Nanoparticles for drug delivery comprising albumin having a polymer chain coupled thereto
10251958 ยท 2019-04-09
Assignee
Inventors
- Martina Heide Stenzel (Malabar, AU)
- Wei Scarano (East Hills, AU)
- Domenic Svejkar (Reandwich, AU)
- Mingtao Liang (Cameron Park, AU)
Cpc classification
A61P29/00
HUMAN NECESSITIES
A61K47/593
HUMAN NECESSITIES
A61K47/58
HUMAN NECESSITIES
A61K47/643
HUMAN NECESSITIES
A61K9/1075
HUMAN NECESSITIES
A61K47/32
HUMAN NECESSITIES
A61K47/6925
HUMAN NECESSITIES
A61K31/713
HUMAN NECESSITIES
A61K47/42
HUMAN NECESSITIES
A61K47/60
HUMAN NECESSITIES
A61K9/141
HUMAN NECESSITIES
International classification
A61K47/64
HUMAN NECESSITIES
A61K47/59
HUMAN NECESSITIES
A61K47/32
HUMAN NECESSITIES
A61K47/69
HUMAN NECESSITIES
A61K9/14
HUMAN NECESSITIES
A61K47/42
HUMAN NECESSITIES
A61K47/58
HUMAN NECESSITIES
A61K47/60
HUMAN NECESSITIES
Abstract
The invention provides a dispersion of assemblies. The assemblies comprise an albumin derivative comprising albumin having a polymer chain coupled thereto, wherein the assemblies comprise a core comprising the polymer chains and a shell comprising the albumin. A process for making the dispersion and methods of using the dispersion are also described.
Claims
1. A substance comprising a plurality of assemblies, each of said assemblies comprising a plurality of albumin derivatives and a drug, each albumin derivative comprising an albumin having a polymer chain coupled thereto, wherein the polymer chain is coupled to a single site of the albumin, wherein the assemblies comprise a core comprising the polymer chains of the albumin derivatives and a shell comprising the albumin of the albumin derivatives, wherein the drug is located at least partially in the core of the assemblies, wherein the albumin having the polymer chain coupled thereto of the albumin derivatives is undenatured, wherein the polymer chain is selected from a hydrophobic polymer chain and an ionically charged polymer chain, and wherein when the polymer chain is a hydrophobic polymer chain, the drug is hydrophobic, and when the polymer chain is an ionically charged polymer chain, the drug is a counterion to the ionically charged polymer chain.
2. The substance of claim 1 which is in the form of a powder.
3. The substance of claim 1 which has a water content of less than 2% on a weight basis based on the total weight of the substance.
4. A pharmaceutical composition comprising the substance of claim 1 together with one or more pharmaceutically acceptable carriers, diluents and/or adjuvants.
5. The pharmaceutical composition of claim 4 which is in the form of a powder.
6. The pharmaceutical composition of claim 5 which has a water content of less than 2% on a weight basis based on the total weight of the substance.
7. The substance of claim 1, wherein the thio group is on a cysteine residue.
8. The substance of claim 7, wherein the thio group is on a cysteine residue.
9. The substance of claim 1, wherein the polymer chain has a polydispersity index of about 1.2 to about 2.
10. The substance of claim 1, wherein each of said assemblies consist of a plurality of the albumin derivatives and the drug.
11. A process for making a substance according to claim 1 comprising: Providing a dispersion of assemblies, said assemblies comprising an albumin derivative comprising albumin having a polymer chain coupled thereto, wherein the assemblies comprise a core comprising the polymer chains and a shell comprising the albumin; and Drying said dispersion, thereby making the substance according to claim 1.
12. The process of claim 11 wherein the step of drying comprises freeze-drying.
13. The process of claim 11 wherein the drying is conducted to a water content of less than about 2% by weight.
14. A process for making a dispersion of assemblies, said assemblies comprising an albumin derivative comprising albumin having a polymer chain coupled thereto, wherein the assemblies comprise a core comprising the polymer chains and a shell comprising the albumin comprising: Providing a substance according to claim 1; and Combining said substance with water or an aqueous solution, thereby making a dispersion of assemblies, said assemblies comprising an albumin derivative comprising albumin having a polymer chain coupled thereto, wherein the assemblies comprise a core comprising the polymer chains and a shell comprising the albumin.
15. The process of claim 14 additionally comprising agitating the substance in the aqueous solution so as to disperse the substance in the aqueous solution.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
DESCRIPTION OF EMBODIMENTS
(31) Albumin is increasingly used as a protein carrier for drugs. It facilitates targeting of drugs and improves the pharmacokinetic profile of drugs. Albumin is the most abundant plasma protein (35-50 g/L human serum) with a molecular weight of 66.5 kDa. The circulation time of human serum albumin (HSA) is very high with an average half-life of 19 days. HSA has many functions: a) solubilises fatty acids b) binds bilirubin, the yellow breakdown product of normal heme catabolism c) binds many drugs d) acts as transport vehicle for metal ions such as copper(II) and nickel(II) e) regulates the colloid osmotic pressure of the blood f) provides nutrition for tissue once it has been cleaved into amino acids
(32) Albumin is a slightly acidic and very soluble protein. The isoelectric point (IEP) is at pH=4.8, which means that albumin is negatively charged in blood. The protein is very robust: it is stable in the pH range of 4 to 9, soluble in 40% ethanol, and can be heated at 60 C. for up to 10 hours. The interest in albumin as drug carrier stems from its availability, its biodegradability, and its lack of toxicity and immunogenicity. A very intriguing aspect of albumins is their preferential uptake in tumor and inflamed tissue.
(33) The product of the present invention may be made by attaching a polymer (optionally copolymer) chain onto an albumin molecule, so as to produce a molecule capable of self-assembly into particles which may be less than 200 nm, commonly less than 100 nm. The attaching may comprise bonding, e.g. covalently bonding, the polymer to the albumin molecule. The size of the particles may be adjusted by adjusting the size (e.g. molecular weight) of the polymer. Thus for a particular polymer chemistry, a lower molecular weight may be used in order to achieve smaller diameter particles. The process of the invention may therefore comprise the step of selecting a molecular weight of the polymer chain in order to obtain a desired particle size. The uptake into tumors of assembly having an albumin shell is superior to traditional micelles leading to higher toxicity to the tumors relative to other micelles. In a particular embodiment of the invention a hydrophobic chain is conjugated to albumin, so as to produce a structure that is amphiphilic (hydrophilic albumin, oil-soluble polymer chain) As a result, the structure is capable of self-assembly into assemblies, which are in general below 200 nm, commonly below 100 nm, in size. The inventors have encapsulated drugs into these assemblies, which have a core comprising polymer and a shell comprising albumin. The structure of the polymer in the core may be adjusted to the particular drug delivery challenge. The inventors have successfully demonstrated this technique for hydrophobic drugs and metal based drugs, however similar technology may also be used to deliver DNA or other hydrophilic substances, by adjusting the type of polymer. The core may be adjusted to any drug or other substance that needs to be delivered, e.g. an anti-cancer drug such as doxicyclin, paclitaxel, cisplatin or DNA, a peptide drug, or a proteinaceous drug. In this context it should be noted that in the present specification the term comprise and related words should be taken to indicate the presence of the designated integer and optionally other unspecified integers. The term encompasses the possibility that no such unspecified integers are present and therefore encompasses the term consists of or consists essentially of.
(34) In summary, albumin assemblies may be readily made having a smaller size than nab-albumin. The actual size of the assemblies may be adjusted by adjusting the length of the polymer chain. The core may be designed to suit a wide range of hydrophobic drugs, but, in contrast to nab-albumin, can also be tailored so as to encapsulate other drugs such as DNA. In the context of the present invention, an assembly is a self-assembled structure of molecules. These molecules are commonly amphiphiles, i.e. have a hydrophilic region (derived from albumin) coupled to a hydrophobic region (which is a polymer chain) so as to enable them to self-assemble. Examples of assemblies that may be made, or used, in accordance with the invention include micelles, rod-like micelles, vesicles, bilayer cylinders, bilayer sheets etc. In the case where the assemblies are not micelles, the core should be taken to be the region of the assembly occupied by the polymer chains. Similarly, in such cases, the shell should be taken to be the region of the assembly occupied by the albumin. In other words, the assemblies are such that the polymer chains of the albumin derivative are collected in a region designated the core and the albumin portions of the albumin derivative are collected in a region designated the shell, which, in many, but not all, embodiments, surrounds, or substantially completely surrounds, or at least partially surrounds, the core. In some embodiments the polymer is hydrophilic. In such cases the assembly formation may be driven by the interaction of the polymer with the drug (e.g. by dipole-dipole interactions or by ionic attractions).
(35) The present invention complements the nab-albumin technology that is presently available. A disadvantage of nab-albumin technology is that it is only suitable for encapsulation of hydrophobic drugs such as paclitaxel or doxorubicin. In addition, the particles are usually above 100 nm. The present technology therefore has the advantage that: 1) albumin assemblies may be constructed having a smaller size than nab-albumin, 2) the size of the assemblies may be adjusted by adjusting the length and nature of the polymer chain and 3) the core may be designed to suit all types of hydrophobic drugs (and in some cases hydrophilic drugs) so that, in contrast to nab-albumin, the assemblies of the present invention are also capable of encapsulating other drugs such as DNA, peptides etc. The present technology is capable of producing particles of less than 100 nm with albumin coating by adjusting the length of the polymer, and can also deliver other drugs such as siRNA, metal based drugs or peptides. Smaller particles such as those afforded by the present invention are more suitable for treatment of cancers that respond better to small particle such as pancreatic cancer.
(36) The present invention discloses a dispersion of assemblies. In this context, the term dispersion indicates that the assemblies are dispersed in the dispersion. The dispersion may comprise a continuous phase and the assemblies may represent a discontinuous phase dispersed through the continuous phase. The continuous phase may be a liquid or may be a gel or may be some other type of continuos phase. The dispersion may therefore be an emulsion, or may be a microemulsion, or may be a suspension. The assemblies may be substantially homogeneously dispersed through the continuous phase of the dispersion. The dispersion may be a liquid or may be a gel or may be in some other physical form. The proportion of assemblies in the dispersion may be between about 0.1 and about 50% on a volume/volume basis, or between about 0.1 and 10, 0.1 and 5, 0.1 and 1, 1 and 50, 5 and 50, 10 and 50, 1 and 20, 1 and 10, 1 and 5, 5 and 20 or 10 and 20%, e.g. about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45 or 50% or may in some instances be over 50%. The continuous phase may be aqueous. It may contain no organic solvents. It may comprise salts. It may comprise buffers. It may have a pH of about 2 to about 12, or about 2 to 7, 7 to 12, 3 to 11, 4, to 10, 5 to 9, 6 to 8, 4 to 7, 7 to 10 or 7 to 8, e.g. about 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5 or 12.
