COMPOSITIONS AND METHODS FOR PRODUCING BENZYLISOQUINOLINE ALKALOIDS
20190100781 ยท 2019-04-04
Inventors
Cpc classification
C12P17/182
CHEMISTRY; METALLURGY
C12N9/0059
CHEMISTRY; METALLURGY
International classification
C12P17/18
CHEMISTRY; METALLURGY
C12P13/00
CHEMISTRY; METALLURGY
Abstract
The present invention relates to host cells that produce compounds that are characterized as benzylisoquinolines, as well as select precursors and intermediates thereof. The host cells comprise one, two or more heterologous coding sequences wherein each of the heterologous coding sequences encodes an enzyme involved in the metabolic pathway of a benzylisoquinoline, or its precursors or intermediates from a starting compound. The invention also relates to methods of producing the benzylisoquinoline, as well as select precursors and intermediates thereof by culturing the host cells under culture conditions that promote expression of the enzymes that produce the benzylisoquinoline or precursors or intermediates thereof.
Claims
1.-37. (canceled)
38. A method of producing an alkaloid compound in a host cell, the method comprising: (a) providing a first chimeric nucleic acid sequence comprising as operably linked components: (i) a first polynucleotide obtainable from a first plant capable of producing an alkaloid compound encoding a first enzyme capable of catalyzing a chemical reaction that converts a first alkaloid compound into a second alkaloid compound; and (ii) one or more polynucleotides capable of controlling expression in a cell; (b) providing a second chimeric nucleic acid sequence comprising as operably linked components: (i) a second polynucleotide obtainable from a second plant capable of producing an alkaloid compound encoding a second enzyme capable of catalyzing a chemical reaction that converts the second alkaloid compound into a third alkaloid compound; and (ii) one or more polynucleotides capable of controlling expression in a cell; (c) introducing the first and second chimeric nucleic acid sequence into a cell; and (d) growing the cell to produce the first and second enzyme and the second and third alkaloid compound; and wherein the first and second polynucleotide are non-homologous and wherein the third alkaloid compound is produced in the cell at a level that is in excess of the level of alkaloid compound produced when a homologous first and second polynucleotide are used.
39. The method according to claim 38, wherein the first and second plant are selected from the group of families of plants consisting of plants belonging to the families of Berberidaceae, Ranunculaceae, and Papaveraceae.
40. The method according to claim 38, wherein the first and second plant are selected from the group of plants consisting of plants belonging to the genus of Berberis, Papaver, and Thalictrum.
41. The method according to claim 38, wherein the first and second plant are selected from the group of plants consisting of Papaver somniferum and Thalictrum flavum.
42. The method according to claim 38, wherein the first, second and third alkaloids are selected from the group of alkaloids consisting of the isoquinoline group, the phenanthrene alkaloid group, and the phenethyl amine group.
43. A method of producing an alkaloid compound in an engineered non-plant cell, the method comprising: (a) providing a first heterologous coding sequence comprising as operably linked components: (i) a first polynucleotide obtainable from a first plant capable of producing an alkaloid compound encoding a first enzyme capable of catalyzing a chemical reaction that converts a first alkaloid compound into a second alkaloid compound; and (ii) one or more polynucleotides capable of controlling expression in the engineered non-plant cell; (b) providing a second heterologous coding sequence comprising as operably linked components: (i) a second polynucleotide obtainable from a second plant capable of producing an alkaloid compound encoding a second enzyme capable of catalyzing a chemical reaction that converts the second alkaloid compound into a third alkaloid compound; and (ii) one or more polynucleotides capable of controlling expression in the engineered non-plant cell; (c) introducing the first and second heterologous coding sequences into the engineered non-plant cell; and (d) growing the cell to produce the first and second enzymes and the second and third alkaloid compounds; and wherein the first and second polynucleotides are non-homologous and wherein the third alkaloid compound is produced in the engineered non-plant cell at a level that is in excess of the level of alkaloid compound produced when a homologous first and second polynucleotide are used.
44. The method according to claim 43, wherein the first and second plants are selected from the group of families of plants consisting of plants belonging to the families of Berberidaceae, Ranunculaceae, and Papaveraceae.
45. The method according to claim 43, wherein the first and second plants are selected from the group of plants consisting of plants belonging to the genus of Berberis, Papaver, and Thalictrum.
46. The method according to claim 43, wherein the first and second plants are selected from the group of plants consisting of Papaver somniferum and Thalictrum flavum.
47. The method according to claim 43, wherein the first, second, and third alkaloids are selected from the group of alkaloids consisting of the isoquinoline group, the phenanthrene alkaloid group, and the phenethyl amine group.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
DETAILED DESCRIPTION OF THE INVENTION
[0026] The present invention relates to compositions and methods for producing benzylisoquinoline alkaloids (BIAS). In particular, the invention relates to host cells that have been genetically engineered to express recombinant and/or have altered expression of endogenous enzymes involved in the biosynthesis of BIAs and their intermediates and derivatives.
[0027] In one embodiment, the cells of the present invention are non-plant cells. In a more particular embodiment, the cells are insect cells, mammalian cells, bacterial cells or yeast cells. Representative examples of appropriate hosts include, but are not limited to, bacterial cells, such as Bacillus subtilis, Escherichia coli, Streptomyces and Salmonella typhimurium cells and insect cells such as Drosophila S2 and Spodoptera Sf9 cells. In one specific embodiment, the cells are yeast cells or E. coli cells. In a more specific embodiment, the yeast cells can be of the species Saccharomyces cerevisiae (S. cerevisiae). Yeast is also an ideal host cell because cytochrome P450 proteins, which are involved in certain steps in the synthetic pathways, are able to fold properly into the endoplasmic reticulum membrane so that activity is maintained, as opposed to bacterial cells which lack such intracellular compartments. Examples of yeast strains that can be used in the invention include, but are not limited to, S288C, W303, D273-10B, X2180, A364A, 1278B, AB972, SK1 and FL100. In specific examples, the yeast strain is any of S288C (MAT; SUC2 mal mel gal2 CUP1 flo1 flo8-1 hap1), BY4741 (MATa; his31; leu20; met150; ura30), BY4742 (MAT; his31; leu20; lys20; ura30), BY4743 (MATa/MAT; his31/his31; leu20/leu20; met150/MET15; LYS2/lys20; ura30/ura30), and WAT11 or W(R), derivatives of the W303-B strain (MATa; ade2-1; his3-11, -15; leu2-3,-112; ura3-1; canR; cyr+) which express the Arabidopsis thaliana NADPH-P450 reductase ATR1 and the yeast NADPH-P450 reductase CPR1, respectively. In another specific embodiment, the particular strain of yeast cell is W303 (MAT; his3-11,15 trp1-1 leu2-3 ura3-1 ade2-1), which is commercially available. The identity and genotype of additional examples of yeast strains can be found at EUROSCARF, available through the World Wide Web at web.uni-frankfurt.de/fb15/mikro/euroscarf/col_index.html.
[0028] Other example of cells that can serve as host cells are included, but not limited to, the strains listed in the table below.
