and ELISA data of 11-12 expression is shown.
[0099]
[0100]
Example 6
Expression of IL-15 Following Infection of Cells by hVG161
[0101] In this Example, Western blot and ELISA data of IL-15 expression is shown.
[0102]
[0103]
Example 7
Expression of IgG4 Following Infection of Cells by hVG161
[0104] In this Example, Western blot and ELISA data of IgG4 expression is shown.
[0105]
[0106]
Example 8
In Vitro Efficacy of Viruses VG161-pLBh and VG161-15h
[0107] In this example, 310.sup.4 H460 or LS174T tumour cells were seeded into each well of 96-well plate and cultured at 37 C. for overnight. Next day, seeded cells were infected with VG001 backbone, VG161-PLBh, or VG161-15h virus (MOI=1) for 24 hours and the productions of human IL-12, human IL-15, and human IgG4 were assessed (
Example 9
In Vitro Efficacy of Various Constructs
[0108]
[0109]
[0110]
[0111] In
[0112]
[0113] In
[0114] In
[0115] In
[0116] In
Example 11
In Vivo Efficacy of VG161 Viral Constructs
[0117] In
[0118] In
[0119] In
Example 12
Replication of hVG161 in Cell Lines
[0120] The growth curve and cytotoxicity data in
[0121] The following are additional exemplary embodiments of the present disclosure:
[0122] 1) An HSV vector comprising an NF-
[0123] 2) A HSV vector comprising an Oct-3/4-SOX2 response element in a regulatory region of viral gene that affects viral replication efficiency.
[0124] 3) The vector of embodiments 1 or 2, wherein the viral gene encodes ICP4, ICP27, US11 or ICP8. Within further aspects of embodiments 1 and/or 2, the HSV vector is an HSV-1 vector.
[0125] 4) The vector of any of embodiments 1 to 3, wherein the NF-
[0126] 5) The vector of embodiment 4, wherein the tandem sequences are identical or a mix of identical and different sequences or all different sequences.
[0127] 6) The vector of embodiment 4, wherein the NF-
TABLE-US-00004 GGGAATTTCCGGGGACTTTCCGGGAATTTCCGGGGACTTTCCGGGAATTT CC.
[0128] 7) The vector of embodiment 2, where the OCT-3/4-SOX2 complex response element comprises SEQ ID NO: 2 or a variant thereof, wherein the variant has at least 90% identical nucleotides.
[0129] 8) The HSV vector of any one of embodiments 1-7, further comprising a sequence encoding a therapeutic substance for cancer treatment.
[0130] 9) The HSV vector of embodiment 8, wherein the therapeutic substance is IL12, IL15, OX40L, PDL-1 blocker and/or a PD-1 blocker.
[0131] 10) A method of treating cancer, comprising administering an HSV-1 vector according to any one of embodiments 1-9 to a patient in need.
[0132] 11) A method of treating cancer stem cells and treatment-resistant cancer, comprising administering an HSV vector according to any one of embodiments 1-9 to a patient with a treatment resistant cancer or a cancer having cancer stem cells.
[0133] 12) The method of embodiments 10-11, wherein the cancers are colon cancer, lung cancer, breast cancer, prostate cancer, brain cancer, or bladder cancer.
[0134] From the foregoing it will be appreciated that, although specific embodiments have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims.
[0135] All of the U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications and non-patent publications referred to in this specification and/or listed in the Application Data Sheet, are incorporated herein by reference, in their entirety. Such documents may be incorporated by reference for the purpose of describing and disclosing, for example, materials and methodologies described in the publications, which might be used in connection with the presently described invention. The publications discussed above and throughout the text are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the inventors are not entitled to antedate any referenced publication by virtue of prior invention.
[0136] All patents, publications, scientific articles, web sites, and other documents and materials referenced or mentioned herein are indicative of the levels of skill of those skilled in the art to which the invention pertains, and each such referenced document and material is hereby incorporated by reference to the same extent as if it had been incorporated by reference in its entirety individually or set forth herein in its entirety. Applicants reserve the right to physically incorporate into this specification any and all materials and information from any such patents, publications, scientific articles, web sites, electronically available information, and other referenced materials or documents.
[0137] In general, in the following claims, the terms used should not be construed to limit the claims to the specific embodiments disclosed in the specification and the claims, but should be construed to include all possible embodiments along with the full scope of equivalents to which such claims are entitled. Accordingly, the claims are not limited by the disclosure
[0138] Furthermore, the written description portion of this patent includes all claims. Furthermore, all claims, including all original claims as well as all claims from any and all priority documents, are hereby incorporated by reference in their entirety into the written description portion of the specification, and Applicants reserve the right to physically incorporate into the written description or any other portion of the application, any and all such claims. Thus, for example, under no circumstances may the patent be interpreted as allegedly not providing a written description for a claim on the assertion that the precise wording of the claim is not set forth in haec verba in written description portion of the patent.
[0139] Other nonlimiting embodiments are within the following claims. The patent may not be interpreted to be limited to the specific examples or nonlimiting embodiments or methods specifically and/or expressly disclosed herein. Under no circumstances may the patent be interpreted to be limited by any statement made by any Examiner or any other official or employee of the Patent and Trademark Office unless such statement is specifically and without qualification or reservation expressly adopted in a responsive writing by Applicants.