(37) The inventors have discovered that the dispersion of the present invention may be dried. This facilitates storage. Commonly the process of drying the dispersion will comprise freeze-drying. The dried dispersion may be in the form of a powder, commonly a free-flowing powder. It may have a water content of less than about 5% on a weight basis, or less than about 4, 3, 2 or 1%, or about 1 to 5 or 1 to 3%, e.g. about 5, 4, 3, 2, 1, 0.5 or 0.1%. The dried dispersion may be readily redispersed in water or suitable aqueous solution, so as to produce an aqueous dispersion of the assemblies. The redispersing may simply involve addition of the water or suitable aqueous solution. It may additionally comprise agitating the resulting mixture so as to disperse the assemblies. The agitation may comprise one or more of swirling, shaking, stirring or sonicating. The agitation may be conducted for sufficient time and with sufficient vigour or power to completely disperse the assemblies in the water or aqueous solution. The dried dispersion may additionally comprise suitable additives. These may be suitable for pharmaceutical use, for example adjuvants. They may include dessicants or other suitable additives. It should be noted that where reference is made in this specification to dissolving the assemblies or albumin, this may include formation of a micellar solution, i.e. may include micellisation.
(38) These assemblies comprise, optionally consist essentially of, an albumin derivative (and optionally also water), and also optionally have a biologically active substance associated with said derivative. The derivative comprises, optionally consists essentially of, albumin having a polymer chain coupled thereto. The assemblies comprise a core comprising the polymer chains and a shell comprising the albumin. The core may consist essentially of the polymer chains, together with the biologically active substance (if present). The shell may consist essentially of the albumin, optionally also together with bound water and/or bound ions.
(39) The assemblies of the present invention comprise molecules having an albumin molecule coupled to, optionally bonded (e.g. covalently bonded) to, a polymer chain. The albumin molecule may be any suitable album. It may be a serum albumin, for example bovine serum albumin or human serum albumin. It may be a storage albumin, e.g. ovalbumin. The polymer chain may be attached through a terminal monomer group in the chain or may be attached through a non-terminal monomer group in the chain. Suitable coupling chemistries will be dictated by the nature of the polymer chain and the available functional groups on the albumin. A particularly suitable group on the albumin molecule for coupling is the thiol group, in particular the thiol group on a cysteine group (e.g. cysteine-34) in the albumin molecule. The skilled person will readily appreciate which groups on a polymer chain may be suitable for coupling to particular groups in the albumin molecule, in particular to a thiol group.
(40) The polymer chain may be any type of polymer chain capable of coupling to the albumin. It may be hydrophilic or it may be hydrophobic. In the case where the polymer chain is hydrophilic, it may be charged (either positively or negatively) or may be zwitterionic. It may be functionalised so as to associate with (e.g. complex with) a desired biologically active substance. Commonly it is not a polyethyleneglycol chain. More generally it may be a chain that is not a hydrophilic polyglycol chain, or that is not a non-ionic hydrophilic chain.
(41) Suitable hydrophobic chains include acrylate and methacrylate chains (e.g. methyl, ethyl, propyl, butyl or phenyl acrylate or methacrylate), polyolefin chains (e.g. ethylene, propylene, butylene, butadiene or hexene), polyether chains (e.g. methylvinyl ether, phenylvinyl ether), polyester chains (e.g. polylactide), polyamide chains (e.g. nylon-6, nylon-6,6, nylon-4,6, nylon-11), polystyrene chains (optionally substituted) or some other suitable polymer chain. Copolymers, either random or block, are also envisaged. In some instances the polymer, or one of the polymeric units in a copolymer, may contain functional groups capable of binding or complexing a substance to be encapsulated in the assemblies. For example diamine groups may be used to complex metals such as platinum which are to be incorporated into the assemblies.
(42) Suitable hydrophilic chains include polypeptides and polyelectrolytes, e.g. polyamines (optionally polyquaternary ammonium), polycarboxylic acids etc.
(43) The molecular weight of the polymer chain may be adjusted so as to obtain a desired size of amphiphile assembly. Thus a longer polymer chain of the same chemical nature will in general result in larger amphiphile assemblies. Commonly the molecular weight will be from about 1000 to about 1,000,0000, or about 1000 to 1000000, 1000 to 500000, 1000 to 100000, 1000 to 50000, 1000 to 20000, 1000 to 10006, 1000 to 5000, 1000 to 2000, 2000 to 1000000, 5000 to 1000000, 10000 to 1000000, 50000 to 1000000, 100000 to 1000000, 5000 to 100000, 5000 to 50000, 5000 to 10000, 10000 to 50000, 10000 to 100000 or 20000 to 50000, e.g. about 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 15000, 20000, 25000, 30000, 35000, 40000, 50000, 60000, 70000, 80000, 90000, 100000, 200000, 500000 or 1000000. In some cases the molecular weight may be greater than or less than the above ranges. This may be a number average or a weight average molecular weight. The polymer chain may have an average degree of polymerisation of about 10 to about 100, or about 10 to 50, 10 to 20, 20 to 50, 20 to 100 or 50 to 100, e.g. about 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100, or may be more than or less than those ranges. The polymer chain may be essentially monodispersed, or may have a distribution of molecular weights. It may have a polydispersity (defined as the ratio between weight average and number average molecular weights) of less than about 1.1, or less than about 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2, or of about 1 to about 2, or about 1 to 1.5, 1 to 1.2, 1.2 to 2, 1.5 to 2 or 1.2 to 1.5, e.g. about 1, 1.1, 1.2, 13, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2, or may be greater than about 2. The synthesis of the polymer chain may be by means of a living polymerisation technique such as RAFT (Reversible Addition-Fragmentation chain-Transfer) polymerisation. It may be by means of a polymerisation technique which introduces a functional endgroup, e.g. an endgroup capable of coupling to albumin or capable of being converted to a group capable of coupling to albumin, or may be by means of a polymerisation technique which introduces a non-terminal functional group capable of coupling to albumin or capable of being converted to a group capable of coupling to albumin.
(44) The coupling between the albumin and the polymer chain may be any suitable coupling, e.g. an ester, an ether, an amide, a thioether, a triazole, a siloxane or other suitable coupling.
(45) The assemblies of the present invention may have a mean diameter of less than about 200 nm, or less than about 150, 100, 90, 80, 70, 60 or 50 nm, or of about 25 to about 200 nm, or about 25 to 50, 25 to 75, 25 to 100, 50 to 200, 50 to 150, 50 to 100, 50 to 75, 75 to 200, 100 to 200, 100 to 150 or 75 to 150 nm, e.g. about 25, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 nm. In some instances, the amphiphile assemblies may have a mean diameter of greater than 200 nm, e.g. about 250, 300, 350, 400, 450 or 500 nm. As discussed elsewhere, by suitable choice of the chemical nature of the polymer chain and its degree of polymerisation, the mean diameter may be varied at will to suit a specific application. The assemblies may be essentially monodispersed in diameter, or may have a distribution of diameters. They may have a polydispersity (defined as the ratio between weight average and number average diameters) of less than about 1.1, or less than about 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2, or of about 1 to about 2, or about 1 to 1.5, 1 to 1.2, 1.2 to 2, 1.5 to 2 or 1.2 to 1.5, e.g. about 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2, or may be greater than about 2. The assemblies may be spherical, or may be substantially spherical, or may be oblate spherical, polyhedral, acicular, disc-shaped, torroidal, or some other shape. In the event that the assemblies are not spherical, the above mean diameters may be hydrodynamic diameters, or may be the mean of the maximum or minimum diameters of the assemblies. It should be noted that, as stated elsewhere herein, for treatment of tumours, particle diameters of the assemblies of less than about 100 nm may be preferred. However there is still value in some instances in preparing assemblies of greater than 100 nm, particularly when these are tailored to incorporate bioactive substances which have hitherto been difficult to incorporate into albumin-based assemblies, e.g. hydrophilic molecules such as DNA, RNA etc.
(46) The assemblies may comprise a drug or other bioactive (i.e. biologically active) substance. Suitable drugs include those which are active in treatment of inflammations or of tumors. Particularly suitable drugs include anticancer drugs. Mixtures of drugs may also be used. The ratio of polymer (i.e. polymer chain) to drug may be about 5 to about 50 (i.e. 5:1 to about 50:1) on a weight basis, or about 5 to 20, 5 to 10, 10 to 20, 10 to 50, 20 to 50 or 20 to 30, e.g. about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50. Commonly the bioactive substance will be located at least partially, optionally primarily (e.g. greater than about 50%, or greater than about 60, 70, 80, 90 or 95%) in the core of the assemblies. It may be associated with the polymer chains in the core of the assemblies. In the case of a hydrophobic polymer core, the bioactive substance may be hydrophobic and hence may partition preferentially to the core of the assemblies. In other cases the polymer chains are ionically charged. In this case the bioactive substance may have a charge opposite to that on the polymer chains so that it partitions preferentially to the core of the assemblies due to ionic attraction. Thus the bioactive substance may represent a counterion to charged polymer chains in the core of the assemblies. The bioactive substance may be positively charged and the polymeric chains negatively charged (e.g. carboxylate or sulfonate functional) or the bioactive substance may be negatively charged and the polymeric chains positively charged (e.g. quaternary ammonium functional). In some instances the bioactive substance may be complexed (or complexable) to the polymer chains. This may be particularly suitable in cases where the bioactive substance is a metal. The skilled person will readily recognise suitable complexing groups which may be present, or may be introduced, in the polymer chains. Frequently these will include diamine or polyamines suitable for bidentate or polydentate complexation.
(47) The assemblies of the present invention may be made by combining an albumin derivative and an aqueous solution and allowing the albumin derivative to self-assemble to form the assemblies. As discussed, the albumin derivative comprises albumin having a polymer chain attached thereto. In a particular embodiment, the polymer chain is attached through a terminal monomer unit thereof to a thiol group on the albumin molecule. The self-assembly step may simply involve allowing the derivative to stand in the aqueous solution or it may comprise agitating the derivative in the aqueous solution, e.g. stirring, swirling, shaking, sonicating or other form of agitating, or combinations of forms of agitation may be used. It may require some time for formation of the assemblies, e.g. at least about 6 hours, or at least about 12, 24, 36 or 48 hours, or about 6 to about 60 hours, or about 6 to 48, 6 to 24, 12 to 60, 24 to 60, 48 to 60 or 24 to 48 hours, e.g. about 6, 12, 18, 24, 36, 42, 48, 54 or 60 hours. It will be understood that the time will depend on the temperature, and higher temperatures may require less time for the self-assembly step.