TABLE-US-00001 TABLE I EUROSCARF/ Open Biosystems CSY Accession # ORF deleted Gene Strain Background 3 n/a wild type W303; Mat ; his3-11, 15 trp1-1 leu2-3 ura3-1 ade2-1 142 n/a YER073w/YPL061w ALD5/ALD6 W303; Mat ; his3-11, 15 trp1-1 leu2-3 ura3-1 ade2-1 152 Y10753 YMR170c ALD2 BY4742; Mat ; his31; leu20; lys20; ura30; 153 Y10752 YMR169c ALD3 BY4742; Mat ; his31; leu20; lys20; ura30; 154 Y11671 YOR374w ALD4 BY4742; Mat ; his31; leu20; lys20; ura30; 155 Y10213 YER073w ALD5 BY4742; Mat ; his31; leu20; lys20; ura30; 156 Y12767 YPL061w ALD6 BY4742; Mat ; his31; leu20; lys20; ura30; 157 Y16510 YML110c COQ5 BY4742; Mat ; his31; leu20; lys20; ura30; 158 Y16246 YOL096c COQ3 BY4742; Mat ; his31; leu20; lys20; ura30; 159 Y13675 YDR316w OMS1 BY4742; Mat ; his31; leu20; lys20; ura30; 160 30701B YGR001c CVDM003-01A BY4742; Mat ; his31; leu20; lys20; ura30; 161 Y11457 YIL064w BY4742; Mat ; his31; leu20; lys20; ura30; 162 Y15719 YBR271w BY4742; Mat ; his31; leu20; lys20; ura30; 163 B0006B YJR129c CEN.EN2-1B BY4742; Mat ; his31; leu20; lys20; ura30; 164 B0199B YNL024c CEN.HE27-2C BY4742; Mat ; his31; leu20; lys20; ura30; 165 Y12984 YNL092w BY4742; Mat ; his31; leu20; lys20; ura30; 166 Y12811 YPL017c BY4742; Mat ; his31; leu20; lys20; ura30; 167 Y12903 YHR209w BY4742; Mat ; his31; leu20; lys20; ura30; 417 16236 YOL086C ADH1 BY4742; Mat ; his31; leu20; lys20; ura30; 418 10891 YMR303C ADH2 BY4742; Mat ; his31; leu20; lys20; ura30; 419 16217 YMR083W ADH3 BY4742; Mat ; his31; leu20; lys20; ura30; 420 14623 YGL256W ADH4 BY4742; Mat ; his31; leu20; lys20; ura30; 421 13284 YBR145W ADH5 BY4742; Mat ; his31; leu20; lys20; ura30; 422 16460 YMR318C ADH6 BY4742; Mat ; his31; leu20; lys20; ura30; 423 15821 YCR105W ADH7 BY4742; Mat ; his31; leu20; lys20; ura30; 151 Y10000 wild type BY4742 MAT; his31; leu20; lys20; ura30
[0029] The cells can be in any environment, provided the cells are able to express functional heterologous enzymes. In particular, the cells can be used in either in vitro or in vivo experiments. To be clear, in vitro, as used in the present invention, simply means outside of a living cell, regardless of the location of the cell. The term in vivo, on the other hand, indicates inside a cell, regardless of the location of the cell. In one embodiment, the cells are cultured under conditions that are conducive to enzyme expression and with appropriate substrates available to allow production of BIAs in vivo. Alternatively, the functional enzymes can be extracted from the host for production of BIAs under in vitro conditions. In another embodiment, the host cells can be placed back into a multicellular host organism. The host cells can be in any phase of growth, such as, but not limited to, stationary phase and log-growth phase, etc. In addition, the cultures themselves may be continuous cultures or they may be batch cultures.
[0030] The cell culture conditions for a particular cell type are well-known in the art and need not be repeated herein. In one particular embodiment, the host cells that comprise the various heterologous coding sequences can be cultured under standard or readily optimized conditions, with standard cell culture media and supplements. As one example, standard growth media when selective pressure for plasmid maintenance is not required may contain 20 g/L yeast extract, 10 g/L peptone, and 20 g/L dextrose (YPD). Host cells containing plasmids can be grown in synthetic complete (SC) media containing 1.7 g/L yeast nitrogen base, 5 g/L ammonium sulfate, and 20 g/L dextrose supplemented with the appropriate amino acids required for growth and selection. Alternative carbon sources which may be useful for inducible enzyme expression include sucrose, raffinose, and galactose. Cells can be grown at 30 C. with shaking at 200 rpm, typically in test tubes or flasks in volumes ranging from 1-1000 mL, or larger, in the laboratory. Culture volumes can also be scaled up for growth in larger fermentation vessels, for example, as part of an industrial process.
[0031] The term host cells, as used in the present invention, are cells that harbor the heterologous coding sequences of the present invention. The heterologous coding sequences could be integrated stably into the genome of the host cells, or the heterologous coding sequences can be transiently inserted into the host cell. As used herein, the term heterologous coding sequence is used to indicate any polynucleotide that codes for, or ultimately codes for, a peptide or protein or its equivalent amino acid sequence, e.g., an enzyme, that is not normally present in the host organism and can be expressed in the host cell under proper conditions. As such, heterologous coding sequences includes additional copies of coding sequences that are normally present in the host cell, such that the cell is expressing additional copies of a coding sequence that are not normally present in the cells. The heterologous coding sequences can be RNA or any type thereof, e.g., mRNA, DNA or any type thereof, e.g., cDNA, or a hybrid of RNA/DNA. Examples of coding sequences include, but are not limited to, full-length transcription units that comprise such features as the coding sequence, introns, promoter regions, 3-UTRs and enhancer regions.
[0032] Heterologous coding sequences also includes the coding portion of the peptide or enzyme, i.e., the cDNA or mRNA sequence, of the peptide or enzyme, as well as the coding portion of the full-length transcriptional unit, i.e., the gene comprising introns and exons, as well as codon optimized sequences, truncated sequences or other forms of altered sequences that code for the enzyme or code for its equivalent amino acid sequence, provided that the equivalent amino acid sequence produces a functional protein. Such equivalent amino acid sequences can have a deletion of one or more amino acids, with the deletion being N-terminal, C-terminal or internal. Truncated forms are envisioned as long as they have the catalytic capability indicated herein. Fusions of two or more enzymes are also envisioned to facilitate the transfer of metabolites in the pathway, provided again that catalytic activities are maintained.
[0033] Operable fragments, mutants or truncated forms may be identified by modeling and/or screening. This is made possible by deletion of, for example, N-terminal, C-terminal or internal regions of the protein in a step-wise fashion, followed by analysis of the resulting derivative with regard to its activity for the desired reaction compared to the original sequence. If the derivative in question operates in this capacity, it is considered to constitute an equivalent derivative of the enzyme proper.
[0034] Codon optimization is a well-known technique for optimizing the expression of heterologous polynucleotides in host cells and is reviewed in Gustafsson, C. et al., Trends Biotechnol, 22:346-353 (2004), which is incorporated by reference in its entirety.
[0035] The present invention also relates to heterologous coding sequences that code for amino acid sequences that are equivalent to the native amino acid sequences for the various enzymes. An amino acid sequence that is equivalent is defined as an amino acid sequence that is not identical to the specific amino acid sequence, but rather contains at least some amino acid changes (deletions, substitutions, inversions, insertions, etc.) that do not essentially affect the biological activity of the protein as compared to a similar activity of the specific amino acid sequence, when used for a desired purpose. The biological activity refers to, in the example of a decarboxylase, its catalytic activity. Equivalent sequences are also meant to include those which have been engineered and/or evolved to have properties different from the original amino acid sequence. Examples of mutable properties include catalytic activity, substrate specificity, selectivity, stability, solubility, localization, etc. In specific embodiments, an equivalent amino acid sequence contains at least 80%-99% identity at the amino acid level to the specific amino acid sequence, in particular at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94% and more in particular, at least 95%, 96%, 97%, 98% and 99% identity, at the amino acid level. In some cases, the amino acid sequence may be identical but the DNA sequence is altered such as to optimize codon usage for the host organism, for example.
[0036] The host cells may also be modified to possess one or more genetic alterations to accommodate the heterologous coding sequences. Alterations of the native host genome include, but are not limited to, modifying the genome to reduce or ablate expression of a specific enzyme that may interfere with the desired pathway. The presence of such native enzymes may rapidly convert one of the intermediates or final products of the pathway into a metabolite or other compound that is not usable in the desired pathway. Thus, if the activity of the native enzyme were reduced or altogether absent, the produced intermediates would be more readily available for incorporation into the desired product. For example, if the host cell is a yeast cell and the desired pathway produces 4-HPA from tyrosine, or a downstream metabolite thereof, it may be beneficial to reduce or ablate expression of the native endogenous alcohol and/or aldehyde dehydrogenase enzymes, which could convert the desired final product (4-HPA) into tyrosol or 4-hydroxyphenylacetic acid, respectively. Genetic alterations may also include modifying the promoters of endogenous genes to increase expression and/or introducing additional copies of endogenous genes. Examples of this include the construction/use of strains which overexpress the endogenous yeast NADPH-P450 reductase CPR1 to increase activity of heterologous P450 enzymes. In addition, endogenous enzymes such as ARO8, 9, and 10, which are directly involved in the synthesis of intermediate metabolites, may also be overexpressed.
[0037] The heterologous coding sequences of the present invention are sequences that encode enzymes, either wild-type or equivalent sequences, that are normally responsible for the production of BIAs in plants. The enzymes for which the heterologous sequences will code can be any of the enzymes in the BIA pathway, and can be from any known source. For example, Norcoclaurine synthase (NCS; EC 4.2.1.78) is found in at least Thalictrum flavum, Papaver somniferum, and Coptis japonica and is known to catalyze the condensation reaction of dopamine and 4-hydroxyphenylacetaldehyde (4-HPA) to form the trihydroxylated alkaloid (S)-norcoclaurine, which is widely accepted as the first committed step in the production of BIAs in plants. The choice and number of enzymes encoded by the heterologous coding sequences for the particular synthetic pathway should be chosen based upon the desired product. For example, the host cells of the present invention may comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more heterologous coding sequences.
