ANTIBODIES SPECIFIC FOR ENTEROVIRUSES THAT INFECT HUMANS
20190100574 ยท 2019-04-04
Inventors
Cpc classification
C07K2317/90
CHEMISTRY; METALLURGY
C07K2317/76
CHEMISTRY; METALLURGY
C07K2317/34
CHEMISTRY; METALLURGY
C07K2317/14
CHEMISTRY; METALLURGY
C12N5/163
CHEMISTRY; METALLURGY
C07K2317/92
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
Abstract
This invention provides antibodies or fragments thereof that are capable of specifically binding to at least one conformational epitope of Human Enterovirus 71 (EV71), wherein the antibody individually comprises at least one variable light chain and at least one variable heavy chain. There is also provided a method of producing an antibody capable of specifically binding to at least one conformational epitope of Human Enterovirus 71 (EV71).
Claims
1. An isolated antibody or epitope-binding fragment thereof that specifically binds to at least one conformational (non-linear) epitope of enterovirus 71 (EV71), wherein the antibody comprises at least one variable light chain and at least one variable heavy chain, wherein the variable light chain comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 3, and wherein the variable heavy chain comprises an amino acid sequence selected from an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 4 and an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 5, wherein the antibody or fragment thereof is neutralizing.
2. The isolated antibody or fragment thereof of claim 1, wherein the antibody comprises a variable light chain comprising the amino acid sequence set forth in SEQ ID NO: 3 and a variable heavy chain comprising the amino acid sequence set forth in either SEQ ID NO: 4 or SEQ ID NO: 5.
3. The isolated antibody or fragment thereof of claim 1, wherein the variable light chain comprises an amino acid sequence selected from the amino acid sequence set forth in SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18, and the variable heavy chain comprises an amino acid sequence selected from the amino acid sequence set forth in SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 22.
4. The isolated antibody or fragment thereof of claim 1, wherein the antibody is a monoclonal mouse, human, humanized or chimeric antibody.
5. The isolated antibody or fragment thereof of claim 1 for use in EV71 vaccine process control, candidate EV71 vaccine purification or determining EV71 antibody potency standards.
6. The isolated antibody or fragment thereof of claim 1 for use in treatment of EV71 infection and/or at least one EV71-linked disease selected from the group consisting of aseptic meningitis, encephalitis, cranial nerve palsies, Guillain-Barre syndrome, poliomyelitis-like syndrome, brainstem encephalitis, herpangina, and Hand, Foot and Mouth disease.
7. A method of treating at least one of an EV71-infection and at least one EV-linked disease selected from the group consisting of aseptic meningitis, encephalitis, cranial nerve palsies, Guillain-Barre syndrome, poliomyelitis-like syndrome, brainstem encephalitis, herpangina, and Hand, Foot and Mouth disease, the method comprising administering to a subject the antibody or epitope-binding fragment thereof of claim 1.
8. An isolated nucleic acid molecule encoding (a) at least one variable light chain of the antibody or epitope-binding fragment thereof of claim 1, wherein the variable light chain comprises an amino acid sequence selected from the amino acid sequence set forth in SEQ ID NO: 3, SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18; and (b) at least one variable heavy chain of the antibody or epitope-binding fragment thereof of claim 1, wherein the variable heavy chain comprises an amino acid sequence selected from the amino acid sequence set forth in SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 and SEQ ID NO: 22.
9. The isolated nucleic acid molecule of claim 8, wherein the nucleic acid sequence encoding the variable light chain or epitope-binding fragment thereof in (a) has at least 90% sequence identity to a nucleic acid sequence selected from the nucleic acid sequence set forth in SEQ ID NO: 10, SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26 or to a portion thereof encoding the variable light chain epitope-binding fragment; and wherein the nucleic acid sequence encoding the variable heavy chain in (b) has at least 90% sequence identity to a nucleic acid sequence selected from the nucleic acid sequence set forth in SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30 or to a portion thereof encoding the variable heavy chain epitope-binding fragment.
10. The isolated nucleic acid molecule of claim 8, comprising: (a) a nucleic acid sequence selected from the nucleic acid sequence set forth in SEQ ID NO: 10, SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26; and (b) a nucleic acid sequence selected from the nucleic acid sequence set forth in SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30.
11. An expression vector comprising at least one isolated nucleic acid molecule defined in any one of claims 8 to 10.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
DETAILED DESCRIPTION OF THE INVENTION
[0035] Bibliographic references mentioned in the present specification are for convenience listed in the form of a list of references and added at the end of the examples. The whole content of such bibliographic references is herein incorporated by reference.
Definitions
[0036] For convenience, certain terms employed in the specification, examples and appended claims are collected here.
[0037] As used herein, the term antibody refers to any immunoglobulin or intact molecule as well as to fragments thereof that bind to a specific epitope. Such antibodies include, but are not limited to polyclonal, monoclonal, chimeric, humanised, single chain, single chain fragment variable (scFv), Fab, Fab, F(ab) fragments and/or F(v) portions of the whole antibody. The term monoclonal antibody may be referred to as Mab. The antibody includes antibodies E18, E19, and E20, produced by the hybridoma cell lines EV18/4, EV19/5, and EV20/5, respectively. The antibodies, E18, E19 and E20 may be monoclonal antibodies, polyclonal antibodies, single-chain antibodies, and fragments thereof which retain the antigen binding function of the parent antibody. The antibodies E18, E19, and E20 are capable of specifically binding to EV71, including but not limited to a conformational epitope comprising at least one capsid protein of EV71 and include monoclonal antibodies, polyclonal antibodies, single-chain antibodies, and fragments thereof which retain the antigen binding function of the parent antibody.
[0038] The term antibody fragment as used herein refers to an incomplete or isolated portion of the full sequence of the antibody which retains the antigen binding function of the parent antibody. Examples of antibody fragments include scFv, Fab, Fab, F(ab)2, and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules; and multispecific antibodies formed from antibody fragments. Fragments of the E18, E19, and E20 antibodies are encompassed by the invention so long as they retain the desired affinity of the full-length antibody. In particular, it may be shorter by at least one amino acid.