(48) The process may comprise the step of preparing the albumin derivative. This may be accomplished by coupling a polymer (i.e. polymeric reagent) to albumin. As noted above, the albumin may be any suitable albumin, commonly a serum albumin such as BSA (bovine serum albumin) or HSA. In some cases it may be necessary to functionalise the albumin or the polymer or both in order to provide suitable groups for coupling. A convenient group on albumin for coupling is the thiol group. This may be coupled to suitable polymers by a thiol-ene reaction, thioesterification, oxidative coupling of thiols or thioether formation. For such reactions, the polymer should be functionalised with a suitable functional group, e.g. an olefin such as maleimide, a carboxylic acid or equivalent, a thiol or a halide.
(49) Other coupling reactions suitable for coupling the polymer to the albumin are well known. These include cycloaddition of an alkyne to an azide to form a triazole; reaction of an alcohol with a carboxylic acid or a carboxylic acid halide to form an ester; reaction of an amine with a carboxylic acid or a carboxylic acid halide to form an amide; addition of a thiol to an alkene to form a thioether; reaction of an organometallic substance with an organic halide to form a CC bond. It will be understood that for some of these it is necessary to functionalise the albumin appropriately. This may commonly be achieved by reacting a thiol on the albumin molecule with a suitable compound so as to introduce the desired functional group into the albumin.
(50) In some cases, the polymer prior to coupling to the albumin will be insoluble in water. It may be necessary to dissolve it in a solvent, commonly an organic solvent, prior to mixing it with an aqueous solution of the albumin. The organic solvent is preferably miscible or at least partially miscible with water. Suitable such solvents include DMSO, DMF, HMPT, HMPA, acetone and THF. Commonly as little as possible of the organic solvent will be used. The solution of albumin, which is aqueous, may contain salts, commonly buffers such as PBS.
(51) The coupling may be conducted at any suitable temperature. It may be conducted at room temperature, or between about 10 and about 50 C., or about 10 to 30, 10 to 20, 20 to 50, 30 to 50 or 20 to 30 C., e.g. at about 10, 15, 20, 25, 30, 35, 40, 45 or 50 C. The temperature used should, however, not be sufficient to denature the albumin. It may be sufficiently low as to not denature a bioactive substance in the assemblies. The time for the coupling may be with the same range as for self-assembly to form the assemblies as described earlier. Commonly the steps of coupling and self-assembly will be conducted in a one-pot process rather than in two discrete steps.
(52) Another approach to preparing the albumin derivative comprises coupling an initiator group to the albumin and then using the resulting albumin bound initiator to initiate polymerisation of a monomer to form a polymer chain attached to the albumin moiety. Suitable initiator groups that may be attached to albumin for this purpose include thiocarbonyl thio groups (for RAFT polymerisations), aminoxy groups (for nitroxide mediated polymerisations), an active halide (e.g. alpha-halo carbonyl or benzyl halide, for ATRP polymerisation) etc.
(53) A further approach to preparing the albumin derivative comprises coupling a chain transfer group to the albumin and polymerising a monomer in the presence of the albumin bound chain transfer group. Suitable chain transfer groups which may be used in this case include thiols and halides. It should be noted that albumin contains thiols, and may therefore be used as a chain transfer agent without further elaboration.
(54) Yet another approach to preparing the albumin derivative comprises polymerising a monomer in the presence of the albumin as a terminating agent so as to form the albumin derivative. In this event, the polymerisation may be an anionic polymerization or a ring-opening polymerization or some other type of polymerisation which may be terminated by the albumin.
(55) In any of the above approaches to forming the assemblies, the process may comprise the step of selecting a suitable chemistry of the polymer chain so as to bind a desired biologically active substance or to encapsulate the biologically active substance in the resulting assemblies. It may comprise the step of selecting a suitable molecular weight, or degree of polymerisation, of the polymer chain so as to produce assemblies of desired diameter or size. It may comprise using suitable polymerisation conditions as to obtain the desired molecular weight, or degree of polymerisation, of the polymer chain.
(56) In certain embodiments the assemblies contain a substance, e.g. a biologically active substance. The substance may be releasable from the assemblies. In order to load this substance into the assemblies, the assemblies may be formed in the presence of the substance or the substance may be added to the preformed assemblies so as to penetrate into the assemblies, commonly into the cores thereof. Thus in some embodiments, the process comprises combining the substance, optionally in solution, albumin and a polymer and agitating the resulting mixture for sufficient time and at suitable temperature for formation of assemblies comprising albumin-polymer conjugates together with the substance. In other embodiments the process comprises combining albumin and a polymer and agitating the resulting mixture for sufficient time and at suitable temperature for formation of assemblies comprising albumin-polymer conjugates, adding the substance, optionally in solution, and allowing the substance to penetrate into the assemblies so as to form assemblies comprising albumin-polymer conjugates together with the substance. In particular embodiments, the polymer may be combined with the substance, optionally coupled (e.g. complexed) thereto, prior to addition of or to the albumin. Thus the albumin may be coupled with a complex or conjugate comprising the polymer and the substance.
(57) The process may comprise the step of producing the polymer prior to coupling the polymer to the albumin. In many cases this will involve a controlled polymerisation for example a controlled radical polymerisation. Suitable controlled radical polymerisation methods include RAFT (reversible addition-fragmentation chain transfer polymerisation), ATRP (atom transfer polymerisation), nitroxide-mediated polymerisation etc. These are well known to those skilled in the art. By adjusting the ratio of monomer to initiator, it is commonly possible to control the molecular weight of the polymer and at times the polydispersity thereof. This may in turn be used to control the diameter of the resulting assemblies as required.
(58) The dispersion of the present invention may be used for delivering an encapsulated substance. An advantage of the present invention is that the albumin shell of the assemblies is preferentially taken up in tumors and sites of inflammation. Thus the assemblies are suited for delivering substances to such loci. Accordingly, suitable substances for incorporation into the assemblies include anti-cancer drugs, anti-inflammatory drugs and combinations of these. In this context, a drug may be considered as any substance capable of treating the particular condition (cancer, inflammation). It may be an organic substance, an inorganic substance, an ionic substance, a metallic substance, an organometallic substance or may be a combination or mixture of any two or more of these or may be more than one of these. The substance may be releasable from the assemblies. It may be releasable over an extended time, e.g. over a time of from about 1 minute to about 1 month. The extended time may be for example about 1, 2, 3, 4, 5, 10, 20, 30, 40 or 50 minutes, or about 1, 2, 3, 4, 5, 6, 12, or 18 hours or about 1, 2, 3, 4, 5 or 6 days or 1, 2, 3 or 4 weeks, or may be some other time. It may be a time on the order of minutes, hours, days, weeks or months.
(59) Following formation of the assemblies, they may be crosslinked. This may serve to render them more resilient, or less likely to disintegrate, or more resistant to aggressive environmental conditions (e.g. temperature, pressure, pH, protein denaturing agents etc.). The step of crosslinking may comprise crosslinking the albumin portions of the albumin derivatives molecules. It may comprise exposing the assemblies to a crosslinking agent under suitable crosslinking conditions. The crosslinking agent may be a compound having at least two (optionally 3, 4 or 5 or more than 5) functional groups capable of reacting with functional groups on the albumin, e.g. capable of reacting with amine groups on the albumin. Examples of such crosslinking agents include dialdehydes. These may be of formula CHO(CH.sub.2).sub.nCHO. In this formula, n may be an integer from 0 to 10, e.g. 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. A suitable crosslinking agent is glutaraldehyde. In this instance, the crosslinking may simply require exposure of the assemblies to aqueous dialdehyde at ambient temperature, or for example about 20 to about 50 C.
(60) The crosslinking may be conducted before loading the assemblies with a bioactive substance or may be conducted after loading the assemblies with a bioactive substance or may be conducted concurrently with the step of loading the assemblies with a bioactive substance. The step of crosslinking may be conducted at ambient temperature or at any other suitable temperature.
(61) At any suitable stage during or after the formation of the assemblies, unreacted starting materials such as uncoupled polymer, uncoupled albumin, excess crosslinker (if used) or unbound substance, may be removed by a suitable means. The suitable means will depend on the stage of formation and the nature of the material to be removed, and may include one or more of filtration, centrifugation, microfiltration, ultrafiltration, settling and dialysis.
(62) The dispersion of assemblies described herein may be used for manufacturing a medicament for treatment of cancer or for treatment of inflammation or both. It will be understood that to do so, the assemblies should contain a suitable substance for treating the cancer or inflammation or both. The invention also encompasses the use of the dispersion for the treatment of a condition in a patient, commonly for the treatment of a cancer or inflammation. The cancer may be a primary cancer or may be a metastatic cancer. It may be bladder cancer, breast cancer, colorectal cancer, endometrial cancer, kidney cancer, liver cancer, leukemia, lung cancer, melanoma, other skin cancer, non-Hodgkin lymphoma, pancreatic cancer, prostate cancer or thyroid cancer, or may be some other cancer. The patient may be a human or may be a non-human. The patient may be a non-human primate or non-human mammal or non-mammal.
(63) The invention also encompasses a pharmaceutical or veterinary composition for treatment of a condition, e.g. cancer or an inflammation, comprising the dispersion of the present invention. The composition may additionally comprise one or more additives, e.g. one or more pharmaceutically or veterinarily acceptable carriers, diluents and/or adjuvants.
(64) In use of such a composition for treatment of a condition, it will be apparent to one of ordinary skill in the art that the optimal quantity and spacing of individual dosages will be determined by the nature and extent of the disease state being treated, the form, route and site of administration, and the nature of the particular individual being treated. Also, such optimum conditions can be determined by conventional techniques.
(65) It will also be apparent to one of ordinary skill in the art that the optimal course of treatment, such as, the number of doses of the composition given per day for a defined number of days, can be ascertained by those skilled in the art using conventional course of treatment determination tests.
(66) These compositions can be administered by standard routes. In general, the compositions may be administered by the parenteral (e.g., intravenous, intraspinal, subcutaneous or intramuscular), oral or topical route. In some cases the administration may be by direct injection to the diseased site, e.g. direct injection into a tumor.
(67) The carriers, diluents and adjuvants should be acceptable in terms of being compatible with the other ingredients of the composition, and not deleterious to the recipient thereof.
(68) Examples of pharmaceutically acceptable carriers or diluents are demineralised or distilled water; saline solution; lower alkanols, for example ethanol or iso-propanol; lower aralkanols; lower polyalkylene glycols or lower alkylene glycols, for example polyethylene glycol, polypropylene glycol, ethylene glycol, propylene glycol, 1,3-butylene glycol or glycerin; polyvinylpyrridone; agar; carrageenan; gum tragacanth or gum acacia, and petroleum jelly. Typically, the carrier or carriers will form from 10% to 99.9% by weight of the compositions.
(69) The compositions of the invention may be in a form suitable for administration by injection, in the form of a formulation suitable for oral ingestion (such as capsules, tablets, caplets, elixirs, for example), in an aerosol form suitable for administration by inhalation, such as by intranasal inhalation or oral inhalation, in a form suitable for parenteral administration, that is, subcutaneous, intramuscular or intravenous injection, or in the form of a suppository.