[0038] With regard to the heterologous coding sequences, the sequences are as reported in GENBANK unless otherwise noted. For example, the codon-optimized CYP2D6 sequence is included for reference along with the human monoamine oxidase A sequence with the first 10 amino acids optimized to facilitate translation initiation and proper folding in yeast.
[0039] A non-exhaustive list of enzymes that are contemplated in the present invention is shown in the table below. The host cells of the present invention may comprise any combination of the listed enzymes, from any source. Unless otherwise indicated, Accession numbers in Table I refer to GenBank. Some accession numbers refer to the Saccharomyces genome database (SGD) which is available on the world-wide web at www.yeastgenome.org.
TABLE-US-00002 TABLE II Example Source Organism Enzyme Name Abbrev. (Accession #) Reference Catalyzed Reactions L-tyrosine/dopa TYDC1 P. somniferum Facchini, P. J. and De L-tyrosine-.fwdarw.L-tyramine, decarboxylase 1 U08597 Luca, V. J. Biol. L-dopa.fwdarw.L-dopamine T. flavum Chem. 269 (43), AF314150 26684-26690 (1994). PUBMED 7929401 L-tyrosine/dopa TYDC2 P. somniferum Facchini, P. J. and De L-tyrosine-.fwdarw.L-tyramine, decarboxylase 2 U08598 Luca, V. J. Biol. L-dopa.fwdarw.L-dopamine V. vinifera Chem. 269 (43), AM429650 26684-26690 (1994). PUBMED 7929401 Cytochrome P450 CYP2D6 H. sapiens Hiroi, T, Imaoka, S, L-tyramine.fwdarw.L-dopamine 2D6 NM000106 and Funac, Y. (R)-reticuline.fwdarw.(R)- S. cerevisiae Biochem Biophys Res salutaridine codon- Commun. 1998 Aug. codeine.fwdarw.morphine optimized 28; 249 (3): 838-43. PUBMED 9731223 Zhu, W et. Al. The Journal of Immunology. Vol. 175, pp. 7357-7362 (2005). NADPH p450 CPR1 S. cerevisiae Turi, T G and Loper, L-tyramine.fwdarw.L-dopamine reductase SGDID: J C. J Biol Chem. (R)-reticuline.fwdarw.(R)- S000001084 1992 Jan. 25; salutaridine 267 (3): 2046-56. codeine.fwdarw.morphine PUBMED 1730736 Polyphenyloxidase PPO A. bisporus Wichers, H J et. Al. L-tyrosine.fwdarw.L-dopa X85112, Appl. Microbiol. AJ223816 Biotechnol. (2003) 61: 336-341. Tyrosine TyrH R. norvegicus Grima, B., L-tyrosine.fwdarw.L-dopa hydroxylase NM 012740 Lamouroux, A., Blanot, F., Biguet, N. F. and Mallet, J. Proc. Natl. Acad. Sci. U.S.A. 82 (2), 617-621 (1985). PUBMED 2857492 Tyrosine TH2 H. sapiens Grima, B., L-tyrosine.fwdarw.L-dopa hydroxylase NM 000240 Lamouroux, A., Boni, C., Julien, J. F., Javoy-Agid, F. and Mallet, J. Nature 326 (6114), 707-711 (1987). PUBMED 2882428 GTPcyclohydrolase GTPCH1 H. sapiens Leff, S E et. al. I NM 00161 Experimental Produces BH.sub.4 cofactor Neurology 151, 249- for tyrosine 64 (1998). hydroxylase reaction L-tyrosine.fwdarw.L-dopa Monoamine MaoA H. sapiens Bach, W J et. al. Proc. L-tyramine.fwdarw.4-HPA oxidase A J03792 Natl. Acad. Sci. USA. Vol. 85, pp. 4934- 4938, July 1988. Monoamine maoA E. coli Azakami, H et. al. J. L-tyramine.fwdarw.4-HPA oxidase D2367 Ferment. Bioeng. 77, 315-319, 1994. Tyramine oxidase tynA K. aerogenes Cooper, R A. FEMS L-tyramine.fwdarw.4-HPA AB200269 Microbiol Lett. 1997 Jan. 1; 146 (1): 85-9. PUBMED 8997710 Aromatic amino ARO8 S. cerevisiae Iraqui, I et. al. Mol. L-tyrosine.fwdarw.4- acid transaminase SGDID: Gen. Genet. (1998) hydroxyphenylpyruvate S000003170 257: 238-248. Aromatic amino ARO9 S. cerevisiae Iraqui, I et. al. Mol. L-tyrosine.fwdarw.4- acid transaminase SGDID: Gen. Genet. (1998) hydroxyphenylpyruvate S000001179 257: 238-248. Phenylpyruvate ARO10 S. cerevisiae Vuralhan, Z. et. al. 4-hydroxyphenyl- decarboxylase SGDID: Appl. And Environ. pyruvate.fwdarw.4-HPA S000002788 Microbiol. Vol. 71, No. 6, p. 3276-3284. Norcoclaurine NCS T. flavum, Samanani, N, L-dopamine + 4-HPA.fwdarw. synthase AY376412 Liscombe, D K, and (S)-norcoclaurine P. somniferum Facchini, P. The AY860500, Plant Journal (2004) AY860501 40, 302-313. Norcoclaurine 6OMT T. flavum Ounaroon, A. et. al. (S)-norcoclaurine.fwdarw. 6-O- AY61057 The Plant Journal (S)-coclaurine methyltransferase P. somniferum (2003) 36, 808-819. norlaudanosoline.fwdarw.6- AY268894 O-methyl norlaudanosoline laudanosoline.fwdarw.6-O- methyl laudanosoline Coclaurine-N- CNMT T. flavum Choi, Kum-Boo et. coclaurine.fwdarw. methyltransferase AY610508 al. J. Biol. Chem. N-methylcoclaurine, P. somniferum Vol. 277, No. 1, pp. laudanosoline.fwdarw. AY217336 830-835, 2002. N-methyl laudanosoline Cytochrome P450 CYP80B1 P. somniferum Pauli, H H and (S)-N- 80B1 AF191772 Kutchan, T M. Plant methylcoclaurine.fwdarw. J. 1998 March; (S)-3-hydroxy-N- 13 (6): 793-801. methylcoclaurine 4-O- 4OMT T. flavum Morishige, T. et. al. 3-hydroxy-N- methyltransferase AY610510 J. Biol Chem. Vol. methylcoclaurine.fwdarw. P. somniferum 275, No. 30, pp. reticuline AY217333, 23398-23405, 2000. norlaudanosoline.fwdarw.4- AY217334 O-methyl norlaudanosoline laudanosoline.fwdarw.4-O- methyl laudanosoline Berberine bridge BBE P. somniferum Facchini, P. J., (S)-reticuline.fwdarw. enzyme AF025430 Penzes, C., (S)-scoulerine Johnson, A. G. and Bull, D. Plant Physiol. 112 (4), 1669-1677 (1996). PUBMED 8972604 Reticuline 7-O- 7OMT P. somniferum Ounaroon, A. et. al. reticuline.fwdarw. methyltransferase AY268893 The Plant Journal laudanine (2003) 36, 808-819. Scoulerine 9-O- S9OMT T. flavum Samanani, N., (S)-scoulerine.fwdarw. methyltransferase AY610512 Park, S. U. and (S)- Facchini, P. J. Plant tetrahydrocolumbamine Cell 17 (3), 915-926 (2005). PUBMED 15722473 Canadine CYP719A T. flavum Samanani, N., synthase AY610513 Park, S. U. and (S)tetrahydrocolumbamine.fwdarw. Facchini, P. J. Plant (S)-canadine Cell 17 (3), 915-926 (2005). PUBMED 15722473 Ikezawa, N. et. al. J. Biol. Chem. Vol. 278, No. 40, pp. 38557- 38565, 2003. NADPH P450 ATR1 A. thaliana Lourat-Oriou B, Reductase partner for reductase NM 118585 Perret A, Pompon D. cytochrome P450s Eur J Biochem. 1998 Ex. (S)tetrahydro- Dec. 15; 258 (3): columbamine.fwdarw. (S)- 1040-9. canadine Salutaridine SalR P. somniferum Ziegler, J. et. al. Plant salutaridine.fwdarw.salutaridinol reductase DQ316261 J. 48 (2), 177-192 (2006) Salutaridinol 7-O- SalAT P. somniferum Grothe, T., Lenz, R. salutaridinol.fwdarw.salutaridinol- acetyltransferase AF339913 and Kutchan, T. M. J. 7-O- Biol. Chem. 276 (33), acetate.fwdarw.thebaine 30717-30723 (2001). PUBMED 11404355 Codeine COR P. somniferum Unterlinner, B., codeinone.fwdarw.codeine reductase AF108432 Lenz, R. and Kutchan, T. M. Plant J. 18 (5), 465-475 (1999). PUBMED 1041769 Berbamunine CYP80A1 B. stolonifera Kraus, P F and 2 (R)-N- synthase U09610 Kutchan, T M. Proc methylcoclaurine.fwdarw. Natl Acad Sci USA. guattegaumerine 1995 Mar. 14; (R)-N-methlcoclaurine + 92 (6): 2071-5. (S)-N- methylcoclaurine.fwdarw. berbamunine
[0040] In one specific embodiment, the present invention relates to host cells that produce 4-Hydroxyphenylacetaldehyde (4-HPA) from tyrosine. For example, the host cells that produce 4-HPA from tyrosine comprise at least two heterologous coding sequences, wherein each of the heterologous coding sequences encodes a separate enzyme that is involved in the biosynthetic pathway that converts tyrosine to 4-IIPA. In a more specific embodiment, the host cells that produce 4-HPA from tyrosine comprise L-tyrosine/dopa decarboxylase (TYDC, P. somniferum) and one of monoamine oxidase (mao, E. coli or Homo sapiens) or Tyramine oxidase (tyn , Klebsiella aerogenes). In another specific embodiment, the host cells that produce 4-HPA from tyrosine comprise Aromatic amino acid transaminase (ARO8/ARO9, S. cerevisiae) and Phenylpyruvate decarboxylase (ARO10, S. cerevisiae).