[0039] The term antigen as used herein, refers to a substance that prompts the generation of antibodies and can cause an immune response. It may be used interchangeably in the present invention with the term immunogen. In the strict sense, immunogens are those substances that elicit a response from the immune system, whereas antigens are defined as substances that bind to specific antibodies. An antigen or fragment thereof may be a molecule (i.e. an epitope) that makes contact with a particular antibody. When a protein or a fragment of a protein is used to immunize a host animal, numerous regions of the protein may induce the production of antibodies (i.e. elicit the immune response), which bind specifically to the antigen (given regions or three-dimensional structures on the protein). Non-limiting examples of an antigen is the VP0 protein of EV71 and an immature picornavirus particle. The antigen may include but is not limited to a capsid protein and/or non-structural proteins of EV71. In particular, the term epitope refers to a consecutive sequence of from about 5 to about 13 amino acids which form an antibody binding site. The epitope in the form that binds to the antibodies or binding protein may be a denatured protein that is substantially devoid of tertiary structure. The epitope may be a conformational epitope.
[0040] A conformational epitope is herein defined as a sequence of subunits (usually, amino acids) composing an antigen that comes in direct contact with a receptor of the immune system. Whenever a receptor interacts with an undigested antigen, the surface amino acids that come in contact may not be continuous with each other if the protein is unwound. Such discontinuous amino acids that come together in three dimensional conformation and interact with the receptor's paratope are called conformational epitopes. In contrast, if the antigen is digested, small segments called peptides are formed, which bind with major histocompatibility complex molecules, and then later with T cell receptors through amino acids that are continuous in a line. These are known as linear epitopes.
[0041] The term comprising is herein defined to be that where the various components, ingredients, or steps, can be conjointly employed in practicing the present invention. Accordingly, the term comprising encompasses the more restrictive terms consisting essentially of and consisting of.
[0042] The term humanized antibody, as used herein, refers to at least one antibody molecule in which the amino acid sequence in the non-antigen binding regions has been altered so that the antibody more closely resembles a human antibody, and still retains its original binding ability.
[0043] As used herein, the term hybridoma refers to cells that have been engineered to produce a desired antibody in large amounts. For example, to produce at least one hybridoma, B cells are removed from the spleen of an animal that has been challenged with the relevant antigen and fused with at least one immortalized cell. This fusion is performed by making the cell membranes more permeable. The fused hybrid cells (called hybridomas), will multiply rapidly and indefinitely and will produce at least one antibody. Examples of hybridomas are the cell lines EV18/4, EV19/5, and EV20/5.
[0044] Immortalised cells as used herein are also known as transformed cellsi.e. cells whose growth properties have been altered. This does not necessarily mean that these are cancer or tumour cells, i.e. able to form a tumour if introduced into an experimental animal, although in some cases they may do. Immortalised cell lines include but are not limited to NS1, Jurkat, HeLa, HepG2, SP2/0, Hep-3b and the like.
[0045] The term immunological binding characteristics of an antibody or related binding protein, in all of its grammatical forms, refers to the specificity, affinity and cross-reactivity of the antibody or binding protein for its antigen.
[0046] The term isolated is herein defined as a biological component (such as a nucleic acid, peptide or protein) that has been substantially separated, produced apart from, or purified away from other biological components in the cell of the organism in which the component naturally occurs, i.e., other chromosomal and extrachromosomal DNA and RNA, and proteins. Nucleic acids, peptides and proteins which have been isolated thus include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids, peptides and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids.
[0047] The term neutralising antibody is herein defined as an antibody that can neutralise the ability of that pathogen to initiate and/or perpetuate an infection in a host. The invention provides at least one neutralising human monoclonal antibody, wherein the antibody recognises an antigen from EV71.
[0048] The term mutant is herein defined as one which has at least one amino acid sequence that varies from at least one reference sequence via substitution, deletion or addition of at least one amino acid, but retains the ability to recognize and bind the same conformational epitope on EV71 as the un-mutated sequence. In particular, the mutants may be naturally occurring or may be recombinantly or synthetically produced. More in particular, the mutant may be of at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% sequence identity to the reference sequences.
[0049] The term sample, as used herein, is used in its broadest sense. A biological sample suspected of containing nucleic acids encoding at least one EV71 derived peptide, or fragments thereof, or EV71 itself may comprise a bodily fluid, an extract from a cell, chromosome, organelle, or membrane isolated from a cell, a cell; genomic DNA, RNA, or cDNA (in solution or bound to a solid support), a tissue, a tissue print and the like.
[0050] As used herein, the terms specific binding or specifically binding refer to the interaction between a protein or peptide and an agonist, an antibody, or an antagonist. In particular, the binding is between an antigen and an antibody. The interaction is dependent upon the presence of a particular structure of the protein recognized by the binding molecule (i.e., the antigen or epitope). For example, if an antibody is specific for epitope A, the presence of a polypeptide containing the epitope A, or the presence of free unlabeled A, in a reaction containing free labeled A and the antibody will reduce the amount of labeled A that binds to the antibody.
[0051] The term immature picornavirus particle refers to an empty virus particle which lacks the genome materials and comprises the capsid protein V0. Capsid protein V0 is a precursor of the capsid proteins V2 and V4.
[0052] The term subject is herein defined as vertebrate, particularly mammal, more particularly human. For purposes of research, the subject may particularly be at least one animal model, e.g., a mouse, rat and the like. In particular, for treatment of EV-71 infection and/or EV71-linked diseases, the subject may be a human infected by EV71.
[0053] A person skilled in the art will appreciate that the present invention may be practiced without undue experimentation according to the method given herein. The methods, techniques and chemicals are as described in the references given or from protocols in standard biotechnology and molecular biology text books.
[0054] According to a first aspect, the present invention provides isolated monoclonal antibodies and related binding proteins that bind specifically to EV71. The antibodies according to any aspect of the present invention may be a monoclonal antibodies (Mab) which may be a substantially homogeneous population of antibodies derivable from a single antibody-producing cell. Thus, all antibodies in the population may be identical and may have the same specificity for a given epitope. The specificity of the Mab responses provides a basis for an effective treatment against EV71 infection and/or at least one EV71-linked disease. Monoclonal antibodies and binding proteins derived therefrom also have utility as therapeutic agents.
