METHODS FOR REDUCING SEVERITY OF PULMONARY FIBROSIS
20190099471 ยท 2019-04-04
Inventors
- Carol Jiurong Liang (Encino, CA, US)
- Dianhua Jiang (Encino, CA, US)
- Paul W. Noble (Beverly Hills, CA, US)
Cpc classification
A61K45/06
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
International classification
Abstract
The described invention provides a method of treating a lung injury at risk of progressing to a fibrotic lung disease in a subject in need thereof comprising administering to the subject a composition comprising a therapeutic amount of IL-6 polypeptide, hyaluronan (HA), mimetics thereof, pharmaceutically acceptable salts thereof, or combinations thereof, wherein the therapeutic amount is effective to increase renewal of alveolar epithelial cell 2 (AEC2) stem cells, to repair the injury, to reduce lung fibrosis, or a combination thereof.
Claims
1. A method of treating a lung injury at risk of progressing to a fibrotic lung disease in a subject in need thereof comprising administering to the subject a pharmaceutical composition comprising a therapeutic amount of IL-6 polypeptide, hyaluronan (HA), mimetic s thereof, or pharmaceutically acceptable salts thereof, wherein the therapeutic amount is effective to increase renewal of alveolar epithelial cell 2 (AEC2) stem cells, to repair the injury, to reduce lung fibrosis, or a combination thereof.
2. The method according to claim 1, wherein the lung injury or fibrotic lung disease is pulmonary fibrosis.
3. The method according to claim 1, wherein the lung injury or fibrotic lung disease is idiopathic pulmonary fibrosis (IPF).
4. The method according to claim 1, wherein the lung injury is a bleomycin-induced lung injury.
5. The method according to claim 1, wherein the method further comprises administering to the subject a therapeutic amount of one or a plurality of immunomodulators, analgesics, anti-inflammatory compounds, anti-fibrotic compounds, proton pump inhibitors, oxygen therapy, or combinations thereof.
6. The method according to claim 5, i. wherein the immunomodulator is prednisone, azathioprine, mycophenolate, mycophenolate mofetil, colchicine, or interferon-gamma 1b; or ii. wherein the analgesic is codeine, hydrocodone, oxycodone, methadone, hydromorphone, morphine, or fentanyl; or iii. wherein the anti-inflammatory compound is aspirin, celecoxib, diclofenac, diflunisal, etodolac, ibuprofen, indomethacin, ketoprofen, ketorolac nabumetone, naproxen, nintedanib, oxaprozin, pirfenidone, piroxicam, salsalate, sulindac, or tolmetin; or iv. wherein the anti-fibrotic compound is nintedanib or pirfenidone; or v. wherein the proton pump inhibitor is omeprazole, lansoprazole, dexlansoprazole, esomeprazole, pantoprazole, rabeprazole, or ilaprazole.
7. (canceled)
8. (canceled)
9. (canceled)
10. (canceled)
11. (canceled)
12. The method according to claim 1, wherein the IL-6 polypeptide is a recombinant IL-6 polypeptide or pharmaceutically acceptable salt thereof.
13. The method according to claim 1, wherein the therapeutic amount is effective to increase the cell surface expression of hyaluronan in one or a plurality of alveolar epithelial cell 2 (AEC2) cells in the subject.
14. The method according to claim 1, wherein the therapeutic amount is effective to increase toll-like receptor 4 (TLR4)-hyaluronan (HA) signaling in the subject.
15. A method of increasing alveolar epithelial cell 2 (AEC2) stem cell renewal in a lung to reduce progression of a lung injury to a fibrotic disease in a subject in need thereof comprising administering to the subject a pharmaceutical composition comprising a therapeutic amount of IL-6 polypeptide, hyaluronan (HA), or mimetics thereof, pharmaceutically acceptable salts thereof.
16. The method according to claim 15, wherein the lung injury or fibrotic lung disease is pulmonary fibrosis.
17. The method according to claim 15, wherein the lung injury or fibrotic lung disease is idiopathic pulmonary fibrosis (IPF).
18. The method according to claim 15, wherein the lung injury is a bleomycin-induced lung injury.
19. The method according to claim 15, wherein the method further comprises administering to the subject a therapeutic amount of one or a plurality of immunomodulators, analgesics, anti-inflammatory compounds, anti-fibrotic compounds, proton pump inhibitors, oxygen therapy, or combinations thereof.
20. The method according to claim 19, i. wherein the immunomodulator is prednisone, azathioprine, mycophenolate, mycophenolate mofetil, colchicine, or interferon-gamma 1b; or ii. wherein the analgesic is codeine, hydrocodone, oxycodone, methadone, hydromorphone, morphine, or fentanyl; or iii. wherein the anti-inflammatory compound is aspirin, celecoxib, diclofenac, diflunisal, etodolac, ibuprofen, indomethacin, ketoprofen, ketorolac nabumetone, naproxen, nintedanib, oxaprozin, pirfenidone, piroxicam, salsalate, sulindac, or tolmetin; or iv. wherein the anti-fibrotic compound is nintedanib or pirfenidone; or v. wherein the proton pump inhibitor is omeprazole, lansoprazole, dexlansoprazole, esomeprazole, pantoprazole, rabeprazole, or ilaprazole.