[0041] In another specific embodiment, the present invention relates to host cells that produce dopamine from tyrosine. For example, the host cells that produce dopamine comprise at least two heterologous coding sequences, wherein each of the heterologous coding sequences encodes a separate enzyme that is involved in the biosynthetic pathway that converts tyrosine to dopamine. In a more specific embodiment, the host cells that produce dopamine from tyrosine comprise a Tyrosine/dopa decarboxylase (TYDC, P. somniferum) and one of Cytochrome P450 2D6 (CYP2D6, H. sapiens) or Codon-Optimized Cytochrome P450 2D6 (CYP2D6, S. cerevisiae). To improve of the activity of CYP2D6, additional copies of the yeast NADPH-P450 reductase (yCPR1) may be expressed either from the chromosome or a plasmid. In another specific embodiment, the host cells that produce dopamine from tyrosine comprise a Tyrosine hydroxylase (PPO Agaricus bisporus; TH2, H. sapiens; TyrH, Rattus norvegicus) and Tyrosine/dopa decarboxylase (TYDC, P. somniferum).
[0042] In another specific embodiment, the present invention relates to host cells that convert tyrosine into norcoclaurine. Regardless of the source of the tyrosine starting material, the host cells of the present invention that produce norcoclaurine comprise at least three heterologous coding sequences, wherein each of the heterologous coding sequences encodes a separate enzyme, or its equivalent, that is involved in the biosynthetic pathway that converts tyrosine to norcoclaurine. In one specific embodiment, the host cells that produce norcoclaurine from tyrosine comprise the L-tyrosine/dopa decarboxylase (TYDC, P. somniferum), Monoamine oxidase (MaoA, E. coli), one of Cytochrome P450 2D6 (CYP2D6, H. sapiens) or Codon-Optimized Cytochrome P450 2D6 (CYP2D6, S. cerevisiae), and NCS (T. flavum or P. somniferum) coding sequences. To improve the activity of CYP2D6, additional copies of the endogenous yeast P450 NADPH reductase (yCPR1) may be expressed either from the chromosome or a plasmid. Of course, the embodiment above may further comprise additional heterologous coding sequences that will continue the synthetic pathway to create at least one additional metabolite. For example, the presence of the heterologous coding sequence that codes for Norcoclaurine 6-O-methyltransferase (6OMT, T. flavum, P. somniferum) will further metabolize norcoclaurine into coclaurine. Other pathways to/from norcoclaurine are depicted herein.
[0043] The embodiment above can serve as the basis of additional embodiments. For example, embodiments comprising TYDC, CYP2D6, maoA, NCS, 6OMT may further comprise the Coclaurine-N-methyltransferase (CNMT, T. flavum, P. somniferum) heterologous coding sequence, the embodiments of which may further comprise the Cytochrome P450 80B1 (CYP80B1, P. somniferum) heterologous coding sequence, the embodiments of which may further comprise the 4O-methyltransferase (4OMT, T. flavum, P. somniferum) heterologous coding sequence, the embodiments of which may further comprise Berberine bridge enzyme (BBE, P. somniferum), etc. The embodiments in which the host cell comprises TYDC, CYP2D6, maoA, NCS, 6OMT and CNMT will generate N-methylcoclaurine ultimately from tyrosine. The embodiments in which the host cell comprises TYDC, CYP2D6, maoA, NCS, 6OMT, CNMT and CYP80B1 will generate 3-Hydroxy-N-methylcoclaurine ultimately from tyrosine. The embodiments in which the host cell comprises TYDC, CYP2D6, maoA, NCS, 6OMT, CNMT CYP80B1 and 4OMT will generate reticuline ultimately from tyrosine. The embodiments in which the host cell comprises TYDC, CYP2D6, maoA, NCS, 6OMT, CNMT CYP80B1, 4OMT and BBE will generate scoulerine ultimately from tyrosine. All strains containing either CYP2D6 and/or CYP80B1 will likely require overexpression of CPR1 and/or ATR1 NADPH-P450 reductases for optimal activity.
[0044] Of course, the desired pathways need not start with tyrosine. For example, the synthetic pathways generated in the host cells may start with laudanosoline, methyl laudanosoline, norlaudanosoline, methyl norlaudanosoline, or another compound that may or may not be normally present in the endogenous BIA pathway. Thus, the starting material may be non-naturally occurring or the starting material may be naturally occurring. Additional examples of starting material include, but are not limited to, tyramine, dopamine, 4-HPA, 4-HPPA, norcoclaurine, coclaurine, N-methylcoclaurine, 3-hydroxy-N-methylcoclaurine, reticuline, scoulerine, tetrahydrocolumbamine, canadine, laudanine, sanguinarine, morphine, codeine, codeinone and dimethyl tetrahydoisoquinoline, e.g., 6,7-dimethyl-1-2-3-4-tetrahydroisoquinoline. Other compounds may also be used as the starting material in the desired synthetic pathway and one of skill in the art would recognize the necessary starting material, based upon the synthetic pathway present in the host cell. The source of the starting material may be from the host cell itself, e.g., tyrosine, or the starting material may be added or supplemented to the host cell from an outside source. For example, if the host cells are growing in liquid culture (an in vivo environment), the cell media may be supplemented with the starting material, e.g., tyrosine or norlaudanosoline, which is transported into the cells and converted into the desired products.
[0045] In one embodiment, the host cells of the claimed invention convert norlaudanosoline into reticuline. The norlaudanosoline may be generated through a normal or synthetic pathway in the same or different host cell, or the norlaudanosoline may be fed to the cells from the outside. In this particular embodiment, the host cells comprise 6OMT, CNMT and 4OMT. This embodiment can serve as the basis of additional embodiments. For example, embodiments comprising 6OMT, CNMT and 4OMT may further comprise BBE or Reticuline 7-O-methyltransferase (7OMT, P. somniferum) the embodiments of which may further comprise Scoulerine 9-O-methyltransferase (S9OMT, T. flavum), the embodiments of which may further comprise Canadine synthase (CYP719A, T. flavum). The embodiments that comprise 6OMT, CNMT and 4OMT will generate reticuline from norlaudansoline. The embodiments that comprise 6OMT, CNMT, 4OMT and BBE will generate scoulerine from norlaudanosoline. The embodiments that comprise 6OMT, CNMT, 4OMT, and CYP2D6 with its reductase partner (CPR1 or ATR1) will generate salutaridine from norlaudanosoline. The embodiments that comprise 6OMT, CNMT, 4OMT and 7OMT will generate laudanine from norlaudanosoline. The embodiments that comprise 6OMT, CNMT, 4OMT, BBE and S9OMT will generate tetrahydrocolumbamine from norlaudanosoline. The embodiments that comprise 6OMT, CNMT, 4OMT, BBE, S9OMT and CYP719A with its reductase partner ATR1 will generate canadine from norlaudanosoline.