[0055] The antibodies according to any aspect of the present application provide at least one anti-EV71 antibody which is capable of neutralizing EV71 infection and inhibiting cell-to-cell spread. These antibodies according to any aspect of the present application may be used as prophylactic and/or therapeutic agent(s) for the treatment of EV71 and EV71-linked diseases.
[0056] According to an aspect of the present invention, there is provided an isolated antibody or a fragment thereof that is capable of specifically binding to at least one conformational epitope of Enterovirus 71 (EV71).
[0057] In particular, the isolated antibody may be selected from the group consisting of: [0058] (a) an antibody produced by hybridoma cell line EV18/4; [0059] (b) an antibody having the binding characteristics of the antibody produced by hybridoma cell line EV18/4; [0060] (c) an antibody that binds to an antigen capable of binding to the antibody produced by hybridoma cell line EV18/4; [0061] (d) an antibody comprising at least one variable light chain and at least one variable heavy chain, wherein the variable light chain comprises SEQ ID NO. 1, a variant, mutant or fragment thereof, and the variable heavy chain comprises SEQ ID NO. 2, a variant, mutant, or fragment thereof.
[0062] The isolated monoclonal antibody or a fragment thereof may be a neutralizing monoclonal antibody or a fragment thereof that may be capable of specifically binding to at least one epitope of EV71. The epitope may be a linear one or may be a conformational epitope. The conformational epitope may be an intact virus capsid. More in particular, the capsid protein may be VP1, VP2 VP3, VP4 and/or VP0 precursor. All members of the genus Enterovirus, including EV71, poliovirus and Coxsackievirus A16 have a single stranded positive sense RNA genome which has a single open reading frame encoding a polyprotein, P1, consisting of the capsid proteins, VP4, VP2, VP3 and VP1, and several non-structural proteins including the viral proteases 3C and 3CD which are responsible for cleaving the polyprotein P1 into individual capsid proteins VP1, VP3 and VP0. VP0 is a precursor of VP2 and VP4. The capsid proteins may assemble into virus like particles (VLPs).
[0063] The inventors of the present application showed that antibodies capable of neutralizing EV71 may be generated by using an immature EV71 virus particle as an antigen. In particular, the immature EV71 virus particle may be an empty virus particle which does not contain the genome materials. More in particular, the immature EV71 virus particle may comprise the capsid protein VP0.
[0064] Like all enteroviruses, four different Human Enterovirus C coat/capsid polypeptides have been identified and are designated as VP1, VP2, VP3, and VP4, which associate to form an icosahedral virus capsid. Typically, vaccination with the individual polypeptides of Human Enterovirus C has shown that the isolated polypeptides are not capable of raising neutralizing antibodies in humans and animals. The induction of genome release is thus a novel mechanism by which antibodies can neutralize viruses. Furthermore, the approach presented in this application may be used to prepare antibodies with similar properties against related viruses that include significant human pathogens.
[0065] The antibody according to any aspect of the present invention may be produced by the hybridoma cell line, EV18/4, and may comprise at least one variable light (VL) chain comprising SEQ ID NO. 1 as shown in Table 1, or a variant, mutant, or fragment thereof, and/or at least one variable heavy (VH) chain comprising SEQ ID NO. 2 as shown in Table 1, or a variant, mutant or fragment thereof. In particular, the isolated antibody may comprise at least one variable light chain comprising a sequence having at least 80%, at least 90% or at least 95% sequence identity to SEQ ID NO. 1, and/or at least one variable heavy chain comprising at least one a sequence having at least 80% at least 90%, or at least 95% sequence identity to SEQ ID NO. 2.
TABLE-US-00001 TABLE1 Polypeptidesequencesoftheantibodies producedbythehybridomacelllines EV18/4,E19/5,orE20/5. SEQ ID NO. Hybridoma Chain Sequences 1 EV18/4/ VL DIKMTQSPSSMYASLGERVTITCKASQDI KSYLSWYQQKPWKSPKTLIYYAKNLADGV PSRFSGSGFGQDYSLTISSLESDDTATYY CLQHGESPYTFGSGTKLEIKR 2 VH QIQLVQSGPELKKPGETVKISCKASGYTF TRYGMSWVKQAPGKGLKWMGWINTYSGVP TYADDFKGRFAFSLETSASTAYLQINNLK NEDTATYFCARRGYSNYYPMDFWGQGTSV TVSS 3 E19/5 VL NIMMTQSPSSLAVSAGGKVTMSCKSSQSV LYSSNQKNYLAWYQQKPGQSPKLLIYWAS TRESGVPDRFTGSGSGTDFTLTISSVQAE DLAVYYCHQYLSSWTFGGGTKLEIK 4 VH1 EVMLVESGGGLVKPGGSLQLSCAASGFTF SDYAMSWVRQTAETRLEWVATISDGGSHT YYPDSVRGRFTISRDNAKKALYLEMSSLK SEDTAMYYCGRRAGRYDERDAMDYWGQGT TVTVSS 5 VH2 SDVQLQESGPGLVKPSQSLSLTCSVTGYS ITSGFYLNWIRQFPGNKLEWMGYINYGGS INYNPSLKSRISITRDTSKNQFFLRLNSV TAEDTATYYCATMPNSWYFDVWGTGTTVT VSS 6 E20/5 VL SIVMTQTPKFLPVSAGDRVTMTCKASQSV GNNVAWYQQKSGQSPKLLIYYASNRYTGV PDRFTGSGSGTDFTFTISSVQVEDLAVYF CQQHYSSPPTFGAGTKLELK 7 VH EVQLVESGGGLVKPGGSLKLSCAASGFTF NIYAMSWVRQTPEKRLEWVATISDGGSYT YYPDNVKGRFTISRDNAKNNLYLQMSHLK SEDTAMYYCVRDRGNYYSRAFPYAYWGQG TLVTVSA
[0066] According to another aspect of the invention, there is provided an isolated antibody or a fragment thereof that is capable of specifically binding to at least one epitope of Enterovirus 71 (EV71), wherein the antibody is selected from the group consisting of: [0067] (a) an antibody produced by a hybridoma cell line EV19/5; [0068] (b) an antibody having the binding characteristics of the antibody produced by the hybridoma cell line EV19/5; [0069] (c) an antibody that binds to an antigen capable of binding to the antibody produced by the hybridoma cell line EV19/5; [0070] (d) an antibody comprising at least one variable light chain and at least one variable heavy chain, wherein the variable light chain comprises SEQ ID NO. 3 as set out in Table 1, a variant, mutant or fragment thereof, and the variable heavy chain comprises at least one of SEQ ID NOs. 4 and 5 as set out in Table 2, a variant, mutant or fragment thereof.