21. (canceled)
22. (canceled)
23. (canceled)
24. (canceled)
25. (canceled)
26. The method according to claim 15, wherein the IL-6 polypeptide is a recombinant IL-6 polypeptide or pharmaceutically acceptable salt thereof.
27. The method according to claim 15, wherein the therapeutic amount is effective to increase the cell surface expression of hyaluronan in one or a plurality of alveolar epithelial cell 2 (AEC2s) in the subject.
28. The method according to claim 15, wherein the therapeutic amount is effective to increase toll-like receptor 4 (TLR4)-hyaluronan (HA) signaling in the subject.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0115] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
DETAILED DESCRIPTION OF EMBODIMENTS
[0131] Before the present compositions and methods are described, it is to be understood that this invention is not limited to the particular processes, compositions, or methodologies described, as these may vary. It is also to be understood that the terminology used in the description is for the purpose of describing the particular versions or embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the present invention, the preferred methods, devices, and materials are now described. All publications mentioned herein are incorporated by reference in their entirety. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.
[0132] It must also be noted that as used herein and in the appended claims, the singular forms a, an, and the include plural reference unless the context clearly dictates otherwise. Thus, for example, reference to a peptide is a reference to one or more peptides and equivalents thereof known to those skilled in the art, and so forth.
[0133] As used herein, the term about means plus or minus 10% of the numerical value of the number with which it is being used. Therefore, about 50% means in the range of 40%-60%.
[0134] Administering when used in conjunction with a therapeutic means to administer a therapeutic directly into or onto a target organ, tissue or cell or to administer a therapeutic to a subject, whereby the therapeutic positively impacts the organ, tissue or cell to which it is targeted. Thus, as used herein, the term administering, when used in conjunction with IL-6 polypeptide or hyaluronan (HA), can include, but is not limited to, providing IL-6 polypeptide or hyaluronan (HA) into or onto the target organ, tissue or cell; providing IL-6 polypeptide or hyaluronan (HA) systemically to a patient by, e.g., intravenous injection, whereby the therapeutic reaches the target organ, tissue or cell; providing IL-6 polypeptide or hyaluronan (HA) in the form of the encoding sequence thereof to the target tissue (e.g., by so-called gene-therapy techniques). Administering may be accomplished by parenteral, oral or topical administration, by inhalation, or by such methods in combination with other known techniques.
[0135] The terms animal, patient, and subject as used herein include, but are not limited to, humans and non-human vertebrates such as wild, domestic and farm animals. According to some embodiments, the terms animal, patient, and subject may refer to humans. According to some embodiments, the terms animal, patient, and subject may refer to non-human mammals. According to some embodiments, the terms animal, patient, and subject may refer to any or combination of: dogs, cats, pigs, cows, horses, goats, sheep or other domesticated non-human mammals. According to some embodiments, the subject is a human patient that has been diagnosed or is suspected of having a lung injury at risk of progressing to a fibrotic lung disease. According to some embodiments, the subject is a human patient that has been diagnosed or is suspected of having pulmonary fibrosis. According to some embodiments, the subject is a human patient that has been diagnosed or is suspected of idiopathic pulmonary fibrosis. According to some embodiments, the subject is a human patient that has been diagnosed or is suspected of having a bleomycin-induced lung injury. A subject in need of treatment for a particular condition can be a subject having that condition, diagnosed as having that condition, or at risk of developing that condition.
[0136] The terms apoptosis or programmed cell death refer to a highly regulated and active process that contributes to biologic homeostasis comprised of a series of biochemical events that lead to a variety of morphological changes, including blebbing, changes to the cell membrane, such as loss of membrane asymmetry and attachment, cell shrinkage, nuclear fragmentation, chromatin condensation, and chromosomal DNA fragmentation, without damaging the organism.
[0137] Apoptotic cell death is induced by many different factors and involves numerous signaling pathways, some dependent on caspase proteases (a class of cysteine proteases) and others that are caspase independent. It can be triggered by many different cellular stimuli, including cell surface receptors, mitochondrial response to stress, and cytotoxic T cells, resulting in activation of apoptotic signaling pathways.
[0138] The caspases involved in apoptosis convey the apoptotic signal in a proteolytic cascade, with caspases cleaving and activating other caspases that then degrade other cellular targets that lead to cell death. The caspases at the upper end of the cascade include caspase-8 and caspase-9. Caspase-8 is the initial caspase involved in response to receptors with a death domain (DD) like Fas.