[0046] The following is a non-exhaustive list of exemplary host organisms comprising heterologous coding sequences. The list is not intended to limit the scope of the invention in any way.
TABLE-US-00003 TABLE III Strain Background Plasmid(s) Enzyme(s) CSY73 W303 P.sub.AR09::TEF, P.sub.ARO10::TEF CSY87 W303 pCS251 P.sub.TEF1-AbPPO2 CSY88 W303 pCS251, P.sub.TEF1-AbPPO2, P.sub.TEF1-TYDC2 pCS221 CSY94 W303 pCS250, P.sub.TEF1-TfNCS10, P.sub.TEF1-TYDC2, pCS283 P.sub.TEF1-maoA CSY95 W303 ChrlV 122460::P.sub.TEF1-TYDC2 CSY104 CSY95 ChrV 1100::P.sub.TEF1-maoA CSY107 W303 pCS222, P.sub.tetO7-yCPR1, P.sub.TEF1-TYDC2, pCS330 P.sub.TEF1-yCYP2D6 CSY116 CSY104 his3::P.sub.GPD-yCPR1 CSY176 W303 his3::P.sub.GAL1-TfNCS CSY177 W303 his3::P.sub.GAL1-Tf6OMT CSY178 W303 his3::P.sub.GAL1-PsNCS2 CSY179 W303 his3::P.sub.GAL1-Ps6OMT CSY234 CSY194 pCS330 P.sub.TEF1-TYDC2, P.sub.TEF1-yCYP2D6 W(R) CSY235 CSY194 pCS222, P.sub.tetO7-yCPR1, P.sub.TEF1-TYDC2, W(R) pCS330 P.sub.TEF1-yCYP2D6 CSY307 W303 pCS827, P.sub.TEF1-Ps6OMT, P.sub.TEF1-PsCNMT, pCS830 P.sub.TEF1-Ps4OMT CSY308 W303 pCS828, P.sub.TEF1-Ps6OMT, P.sub.TEF1-TfCNMT, pCS830 P.sub.TEF1-Ps4OMT CSY309 W303 pCS829, P.sub.TEF1-Tf6OMT, P.sub.TEF1-PsCNMT, pCS830 P.sub.TEF1-Ps4OMT CSY310 W303 pCS772, P.sub.TEF1-Tf6OMT, P.sub.TEF1-TfCNMT, pCS830 P.sub.TEF1-Ps4OMT CSY311 W303 pCS827, P.sub.TEF1-Ps6OMT, P.sub.TEF1-PsCNMT, pCS831 P.sub.TEF1-Tf4OMT CSY312 W303 pCS828, P.sub.TEF1-Ps6OMT, P.sub.TEF1-TfCNMT, pCS831 P.sub.TEF1-Tf4OMT CSY313 W303 pCS829, P.sub.TEF1-Tf6OMT, P.sub.TEF1-PsCNMT, pCS831 P.sub.TEF1-Tf4OMT CSY314 W303 pCS772, P.sub.TEF1-Tf6OMT, P.sub.TEF1-TfCNMT, pCS831 P.sub.TEF1-Tf4OMT CSY288 W303 his3::P.sub.TEF1-Ps6OMT, leu2::P.sub.TEF1-PsCNMT, ura3::P.sub.TEF1-Ps4OMT CSY334 W303 his3::P.sub.TEF1-Ps6OMT, leu2::P.sub.TEF1-PsCNMT, ura3::P.sub.TEF1-Tf4OMT CSY316 W303 his3::P.sub.GAL1-Ps6OMT-loxP-KanR, leu2::P.sub.TEF1-PsCNMT, ura3::P.sub.TEF1-Ps4OMT CSY317 W303 his3::P.sub.TEF1-Ps6OMT, leu2::P.sub.GAL1-PsCNMT-loxP-URA3, ura3::P.sub.TEF1-Ps4OMT CSY318 W303 his3::P.sub.TEF1-Ps6OMT, leu2::P.sub.TEF1-PsCNMT, ura3::P.sub.GAL1-Ps4OMT-loxP-LEU2 CSY319 W303 his3::P.sub.TEF1-Ps6OMT, leu2::P.sub.TEF1-PsCNMT, ura3::P.sub.GAL1-Tf4OMT-loxP-LEU2 CSY325 W303 his3::P.sub.GAL1-Ps6OMT-loxP-KanR, leu2::P.sub.TEF1-PsCNMT, ura3::P.sub.TEF1-Ps4OMT- gal2::HIS3 CSY326 W303 his3::P.sub.TEF1-Ps6OMT, leu2::P.sub.GAL1-PsCNMT-loxP-URA3, ura3::P.sub.TEF1-Ps4OMT, gal2::HIS3 CSY327 W303 his3::P.sub.TEF1-Ps6OMT, leu2::P.sub.TEF1-PsCNMT, ura3::P.sub.GAL1-Ps4OMT-loxP-LEU2, gal2::HIS3 CSY328 W303 his3::P.sub.TEF1-Ps6OMT, leu2::P.sub.TEF1-PsCNMT, ura3::P.sub.GAL1-Tf4OMT-loxP-LEU2, gal2::HIS3 CSY336 CSY288 pCS1018 P.sub.TEF1-PsBBE CSY337 CSY288 pCS1070 P.sub.TEF1-PsBBE, P.sub.TEF1-TfS9OMT CSY338 CSY334 pCS1018 P.sub.TEF1-PsBBE C3Y339 CSY334 pCS1070 P.sub.TEF1-PsBBE, P.sub.TEF1-TfS9OMT C3Y399 CSY288 pCS1018, P.sub.TEF1-PsBBE, P.sub.TEF1-TfS9OMT, pCS953, P.sub.TEF1-TfCYP719A, P.sub.TEF1-AtATR1 pCS1058 CSY400 CSY334 pCS1018, P.sub.TEF1-PsBBE, P.sub.TEF1-TfS9OMT, pCS953, P.sub.TEF1-TfCYP719A, P.sub.TEF1-AtATR1 pCS1058 CSY401 CSY288 pCS1163 P.sub.TEF1-PsR7OMT CSY402 CSY334 pCS1163 P.sub.TEF1-PsR7OMT CSY409 CSY334 his3::P.sub.TEF1-Ps6OMT, leu2::P.sub.TEF1-PsCNMT, ura3::P.sub.TEF1-Tf4OMT, trp1::P.sub.TEF1-AtATR1(KanR) CSY410 CSY409 pCS1018, P.sub.TEF1-PsBBE, P.sub.TEF1-TfS9OMT, pCS953 P.sub.TEF1-TfCYP719A CSY424 CSY334 pCS782 P.sub.TEF1-yCYP2D6 CSY425 CSY409 pCS782 P.sub.TEF1-yCYP2D6 CSY426 CSY288 trp1::P.sub.TEF1-yCPR1(KanR) CSY427 CSY426 pCS782 P.sub.TEF1-yCYP2D6
[0047] The promoters driving expression of the heterologous coding sequences can be constitutive promoters or inducible promoters, provided that the promoters can be active in the host cells. The heterologous coding sequences may be expressed from their native promoters, or non-native promoters may be used. Although not a requirement, such promoters should be medium to high strength in the host in which they are used. Promoters may be regulated or constitutive. In one embodiment, promoters that are not glucose repressed, or repressed only mildly by the presence of glucose in the culture medium, should be used. There are numerous suitable promoters, examples of which include promoters of glycolytic genes such as the promoter of the B. subtilis tsr gene (encoding fructose biphosphate aldolase) or GAPDH promoter from yeast S. cerevisiae (coding for glyceraldehyde-phosphate dehydrogenase) (Bitter G. A., Meth. Enzymol. 152:673 684 (1987)). Other strong promoters include the ADHI promoter of baker's yeast (Ruohonen L., et al., J. Biotechnol. 39:193 203 (1995)), the phosphate-starvation induced promoters such as the PHOS promoter of yeast (Hinnen, A., et al., in Yeast Genetic Engineering, Barr, P. J., et al. eds, Butterworths (1989), and the alkaline phosphatase promoter from B. licheniformis (Lee. J. W. K., et al., J. Gen. Microbiol. 137:1127 1133 (1991)). Some specific examples of yeast promoters include inducible promoters such as Gal1-10, Gal1, GalL, GalS, repressible promoter Met25, tetO, and constitutive promoters such as glyceraldehyde 3-phosphate dehydrogenase promoter (GPD), alcohol dehydrogenase promoter (ADII), translation-elongation factor-1-alpha promoter (TEF), cytochrome c-oxidase promoter (CYC1), MRP7 promoter, etc. Autonomously replicating yeast expression vectors containing promoters inducible by hormones such as glucocorticoids, steroids, and thyroid hormones are also known and include, but are not limited to, the glucorticoid responsive element (GRE) and thyroid hormone responsive element (TRE). These and other examples are described U.S. Pat. No. 7,045,290, which is incorporated by reference, including the references cited therein. Additional vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH may be used. Additionally any promoter/enhancer combination (as per the Eukaryotic Promoter Data Base EPDB) could also be used to drive expression of genes. Similarly, one of skill in the art can choose appropriate promoters specific to the host cell, e.g., E. coli. One can also use promoter selection to optimize transcript, and hence, enzyme levels to maximize production while minimizing energy resources.