(70) For administration as an injectable solution or suspension, non-toxic parenterally acceptable diluents or carriers can include, Ringer's solution, isotonic saline, phosphate buffered saline, ethanol and 1,2 propylene glycol.
(71) Adjuvants typically include emollients, emulsifiers, thickening agents, preservatives, bactericides and buffering agents.
(72) Methods for preparing parenterally administrable compositions are apparent to those skilled in the art, and are described in more detail in, for example, Remington's Pharmaceutical Science, 15th ed., Mack Publishing Company, Easton, Pa., hereby incorporated by reference herein.
Example 1
(73) Polymer-protein amphiphiles were prepared having maleimide-terminated poly(methyl methacrylate) (PMMA) chains extended via Reversible Addition-Fragmentation Chain-Transfer (RAFT) polymerisation and then conjugated to Bovine Serum Albumin (BSA) via thiol-ene reaction with the deprotected maleimide functionality of the polymer. Conversion of monomer was determined by 1H-NMR Spectroscopy and Gel Permeation Chromatography (GPC). Deprotection of the maleimide moiety to increase polymer functionality was confirmed by 1H-NMR Spectroscopy. Model biofunctional micelles were developed from the self-assembly of the amphiphiles with hydrophobic PMMA cores and hydrophilic BSA shells for the encapsulation of hydrophobic Curcumin anti-cancer drugs. Blank aggregates produced particle diameters as low as 44 nm as measured by Dynamic Light Scattering (DLS). Preliminary Curcumin-encapsulated aggregates with a drug to polymer ratio of 1:15 produced particles of 51 nm and 69 nm for PMMA-3000 and 5000 chains respectively. TEM analysis was undertaken to confirm the structures of the aggregates in solution. The encapsulation efficiency and drug release of Curcumin was monitored using UV-Vis Spectroscopy. Cytotoxicity studies revealed that the Curcumin-loaded aggregates had a more pronounced effect on cancer cells as compared to free Curcumin, requiring just 59% and 32% (for PMMA-3000 and PMMA-5000 aggregates) of the amount of free Curcumin required to inhibit cell growth by 50%.
(74) Harmful side-effects, low drug efficacy, and drug-resistance in cancer cells are often the result of traditional anti-carcinogenic drugs, and so recent research has been directed into improving their cellular uptake in cancerous cells. The anti-carcinogenic properties of the polyphenol Curcumin derived from Turmeric are well known, however its severe hydrophobicity results in poor solubility, rapid removal by the immune system and poor circulation times within the bloodstream. To overcome these limitations a range of nano-sized targeted drug-delivery mechanisms may be used to carry the drugs through the body virtually undetected. The drugs are ideally released from the carriers after preferentially accumulating in tumorous areas by the Enhanced Permeability and Retention Effect to cause the death of cancerous cells with minimal exposure to healthy bodily cells.
(75) Amphiphilic block copolymers are promising and widely studied molecules for such carriers, which under the right environmental conditions and block configurations can self-assemble to form polymeric micelles with hydrophilic outer shells that facilitate passage through the bloodstream, and cores which can solubilise hydrophobic drugs. Due to their unique size range (as low as 20-150 nm), polymeric micelles are able to overcome multiple biological barriers, such as avoidance of the Mononuclear Phagocyte System (typically less than 100 nm).
(76) It was considered a promising avenue to build on these structures by replacing these hydrophilic surfaces with aqueous human proteins such as albumin, which might significantly increase biofunctionality and circulation time in the body, and thus the effectiveness of the anticancer drugs. The inherent specificity of proteins in biological systems makes them suitable for use as therapeutic agents and potentially overcomes these issues experienced with traditional polymeric micelles, and the attachment of polymer chains to proteins can significantly improve properties such as stability.
(77) Of the vast range of polymerisation methods available, Reversible Addition-Fragmentation Chain-Transfer Polymerisation (RAFT) shows great promise in the development of these polymer-protein conjugate carrier systems. The high level of control in RAFT polymerisation allows the creation of a variety of desired sizes and shapes of polymers much more easily than conventional methods, and its living nature allows easy conjugation to other structures such as proteins.
(78) The present experiment illustrates a systematic approach to the development of a drug carrier system for the hydrophobic drug Curcumin. Polymer-protein conjugates are synthesised through the thiol-ene click reaction of a tailored deprotected maleimide functional end-group PMMA chain, extended via RAFT polymerisation, to Bovine Serum Albumin. The amphiphiles are self-assembled in aqueous solution to form aggregates of a desirable size. The encapsulation efficiency, release rate and in vitro cytotoxicity of Curcumin post-encapsulation are evaluated, and optimal carrier-system characteristics are investigated.
Experimental
(79) Materials
(80) Unless otherwise specified, all chemicals were reagent grade and used as received. 4,4-azobis(4-cyanopentanoic acid) (Fluka, 98%), 4-(dimethylamino)pyridine (Aldrich, >99%), acetonitrile (Aldrich, 99.8%), AIBN (azobisisobutyronitrile, Aldrich, 99.8%), anhydrous methanol (Sigma-Aldrich, 99.8%), benzyl chloride (Aldrich, 99%), bovine serum albumin (Sigma, >96%), chloroform-D (CIL, 99.8%), copper (II) sulphate pentahydrate (BDH, 99.5%), Curcumin (Sigma), diethyl ether (Ajax, 98%), dimethylacetamide (Sigma-Aldrich, 99.9%), dimethyl sulfoxide (Ajax, 98%), elemental sulphur (Ajax, 98%), ethanolamine (Ajax, 97%), ethyl acetate (Ajax, 99%), furan (Aldrich, >99%), hydrochloric acid (Ajax, 31.5% w/w), maleic anhydride (Fluka, >99%), n-Hexane (Ajax, >95%), N,N-dimethylformamide (Ajax, 99.8%), N,N-dicyclohexylcarbodiimide (Aldrich, 99%), PEGMEMA (Aldrich), petroleum ether (Ajax, >95%), potassium ferricyanide (Sigma-Aldrich, 99%), pyroneg (Johnson Diversey), silica gel (Sigma-Aldrich, 60 , 70-230 mesh), sodium hydroxide (Fluka, 0.1 M), sodium methoxide (Fluka, >97%), sodium phosphate dibasic (Sigma-Aldrich, 98%), sodium phosphate monobasic (Sigma-Aldrich, >99%), tetrahydrofuran (Fisher Scientific, HPLC Grade, >99.9%), and toluene (Ajax, 99%) were used as received. Methyl methacrylate (Aldrich, 99%, <30 ppm MEHG inhibitor) was purified by passing through a column of activated basic alumina to remove inhibitor.
(81) Analysis.
(82) Proton Nuclear Magnetic Resonance (1H-NMR) Spectroscopy.
(83) All NMR measurements were performed using a Bruker DPX-300 with a .sup.1H/X inverse broadband z gradient BBI probe at 300 MHz frequencies and using 16 scans as default. Samples were dissolved and analysed in deuterated chloroform (CDCl.sub.3).
(84) Dynamic Light Scattering (DLS).
(85) DLS was performed by preparation of 1 mg.Math.mL.sup.1 aqueous solutions of protein-polymer aggregates filtered through 0.45 m filters and analysis on a Brookhaven ZetaPlus Particle Sizer at 25 C. with a Dust-Cutoff of 40.
(86) Gel Permeation Chromatography (GPC).
(87) GPC was performed using a Shimadzu modular system containing a DGU-12A degasser, an LC-10AT pump, an SIL-10AD automatic injector, a CTO-10A column oven and a RID-10A refractive index dector. A 507.8 mm guard column and four 3007.8 mm linear columns (500, 10.sup.3, 10.sup.4, 10.sup.5 pore size, 5 m particle size) were used for analyses. N,N-dimethylacetamide (HPLC grade, 0.05% w/v BHT, 0.03% w/v LiBr) with a flow rate of 1 mL.Math.min.sup.1 was used as the mobile phase. The injection volume was 50 L. The samples were prepared by dissolving 2-3 mg.Math.mL.sup.1 of the analyte in N,N-dimethylacetamide, followed by filtration through a 0.45 m filter. The unit was calibrated using commercially available linear polystyrene standards (0.5-1000 kDa, Polymer Laboratories).
(88) Transmission Electron Microscopy (TEM).
(89) TEM analyses were performed using a JEOL1400 TEM at 80-100 kV beam voltage. Samples were prepared by placing a droplet of solution on formamide and graphite-coated copper grids and draining the excess using filter paper. Stained samples were exposed to uranyl acetate (3% aqueous solution) for 20 seconds once completely dry.
(90) Ultraviolet-Visible Spectroscopy (UV-Vis).
(91) UV-Vis measurements were performed on a double-beam Varian Cary-300 UV-Vis Spectrophotometer (PerkinElmer Differential Scanning calorimeter) (<5 Abs, =190-900 nm) over the visible range (=400-800 nm) at 25 C. Samples containing Curcumin were dissolved in N,N-dimethylformamide and measured in a quartz cell with a 10 mm path length.
(92) Synthesis and Methods.
(93) Synthesis of Protected Maleimide CPADB RAFT agent. Maleic anhydride (30.0 g, 306 mmol) was suspended in 150 mL of toluene and the mixture warmed to 80 C. Furan (33.4 mL, 459 mmol) was added via syringe and the turbid solution stirred for 24 hours in an oil bath at this temperature. After cooling for 1 hour at ambient temperature the resulting white crystals were collected by filtration and washed with 230 mL of petroleum ether to obtain 44.4 g (267 mmol, 87% yield) of small white needles. To a dry 100 mL round-bottomed flask, this was added (10.0 g, 60.2 mmol) with anhydrous methanol (20 mL) and ethanolamine (3.68 g, 60.2 mmol). The mixture was brought to reflux under stirring and the solution turned dark orange. After 24 hours, the reaction mixture was cooled to room temperature and product began to crystallize after 2 hours. The mixture was stored in the freezer overnight, and the precipitate was collected by vacuum filtration. The filtrate volume was reduced by rotary evaporation and allowed to crystallize, and a second crop of crystals was collected (yield 59%). This protected maleimide alcohol (0.25 g, 1.2 mmol), CPADB (4-cyanopentanoic acid dithiobenzoate, 0.29 g, 1.1 mmol), and DMAP (4-dimethylaminopyridine, 14 mg) were dissolved in dry THF (20 mL). DCC (dicyclohexylcarbodiimide, 0.27 g) was then added and the reaction mixture was stirred at room temperature for 4 hours. The reaction was monitored by TLC (hexane:EtOAc=2:1) and the third spot was the product. The reaction mixture was filtered to remove the white precipitate. The filtrate was concentrated enough to afford crude red oil and the crude was further purified by silica column chromatography (using 3:1 hexane:EtOAc to wash out the first two side product and 1:1 hexane:EtOAc to wash out the target compound) (0.34 g). .sup.1H NMR (300 MH.sub.z, CDCl.sub.3) S=7.75 (t, 2H), 7.42 (t, 1H), 7.25 (t, 2H) 6.38 (t, 2H), 5.12 (t, 2H), 4.13 (t, 2H), 3.60 (t, 2H), 2.70 (m, 2H), 2.2-2.5 (m, 4H), 1.78 (s, 3H)
(94) Polymerisation of Methyl Methacrylate with Protected Maleimide RAFT Agent.