[0071] In particular, the isolated antibody may comprise a variable light chain comprising a sequence having at least 80%, at least 90% or at least 95% sequence identity to SEQ ID NO. 3, and/or at least one variable heavy chain comprising at least one sequence having at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NOs. 4 or 5.
[0072] According to yet another aspect of the invention, there is provided an isolated antibody or a fragment thereof that is capable of specifically binding to at least one conformational epitope of Enterovirus 71 (EV71), wherein the antibody is selected from the group consisting of: [0073] (a) an antibody produced by a hybridoma cell line EV20/5; [0074] (b) an antibody having the binding characteristics of the antibody produced by the hybridoma cell line EV20/5; [0075] (c) an antibody that binds to an antigen capable of binding to the antibody produced by the hybridoma cell line EV20/5; [0076] (d) an antibody comprising at least one variable light chain and at least one variable heavy chain, wherein the variable light chain comprises SEQ ID NO. 6, a variant, mutant or fragment thereof, and the variable heavy chain comprises SEQ ID NO. 7, a variant, mutant or fragment thereof.
[0077] In particular, the isolated antibody may comprise a variable light chain comprising a sequence having at least 80%, at least 90% or at least 95% sequence identity to SEQ ID NO. 6, and/or at least one variable heavy chain comprising a sequence having at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NO. 7.
[0078] The antibodies, E18, E19, and E20 may be capable of blocking viral mechanisms to spread within a host. They effectively neutralize cell-free virus particles and inhibit the direct cell-to-cell spread of the virus.
[0079] The antibodies according to any aspects of this invention bind to at least one conformational epitope of EV71. This is advantageous as epitopes usually exist in nature in a three dimensional conformation and the antibodies may thus be more efficient and effective in detecting the presence of EV71 and/or subsequently neutralizing the effect of EV71. The conformational epitope may comprise at least one capsid protein and/or at least one non-structural protein. The capsid protein may be an intact virus capsid protein. The capsid protein may comprise one or more proteins selected from the group consisting of VP1, VP2 VP3, VP4 and VP0 precursor. The antibodies according to any aspect of the present invention may be capable of recognizing a whole spectrum of EV71 viruses. These antibodies may be of high specificity and sensitivity. The antibodies of the present invention provide several advantages, including being capable of use as drugs or vaccines for HFMD.
[0080] In particular, the antibodies according to any aspect of the present invention may be available in large quantities, prepared either in hybridoma supernatant or ascites fluid. There may also be a constant and renewable source of monoclonal antibodies available, with any one of the hybridoma cell lines according to any aspect of the present invention. The defined epitope of the antibodies according to any aspect of the present invention also allows for mechanistic study of its virus neutralization ability to be easily performed. These antibodies may also be easily purified by affinity chromatography, using any method known in the art.
[0081] In one embodiment, the neutralizing antibodies according to any aspect of the present invention may be capable of effective in vivo protection against EV71 infection. The efficacy and specificity of these antibodies are shown in the Examples.
[0082] In particular, the antibody according to any aspect of the present invention may comprise the immunological binding characteristics of the monoclonal antibody E18, E19 or E20. The immunological binding characteristics of E18 are produced by hybridoma EV18/4. The immunological binding characteristics of E19 are produced by hybridoma EV19/5. The immunological binding characteristics of E20 are produced by hybridoma EV20/5. The hybridomas provide a continuous source of the antibodies and binding proteins of the invention.
[0083] According to another aspect of the invention, there is provided a method for producing an antibody specific for picornavirus, the method comprising immunizing at least one non-human mammal with at least one immature picornavirus particle to form at least one B cell specific for the picornavirus. In particular, the non-human animal may be a mouse. More in particular, the non-human mammal may be a Balb/c mouse.
[0084] In particular, an immature picornavirus particle may be an empty picornavirus particle which does not contain the genome material. More in particular, the immature picornavirus particle may contain the capsid protein VP0, which is a precursor of the capsid proteins V2 and V4. The empty particles are presumably precursors of the mature infectious virions.
[0085] Antibodies may be obtained by fusing the immune B-cells from the spleen of a non-human mammal with an immortal cell line to produce a hybridoma cell line. The hybridoma cell line may secrete a single type of monoclonal antibody that has precise specificity and often high affinity against the picornavirus. In particular, the immortal cell line may be cancer or tumour cells. More in particular, the immortal cell line may include but are not limited to NS1, Jurkat, HeLa, HepG2, SP2/0, Hep-3b and the like.
[0086] The picornavirus family encompasses the following genuses: Aphthovirus, Aquamavirus, Avihepatovirus, Cardiovirus, Cosavirus, Dicipivirus, Enterovirus, Erbovirus, Hepatovirus, Kobuvirus, Megrivirus, Parechovirus, Salivirus, Sapelovirus, Senecavirus, Teschovirus, and Tremovirus. In particular, the picornavirus may be from the genus Enterovirus. More in particular, the picornavirus may be Human Enterovirus 71 (EV71).
[0087] Enterovirus represents a genus of a large and diverse group of small RNA viruses characterized by a single positive-strand genomic RNA. All enteroviruses contain a genome of approximately 7,500 bases and are known to have a high mutation rate due to low-fidelity replication and frequent recombination. After infection to the host cell, the genome is translated in a cap-independent manner into a single polyprotein, which is subsequently processed by virus-encoded proteases into the structural capsid proteins and the non-structural proteins, which are mainly involved in the replication of the virus.