[0048] Vectors useful in the present invention include vectors for use in yeast and other cells. Yeast vectors can be broken up into 4 general categories: integrative vectors (YIp), autonomously replicating high copy-number vectors (YEp), autonomously replicating low copy-number vectors (YCp) and vectors for cloning large fragments (YACs). There are myriad of yeast expression vectors that are commercially available from sources such as, but not limited to, American Type Culture Collection (ATCC, Manassas, Va., USA) and Invitrogen Corp. (Carlsbad, Calif., USA).
[0049] Alternatively, insect cells may be used as host cells. In one embodiment, the polypeptides of the invention are expressed using a baculovirus expression system (see, Luckow et al., Bio/Technology, 1988, 6, 47; BACULOVIRUS EXPRESSION VECTORS: A LABORATORY MANUAL, O'Rielly et al. (Eds.), W.H. Freeman and Company, New York, 1992; and U.S. Pat. No. 4,879,236, each of which is incorporated herein by reference in its entirety). In addition, the MAXBAC complete baculovirus expression system (Invitrogen) can, for example, be used for production in insect cells.
[0050] Suitable host cells are discussed further in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990). Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
[0051] Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms transformation and transfection are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection, or electroporation. Suitable methods for transforming or transfecting host cells can be found in Sambrook, et al (MOLECULAR CLONING: A LABORATORY MANUAL 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989), and other laboratory manuals.
[0052] For stable transfection of mammalian cells, it is known that, depending upon the expression vector and transfection technique used, only a small fraction of cells may integrate the foreign DNA into their genome. In order to identify and select these integrants, a gene that encodes a selectable marker (e.g., resistance to antibiotics) is generally introduced into the host cells along with the gene of interest. Various selectable markers include those that confer resistance to drugs, such as G418, hygromycin, dihydrofolate reductase (DHFR) and methotrexate. Nucleic acid encoding a selectable marker can be introduced into a host cell on the same vector as that encoding the functional enzyme, or its equivalent, or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die).
[0053] Similarly, if the host cells are bacterial cells or animal or insect cells, there are a variety of commercially available expression vectors from which to choose. The choice of expression vector system will be apparent to one of skill in the art. One example of a yeast expression vector includes, but is not limited to, p413-TEF, p426-GPD, pCM190, pRS313, pYES2-NT/A, etc.
[0054] The choice of yeast plasmids will depend on the host. For Z. rouxii vectors based on the native cryptic plasmids pSR1 (Toh, E. et al., J. Bacteriol. 151:1380-1390 (1982)), pSB1, pSB2, pSB3 or pSB4 (Toh-E et al., J. Gen. Microbiol. 130:2527-2534 (1984)) may be used. Plasmid pSRT303D (Jearnpipatkul, A., et al., Mol. Gen. Genet. 206:88-94 (1987)) is an example of useful plasmid vector for Zygosaccharomyces yeast.
[0055] Methods of transforming yeast for the purposes of the present invention are well known in the art. Briefly, inserting DNA into yeast can be accomplished with techniques that include but are not limited to, those using spheroplasts, treating with lithium salts and electroporation. The methods are used to insert the heterologous coding sequences into the host cells such that the host cells will functionally express the enzymes or their equivalents and convert the starting/intermediate compounds into the desired end product.
[0056] Of course, the present invention also relates to methods of producing BIAs comprising culturing the host cells under conditions suitable for protein production such that the heterologous coding sequences are expressed in the host cells and act upon the starting/intermediate molecules.
[0057] In another embodiment of the present invention the host cells may also be used for functional genomics studies in both plant and animals. For example, host cells that are able to convert a given substrate such as norlaudanosoline into reticuline or other downstream BIAs can be used to screen libraries of plant cDNA sequences to discover enzymes which act on the product molecule. Of course, the screening methods can also be applied to precursors of BIAs. The screening methods can be accomplished by cloning a cDNA library from an organism, such as a plant or any organism that produces BIAs or an intermediate thereof, e.g., dopamine; into a suitable expression vector, e.g., a yeast expression vector, and transforming the library of plasmids into the engineered host cells. The standard LiAc/SSD/PEG method can be used. Single colonies can then be grown in liquid culture in the presence of substrate and the growth media or cell extract analyzed by LC-MS. New BIA molecules and the corresponding enzymes catalyzing their production can be identified by chromatogram peaks not present in strains lacking the cDNA library sequence. In vitro or other high-throughput methods can also be used if a suitable assay has been developed for a particular metabolite or byproduct, for example. An additional area of study where these engineered host cells can be employed is in the characterization of the recombinant enzymes known or suspected to be involved in these pathways. In particular, host cells expressing one or more heterologous coding sequences can be grown in the presence of various substrates and the resulting metabolites analyzed by LC-MS or other methods. Both in vivo and in vitro methods can be used in this manner to determine the substrate specificities of these enzymes and possibly discover new catalytic activities.
EXAMPLES
Example 1Construction of Yeast Expression Vectors
[0058] Standard molecular biology methods were used to construct the yeast expression vectors. Heterologous coding sequences for the genes of interest were received as plasmids, typically suited for expression in E. coli. Coding sequences were either amplified by polymerase chain reaction (PCR) or excised from the vectors if restriction sites were compatible with the destination vector. Briefly, yeast shuttle vectors were constructed based on pCM185 and pCM180 which have an ampicillin resistance marker for maintenance in E. coli, URA and TRY selection markers, respectively, and a centromeric (ARS1/CEN4) origin of replication for yeast. To construct exemplary vectors, the TEF1 promoter was amplified from p413-TEF and the CYC1 promoter from pCM190 and assembled with the NCS coding sequence using PCR methods. Primers for each segment included suitable restriction sites both for cloning into the plasmid backbone and allowing the coding sequence to be easily replaced. This promoter-gene-terminator assembled PCR product was cloned into XhoI/BamHI sites of pCM185. Similar methods were used to make a second DNA insert containing the TEF promoter and 6OMT gene, which was then cloned into PmeI/NotI sites of the previous vector such that a CYC1 terminator for this gene was included on the plasmid backbone. Similar methods were used to construct the analogous vector with a TRP selection marker. In later constructs, the origin of replication was replaced with the 2 origin using standard cloning procedures to allow for high copy expression in yeast. For cloning and expression of desired enzyme combinations, heterologous coding sequences were cloned into these primary vectors; restriction sites were changed using site-directed mutagenesis if necessary. To remove the second gene from these constructs, vectors were digested with MluI and self-ligated. To remove the first gene from these constructs, the vectors were digested with XhoI and either BamHI or PmeI, ends were blunted using the Klenow enzyme, and self-ligated. Alternatively, a single promoter vector can be made by cloning the gene of interest between the first promoter and second terminator. Analogous vectors with the HIS selection marker were also constructed as needed; for example, to express more than four heterologous coding sequences.
Example 2Production of Codon-Optimized CYP2D6
[0059] The coding sequence for CYP2D6 was optimized based on codon usage in S. cerevisiae as well as RNA secondary structure, using commercially available service providers, such as DNA2.0 Inc. (Menlo Park, Calif., USA). There are other service providers that offer codon-optimized sequences, and some algorithms are available on the world-wide web.