[0139] Receptors in the TNF receptor family are associated with the induction of apoptosis, as well as inflammatory signaling. The Fas receptor (CD95) mediates apoptotic signaling by Fas-ligand expressed on the surface of other cells. The Fas-FasL interaction plays an important role in the immune system and lack of this system leads to autoimmunity, indicating that Fas-mediated apoptosis removes self-reactive lymphocytes. Fas signaling also is involved in immune surveillance to remove transformed cells and virus infected cells. Binding of Fas to oligimerized FasL on another cell activates apoptotic signaling through a cytoplasmic domain termed the death domain (DD) that interacts with signaling adaptors including FAF, FADD and DAX to activate the caspase proteolytic cascade. Caspase-8 and caspase-10 first are activated to then cleave and activate downstream caspases and a variety of cellular substrates that lead to cell death.
[0140] Mitochondria participate in apoptotic signaling pathways through the release of mitochondrial proteins into the cytoplasm. Cytochrome c, a key protein in electron transport, is released from mitochondria in response to apoptotic signals, and activates Apaf-1, a protease released from mitochondria. Activated Apaf-1 activates caspase-9 and the rest of the caspase pathway. Smac/DIABLO is released from mitochondria and inhibits IAP proteins that normally interact with caspase-9 to inhibit apoptosis. Apoptosis regulation by Bcl-2 family proteins occurs as family members form complexes that enter the mitochondrial membrane, regulating the release of cytochrome c and other proteins. TNF family receptors that cause apoptosis directly activate the caspase cascade, but can also activate Bid, a Bcl-2 family member, which activates mitochondria-mediated apoptosis. Bax, another Bcl-2 family member, is activated by this pathway to localize to the mitochondrial membrane and increase its permeability, releasing cytochrome c and other mitochondrial proteins. Bcl-2 and Bcl-xL prevent pore formation, blocking apoptosis. Like cytochrome c, AIF (apoptosis-inducing factor) is a protein found in mitochondria that is released from mitochondria by apoptotic stimuli. While cytochrome C is linked to caspase-dependent apoptotic signaling, AIF release stimulates caspase-independent apoptosis, moving into the nucleus where it binds DNA. DNA binding by AIF stimulates chromatin condensation, and DNA fragmentation, perhaps through recruitment of nucleases.
[0141] The mitochondrial stress pathway begins with the release of cytochrome c from mitochondria, which then interacts with Apaf-1, causing self-cleavage and activation of caspase-9. Caspase-3, -6 and -7 are downstream caspases that are activated by the upstream proteases and act themselves to cleave cellular targets.
[0142] Granzyme B and perforin proteins released by cytotoxic T cells induce apoptosis in target cells, forming transmembrane pores, and triggering apoptosis, perhaps through cleavage of caspases, although caspase-independent mechanisms of Granzyme B mediated apoptosis have been suggested.
[0143] Fragmentation of the nuclear genome by multiple nucleases activated by apoptotic signaling pathways to create a nucleosomal ladder is a cellular response characteristic of apoptosis. One nuclease involved in apoptosis is DNA fragmentation factor (DFF), a caspase-activated DNAse (CAD). DFF/CAD is activated through cleavage of its associated inhibitor ICAD by caspases proteases during apoptosis. DFF/CAD interacts with chromatin components such as topoisomerase II and histone H1 to condense chromatin structure and perhaps recruit CAD to chromatin. Another apoptosis activated protease is endonuclease G (EndoG). EndoG is encoded in the nuclear genome but is localized to mitochondria in normal cells. EndoG may play a role in the replication of the mitochondrial genome, as well as in apoptosis. Apoptotic signaling causes the release of EndoG from mitochondria. The EndoG and DFF/CAD pathways are independent since the EndoG pathway still occurs in cells lacking DFF.
[0144] Hypoxia, as well as hypoxia followed by reoxygenation can trigger cytochrome c release and apoptosis. Glycogen synthase kinase (GSK-3) a serine-threonine kinase ubiquitously expressed in most cell types, appears to mediate or potentiate apoptosis due to many stimuli that activate the mitochondrial cell death pathway. Loberg, R D, et al., J. Biol. Chem. 277 (44): 41667-673 (2002). It has been demonstrated to induce caspase 3 activation and to activate the proapoptotic tumor suppressor gene p53. It also has been suggested that GSK-3 promotes activation and translocation of the proapoptotic Bcl-2 family member, Bax, which, upon agregation and mitochondrial localization, induces cytochrome c release. Akt is a critical regulator of GSK-3, and phosphorylation and inactivation of GSK-3 may mediate some of the antiapoptotic effects of Akt.
[0145] Cluster of Differentiation or cluster of designation (CD) molecules are utilized in cell sorting using various methods, including flow cytometry. Cell populations usually are defined using a + or a symbol to indicate whether a certain cell fraction expresses or lacks a particular CD molecule.
[0146] CD31 (platelet/endothelial cell adhesion molecule; PECAM1) normally is found on endothelial cells, platelets, macrophages and Kupffer cells, granulocytes, T cells, natural killer cells, lymphocytes, megakaryocytes, osteoclasts and neutrophils. CD31 has a key role in tissue regeneration and in safely removing neutrophils from the body. Upon contact, the CD31 molecules of macrophages and neutrophils are used to communicate the health status of the neutrophil to the macrophage.