[0088] Serological studies have distinguished 66 human enterovirus serotypes on the basis of antibody neutralization tests. Additional antigenic variants have been defined within several of the serotypes on the basis of reduced or nonreciprocal cross-neutralization between variant strains. On the basis of their pathogenesis in human and animals, enteroviruses were originally classified into four groups, polioviruses Coxsackie A viruses (CA), Coxsackie B viruses (CB), and echoviruses, but it was quickly realized that there were significant overlaps in the biological properties of viruses in the different groups. Table 2 shows the species and serotypes encompassed by the Enterovirus genus.
TABLE-US-00002 TABLE 2 Species and serotypes of Enterovirus. Species Serotypes Human Baboon Enterovirus, Coxsackicevirus A10, A12, enterovirus A A14, A16, A2-8, Enterovirus A71, A76, A89, A90, A91, A92, Simiam enterovirus 19, 43, 46 Human E1-9, E11-21, E24-33,, Enterovirus B69, B73-75, enterovirus B B77-80,, B83-87, B97, Enterovirus Yanbian 96- 83csf, Enterovirus Yanbian 96-85csf, Simian agent 5, Human enterovirus 100, 101, 107, 79, 81, 82, 88, 93, 95 and 98 Human Coxsackievirus A1, A11, A13, A17, A19, A20, enterovirus C Enterovirus C95, C99, Human coxsackievirus A15, A18, A19/22, A22, Human enterovirus C104, C105, C109, C116, C96, wild poliovirus type 3, unidentified poliovirus Human Enterovirus D68, Human enterovirus 70, Human enterovirus D enterovirus 94, Human enterovirus D111 Human Bovine enterovirus strain K2577, SL305, VG-5-27, enterovirus E and type 1 Human Bovine enterovirus type 2 enterovirus F Human Ovine enterovirus, Porcine enterovirus 10, 15, enterovirus G 3H, 9, J10 Human A-2 plague virus, Simian enterovirus SA4, Human enterovirus H enterovirus 101, 107, 79, 81, 82, 88, 93, 95, 98, Simian agent 5 Human enterovirus J Human rhinovirus Human Rhino Virus (HRV) A1, A2, A7-13, A15, A A16, A18, A19, A20-25, A28-34, A36, A38, A39, A40, A41, A43, A44-47, A49, A50, A51, A53-68, A71, A73-78, A80, A81, A82, A85, A88, A89, A90, A94, A95, A96, A98 Human rhinovirus human rhinovirus (HRV) B3, B4, B5, B6, B14, B17, B B26, B27, B35, B37, B42, B48, B52, B69, B70, B72, B79, B83, B84, B86, B91, B92, B93, B97 and B99 Human rhinovirus human rhinovirus (HRV) C1-3, C5-C12, C15, C17, C C18, C19, C20, C22, C25, C28, C32, C35, C36, C37, C39, C40, C42, C43, C49, C
[0089] The antibodies of the present invention may be produced by any technique that provides for the production of antibody molecules by continuous cell lines in culture. Such methods include, but are not limited to, the hybridoma technique originally developed in 1975 by Kohler and Milstein, as well as the trioma technique, the human B-cell hybridoma technique and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., 1985). Human antibodies can be used and can be obtained by using human hybridomas (Cote et al., 1983).
[0090] According to an aspect of the present invention, there is provided an isolated nucleic acid molecule encoding at least one variable light chain of an antibody according to any aspect of the present invention, or a variant, mutant, or fragment thereof, and/or at least one variable heavy chain of an antibody according to any aspect of the present invention, or a variant, mutant, or fragment thereof. In particular, the isolated nucleic acid molecule may encode at least one of SEQ ID NOs. 1, 3 and 6, a variant, mutant, or fragment thereof and/or at least one of SEQ ID NOs. 2, 4, 5 and 7, a variant, mutant or fragment thereof. More in particular, the isolated nucleic acid molecular may comprise at least one of SEQ ID NOs. 8, 10, and 13, a variant, mutant, or fragment thereof and/or at least one of SEQ ID NOs. 9, 11, 12, and 13, a variant, mutant, or fragment thereof as listed in Table 3.
TABLE-US-00003 TABLE3 Nucleicacidsequencesencodingforthevariable lightchainorvariableheavychainsof antibodiesEV18,19,or20. SEQ ID No. Hybridoma Chain Sequences 8 EV18/4 VL GACATCAAGATGACCCAGTCTCCATCCTC CATGTATGCATCGCTGGGAGAGAGAGTCA CTATCACTTGCAAGGCGAGTCAGGACATT AAAAGCTATTTAAGCTGGTACCAGCAGAA ACCATGGAAATCTCCTAAGACCCTGATCT ATTATGCAAAAAACTTGGCAGATGGGGTC CCATCAAGATTCAGTGGCAGTGGATTTGG GCAAGATTATTCTCTAACCATCAGCAGCC TGGAGTCTGACGATACAGCAACTTATTAC TGTCTACAGCATGGTGAGAGCCCGTATAC GTTCGGATCGGGGACCAAACTGGAAATAA AACG 9 VH CAGATCCAGTTGGTACAGTCTGGACCTGA GCTGAAGAAGCCTGGAGAGACAGTCAAGA TCTCCTGCAAGGCTTCTGGATATACCTTC ACAAGGTATGGAATGAGCTGGGTGAAACA GGCTCCAGGAAAGGGTTTAAAGTGGATGG GCTGGATAAACACCTACTCTGGAGTGCCA ACATATGCTGACGACTTCAAGGGACGGTT TGCCTTCTCTTTGGAAACCTCTGCCAGCA CTGCCTATTTGCAGATCAACAACCTCAAA AATGAGGACACGGCTACATATTTCTGTGC AAGAAGGGGGTATAGTAACTATTATCCTA TGGACTTCTGGGGTCAAGGAACCTCAGTC ACCGTCTCCTCA 10 E19/5 VL AACATTATGATGACACAGTCGCCATCATC TCTGGCTGTGTCTGCAGGAGGAAAGGTCA CTATGAGCTGTAAGTCCAGTCAAAGTGTT TTATACAGTTCAAATCAGAAGAACTACTT GGCCTGGTACCAGCAGAAACCAGGGCAGT CTCCTAAACTACTGATCTACTGGGCATCC ACTAGGGAATCTGGTGTCCCTGATCGCTT CACAGGCAGTGGATCTGGGACAGATTTTA CTCTTACCATCAGCAGTGTACAAGCTGAA GACCTGGCAGTTTATTACTGTCATCAATA CCTCTCCTCGTGGACGTTCGGTGGAGGCA CCAAGCTGGAAATCAAAC 