[0060] The following is an example of a sequence for yeast codon-optimized CYP2D6 sequence; SalI and NotI restriction sites for cloning are underlined.
TABLE-US-00004 1 GTCGACATGGCATTGGAAGCACTAGTCCCTTTAGCTGTAATTGTAGCAAT 51 ATTCCTGTTATTGGTAGACCTTATGCATAGAAGACAAAGATGGGCTGCAA 101 GATACCCACCCGGCCCACTACCCTTGCCAGGACTAGGTAACCTTTTACAT 151 GTTGATTTCCAAAATACTCCGTACTGTTTTGATCAATTGAGGAGAAGATT 201 CGGAGATGTTTTCAGTCTGCAGTTGGCATGGACACCAGTCGTCGTTTTAA 251 ATGGTTTGGCTGCAGTAAGAGAAGCTTTAGTTACGCATGGCGAAGATACG 301 GCGGACAGGCCTCCTGTGCCCATTACACAGATATTGGGTTTCGGACCTAG 351 ATCTCAGGGTGTATTCCTTGCCCGTTACGGTCCTGCGTGGAGAGAACAGA 401 GAAGGTTTTCTGTATCAACACTTAGGAATTTGGGTCTAGGCAAGAAATCA 451 TTGGAACAATGGGTGACCGAGGAAGCCGCTTGTTTGTGCGCAGCCTTTGC 501 TAATCATTCTGGCCGTCCTTTTAGACCTAATGGATTACTTGATAAAGCAG 551 TATCTAATGTGATTGCCTCCTTAACATGTGGTAGACGTTTTGAGTACGAT 601 GACCCAAGGTTTTTGAGATTGTTAGATCTAGCACAAGAGGGATTAAAGGA 651 AGAAAGTGGTTTCTTGAGAGAGGTTTTGAATGCTGTTCCAGTGCTATTAC 701 ACATTCCAGCCCTAGCTGGAAAGGTCTTGAGATTTCAAAAGGCTTTCTTA 751 ACGCAGCTTGATGAGTTACTTACAGAGCATAGGATGACTTGGGATCCTGC 801 TCAACCCCCGAGAGATCTAACCGAGGCCTTCCTGGCTGAAATGGAAAAAG 851 CAAAGGGTAATCCGGAAAGTTCCTTCAATGATGAAAACCTGAGAATTGTC 901 GTGGCGGACTTGTTCTCTGCCGGAATGGTGACAACGTCTACTACTTTGGC 951 CTGGGGACTTCTATTAATGATTCTTCATCCAGACGTCCAGAGAAGAGTGC 1001 AACAAGAAATAGATGATGTGATAGGACAAGTTAGAAGGCCAGAAATGGGT 1051 GACCAGGCACATATGCCATATACGACTGCTGTAATCCATGAAGTGCAACG 1101 TTTTGGGGACATTGTCCCCTTGGGAATGACCCACATGACTTCTCGTGATA 1151 TTGAAGTACAAGGTTTCAGAATACCAAAGGGAACTACGCTGATTACGAAT 1201 CTGTCTAGCGTGCTAAAAGACGAAGCTGTCTGGGAGAAGCCATTTAGGTT 1251 TCATCCAGAACACTTCTTAGACGCTCAGGGTCATTTCGTAAAGCCTGAAG 1301 CATTCCTTCCGTTTAGTGCCGGACGTAGGGCGTGTTTGGGTGAACCATTA 1351 GCTAGAATGGAATTATTCCTTTTTTTTACATCTTTATTGCAGCACTTTTC 1401 ATTTTCTGTTCCGACTGGCCAACCCAGACCTAGCCATCATGGTGTTTTTG 1451 CTTTCCTAGTTTCTCCCTCTCCTTATGAATTATGCGCGGTTCCCCGITGA 1501 GCGGCCGC
[0061] The following is an example of human MAO A sequence optimized for expression in yeast and includes 8 nt preceding the start codon, which is underlined:
TABLE-US-00005 1 AATTAATAATGGAAAACCAAGAAAAGGCTTCTATCGCGGGCCACATGTTC 51 GACGTAGTCGTGATCGGAGGTGGCATTTCAGGACTATCTGCTGCCAAACT 101 CTTGACTGAATATGGCGTTAGTGTTTTGGTTTTAGAAGCTCGGGACAGGG 151 TTGGAGGAAGAACATATACTATAAGGAATGAGCATGTTGATTACGTAGAT 201 GTTGGTGGAGCTTATGTGGGACCAACCCAAAACAGAATCTTACGCTTGTC 251 TAAGGAGCTGGGCATAGAGACTTACAAAGTGAATGTCAGTGAGCGTCTCG 301 TTCAATATGTCAAGGGGAAAACATATCCATTTCGGGGCGCCTTTCCACCA 351 GTATGGAATCCCATTGCATATTTGGATTACAATAATCTGTGGAGGACAAT 401 AGATAACATGGGGAAGGAGATTCCAACTGATGCACCCTGGGAGGCTCAAC 451 ATGCTGACAAATGGGACAAAATGACCATGAAAGAGCTCATTGACAAAATC 501 TGCTGGACAAAGACTGCTAGGCGGTTTGCTTATCTTTTTGTGAATATCAA 551 TGTGACCTCTGAGCCTCACGAAGTGTCTGCCCTGTGGTTCTTGTGGTATG 601 TGAAGCAGTGCGGGGGCACCACTCGGATATTCTCTGTCACCAATGGTGGC 651 CAGGAACGGAAGTTTGTAGGTGGATCTGGTCAAGTGAGCGAACGGATAAT 701 GGACCTCCTCGGAGACCAAGTGAAGCTGAACCATCCTGTCACTCACGTTG 751 ACCAGTCAAGTGACAACATCATCATAGAGACGCTGAACCATGAACATTAT 801 GAGTGCAAATACGTAATTAATGCGATCCCTCCGACCTTGACTGCCAAGAT 851 TCACTTCAGACCAGAGCTTCCAGCAGAGAGAAACCAGTTAATTCAGCGGC 901 TTCCAATGGGAGCTGTCATTAAGTGCATGATGTATTACAAGGAGGCCTTC 951 TGGAAGAAGAAGGATTACTGTGGCTGCATGATCATTGAAGATGAAGATGC 1001 TCCAATTTCAATAACCTTGGATGACACCAAGCCAGATGGGTCACTGCCTG 1051 CCATCATGGGCTTCATTCTTGCCCGGAAAGCTGATCGACTTGCTAAGCTA 1101 CATAAGGAAATAAGGAAGAAGAAAATCTGTGAGCTCTATGCCAAAGTGCT 1151 GGGATCCCAAGAAGCTTTACATCCAGTGCATTATGAAGAGAAGAACTGGT 1201 GTGAGGAGCAGTACTCTGGGGGCTGCTACACGGCCTACTTCCCTCCTGGG 1251 ATCATGACTCAATATGGAAGGGTGATTCGTCAACCCGTGGGCAGGATTTT 1301 CTTTGCGGGCACAGAGACTGCCACAAAGTGGAGCGGCTACATGGAAGGGG 1351 CAGTTGAGGCTGGAGAACGAGCAGCTAGGGAGGTCTTAAATGGTCTCGGG 1401 AAGGTGACCGAGAAAGATATCTGGGTACAAGAACCTGAATCAAAGGACGT 1451 TCCAGCGGTAGAAATCACCCACACCTTCTGGGAAAGGAACCTGCCCTCTG 1501 TTTCTGGCCTGCTGAAGATCATTGGATTTTCCACATCAGTAACTGCCCTG 1551 GGGTTTGTGCTGTACAAATACAAGCTCCTGCCACGGTCTTGA
Example 3Production of Truncated NCS
[0062] The T. flavum NCS sequence, courtesy of Peter Facchini, was that of the N-terminal 10 truncation. To construct the full-length gene, the first 30 nucleotides (coding for 10 amino acids) were included in the forward primer sequence used for cloning the gene. For other variants, such as the 19 N-terminal truncation, the forward primer was designed to amplify the gene beginning at the 20.sup.th amino acid and including an additional start codon if the new starting amino acid was not a methionine. To compare expression levels qualitatively, we cloned each variant into a yeast expression vector containing a V5 epitope tag (pYES2-NT/A, Invitrogen), transformed the plasmids into the wild-type yeast strain using the standard LiAc/SSD/PEG method (Gietz, R D and Woods, R A. Methods in Enzymology, Vol. 350, pp. 87-96, 2002), and performed Western blot analysis on the total protein lysates. This showed that the T. flavum NCS10 was the most highly expressed in yeast, consistent with E. coli studies.