[0147] CD34 is a monomeric cell surface glycoprotein normally found on hematopoietic cells, endothelial progenitor cells, endothelial cells of blood vessels, and mast cells. The CD34 protein is a member of a family of single-pass transmembrane sialomucin proteins and functions as a cell-cell adhesion factor. Studies suggest that CD34 also may mediate the attachment of stem cells to bone marrow extracellular matrix or directly to stromal cells.
[0148] CD45 (protein tyrosine phosphatase, receptor type, C; PTPRC) cell surface molecule is expressed specifically in hematopoietic cells. CD45 is a protein tyrosine phosphatase (PTP) with an extracellular domain, a single transmembrane segment, and two tandem intracytoplasmic catalytic domains, and thus belongs to receptor type PTP. Studies suggest it is an essential regulator of T-cell and B-cell antigen receptor signaling that functions by direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for antigent receptor signaling. CD45 also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. The CD45 family consists of multiple members that are all products of a single complex gene. Various known isoforms of CD45 include: CD45RA, CD45RB, CD45RC, CD45RAB, CD45RAC, CD45RBC, CD45RO, and CD45R (ABC). Different isoforms may be found on different cells. For example, CD45RA is found on nave T cells and CD45RO is found on memory T cells.
[0149] Stem cell antigen (Sca-1) is a cell surface protein on bone marrow cells, indicative of HSC and MSC bonemarrow and blood content.
[0150] The CD24 gene encodes signal transducer CD24 protein, which may have a pivotal role in cell differentiation of different cell types. Signaling can be triggered by the binding of a lectin-like ligand to the CD24 carbohydrates, and transduced by the release of second messengers derived from the GPI-anchor. CD24 modulates B-cell activation responses. It promotes antigen-dependent proliferation of B-cells, and prevents their terminal differentiation into antibody-forming cells (see Su7zuki, T. et al., J. Immunol. (2001) 166: 5567-77).
[0151] The EPCAM gene provides instructions for making a protein known as epithelial cellular adhesion molecule (EpCAM). This protein is found in epithelial cells, which are the cells that line the surfaces and cavities of the body. The EpCAM protein is found spanning the membrane that surrounds epithelial cells, where it helps cells stick to one another (cell adhesion). In addition, the protein in the cell membrane can be cut at a specific location, releasing a piece called the intracellular domain (EpICD), which helps relay signals from outside the cell to the nucleus of the cell. EpICD travels to the nucleus and associates with other proteins, forming a group (complex) that regulates the activity of several genes that are involved in cell growth and division (proliferation), maturation (differentiation), and movement (migration), all of which are important processes for the proper development of cells and tissues. (https://ghr.nlm.nih.gov/gene/EPCAM)
[0152] Ki67 is a nuclear protein associated with cellular proliferation that is expressed in S, G1, G2 and M phases of the cell cycle, but is absent from resting cells (G0). During interphase, the antigen can be exclusively detected within the nucleus, whereas in mitosis most of the protein is relocated to the surface of the chromosomes. Scholzen, T., Gerdes, J., J. Cell Phyusiol (2000) 182(3): 311-22.
[0153] As used herein, expression refers to the process by which a polynucleotide is transcribed from a DNA template (such as into an mRNA or other RNA transcript) and/or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides may be collectively referred to as gene product. If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell. Expression may also refer to the post-translational modification of a polypeptide or protein.
[0154] The term interleukin is used herein to refer to a cytokine secreted by, and acting on, leukocytes. Interleukins regulate cell growth, differentiation, and motility, and stimulates immune responses, such as inflammation. Examples of interleukins include, interleukin-1 (IL-1), interleukin-1 (IL-1), interleukin-6 (IL-6), interleukin-8 (IL-8), and interleukin-12 (IL-12).
[0155] The interleukin-6 (IL-6) polypeptides to be used in the methods of the described invention may be any of natural IL-6 polypeptides, recombinant IL-6 polypeptides and the derivatives thereof as long as they have an IL-6 activity, particularly human IL-6 activity. Although human IL-6 is based on the DNA sequence as provided below, the production of the protein and proteolytic processing can result in processing variants thereof.