(95) Protected maleimide RAFT agent (70 mg, 0.148 mmol), AIBN initiator (4.89 mg, 0.03 mg) and methyl methacrylate monomer (447 mg, 4.47 mmol) were dissolved in toluene and the polymerisation was carried out at 70 C. for 20 hours under an inert, dry atmosphere. After quenching the reaction with liquid nitrogen and letting in air, the mixture was dried in an aluminium pan in a vacuum oven overnight at 40 C. .sup.1H-NMR Spectroscopy was used to determine conversion. .sup.1H NMR (300 MHz, CDCl.sub.3) =6.30 (s, 1H), 5.72 (s, 1H), 3.78 (t, 3H), 1.30 (s, 1H)
(96) Deprotection of End-Functionalised Poly(Methyl Methacrylate).
(97) 2 g of polymer was dissolved in 10 mL toluene and the solution was brought to reflux for 24 hours. The solvent was evaporated and further dried in a vacuum oven at 40 C. overnight to afford the target maleimide-terminated PMMA. The formation of the deprotected maleimide group was confirmed by .sup.1H-NMR with the presence of a new proton peak at near 6.5.
(98) Conjugation of Bovine Serum Albumin to Poly(Methyl Methacrylate) Polymer Chains.
(99) Polymer (0.8 mol) was dissolved in 2 mL of DMSO and the solution was added dropwise over 4-6 hours via syringe pump into a solution of bovine serum albumin (0.5 mol, 34 mg) in 8 mL of PBS buffer (0.1 M, pH 7.0) under stirring. The mixture was stirred for 48 hours and subsequently dialyzed against deionised water using a MWCO=14000 dialysis membrane. After dialysis, the mixture was subjected to a brief sonication for 5 min and centrifugation (2000 g5 min) to remove un-reacted PMMA polymer, and passed through a 0.45 m (Millipore) filter to remove large particles.
(100) Measurement of Encapsulation Efficiency and Drug Release Rate.
(101) The conjugation of Bovine Serum Albumin to deprotected Poly(Methyl Methacrylate) chains was repeated, this time with the incorporation of Curcumin (0.16 mol) dissolved in DMSO into the PMMA/DMSO solution before reaction. A calibration curve was created testing the absorbance of a range of concentrations of Curcumin dissolved in DMF (0.001-0.03 mg.Math.mL.sup.1) through UV-Vis Spectroscopy (=430 nm). The polymer-protein conjugate sample was analysed by UV-Vis following freeze-drying and dissolution in DMF, with the results compared to this graph. The remainder of the aggregate solution in the dialysis membrane was kept submerged in deionized water, with samples taken out periodically over 10 days, freeze-dried, dissolved in DMF, and analysed by UV-Vis.
(102) Cytotoxicity Tests. Human Ovarian Carcinoma A2780 cells were cultured in tissue culture flasks with Medium RPMI1640 supplemented with 10% foetal bovine serum at 37 C. under a 5% CO.sub.2 atmosphere. After reaching confluency, cells were collected from the flasks with Trypsin/EDTA treatment. The cell suspension was then seeded into a 96-well cell culture plate at a cell density of 40,000 cells.Math.mL.sup.1, 200 After incubation for one day, the cell in the plate was subsequently used for cytotoxicity testing. This involved firstly sterilising the micelles by UV irradiation for 1 hour, and serially diluting by half the solution with sterile water. The medium in the cell culture plate was discarded and replaced with 100 L of fresh twice-concentrated RPMI1640 medium and the cells were incubated with the micelles for 72 hours. The cell viability was then investigated first by addition of cold TCA. The culture medium was discarded and 100 L of 10% TCA was added to each well, followed by incubation of the plates for 30 min at 4 C. The supernatant was discarded and the plates washed 5 times with water and air-dried. 100 L of SRB solution 0.4% (w/v) in 1% acetic acid was added to each well, and the plates incubated for 15 minutes at room temperature. After staining, the unbound dye was removed by washing 5 times with 1% acetic acid and the plates air-dried. Bound stains were solubilised with 200 L 10 mM Tris Buffer and absorbance was measured on a Bio-Rad BenchMark microplate reader (=490 nm), with data analysed and plotted.
Results and Discussion
(103) Synthesis of Protected Maleimide CPADB RAFT Agent.
(104) The procedure described above resulted in the grafting of a protected maleimide endgroup to regular CPADB RAFT agent. The furan used in one of the reactions acted to protect the maleimide functionality to increase its compatibility in radical polymerisation processes later on in the work. Without this protection the direct use of a maleimide agent would have most likely led to branching during polymerisation steps. The furan Diers-Alder reaction is reversible, allowing the recovery of the desired maleimide moiety post-polymerisation.
(105) It was in these steps that the true value of RAFT polymerisation to this research was revealed, through the ability to fine-tune RAFT agent functionalities present at the -end (or -end in some cases) for further reaction with a range of important molecules. In the case of this work, such an important molecule was Bovine Serum Albumin through thiol-ene click chemistry with the deprotected maleimide endgroup of the -end-functionalised RAFT polymer.
(106) Polymerisation and Deprotection of Methyl Methacrylate with Protected Maleimide RAFT Agent.
(107) PMMA was primarily chosen as the suitable hydrophobic block due to its high stability with the specific chosen RAFT agent. Recent studies have investigated the effect of hydrophobic block length on polymer-protein micelle size, and concluded that cores below 8000 Da produced Average Number Distributions less than 100 nm as measured by DLS (dynamic light scattering). This was used as the basis for creating PMMA polymers of about 3000 Da and 5000 Da chain length to be used for a majority of investigations in this research in order to attempt to form aggregates well-below this 100 nm cut-off to avoid uptake by the Mononuclear Phagocyte System.
(108) The resulting polymer chains contained a thiocarbonylthio moiety. Concerns regarding the potential toxicity of RAFT agents have been addressed in several studies showing that the toxicity can be neglected. GPC analysis of the polymers showed narrow unimodal peaks and PDI values of 1.31 and 1.26 for the PMMA-3000 and PMMA-5000 chains respectively, as expected by controlled radical RAFT polymerisation. Conversion of monomer to polymer was determined by integrating the area under the monomer and polymer peaks at 6.3 and 5.7 ppm by .sup.1H-NMR Spectroscopy, yielding 78% and 64% for the PMMA-3000 and PMMA-5000 chains respectively.
(109) Deprotection of the maleimide group attached to the polymer chains was only successful after 24 hours reflux in toluene tha. The success of this reversal of the Diels-Alder reaction in order to end-functionalise the polymer chains after chain extension was evidenced by disappearance of the peaks at 6.3 and 5.7 ppm and appearance of a peak near 6.7 ppm by .sup.1H-NMR Spectroscopy, as shown in
(110) Conjugation of Bovine Serum Albumin to End-Functionalised PMMA Polymers and the Preparation of Polymer-Protein Micelles.
(111) Following deprotection, the polymers were dissolved in DMSO and added dropwise very slowly to a BSA in Phosphate Buffer Solution. This mixture was left to stir for 48 hours to allow the thiol-ene click-conjugation reaction of the end-functionalised PMMA chains to the thiol groups of BSA, as shown schematically in
(112) DLS analysis was used to determine particle size of the polymer-protein aggregates after they were dialysed. Initial analyses showed Average Number Distributions around 51 nm and 121 nm for PMMA-3000 and PMMA-5000 conjugated solutions respectively, although optimisation of aggregate preparation later yielded well-defined DLS Number Distributions as low as 44 nm. It was found that using an excess of hydrophilic BSA helped to stabilise the aggregates and resulted in better particle size distributions, and investigation into the optimal ratio of solvents found that much smaller, well-defined aggregates were formed using a DMSO to Buffer ratio of 3:7.
(113) On preliminary encapsulation of Curcumin drugs, DLS analysis measured Average Number distributions of 68 nm and 122 nm for PMMA-3000 and PMMA-5000 conjugated solutions respectively, with Curcumin incorporated in a 1:5 ratio with polymer. Again, optimisation of the aggregation process led to improved distributions, as low as 51 nm and 69 nm for PMMA-3000 and PMMA-5000 conjugated solutions, as shown in
(114)
(115) Determination of Curcumin Encapsulation Efficiency and Drug Release Rate.
(116) After the formation of polymer-protein Curcumin carrying micelles of a desirable size, there was a clear need to determine the amount of Curcumin actually encapsulated. Preliminary aggregates were loaded with Nile Red dye to act as a makeshift drug and analysed by Fluorescence Spectroscopy. After comparison to a Calibration curve established from analysis of Nile Red concentrations dissolved in DMSO solvent, the intensity was backcalculated to yield a 30.4% encapsulation efficiency.
(117) A linear Calibration Curve was then established for Curcumin dissolved in DMF. Loaded with a 1:15 Curcumin to polymer molar ratio, a polymer-protein micelle solution from each of the two deprotected polymer chains was prepared. Small samples were taken from the two solutions following dialysis, freeze-dried, dissolved in DMF, and analysed by UV-Vis Spectroscopy. The Calibration Curve was used to calculate the concentrations of Curcumin in DMF from their absorbance results, and back-calculating gave the concentration in the original solution. A 53.7% Curcumin encapsulation efficiency was yielded from this method for PMMA-3000 conjugated aggregates and an even better 64.1% efficiency was achieved for PMMA-5000 aggregates. The higher efficiencies of Curcumin drugs over Nile Red drugs are attributed to a better compatibility with PMMA.
(118) The remainder of the aggregate solutions were kept in dialysis membranes submerged in deionised water, and samples were taken of each at pre-determined time intervals to measure the drug release rate of Curcumin. The samples were freeze-dried and dissolved in DMF, and likewise analysed by UV-Vis, with their concentrations backcalculated from absorbance measurements. Samples were taken at 24, 48, 53, 72, 97, 169, 192, 217 and 240 hours, and the resulting decline in Curcumin encapsulation over a period of 10 days is shown in
(119) It can be seen that both samples experience the most drug release in the first 24-48 hours, with the PMMA-3000 conjugated sample dropping significantly from 53% to about 21% encapsulation, and the PMMA-5000 sample dropping from 64% to 28%. Both samples mostly plateau after this point for the next 7 or 8 days with about 8 and 14% final encapsulation respectively, appearing to almost reach a steady state with the surrounding environment.