11 VH1 GAAGTGATGCTGGTGGAGTCTGGGGGAGG CTTAGTGAAGCCTGGAGGGTCCCTCCAAC TCTCCTGTGCAGCCTCTGGATTCACGTTC AGTGACTATGCCATGTCTTGGGTTCGCCA GACTGCGGAGACGAGGCTGGAGTGGGTCG CAACCATCAGTGATGGTGGTAGTCACACC TACTATCCAGACAGTGTGAGGGGACGGTT CACCATCTCCAGAGACAATGCCAAGAAGG CCCTGTACCTGGAAATGAGCAGTCTGAAG TCTGAGGACACGGCCATGTATTACTGTGG AAGACGGGCGGGGAGGTACGATGAGAGAG ATGCTATGGACTACTGGGGTCAAGGAACC ACAGTCACCGTCTCCTCA 12 VH2 TCTGATGTACAGCTTCAGGAGTCAGGACC TGGCCTCGTGAAACCTTCTCAGTCTCTGT CTCTCACCTGCTCTGTCACTGGCTACTCC ATCACCAGTGGTTTTTACTTAAACTGGAT CCGGCAGTTTCCAGGAAACAAACTGGAAT GGATGGGCTACATAAACTACGGTGGTAGC ATTAACTACAACCCATCTCTCAAAAGTCG CATCTCCATCACTCGTGACACATCTAAGA ACCAGTTTTTCCTGAGGTTGAATTCTGTG ACTGCTGAGGACACAGCCACATATTACTG TGCAACCATGCCTAACTCCTGGTACTTCG ATGTCTGGGGCACAGGGACCACGGTCACC GTCTCCTCA 13 E20/5 VL AGTATTGTGATGACCCAGACTCCCAAATT CCTGCCTGTATCAGCAGGAGACAGGGTTA CCATGACCTGCAAGGCCAGTCAGAGTGTG GGTAATAATGTAGCCTGGTACCAACAGAA GTCAGGACAGTCTCCTAAACTGCTGATAT ACTATGCATCCAATCGCTACACTGGAGTC CCTGATCGCTTCACTGGCAGTGGATCTGG GACAGATTTCACTTTCACCATCAGCAGTG TGCAGGTTGAAGACCTGGCAGTTTATTTC TGTCAGCAGCATTATAGCTCTCCTCCCAC GTTCGGTGCTGGGACCAAGCTGGAGCTGA AAC 14 VH GAAGTGCAGCTGGTGGAGTCTGGGGGAGG CTTAGTGAAGCCTGGAGGGTCCCTGAAAC TCTCCTGTGCAGCCTCTGGATTCACTTTC AACATCTATGCCATGTCTTGGGTTCGCCA GACTCCGGAAAAGAGGCTGGAGTGGGTCG CAACCATTAGTGATGGTGGTAGTTATACC TACTATCCAGACAATGTAAAGGGCCGATT CACCATCTCCAGAGACAATGCCAAGAACA ACCTGTACCTGCAAATGAGCCATCTGAAG TCTGAGGACACAGCCATGTATTACTGTGT AAGAGATCGAGGAAATTACTACAGTAGAG CGTTCCCGTATGCTTACTGGGGCCAAGGG ACTCTGGTCACTGTCTCTGCA
[0091] In particular, the isolated nucleic acid molecule may comprise at least one nucleic acid sequence having at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NOs. 8, 10, or 13, and/or at least one nucleic acid sequence having at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NOs. 9, 11, 12, or 13 as listed in Table 3.
[0092] The isolated nucleic acid molecule according to an aspect of the invention may be cloned into an expression vector, which may in turn be transformed into a host cell for the production of an antibody according to any aspect of the present invention. In particular, the host cell may be 293 cells or CHO cells.
[0093] Techniques developed for the production of chimeric antibodies (Morrison, et al., 1984 incorporated herein by reference in their entirety) by splicing the genes from a mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity can be used. For example, the genes from a mouse antibody molecule such as E18, E19, and E20 can be spliced together with genes from a human antibody molecule of appropriate biological activity. A chimeric antibody is a molecule in which different portions are derived from different animal species, such as those having a variable region derived from a murine antibody and a human immunoglobulin constant region. Chimeric antibodies are also those that contain a human Fc portion and a murine (or other non-human) Fv portion.
[0094] Techniques have been developed for the production of humanized antibodies (e.g., U.S. Pat. Nos. 5,585,089 and/or 5,225,539, which are incorporated herein by reference in their entirety). An immunoglobulin light or heavy chain variable region consists of a framework region interrupted by three hypervariable regions, referred to as complementarity determining regions (CDRs). Briefly, humanized antibodies are antibody molecules from non-human species having one or more CDRs from the non-human species and a framework region from a human immunoglobulin molecule. Both chimeric and humanized antibodies may be monoclonal. Such human or humanized chimeric antibodies may be preferred for use in in vivo diagnosis or therapy of human diseases or disorders.
[0095] Antibody fragments that contain the idiotype of the antibody molecule can be generated by known techniques. For example, such can be produced by pepsin digestion of the antibody molecule; the Fab fragments can be generated by reducing the disulfide bridges of the F(ab)2 fragment, and the Fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent. Such antibody fragments can be generated from any of the polyclonal or monoclonal antibodies of the invention.
[0096] In the production of antibodies, screening for the desired antibody can be accomplished by techniques known in the art. For example, these techniques may include but are not limited to radioimmunoassay, enzyme-linked immunosorbent assay (ELISA), sandwich immunoassays, immunoradiometric assays, gel diffusion precipitin reactions, immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme, radioisotope labels or the like), western blots, precipitation reactions, agglutination assays (gel agglutination assays, hemagglutination assays or the like), immunofluorescence assays, immunoelectrophoresis assays and the like. For example, the antibody binding may be detected by detecting a label on the primary antibody. In another example, the primary antibody may be detected by detecting binding of a secondary antibody or other reagent to the primary antibody. The secondary antibody may be labeled.