TABLE-US-00001 HUMANIL-6,GeneID:3569 SEQIDNO:13 1 acaccatgtttggtaaataagtgttttggtgttgtgcaagggtctggtttcagcctgaag 61 ccatctcagagctgtctgggtctctggagactggagggacaacctagtctagagcccatt 121 tgcatgagaccaaggatcctcctgcaagagacaccatcctgagggaagagggcttctgaa 181 ccagcttgacccaataagaaattcttgggtgccgacgcggaagcagattcagagcctaga 241 gccgtgcctgcgtccgtagtttccttctagcttcttttgatttcaaatcaagacttacag 301 ggagagggagcgataaacacaaactctgcaagatgccacaaggtcctcctttgacatccc 361 caacaaagaggtgagtagtattctccccctttctgccctgaaccaagtgggcttcagtaa 421 tttcagggctccaggagacctggggcccatgcaggtgccccagtgaaacagtggtgaaga 481 gactcagtggcaatggggagagcactggcagcacaaggcaaacctctggcacagagagca 541 aagtcctcactgggaggattcccaaggggtcacttgggagagggcagggcagcagccaac 601 ctcctctaagtgggctgaagcaggtgaagaaagtggcagaagccacgcggtggcaaaaag 661 gagtcacacactccacctggagacgccttgaagtaactgcacgaaatttgaggatggcca 721 ggcagttctacaacagccgctcacagggagagccagaacacagaagaactcagatgactg 781 gtagtattaccttcttcataatcccaggcttggggggctgcgatggagtcagaggaaact 841 cagttcagaacatctttggtttttacaaatacaaattaactggaacgctaaattctagcc 901 tgttaatctggtcactgaaaaaaaattttttttttttcaaaaaacatagctttagcttat 961 tttttttctctttgtaaaacttcgtgcatgacttcagctttactctttgtcaagacatgc 1021 caaagtgctgagtcactaataaaagaaaaaaagaaagtaaaggaagagtggttctgcttc 1081 ttagcgctagcctcaatgacgacctaagctgcacttttccccctagttgtgtcttgccat 1141 gctaaaggacgtcacattgcacaatcttaataaggtttccaatcagccccacccgctctg 1201 gccccaccctcaccctccaacaaagatttatcaaatgtgggattttcccatgagtctcaa 1261 tattagagtctcaacccccaataaatataggactggagatgtctgaggctcattctgccc 1321 tcgagcccaccgggaacgaaagagaagctctatctcccctccaggagcccagctatgaac 1381 tccttctccacaagtaagtgcaggaaatccttagccctggaactgccagcggcggtcgag 1441 ccctgtgtgagggaggggtgtgtggcccagggagggctggcgggcggccagcagcagagg 1501 caggctcccagctgtgctgtcagctcacccctgcgctcgctcccctccggcacaggcgcc 1561 ttcggtccagttgccttctccctggggctgctcctggtgttgcctgctgccttccctgcc 1621 ccagtacccccaggagaagattccaaagatgtagccgccccacacagacagccactcacc 1681 tcttcagaacgaattgacaaacaaattcggtacatcctcgacggcatctcagccctgaga 1741 aaggaggtgggtaggcttggcgatggggttgaagggcccggtgcgcatgcgttccccttg 1801 cccctgcgtgtggccgggggctgcctgcattaggaggtctttgctgggttctagagcact 1861 gtagatttgaggccaacggggccgactagactgacttctgtatttatcctttgctggtgt 1921 caggaagttcctttcctttctggaaaatgcagaatgggtctgaaatccatgcccaccttt 1981 ggcatgagctgagggttattgcttctcagggcttccttttccctttccaaaaaattaggt 2041 ctgtgaagctcctttttgtcccccgggctttggaaggactagaaaagtgccacctgaaag 2101 gcatgttcagcttctcagagcagttgcagtactttttggttatgtaaactcaatggctag 2161 gattcctcaaagccattccagctaagattcatacctcagagcccaccaaagtggcaaatc 2221 ataaataggttaaagcatctccccactttcaatgcaaggtattttggtcctgtttggtag 2281 aaagaaaagaacacaggaggggagattgggagcccacactcgaattctggttctgccaaa 2341 ccagccttgtgatcttgggtaaattccctaccacctctggactccatcagtaaaattggg 2401 cgtggactaggtgatctcatagatccttcctgctggaacattctatggcttgaattatat 2461 tctcctaattattgtcaaaattgctgttattaagtatctactgtgtgccaggcactttaa 2521 ataaatattgtgtctaatcttcaaaacaaatttgcaaggaaggtttttggagataaggaa 2581 actgagactcaggattaagtaacacacctaaagtcacaggtgagcttggaactgaaccca 2641 agtgtgcccccactccactggaatttgcttgccaggatgccaatgagttgtagcttcatt 2701 tttcttagagactttcctggctgtggttgaacaatgaaaaggccctctagtggtgtttgt 2761 tttagggacacttaggtgataacaattctggtattctttcccagacatgtaacaagagta 2821 acatgtgtgaaagcagcaaagaggcactggcagaaaacaacctgaaccttccaaagatgg 2881 ctgaaaaagatggatgcttccaatctggattcaatgaggtaccaacttgtcgcactcact 2941 tttcactattccttaggcaaaacttctccctcttgcatgcagtgcctgtatacatataga 3001 tccaggcagcaacaaaaagtgggtaaatgtaaagaatgttatgtaaatttcatgaggagg 3061 ccaacttcaagcttttttaaaggcagtttattcttggacaggtatggccagagatggtgc 3121 cactgtggtgagattttaacaactgtcaaatgtttaaaactcccacaggtttaattagtt 3181 catcctgggaaaggtactctcagggccttttccctctctggctgcccctggcagggtcca 3241 ggtctgccctccctccctgcccagctcattctccacagtgagataacctgcactgtcttc 