(120) Cytotoxicity Tests.
(121) Following characterisation of the micelle system formed and showing it could effectively encapsulate and release Curcumin over time, the overall toxicity of the drug carriers on a cell line was then tested. The cytotoxicity study dosed Human Ovarian Carcinoma Cells with PMMA-3000 and PMMA-5000 conjugated solutions loaded with Curcumin in a 1:15 molar ratio with Polymer and a 1 mg.Math.mL.sup.1 final polymer concentration.
(122) The results of the cytotoxicity study are shown in
(123) Conclusion
(124) In this Experiment, the novel production of polymer-protein amphiphiles and their potential as Curcumin drug carriers was evaluated. From the synthesis of a tailored end-functionalised RAFT agent, protected maleimide-terminated poly(methyl methacrylate) chains were extended and successfully conjugated to Bovine Serum Albumin proteins following the deprotection of the maleimide moiety via thiol-ene click chemistry. These amphiphiles were self-assembled in water to form favourably-sized micelles as low as 44 nm in diameter, verified by Dynamic Light Scattering and Transmission Electron Microscopy. On encapsulation of hydrophobic Curcumin drugs inside the hydrophobic cores, aggregation was similarly confirmed, with well-defined particles around 60 nm in diameter. It was found that better aggregation and particle size was achieved in an excess of albumin, a 3:7 DMSO to buffer ratio, and addition of Curcumin to polymer solution prior to conjugation. To then test the efficacy of the aggregates, Ultraviolet-Visible Spectroscopy was utilised to reveal an approximately 60% Curcumin encapsulation efficiency within the drug-carriers, and subsequent analysis of drug release rates revealed approximately 70% of the newly encapsulated Curcumin was released within 48 hours. Cytotoxicity studies then revealed the much higher activity and effectiveness of Curcumin within drug carriers, requiring as little as 32% of the concentration of free Curcumin required to inhibit cell-death by 50%. The development of these delivery systems is therefore crucial to the effectiveness of anti-carcinogenic drugs, with protein-polymer micellisation using functionalised RAFT polymerisation clearly a promising avenue of research to overcome issues in effective targeted anti-cancer drug delivery.
Example 2
Polymer-BSA Conjugate for the Facilitated Transport of Macromolecular Platinum Drugs
(125) An attractive target available for conjugation of a drug to bovine serum albumin (BSA) is the free thiol functionality derived from the amino acid cysteine (cyteine-34). Approximately 70% of circulating albumin in the blood stream contains this accessible cyteines-34. Cysteine-34 is located in a hydrophobic depression approximately 10-12 below the surface of the protein, A disadvantage with this approach is that usually only one drug molecule can be loaded per albumin molecule.
(126) An alternative method, which is the focus of this Example, is the formation of polymer-protein conjugates.
(127) Maleimides are an excellent functional group for chemical attachment of polymers to proteins. Maleimides can also function as monomers during radical polymerization, thus the protection of maleimide to shield the moiety during polymerization and side reactions is important. Polymerization processes such ATRP and RAFT give well-control polymerisation processes which give rise to a narrow molecular weight distribution and afford control over the chemical structure and molecular weights. These polymerization methods can be used to design maleimide terminated ATRP initiators and maleimide-terminated RAFT agents to give rise to polymer-protein conjugates with reactive groups for protein attachment on the polymer chain-ends.
(128) In this Example, a protein-polymer conjugate with platinum drugs was synthesised and the cytotoxicty was investigated. A maleimide-RAFT agent derived from CPADB was synthesised to obtain a maleimide-terminated statistical copolymer of PHPMA and acrylate with platinum conjugation sites. Characterisation was carried out using NMR in d-CDCl.sub.3 and DMSO. Quantification of platinum content on the copolymer was determined using TGA. Due to availability of free thiol on the cysteine-34, BSA was used as a model protein for protein conjugation. A fluorescein isothiocyanate (FITC) labelled BSA (BSA-FITC) was synthesised and conjugated to the copolymer via thiol-maleimide reaction in PBS buffer. BSA quantification was carried out using UV-Vis, fluorescence spectroscopy and sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS PAGE).
(129) Experimental
(130) Materials
(131) The following chemicals are given below and used as received unless stated otherwise. N-(2-Hydroxypropyl) methacrylamide (HPMA, Sigma), acryloyl chloride (97%, Fluka), triethylamine (Et.sub.3N, 99.5%, Sigma-Aldrich), DCC (Sigma), DMAP (Sigma), N,N-dimethyl acetamide (DMAc; Aldrich, 99.9%), hydrochloric acid (HCl, 32%, Univar)dimethyl sulfoxide (DMSO; Ajax, 98.9%), dimethylformaldehyde (DMF; Aldrich), diethyl ether (Univar), petroleum spirit (Aldrich), tetrahydrofuran (THF) and methanol were used without any further purification. 2,2-Azobisisobutyronitrile (AIBN) was dissolved and recrystallized from methanol Protected Maleimide CPADB RAFT agent 4-(2-hydroxy-ethyl)-10-oxa-4-aza-tricyclo[5.2.1.02,6]-dec-8-ene-3,5-dione was synthesised as described in Example 1.
(132) Analysis
(133) .sup.1H-NMR spectra were acquired to characterised compounds using CDCl.sub.3 or d-DMSO with a 300 MHz spectrometer. Thermogravimetric analysis (TGA) was carried out using TG5000 to quantify the amount of platinum conjugated to the copolymers. The sample (5 mg) was placed on a thermo-balance and heated from room temperature to 600 C. at 20 C./min, and held for an isothermal period of 60 minutes under nitrogen atmosphere. Diameter size of copolymers in 0.1M PBS buffer pH 7.0 was measured using a Malvern dynamic light scattering instrument (DLS) in a disposable plastic cuvette (1 cm path length). Fluorescence measurements were performed on Agilent Cary Eclipse Fluorescence Spectrometer using a 1 cm quartz cuvette. Fluorescence spectra were recorded between 400-800 nm at .sub.ex=495 nm, .sub.em=520 nm with entrance and exit slit width of 5 mm. SDS-PAGE was performed using standard techniques using a premixed electrophoresis buffer which contains 25 mM Tris, 192 mM glycine and 0.1% SDS (Tris/Glycine/SDS buffer) to determine the conjugation efficiency between the BSA-FITC and the copolymer. Samples were prepared for electrophoresis without the use of a reducing agent. The samples were mixed with bromophenol blue (0.01% w/v) solution as the marker. The samples were resolved through a 10% polyacrylamide gel which was performed using a BioRad Mini-Protean II electrophoresis setup at a constant voltage (150 V). The samples were stained using Colloidal Blue Coomassie G-250 (Bio-Rad), and left overnight. Gel images were recorded using a Bio-Rad GS-800 calibrated densitometer. Native BSA was used as a control.
(134) Synthesis and Procedures
(135) Synthesis of N-BOC Protected 1,3-Diaminopropanol Acrylate Monomer (DAP-BOC-AC):
(136) DAP-BOC (6.00 g, 20.6 mmol) and Et3N (3.00 mL, 21.7 mmol) was dissolved in anhydrous THF (20.00 mL) and purged with nitrogen for 15 minutes. A solution of acryloyl chloride (2.20 mL, 22.6 mmol) in anhydrous THF (20 mL) was then added to the reaction dropwise with constant stirring and cooled in an ice bath at 0 C. After the addition of acryloyl chloride, the reaction mixture was left to stir for 1 hour and then removed from the ice bath to stir under room temperature for 24 hours. The precipitated Et.sub.3N salt was filtered off and washed with THF and the solvent in the filtrate was evaporated under reduced pressure on a rotary evaporator producing a yellow liquid product. The liquid was stored in the fridge overnight yielding white crystals. The crystals were collected by filtration and recrystallised in THF. (Yield: 62%)
(137) RAFT Polymerisation of HPMA and DAP-BOC-AC Using Protected Maleimide Terminated RAFT Agent, P(HPMA-co-Ac-DAP-BOC):
(138) N-(2-Hydroxypropyl) methacrylamide (0.093 g, 0.68 mmol), Ac-DAP-BOC (4) (0.1 g, 0.29 mmol), MCPADB (3) (15.3 mg, 0.033 mmol) and AIBN (1.6 mg, 0.0098 mmol) were dissolved in 1 mL of DMSO. The reaction mixture was purged with nitrogen for 30 minutes. The reaction mixtures were then immersed in an oil bath at 70 C. for 8 hours. The polymerization was terminated by placing the samples in an ice bath for 5 minutes. The polymer was purified three times by dissolution in additional acetone and then precipitation in diethyl ether. After centrifugation (7000 rpm for 15 min), the polymer was dried under reduced pressure at room temperature. The samples were stored in a freezer prior to any modifications. The conversions are calculated from the reaction mixture via .sup.1H NMR.
(139) Removal of BOC Protective Group:
(140) The polymer was dissolved in 1 mL DMF, followed by 3 drops of concentrated hydrochloric acid 32 (w/v %). The reaction was left to stir over night at r.t and the polymer was purified by precipitation in diethyl ether. After centrifugation (7000 rpm for 15 min), the polymer was dried under reduced pressure at room temperature.
(141) Conjugation of Platinum-DMSO Complex onto Copolymers:
(142) The copolymer with active conjugation sites was dissolved in DMF and 1 eq. of Pt(DMSO).sub.2Cl.sub.2 complex was added. The reaction was stirred for 24 hours at room temperature. Lithium chloride (5 mol eq.) was added into the solution and reacted for another 6 hours at 80 C. The reaction mixture was cooled to ambient temperature and purified via dialysis against deionised water (DI) using MWCO 3500 over 2 days. After freeze-drying, a brown solid of Pt-conjugated copolymers was obtained. TGA was used to determine the platinum content on the copolymer.
(143) Cleavage of Furan Protection Groups on the Maleimide Copolymer:
(144) The deprotection of furan protection group was performed in situ during the platinum conjugation reaction during heating at 80 C. for 6 hours. The reaction mixture was cooled and purified as the above method.
(145) Synthesis of BSA-FITC Polymer Conjugate
(146) Synthesis of BSA-FITC:
(147) A 2 mg/ml BSA solution was made using 100 mg BSA in 50 ml of 0.1M NaCO.sub.3 buffer. A 1 mg/ml FITC solution was made using 2.5 mg of FITC in 2.5 ml DMSO. The FITC solution was added into the BSA solution and stirred for 24 hours. The mixture was dialysed against 0.1 M PBS buffer for 3 days to obtain a yellow solution. The concentration of BSA used and the molar ratio of BSA to FITC were determined using UV-Vis.