[0097] According to an aspect of the invention, there is provided an antibody according to any aspect of the invention for use in medicine.
[0098] According to another aspect, the present invention provides a pharmaceutical composition comprising the isolated antibody according to any aspect of the invention.
[0099] According to yet another aspect of the present invention, there is provided at least one method of treating EV71-infection and/or at least one EV71-linked disease, the method comprising administering to a subject an isolated antibody according to any aspect of the invention. In particular, the EV71-linked disease may be selected from the group consisting of aseptic meningitis, encephalitis, brainstem encephalitis, poliomyelitis-like syndrome, herpangina, and Hand, Foot and Mouth disease.
[0100] According to yet another aspect of the present invention, there is provided a use of at least one antibody according to any aspect of the invention for the preparation of a medicament for treating EV71-infection and/or at least one EV71-linked disease. In particular, the EV71-linked disease may be selected from the group consisting of aseptic meningitis, encephalitis, cranial nerve palsies, Guillan-Barre syndrome, poliomyelitis-like syndrome, and Hand, Foot and Mouth disease.
[0101] Having now generally described the invention, the same will be more readily understood through reference to the following examples which are provided by way of illustration, and are not intended to be limiting of the present invention.
[0102] A person skilled in the art will appreciate that the present invention may be practised without undue experimentation according to the method given herein. The methods, techniques and chemicals are as described in the references given or from protocols in standard biotechnology and molecular biology text books.
EXAMPLES
[0103] Standard molecular biology techniques known in the art and not specifically described were generally followed as described in Sambrook and Russel, Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (2001).
Example 1
[0104] Production of Hybridoma Cell Lines Against EV71
[0105] Ten 8-week old Balb/c mice were immunized with recombinant EV71-VP0 protein with the SUMO fusion protein cleaved off. The first immunization was done in Freund's Complete Adjuvant (Santa Cruz, Calif., United States) and was injected subcutaneously (SC). The second, third, and pre-fusion booster doses were in Freund's Incomplete Adjuvant (Santa Cruz, Calif., United States) and were done 2-3 weeks apart by intraperitoneal injection (IP).
[0106] Three days after the pre-fusion priming injections, the mice spleens were ready for cell fusion (Appendix B: Protocol for Spleen-Myeloma Cell Fusion). Prior to cell fusion, the partner SP2/0 myeloma cell line was expanded to one T75 flask per spleen. On the day of the cell fusion, the mice were bled from the heart to collect sera and the spleens were harvested in an aseptic manner. Both the spleen cells and the SP2/0 cells were washed and mixed at a ratio of one mouse spleen to one T75 flask of SP2/0 cells. The mice spleens were divided into four cell fusion groups according to immunogens, and the appropriate number of SP2/0 cells were added. The cell fusions were performed by slowly adding polyethylene glycol (PEG1500) (Sigma, Missouri, United States) to the cell mixture and the resulting cell pellet was washed, then plated into four 24-well tissue culture plates per spleen (Master Plates). After an overnight incubation, 10% RPMI 2HAT medium (hypoxanthine, aminopterin and thymidine) was added to the wells and the plates were incubated for several days before follow-up feeding with 10% RPMI 1HAT.
[0107] One week to 10 days after the fusion, visible hybridoma clones were picked from the Master Plates into 24-well Picked Clone Plates. When these picked clones were 40-70% confluent, the cell supernatants were screened by Enzyme-Linked Immunosorbent Assay (ELISA) with plates coated with SN07 Lysate (antigen) and Sf9 Lysate (control) (Appendix C: ELISA Protocol). A second screen was conducted by ELISA with plates coated with a cocktail of recombinant EV71 viral proteins (rVP0, rVP1, rVP2, rVP3, rVP4). Any samples that gave a positive reading (SN07>0.1 OD, Sf9<0.1) were amplified to T25 flasks and cryopreserved. Any potentially positive clones were then run on a Mouse Immunoglobulin Capture ELISA (MICE) to ensure the clones were secreting antibodies (Appendix C-II: Protocol for MICE). Antibody-producing cell supernatants were collected from the samples and were used to test for neutralization of the EV71 virus.
[0108] The strongest positive hybridomas were then selected for recloning by a limiting dilution method to obtain single clones in the wells of 96-well plates (Appendix E: Recloning Monoclonal Antibody Cell Lines Protocol). Recloning is needed because the original cultures may have originated from more than one hybridoma cell. Through recloning, single cells from this antibody-positive culture can now be isolated and subcultured. The recloned cells were first screened by MICE for cells that secrete antibodies at a high titer (determined by OD measurements). 4-8 single clones with high OD readings were expanded into the wells of 24-well plates and were then tested for specific reactivity via SN07 Lysate/Retentate ELISA. Clones that had strong specific reactivities were expanded to T25 flasks and cryopreserved. One good clone was chosen for another round of recloning. After two rounds of recloning, the final clones were expanded for the purposes of collecting cell supernatants to be used directly as reagents or for purification of monoclonal antibodies. The final clones were also isotyped through a pre-coated ELISA plate with different anti-mouse-Ig types (anti-IgG1, IgG2a, IgG2b, IgG3, IgA, IgM, Kappa and Lambda light chains) (Appendix C-III: Protocol for Pierce Rapid ELISA Mouse Monoclonal Isotyping Kit).
[0109] Preparation of Fab Fragments of Monoclonal Antibodies
[0110] The Fab fragments of the antibodies were prepared with the use of the Pierce Fab Preparation Kit according to the manufacturer's instructions (http://www.piercenet.com/product/fab-preparation-kits). Animal care and use was conducted in accordance with the National Animal Welfare Standards and Guidelines of Malaysia under the Animals Act of 2006.