Example 4Measurement of Dopamine Production
[0063] Yeast strains were constructed to produce dopamine from tyrosine. A high-copy-TRP plasmid containing TYDC2 and CYP2D6 both between the TEF1 promoter and CYC1 terminator was tested in various yeast strains. The standard LiAc/SSD/PEG method was used to transform the plasmid(s) into yeast. The CYP2D6 activity is enhanced as evidenced by an increase in dopamine production when the background strain is W(R), which overexpresses CPR1 from the chromosome. An additional increase in dopamine accumulation is observed when cells are co-transformed with a second plasmid expressing additional copies of CPR1 from the tetO.sub.7 promoter. Alterations to the growth media have also been shown to enhance the activity of P450s in yeast (Jiang, H and Morgan, J A. Biotechnology and Bioengineering, Vol. 85, No 2, pp. 130-7). Media containing 3.4 g/L yeast nitrogen base, 5 g/L casein hydrolysate, and 20 g/L glucose was shown to improve dopamine production over standard SC media. For measurement of tyramine and dopamine accumulation, the growth media can be analyzed directly by LC-MS. Intracellular concentrations can be estimated by preparation of cell extracts. Briefly, cells are pelleted at 6000 rpm for 5 min at 4 C. and the supernatant carefully removed. Using a pipette, pellets of the cell paste are dropped into liquid nitrogen and a mortar and pestle used to homogenize the cells. Metabolites are extracted with methanol and solids removed by centrifugation; the liquid is passed through a syringe filter to remove any remaining debris. Appropriate dilutions are made prior to LC-MS analysis using 20 L injection volume. Samples were run on an Agilent ZORBAX SB-Aq 3250 mm, 5 m column with 0.1% acetic acid as solvent A and methanol as solvent B. A gradient elution is used to separate the metabolites of interest: 0-10 min at 100% A, 10-30 min 0-90% B, 30-35 min 90-0% B, followed by a 5 min equilibration at 100% A. Tyrosine, tyramine, dopamine, and L-dopa elute within the first 10 min so that an isocratic elution may be used if analyzing only these and/or similar metabolites. Following LC separation, metabolites are injected into an Agilent 6320 ion trap MSD for detection. Extracted ion chromatograms are used to identify peaks for selected ions and compared to available standards in terms of elution time and MS fingerprint.
Example 5Measurement of Norcoclaurine Production
[0064] Norcoclaurine was produced using both in vivo and in vitro methods. For in vitro experiments, protocols were based on published work (Samanani, N, Liscombe, D K, and Facchini, P. The Plant Journal, Vol. 40, pp. 302-313). Both E. coli and yeast cells expressing NCS variants were lysed with B-PER or Y-PER (Pierce), respectively, and total protein extracts were used in the assay. In vitro reactions were analyzed by LC-MS. Samples were run on an Agilent ZORBAX SB-Aq 3250 mm, 5 m column with 0.1% acetic acid as solvent A and methanol as solvent B. A gradient elution is used to separate the metabolites of interest: 0-10 min at 100% A, 10-30 min 0-90% B, 30-35 min 90-0% B, followed by a 5 min equilibration at 100% A. Following LC separation, metabolites are injected into an Agilent 6320 ion trap MSD for detection. Norcoclaurine elutes at 21.2 min using this method. Without a commercially available standard, norcoclaurine is confirmed by its characteristic fragmentation pattern. With the ion trap set to perform MS/MS in the 272 ion, the major fragments of the parent ion of m/z=107 (benzyl) and m/z=161 (isoquinoline) were identified. For in vivo experiments, yeast cells expressing NCS were supplemented with dopamine (between 10 M and 1 mM) and 4-HPA (custom synthesized from Biosynthesis, concentration undetermined). The above method was used to analyze the growth media directly to detect extracellular norcoclaurine accumulation.
Example 6Production and Measurement of Reticuline and its Intermediates
[0065] For production of reticulin from the substrate norlaudanosoline (or laudanosohne), yeast cells were transformed with plasmids expressing various combinations of 6OMT, CNMT, and 4OMT coding sequences using the standard LiAc/SSD/PEG method. Yeast cells were grown in SC media lacking uracil and tryptophan for plasmid maintenance. The growth media (SC-URA/-TRP) was supplemented with norlaudanosoline at concentrations between 1-5 mM from a 10 or 20 mM stock solution in water. Cells were grown in test tubes at 30 C. with shaking at 200 rpm; volumes ranged from 1-10 mL and time points were from 8 hrs up to 1 week following addition of substrate. Cells (or an aliquot of culture) were pelleted and the supernatant analyzed directly by LC-MS. Samples were run on an. Agilent ZORBAX SB-Aq 3250 mm, 5 m column with 0.1% acetic acid as solvent A and methanol as solvent B. A gradient elution is used to separate the metabolites of interest: 0-10 min at 100% A, 10-30 min 0-90% B, 30-35 min 90-0% B, followed by a 5 min equilibration at 100% A. Following LC separation, metabolites are injected into an Agilent 6320 ion trap MSD for detection. Reticuline elutes at 23.6 min with this method and the correct structure of this metabolite is confirmed by performing MS/MS on the 330 ion to produce the fragments m/z=136 and m/z=192. Based on the results from plasmid-based expression, the P. somniferum 6OMT and CNMT were selected with either the P. somniferum or T. flavum 4OMT as the best enzyme combinations, and these sequences were integrated into the chromosome using homologous recombination. In addition, strains were constructed to test each enzyme individually, typically using a single high-copy plasmid with the TEF promoter driving expression of the coding sequence. For the 6OMT activity, the correct product, 6-O-methyl norlaudanosoline, was detected by LC-MS when norlaudanosoline was present in the growth media; in vitro assays based on published protocols and using yeast lysates were also used to confirm this activity (Ounaroon, A et. Al. The Plant Journal, Vol. 36, pp. 808-19). Yeast cells expressing the CNMT enzyme converted 6,7-dimethyl-1,2,3,4-tetrahydroisoquino line present at 1 mM in the growth media to the correct N-methylated product in vivo. Yeast cells expressing the 4OMT enzyme methylated the substrates norlaudanosoline and laudanosoline in vivo. The correct location of the methyl group addition to each substrate is confirmed by performing MS/MS on the selected ion in all cases.
Example 7Production and Measurement of Downstream Metabolites of Reticuline
[0066] For production of metabolites beyond reticuline, yeast strains with chromosomal integrations of 6OMT, CNMT, and 4OMT were used when possible. These host cells contained no selection markers, allowing for additional coding sequences to be introduced on plasmids. For production of scoulerine, a plasmid expressing BBE was transformed into reticuline-producing strain(s) using the standard LiAc/SSD/PEG method. For production of tetrahydrocolumbamine, plasmids expressing BBE and S9OMT were cotransformed. For production of canadine, plasmids expressing BBE, S9OMT, CYP719A, and ATR1 were contransformed. Construction of a yeast strain to stably express ATR1 along with the reticuline-producing enzymes and transformed with BBE, S9OMT, and CYP719A plasmids showed an increase in CYP719A activity (compared to plasmid-based expression of ATR1) demonstrated by increased conversion of substrate to canadine. Metabolites were detected in the growth media when supplemented with 1 mM or greater norlaudanosoline or laudanosoline. Samples were run on an Agilent ZORBAX SB-Aq 3250 mm, 5 m column with 0.1% acetic acid as solvent A and methanol as solvent B. A gradient elution is used to separate the metabolites of interest: 0-10 min at 100% A, 10-30 min 0-90% B, 30-35 min 90-0% B, followed by a 5 min equilibration at 100% A. Following LC separation, metabolites are injected into an Agilent 6320 ion trap MSD for detection. For each metabolite in the pathway, MS/MS was performed and the spectra compared. Based on the patterns observed, it can be confirmed that the peak identified as canadine, for example, has the same molecular structure as its precursor, tetrahydrocolumbamine. For production of salutaridine, the yeast strain stably expressing 6OMT, CNMT, 4OMT, and ATR1 was transformed with a plasmid expressing CYP2D6. When the growth media was supplemented with norlaudanosoline or laudanosoline, salutaridine was detected by LC-MS. The elution time of salutaridine is identical to that of scoulerine as expected although its fragmentation pattern, particularly the 165 ion, indicates that the structure is in the correct (R) conformation based on the reported fragmentation pattern of salutaridinol.