(148) Conjugation of BSA-FITC and Maleimide-Copolymer:
(149) Platinum conjugated copolymer (0.7 mg, 0.04 mol, 31% end-group fidelity) was dissolved in 0.2 mL of DMSO and was added dropwise into a solution of BSA-FITC (0.7 mg, 0.01 mol) in 4 mL of PBS buffer (0.1M, pH 7.0) under stirring. The mixture was stirred for 48 hours at room temperature and subsequently dialysed against 0.1M PBS buffer for 24 hours. After dialysis, the supernatant containing BSA-polymer conjugate was finally collected and analysed by fluorescence spectroscopy, SDS PAGE and DLS.
(150) Cell Culture
(151) The OVCAR-3 cell line were grown as monolayer cultures in cell culture flasks using Roswell Park Memorial Institute (RPMI-1640) media containing 10% Foetal Bovine Serum (FBS) and 5 mL of L-Glutamine-Penicillin-Streptomycin solution (with 200 mM L-glutamine, 10,000 units penicillin and 10 mg/mL streptomycin in 0.9% NaCl, sterile-filtered). Penicillin was added as an antibiotic. Cell cultures were grown in a humidified atmosphere at 5% CO.sub.2 at 37 C. The medium was routinely changed every 3 days. For subculture experiments, cells grown in monolayer were released by washing with PBS (10 mL) and then treatment with 0.05% of trypsin/EDTA.
(152) In Vitro Cell Proliferation Assay
(153) The cytotoxicity of the polymer, platinum incorporated polymer and BSA-conjugated micelles were measured by a standard sulforhodamine B colorimetric proliferation assay (SRB assay). The SRB assay was established by the U.S. National Cancer Institute for rapid, sensitive, and inexpensive screening of antitumor drugs in microtiter plates. For the cytotoxicity assay, 100 L of OVCAR-3 cells were seeded in 96-well microtiter plates at a density of 5000 cells per well, and were allowed to adhere overnight. The growth medium was replaced with fresh medium (200 L) containing various concentration of test material. The cells were incubated for a further 72 hours.
(154) The culture medium was discarded and the live cells were fixed with 200 L of trichloroacetic acid 10% w/v (TCA) for 1 h at 4 C. before washing five times with tap water. After removal of water the TCA-fixed cells were stained with 0.4% (w/vol) SRB dye dissolved in 1% acetic acid for 30 minutes. The unbounded dye was then removed by washing five times with 1% acetic acid. The plates were left to air dry overnight followed by the addition of 100 l, of 10 mM unbuffered Tris base to each well to dissolve bounded dye. The absorbance was determined using a multiwell scanning spectrophotometer at a wavelength of 570 nm. Dose-response curves were plotted (values expressed as percentage of control (non-treated cells were used as controls). The optical density (OD) was used to calculate cell viability. IC50 inhibitory concentrations were estimated by regression analysis.
Cell viability(%)=(OD.sub.570,sampleOD.sub.570,blank)/(OD.sub.570,controlOD.sub.570,blank)100
BSA-FITC Conjugation
(155) BSA conjugation was implemented using the readily available free-cysteine (Cys-34) residue of the bovine serum albumin (BSA) via maleimide-thiol reaction. To allow conjugation of BSA to occur, the furan protected maleimide-RAFT copolymer was deprotected by heating to result in the reactive maleimide functionality. Refluxing a solution of the compound in toluene is typically applied for deprotection. Since the platination reaction included a step where the solution was heated at 80 C. with LiCl, it was assumed that the deprotection of maleimide may also proceed at this temperature. To verify this hypothesis, a control reaction using the protected RAFT agent only was carried out in DMSO at 80 C. The reaction was followed by 1H NMR to monitor the decrease of signal a, b and c of the protecting group (
(156) The characteristic signal of the resulting double bond (signal c) at 7.0 ppm increased over time but did not progress to full conversion.
(157) TABLE-US-00001 TABLE 1 Maleimide conversion of P(HPMA13- co-[(AC-DAP)9-Pt8]) using 1H NMR Intg. NMR Intg. NMR Conversion Copolymer Peak a.sup.b Peak c.sup.b (%).sup.c Unprotected Copolymer .sup.a 2.000 0.9000 31 .sup.a Unprotected copolymer of P(HPMA.sub.13-co-[(AC-DAP).sub.9-Pt.sub.8]) was obtained after platination and LiCl reaction in DMF at 80 C. for 6 hours .sup.bIntegrations (Intg.) of 1H NMR of the pure P(HPMA.sub.13-co-[(AC-DAP).sub.9-Pt.sub.8]) .sup.cCalculated from100* [Intg(peak c)/2]/[Intg(peak a)/2 + Intg(peak c)/2]
(158) Meanwhile, BSA was labelled with a fluorescent marker, fluorescein isothiocyanate (FITC), to allow monitoring of the final product in the cell experiments. FITC provides a simple method of attachment of a fluorescent dye through isocyanate with the primary amino groups available on protein as shown in
(159) The quantity of FITC attached on a BSA was calculated as a dye/protein molar ratio. Based on the absorbance values of the native BSA and BSA-attached FITC in
(160)
where A.sub.max is the absorbance at the wavelength maximum for FITC in solution, c is the BSA molar extinction coefficient (43824 M.sup.1 CF is the correction factor which is adjusts for the amount of absorbance at 280 nm caused by FITC (0.3000).
(161) Thus, from the equation, it can be determined that the concentration of BSA in PBS solution used is 2.54 10.sup.5 M. The degree of labelling moles of FITC per moles of BSA was calculated to be 2.1, using the equation below,
(162)
where is the molar extinction coefficient of FITC (68000 M.sup.1 cm.sup.1)
(163) It is known that conjugation of BSA can be performed using a simple reaction in PBS buffer at pH 6.5. As shown in
(164) It should be noted here that a three times-excess of polymer is needed, taking into account that only one third of polymer has been deprotected. It was not known if dialysis against PBS buffer can remove the excess polymer since the macromolecular drug is poorly soluble in water. Upon dialysis, unreacted polymers could potentially be entrapped in the core of the core-shell nanoparticle, which is coated by a layer of albumins (
(165) The size and shape of the BSA conjugated copolymer in PBS solution was investigated using DLS and TEM.
(166) Although PHPMA is water-soluble, the presence of the platinum drug leads to an amphiphilic structure with a tendency to aggregate, resulting in a bigger diameter size. Upon conjugation with BSA-FITC, amphiphilic block copolymers are formed with a hydrophilic BSA and a rather hydrophobic polymer. It is expected that these polymers self-assemble in solution into core-shell nanoparticles. The measured sizes of all compounds are summarised in Table 2.
(167) TABLE-US-00002 TABLE 2 Hydrodynamic diameter distributions of BSA conjugated copolymer in 0.1M PBS pH 7 Conc. D.sub.h.sup.number Sample (mg/ml) (d/nm) PDi BSA 1.000 9.93 0.42 BSA-FITC 0.800 7.44 0.58 P(HPMA.sub.13-co-[(AC-DAP).sub.9-Pt.sub.8]).sup.a 0.095 198.6 0.14 BSA-FITC-[P(HPMA.sub.13-co-[(AC-DAP).sub.9-Pt.sub.8])].sup.b 0.11.sup.c 82.0 0.27 .sup.aDissolved in DMSO and dialysis against 0.1M PBS buffer pH 7 for 24 hours .sup.bConjugation was performed in DMSO/PBS buffer and purified via dialysis using MWCO 12000 membrane for 48 hours .sup.cConcentration of BSA-FITC conjugated to copolymer was determined via fluorescence spectrascopy
(168) Transmission electron microscopy (TEM) confirmed the presence of platinum in all samples, before and after BSA-FITC conjugation (black dots). The platinum assists the visibility of the particles without the need for staining (
(169) Another method used to confirm the conjugation between the BSA and the copolymer was SDS-PAGE (
(170) In Vitro Cytotoxicity Activity of the Conjugate
(171) The aim of this work was to use albumin as a better transport vehicle for delivery of the macromolecular drug. It is hypothesized flat albumin can lead to better cell-uptake and therefore to higher toxicity. The prepared BSA-conjugated polymer was therefore tested towards its activity against OVCAR-3 ovarian cancer cells. For control, the polymer aggregate based on P(HPMA13-co-[(AC-DAP).sub.9-Ptg]) was employed. The concentrations of both solutions, for platinum free copolymers and BSA-FITC-conjugated copolymers are summarised in Table 3.
(172) TABLE-US-00003 TABLE 3 Copolymer and platinum concentrations of BSA-polymer conjugates [BSA].sup.a [Copolymer] [Pt] [Pt] Sample (mg/ml) (mg/ml) (mg/ml) (M) P(HPMA.sub.13-co-[(AC-DAP).sub.9- 0.095 0.0272.sup.b 140 Pt.sub.8]) BSA-FITC-[P(HPMA.sub.13-co- 0.11 0.0462 0.0134.sup.c 68 [(AC-DAP).sub.9-Pt.sub.8])] .sup.aConcentration of BSA-FITC conjugated to copolymer was determined via fluorescence spectroscopy .sup.bConcentration of platinum was determined via thermal gravimetric analysis(TGA) .sup.cConcentration of platinum was determined via ICP-OES
(173) Both solutions were employed in an in vitro cytotoxicity test against OVCAR-3, ovarian cancer cell lines. The percentages of the cell viability of both samples are presented in
(174) Conclusions
(175) RAFT polymerisation was shown to be a versatile technique to design polymer-protein conjugates by modification of the R-group of the RAFT agent. Maleimide-functionalised RAFT agent was successfully used to obtain P[HPMA-co-(Ac-Dap-BOC)] with a maleimide end functionality. Platinum drugs were conjugated after removal of the BOC protecting group to yield a platination efficiency of 93%, determined by TGA analysis. Cleavage of furan-protection groups on the copolymer chain-ends was performed prior to conjugation of BSA by maleimide-thiol reaction. At 80 C. the conversions into free-maleimide groups on the copolymers were not complete (31%) and needs to be optimised further. Nevertheless, conjugation of BSA to copolymer was still attempted using a 1:1 ratio between BSA and reactive polymer, taking into account that the deprotection was not complete. With evidence from SDS-PAGE, fluorescence, ICP-OES and UV-VIS spectroscopy conjugation was confirmed to be successful although the attachment of a small polymer to BSA was barely detectable using SDS-PAGE. Cell cytotoxicity tests also gave promising results which indicate that the BSA-conjugated copolymers were more toxic than the unconjugated controls.
Example 3
(176) This example illustrates a one-pot production method for an albumin-coated polyion complex micelle incorporating multifunctional oligonucleotide transfection vectors.
(177) In general terms, dimethylaminoethylmethacrylate (DMAEMA) was synthesised using RAFT polymerisation with a protected RAFT agent. The resulting polymer was deprotected in refluxing toluene to provide a maleimide-terminated polymer. This was then dissolved in a buffer solution. The solution was combined with a buffered albumin solution and adjusted to pH 5, so as to conjugate the polymer to the albumin. Addition of ISIS 5132 (a 20-base antisense phosphorothioate oligodeoxyribonucleotide: 5TCCCGCCTGTGACATGCATT3) resulted in formation of micelles containing the ISIS 5132. The synthesis of the polymer is illustrated in
(178) The resulting micelles were then tested for uptake into cells and for cytotoxicity.