3301 tgattattttataaaaggaggttccagcccagcattaacaagggcaagagtgcaggaaga 3361 acatcaagggggacaatcagagaaggatccccattgccacattctagcatctgttgggct 3421 ttggataaaactaattacatggggcctctgattgtccagttatttaaaatggtgctgtcc 3481 aatgtcccaaaacatgctgcctaagaggtacttgaagttctctagaggagcagagggaaa 3541 agatgtcgaactgtggcaattttaacttttcaaattgattctatctcctggcgataacca 3601 attttcccaccatctttcctcttaggagacttgcctggtgaaaatcatcactggtctttt 3661 ggagtttgaggtatacctagagtacctccagaacagatttgagagtagtgaggaacaagc 3721 cagagctgtgcagatgagtacaaaagtcctgatccagttcctgcagaaaaaggtgggtgt 3781 gtcctcattccctcaacttggtgtgggggaagacaggctcaaagacagtgtcctggacaa 3841 ctcagggatgcaatgccacttccaaaagagaaggctacacgtaaacaaaagagtctgaga 3901 aatagtttctgattgttattgttaaatctttttttgtttgtttggttggttggctctctt 3961 ctgcaaaggacatcaataactgtattttaaactatatattaactgaggtggattttaaca 4021 tcaatttttaatagtgcaagagatttaaaaccaaaggcgggggggcgggcagaaaaaagt 4081 gcatccaactccagccagtgatccacagaaacaaagaccaaggagcacaaaatgatttta 4141 agattttagtcattgccaagtgacattcttctcactgtggttgtttcaattctttttcct 4201 accttttaccagagagttagttcagagaaatggtcagagactcaagggtggaaagaggta 4261 ccaaaggctttggccaccagtagctggctattcagacagcagggagtagacttgctggct 4321 agcatgtggaggagccaaagctcaataagaaggggcctagaatgaaacccttggtgctga 4381 tcctgcctctgccatttctacttaagccagggtttctcatatgttaacatgcatgggaat 4441 tccctgggcatcttcttgtggtgtggagtctgacttagcaagcctcgggtgggtttgagg 4501 gtcaaatttctaccaggcttatatccctggtgatgctgcagaattccaggaccacacttg 4561 gaggtttaaggccttccacaagttacttatcccatatggtgggtctatggaaaggtgttt 4621 cccagtcctctttacaccaccggatcagtggtctttcaacagatcctaaagggatggtga 4681 gagggaaactggagaaaagtatcagatttagaggccactgaagaacccatattaaaatgc 4741 ctttaagtatgggctcttcattcatatactaaatatgaactatgtgccaggcattatttc 4801 atatgacagaatacaaacaaataagatagtgatgctggtcaggcttggtggctcatgcct 4861 gtattccctaaactttgggagcctaaggtgagaactccttgaactcctaaggccaggagt 4921 tcaagaccagcctggataacatagcaagaccccatctctacaaaaaaccaaaaccaaaca 4981 aacaaaaatgatagtggtgcttccctcaggatgcttgtggtctaatgggagacagaacag 5041 caaagggatgattagaagttggttgctgtgagccaggcacagtgctgatataatcccagc 5101 gctatgggaggctgaggtgggtggatcatttgaggccaggagtttaagaccagcctggtc 5161 aacatggtaaaaccccatctctacttaaaaatacaaaaaagttagccaggcatggtggca 5221 tacacctgtaacccagctactcaggaggctgaggcacatgaatcacttgaacccaggagg 5281 cagaggttgctgtgcaccactgcactccagcctgggtgacagaacgagaccttgactcaa 5341 aaaaaaaaaaaagaagtttgttgctatggaagggtcctactcagagcaggcaccccagtt 5401 aatctcattcaccccacatttcacatttgaacatcatcccatagcccagagcatccctcc 5461 actgcaaaggatttattcaacatttaaacaatcctttttactttcattttccttcaggca 5521 aagaatctagatgcaataaccacccctgacccaaccacaaatgccagcctgctgacgaag 5581 ctgcaggcacagaaccagtggctgcaggacatgacaactcatctcattctgcgcagcttt 5641 aaggagttcctgcagtccagcctgagggctcttcggcaaatgtagcatgggcacctcaga 5701 ttgttgttgttaatgggcattccttcttctggtcagaaacctgtccactgggcacagaac 5761 ttatgttgttctctatggagaactaaaagtatgagcgttaggacactattttaattattt 5821 ttaatttattaatatttaaatatgtgaagctgagttaatttatgtaagtcatatttatat 5881 ttttaagaagtaccacttgaaacattttatgtattagttttgaaataataatggaaagtg 5941 gctatgcagtttgaatatcctttgtttcagagccagatcatttcttggaaagtgtaggct 6001 tacctcaaataaatggctaacttatacatatttttaaagaaatatttatattgtatttat 6061 ataatgtataaatggtttttataccaataaatggcattttaaaaaattcagcaa
[0156] For use in the subject methods, any of the native IL-6 polypeptides, modifications and variants thereof, or a combination of one or more polypeptides may be used. IL-6 polypeptides of interest include fragments, and can be variously truncated at the carboxyl terminus relative to the full sequence. Such fragments continue to exhibit the characteristic properties of human interleukin 6. Extraneous sequences may be added as long as there is minimal loss of activity. Any variants known in the art and having IL-6 activity may be used in the present methods.