[0111] Immunoblot Analysis
[0112] Equal volume of mock- and EV71-infected cell lysates were separated on a 12% SDS-PAGE, transferred to nitrocellulose membrane, and probed with R525 (polyclonal antibody against EV71 VP1), E18 or E19. Bound antibody was detected by incubation with horseradish peroxidase conjugated secondary antibodies (Dako, Denmark) followed by TMB membrane peroxidase substrate (KPL, Maryland, USA).
[0113] ELISA Analyses
[0114] An indirect ELISA was performed by coating Nunc Immuno plate with recombinant viral proteins or heat-inactivated EV71 infected RD cell lysates as positive control. Nonspecific binding was blocked using 5% skim milk, antibodies were added at various concentrations in duplicate, and bound antibodies were detected using horseradish peroxidase conjugated (HRP)-conjugated anti-mouse IgG (Dako). SureBlue Reserve TMB microwell peroxidase substrate (KPL) was added for 5 min, 0.5 M HCl was added to stop the enzyme reaction and wells were read at 450 nm.
[0115] A sandwich ELISA was performed where the wells were coated with R525 antibody against VP1, and PEG precipitated EV71 that was untreated or heat inactivated at 56 C. for 30 minutes was allowed to bind to the VP1 antibody. The bound particles were detected by the monoclonal antibodies E18 or E19, followed by HRP IgG (Dako) as described above.
[0116] A competitive ELISA was conducted to examine the presence of antibodies containing E18 epitope in mouse serum. Sera from four mice immunized with VLP that had high PRNT50 titres were pooled and sera from four mice immunized with PBS were pooled for the competitive ELISA assay. Wells were coated with R525 followed by equal protein concentrations of mock and EV71-infected RD cell lysates. Sera pooled from mice (at 1/250 dilution) were added into the wells and HRP-conjugated E18 was added immediately after. Reserve TMB microwell peroxidase substrate (KPL) was added for 5 min, 0.5 M HCl was added to stop the enzyme reaction and wells were read at 450 nm. Adjusted OD values were obtained by subtracting OD (mock RD cell lysate) from OD (EV71-infected RD cells). The relative percentage of binding of E18 was derived by dividing the adjusted OD of samples by the adjusted OD of well containing only HRP-E18, multiplied by 100.
[0117] Plaque Reduction Neutralization Test
[0118] Different concentrations of Antibodies, Fab fragments or heat-inactivated mouse serum were incubated in 1:1 volume ratios with infectious EV71 strain MY104 (300 PFU/mL) for 1 hour at 37 C. The virus-antibody (or Fab) mixture was inoculated in duplicates over Vero cell monolayers in 24 well plates (Nunc, Thermo-Fisher, USA). The monolayers were prepared with 0.5 ml per well of Vero cells at 3105 per ml in DMEM supplemented with 5% FBS and antibiotics (all from Invitrogen, Carlsbad, Calif., USA) and left to adhere overnight before inoculation. Media was aspirated before inoculation with 200 l of the antibody (or Fab)-virus mixtures and incubated in a CO.sub.2 incubator at 37 C. for 2 hours before 1 ml of overlay was added containing DMEM supplemented with 2% FBS, antibiotics and 1.5% carboxymethyl cellulose (CMC). Plates were incubated at 37 C. with 5% CO.sub.2 for 4 days and stained with naphthalene black. Plaques were counted manually. The percent inhibition was determined relative to controls in which the mean number of plaques in wells in which the virus had been incubated with media alone.
[0119] Virus Production and Purification
[0120] EV71 virions were produced and purified as described previously (4).
[0121] VLP Production and Purification
[0122] Briefly, EV71 empty immature capsids were produced using a baculovirus expression system where the complete P1 coding sequence and the protease 3CD of EV71 were recombinantly inserted downstream of the polyhedrin promoter and the recombinant baculovirus was used to infect Sf9 cells at an moi of 0.1. The supernatant harvested on day 4 was clarified and concentrated using tangential flow filtration (GE Healthcare Lifesciences) and the retentate was run through an affinity column prepared by coupling E18 to a HiTrap NHS-activated HP column (GE Healthcare Lifesciences). The particles bound were eluted using a glycine buffer at pH 3.0 and immediately neutralized to pH7.2 with 1M Tris-HCl. The particles were transferred to DPBS buffer (Invitrogen).
[0123] Immunization of Mice
[0124] Mice (n=10 per group) were immunized with two doses of DPBS or 10 g of VLP in the presence of Inject Alum (Thermo Scientific), 3 weeks apart. Serum were inactivated by incubation at 56 C. for 30 min, and stored at 20 C. for further analysis.
[0125] Results
[0126] The antibodies, E18, E19, and E20 were prepared by immunizing mice with empty, immature EV71 particles containing VP0. Results from the plaque reduction neutralization test indicate that all three antibodies, E18, E19, and E20, are capable of neutralizing EV71 (
TABLE-US-00004 TABLE 4 PRNT50 values for E18, E19, and E20. Antibody PRNT.sub.50 of original hybridoma E18 0.625 l/ml E19 0.156 l/ml E20 5.0 l/ml
[0127] Further, both E18 and E19 could neutralize the virus as intact antibodies or as Fab fragments (
[0128] Results from indirect ELISA also indicate that both E18 and E19 MAbs can recognize conformational epitopes on the surface of heat-inactivated EV71 particles (
[0129] It has been shown here that antibodies capable of neutralizaing EV71 can be generated by immunization with immature picornavirus particles containing VP0. As an example of this strategy, empty immature virus like particles (VLPs) were purified on an E18 affinity column and were used to immunize mice. The resultant sera were assayed to determine the neutralizing antibody titres (
REFERENCES
[0130] 1. Cole et al., (1985) Monoclonal Antibodies and Cancer Therapy Alan R. Liss, Inc., pp 77-96 [0131] 2. Cote et al., (1983) Proc. Nat. Acad. Sci. U.S.A., 80:2026-2030 [0132] 3. Morrison et al., (1984) Proc. Nat. Acad. Sci. U.S.A., 81(21):6851-5 [0133] 4. Plevka et al., (2012) Acta Crystallogr D Biol Crystallogr 68:1217-1222. [0134] 5. www dot piercenet dot com/product/fab-preparation-kits, 10 Dec. 2013.