(179) Syntheses
(180) Synthesis of PDMAEMA Via RAFT Polymerization.
(181) DMAEMA (14.148 g, 0.09 mol), MCPADB (0.21 g, 7.910.sup.4 mol), and AIBN (0.0374 g, 2.2810.sup.4 mol) were combined with methanol to achieve a concentration of 1.5 mol/ml. The ratio was [monomer]:[RAFT agent]:[Initiator]=120:1:0.2. The reaction mixture was divided equally into 3 vials. After sealing the reaction flasks, the mixture was purged with nitrogen for 1 h at 0 C. Four of the flasks were immersed in an oil bath at 70 C., and samples were taken over a period of 24 h. The vials were removed at 3, 5 and 7 h. Polymerization was terminated by placing the sample bottles in an ice bath for 5 mM. The same procedure was also used to prepare polymers with longer polymer chains at the ratio of [DMAEMA]:[MCPADB]:[Initiator]=350:1:0.2. The polymer was purified by precipitation in cyclohexane and finally dried under reduced pressure. The conversion and the theoretical molecular weight (Mn) was determined .sup.1H NMR (CDCl.sub.3). The polydispersity index (M.sub.w/M.sub.n) was measured by gel permeation chromatography (GPC) using DMAc as solvent. Results are shown in Table 4.
(182) TABLE-US-00004 TABLE 4 RAFT polymerization of PDMAEMA M.sub.n, after Time Con. M.sub.n, theo GPC.sup.b depro- Sample [M]:[RAFT]:[I] (h) (%).sup.a (g .Math. mol.sup.1) Mw/Mn tection 1 120:1:0.1 3 42.6 8528 1.14 8443 2 120:1:0.1 5 55.7 10518 1.17 10434 3 120:1:0.1 7 74.5 14550 1.16 14465 4 350:1:0.1 5 38.7 21793 1.15 21709 5 350:1:0.1 16 84.4 46984 1.17 46900 .sup.aObtained from 1H NMR analysis; .sup.bDetermined from DMAc GPC (relative to PS standards).
(183) Deprotection of End-Functionalised PDMAEMA
(184) 1.3 g polymer was dissolved in 50 mL toluene and the solution was brought to reflux at 110 C. for 7 hours. Therefore, the Diels-Alder protection reaction of the maleimide moiety attached to the RAFT agent on the ends of the polymer chains would be reversed. The solvent was evaporated and further dried with a Schlenk line to afford the target maleimide-terminated PDMAEMA. The formation of maleimide group was confirmed by .sup.1H-NMR with the presence of new proton peak at near 6.75.
(185) Conjugation of Albumin to PDMAEMA.
(186) Two stock solutions were made: 1 mM PDMAEMA in PBS (pH7.4, with 20 mM EDTA) buffer and 1 mM BSA in PBS (pH7.4, with 20 mM EDTA) buffer. Two of the solutions were mixed together in different ratio at the ambient temperature. The molar ratios of BSA and PDMAEMA in each mixture were 1:1, 5:1, 10:1, and 20:1, respectively. Each mixture was degassed with nitrogen for 1 h to get rid of oxygen in the solution and then stirred for 18 h to allow the thiol-ene click reaction between the thiol group on the BSA and the maleimide group on the end of the PDMAEMA polymer chain to proceed. The product was purified by dialysis in PBS buffer (pH5). Solvent was changed every 2 hours for 5-6 times. The aim of dialysing the samples was to get rid of EDTA which is toxic to cells and bring the conjugates to pH5. The conjugates of albumin and PDMAEMA with different chain length at a ratio of 2:1 were obtained using the same procedure.
(187)
(188) Formation of Polyion Complex Micelles from Albumin-PDMAEMA Conjugates and ISIS 5132.
(189) Solutions of albumin-PDMAEMA conjugates with required albumin to PDMAEMA ratios were prepared. The resulting conjugates were dialysed in 0.05 M PBS (pH5) for 12 h by changing solvent every 2 h. The solutions of ISIS 5132 in MilliQ water with different concentration were added dropwise to the conjugates solution (pH5) to yield a polyion complex micelle with certain N/P ratios (molar ratio of positive charged nitrogen (polymer) to negatively charged phosphate (oligonucleotide). The complex could be used immediately in pH 5 since the current complex had a tendency to agglomerate. Alternatively, raising the pH value to pH 7 by adding NaOH allowed the formation of solution which was stable over an extended period of time. Given that the cell grows at neutral environment, the latter routine was preferred. Herein, a control experiment was carried out using inactive DNA instead of ISIS 5132. All the conditions were kept consistent to the corresponding oligonucleotide samples. In addition, the oligonucleotide transfection efficiency of the PEGMEMA-PDMAEAM cationic block copolymer was investigated. The same protocol was adopted to make the polyion complex micelles from this polymer solution.
(190) The condensation of the oligonucleotide was therefore carried out when the conjugate solution was at pH5 and the oligonucleotide was dissolved in MilliQ water. The albumin-polymer conjugates with a pH of 5 was then slowly added to the solutions of ISIS 5132 with the concentration of 200 g/ml (=29.87 mV at pH7). As shown in Table 5, the resulting polyion complexes have sizes of around 12-15 nm (=0.41 mV at pH5 and 4.16 mV at pH7) when C1to1 was added to the ISIS 5132 solution (N/P ratio=12). If using the conjugates with higher ratios of BSA to polymer, the particle size of the polyion complex micelle was seen to increase dramatically due to the natural aggregation of albumin. After the complex micelle was stable, the system was brought back to pH7. There are several reasons for this: to reduce the aggregation of the micelle, to protect the oligonucleotide and to keep the neutral environment for cells in the afterward cytotoxicity assays.
(191) TABLE-US-00005 TABLE 5 The hydrodynamic diameter and zeta potential of the relevant materials and the complexes Zeta D.sub.h potential Sample name* (nm) (mV) Drug only ISIS 5132 at pH 7, 200 ug/ml 0-107 29.87 BSA only BSA at pH 7 conc. of BSA, 5.4 5.64 1 mg/ml BSA at Ph 5 conc. of BSA, 6.28 2.53 1 mg/ml Polymer only PDMAEMA at pH 7, 0 7.63 0.21 mg/ml Polymer-BSA C1to1 at pH 7 conc. of BSA, 6.16 2.04 conjugate 1 mg/ml C1to1 at pH 5 conc of BSA, 7.43 10.87 1 mg/ml C5to1 at pH 7 conc. of BSA, 5.17 0.51 1 mg/ml C5to1 at pH 5 conc. of BSA, 6.01 3.33 1 mg/ml Polymer-BSA C1to1/oligo complex at pH 7 15.8 4.16 conjugate 8 h conc. of BSA, 1 mg/ml complexed C5to1/oligo complex in pH 7 23.9 9.07 with 8 h conc. of BSA, 1 mg/ml oligo- C10to1/oligo complex in pH 7 ~1000 10.8 nucleotide 8 h conc. of BSA, 1 mg/ml C20to1/oligo complex in pH 7 ~1000 12.4 8 h conc. of BSA, 1 mg/ml *the sample name Cx to y describes the molar ratio between albumin to PDMAEMA
(192)
(193) Cell Uptake and Toxicity Testing
(194) Cell Uptake Study Using Laser Scanning Confocal Microscopy.
(195) Human ovarian carcinoma Ovcar-3 cells were seeded in 35 mm Fluorodish (World Precision Instruments) at a density of 60,000 per dish and cultured for 3 days with RPMI 1640 medium supplemented with 10% fetal bovine serum. Micelle solution was loaded to Ovcar-3 cells at a working concentration of 50 g/mL and incubated at 37 C. for 2 hrs. After incubation, the cells were washed twice with phosphate buffered saline (PBS, pH 7.4). Then the cells were stained with 100 nM LysoTracker Red DND-99 (Invitrogen) for 1 min. The dye solution was quickly removed and the cells were gently washed with PBS. Finally, the cells were mounted in PBS and observed under a laser scanning confocal microscope system (Zeiss LSM 780). The system was equipped with a Diode 405-30 laser, an argon laser and a DPSS 561-10 laser (excitation and absorbance wavelengths: 405 nm, 488 nm and 561 nm, respectively) connected to a Zeiss Axio Observer. Z1 inverted microscope (oil immersion100/1.4 NA objective). The ZEN2011 imaging software (Zeiss) was used for image acquisition and processing.
(196) Cytotoxicity Testing.
(197) Human Ovarian Carcinoma Ovcar-3 cells and Chinese Hammer Ovarian (CHO) cells were cultured in tissue culture flasks with Medium RPMI1640 supplemented with 10% foetal bovine serum at 37 C. under a 5% CO.sub.2 atmosphere. After reaching confluency, cells were collected from the flasks with Trypsin/EDTA treatment. The cell suspension was then seeded into a 96-well cell culture plate at a cell density of 40,000 cells.Math.mL.sup.1, 200 L.Math.well.sup.1. After incubation for one day, the cell in the plate was subsequently used for cytotoxicity testing. This involved firstly sterilising the micelles by UV irradiation for 1 hour, and serially diluting by half the solution with sterile water. The medium in the cell culture plate was discarded and replaced with 100 L, of fresh twice-concentrated RPMI1640 medium and the cells were incubated with the micelles for 48 hours. The cell viability was then investigated first by addition of cold TCA. The culture medium was discarded and 100 L of 10% TCA was added to each well, followed by incubation of the plates for 30 min at 4 C. The supernatant was discarded and the plates washed 5 times with water and air-dried. 100 L of SRB (sulphorhodamin B) solution 0.4% (w/v) in 1% acetic acid was added to each well, and the plates incubated for 15 minutes at room temperature. After staining, the unbound dye was removed by washing 5 times with 1% acetic acid and the plates air-dried. Bound stains were solubilised with 200 L 10 mM Tris Buffer and absorbance was measured on a Bio-Rad BenchMark microplate reader (=490 nm), with data analysed and plotted using GraphPad Prism 6.0, as shown in
(198)
(199) In summary, albumin based micelles have been shown to enable the transport of oligonucleotides into tumour cells where a drug is released from the micelles resulting in cell death. The activity of the oligonucleotide is influenced by the molecular weight of the cationic polymer.
Example 4
(200) This example demonstrates the preparation of a fully degradable albumin micelle based on a polyester conjugated to albumin.
(201)
(202) This experiment demonstrates the enhanced delivery of curcumin using albumin based micelles. The IC50 value was improved by a factor of more than 10 since the drug was efficiently taken up via the drug carrier. The albumin micelle is now fully degradable and can potentially be fully removed from the body