[0157] By naturally occurring or wild type, or grammatical equivalents herein is meant an amino acid sequence or a nucleotide sequence that is found in nature and includes allelic variations; that is, an amino acid sequence or a nucleotide sequence that usually has not been intentionally modified. Accordingly, by non-naturally occurring or synthetic or recombinant or grammatical equivalents thereof herein is meant an amino acid sequence or a nucleotide sequence that is not found in nature; that is, an amino acid sequence or a nucleotide sequence that usually has been intentionally modified. It is understood that once a recombinant nucleic acid is made and reintroduced into a host cell or organism, it will replicate non-recombinantly, i.e., using the in vivo cellular machinery of the host cell rather than in vitro manipulations, however, such nucleic acids, once produced recombinantly, although subsequently replicated non-recombinantly, are still considered recombinant for the purpose of the invention.
[0158] The sequence of the IL-6 polypeptide may be altered in various ways known in the art to generate targeted changes in sequence. A variant polypeptide will usually be substantially similar, i.e., will differ by at least one amino acid, and may differ by at least two but not more than about ten amino acids. The sequence changes may be substitutions, insertions or deletions. Scanning mutations that systematically introduce alanine, or other residues, may be used to determine key amino acids. Specific amino acid substitutions of interest include conservative and non-conservative changes. Conservative amino acid substitutions typically include substitutions within the following groups: (glycine, alanine); (valine, isoleucine, leucine); (aspartic acid, glutamic acid); (asparagine, glutamine); (serine, threonine); (lysine, arginine); or (phenylalanine, tyrosine).
[0159] Modifications of interest that may or may not alter the primary amino acid sequence include chemical derivatization of polypeptides, e.g., acetylation, or carboxylation; changes in amino acid sequence that introduce or remove a glycosylation site; changes in amino acid sequence that make the protein susceptible to PEGylation; and the like. In one embodiment, the invention contemplates the use of IL-6 variants with one or more non-naturally occurring glycosylation and/or pegylation sites that are engineered to provide glycosyl- and/or PEG-derivatized polypeptides with reduced serum clearance. Also included are modifications of glycosylation, e.g., those made by modifying the glycosylation patterns of a polypeptide during its synthesis and processing or in further processing steps; e.g., by exposing the polypeptide to enzymes that affect glycosylation, such as mammalian glycosylating or deglycosylating enzymes. Also embraced are sequences that have phosphorylated amino acid residues, e.g., phosphotyrosine, phosphoserine, or phosphothreonine.
[0160] Included in the subject invention are polypeptides that have been modified using ordinary chemical techniques so as to improve their resistance to proteolytic degradation, to optimize solubility properties, or to render them more suitable as a therapeutic agent. For examples, the backbone of the peptide may be cyclized to enhance stability (see Friedler et al. (2000) J. Biol. Chem. 275:23783-23789). Analogs may be used that include residues other than naturally occurring L-amino acids, e.g., D-amino acids or non-naturally occurring synthetic amino acids. The protein may be pegylated to enhance stability.
[0161] As used herein hyaluronan encompasses hyaluronic acid and its hyaluronate salts, including, but not limited to, sodium hyaluronate, potassium hyaluronate, magnesium hyaluronate and calcium hyaluronate.
[0162] The term immune modulate or immunomodulate and its other grammatical forms refers to the ability of a compound of the present invention to alter (modulate) one or more aspects of the immune system. The immune system functions to protect the organism from infection and from foreign antigens by cellular and humoral mechanisms involving lymphocytes, macrophages, and other antigen-presenting cells that regulate each other by means of multiple cell-cell interactions and by elaborating soluble factors, including lymphokines and antibodies, that have autocrine, paracrine, and endocrine effects on immune cells.
[0163] The term improves is used to convey that the present invention changes either the appearance, form, characteristics and/or the physical attributes of the subject, organ, tissue or cell to which it is being provided, applied or administered. For example, the change in form may be demonstrated by any of the following alone or in combination: a decrease in one or more symptoms of a disease or disorder; increase in renewal of alveolar epithelial cell 2 (AEC2) cells; repair of a lung injury; reduce lung fibrosis; reduction or elimination of the need for other active agents or therapeutics; and slower progression of fibrotic lung disease.
[0164] The term inhibiting includes the administration of a compound of the present invention to prevent the onset of the symptoms, alleviating the symptoms, or eliminating the disease, condition or disorder.
[0165] The terms mimetic, peptide mimetic and peptidomimetic are used interchangeably herein, and generally refer to a peptide, partial peptide or non-peptide molecule that mimics the tertiary binding structure or activity of a selected native peptide or protein functional domain (e.g., binding motif or active site). These peptide mimetics include recombinantly or chemically modified peptides, as well as non-peptide agents such as small molecule drug mimetics.
[0166] NFB:
[0167] The nuclear factor-kappaB (NF-kappaB)/REL family of transcription factors has a central role in coordinating the expression of a wide variety of genes that control immune responses. Transcription factors of the NF-kappaB family are activated in response to signals that lead to cell growth, differentiation, apoptosis and other events. (Liang, Y et al, NF-kappaB and its regulation on the immune system, (2004) Cell. Mol. Immunol. 1(5): 343-50)). NF-B is kept sequestered in the cytoplasm by its inhibitor of KB (IB). In unstimulated cells, NF-B/Rel dimers are bound to IBs and retained in the cytoplasm in an inactive form. Stimulation sequentially leads to phosphorylation, ubiquitination, and proteosomal degradation of IB, which allows NF-B to be translocated to the nucleus and to bind to promoter regions of genes. (Grutz, G. (2005) New Insights into the molecular mechanism of interleukin-10 mediated immunosuppression, J. Leukocyte Biol. 77: 3-15). In diverse cell types, NF-B is strongly linked to the regulation of apoptosis. (Liang, Y et al, NF-kappaB and its regulation on the immune system, (2004) Cell. Mol. Immunol. 1(5): 343-50). The canonical NF-B pathway has been defined primarily in response to TNF and IL-1 signaling. TNF and IL-1 are proinflammatory cytokines that play a role in the pathogenesis of chronic inflammatory diseases such as rheumatoid arthritis (RA), inflammatory bowel disease (IBD), asthma, and chronic obstructive pulmonary disease (COPD). Lawrence, T., The Nuclear Factor NF-B pathway in inflammation, Cold Spring Harbor Perspectives in Biol. (2009) 1(6): a001651) (citing Holgate, S T, Cytokine and anti-cytokine therapy for the treatment of asthma and allergic disease, (2004) Cytokine 28: 152-57; , Chung, K F, Cytokines as targets in chronic obstructive pulmonary disease, (2006) Curr. Drug Targets 7: 675-81; 2006, Williams, R O et al., Cytokine inhibitors in rheumatoid arthritis and other autoimmune diseases, (2007) Curr. Opin. Pharacol. 7: 412-17). NF-B activity at sites of inflammation is associated with activation of the canonical pathway and RelA- or cRel-containing complexes. The alternative NF-B pathway is characterized by the inducible phosphorylation of p100 by IKK, leading to activation of RelB/p52 heterodimers. The upstream kinase that activates IKK in this pathway has been identified as an NIK (NF-B inducing kinase) (Id., citing Senftleben, U et al., Activation by IKK of a second, evolutionary conserved, NFB signaling pathway, (2001) Science 293: 1495-99).
[0168] As used herein, the terms peptide, polypeptide and protein are used interchangeably and refer to two or more amino acids covalently linked by an amide bond or non-amide equivalent. The peptides of the invention can be of any length. For example, the peptides can have from about two to about 100 or more residues, such as, 5 to 12, 12 to 15, 15 to 18, 18 to 25, 25 to 50, 50 to 75, 75 to 100, 100 to 200, or more in length. The peptides of the invention include L- and D-isomers, and combinations of L- and D-isomers. The peptides can include modifications typically associated with post-translational processing of proteins, for example, cyclization (e.g., disulfide or amide bond), phosphorylation, glycosylation, carboxylation, ubiquitination, myristylation, or lipidation. According to some embodiments, the peptides of the disclosure comprise only D-isomers. According to some embodiments, the peptides comprise only L-isomers.
[0169] The term pharmaceutically acceptable, is used to refer to the carrier, diluent or excipient being compatible with the other ingredients of the formulation or composition and not deleterious to the recipient thereof. For example, the term pharmaceutically acceptable can mean approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
[0170] Signaling as used herein describes a set of chemical reactions in a cell that occurs when a molecule, such as a hormone, attaches to a receptor. The signal transduction is a cascade of biochemical reactions inside the cell that eventually reach the target molecule or reaction. Thus, signal transduction or signaling as used herein is a method by which molecules inside the cell can be altered by molecules outside the cell.
[0171] The signaling chains of the hematopoietin family of cytokine receptors are noncovalently associated with protein tyrosine kinases of the Janus kinase (JAP) family of which there are four members: Jak1, Jak2, Jak2 and Tyk2. Janeway's Immunology, 9.sup.th Ed. 2017, Garland Science, New York, Chapter 3, at 1090-110.
[0172] Dimerization or clustering of receptor signaling chains brings the JAKs into close proximity, causing phosphorylation of each JAK on a tyrosine residue that stimulates its kinase activity. Activated JAKs then phosphorylate their associated receptors on specific tyrosine residues. This phosphotyrosine, and the specific amino acid sequence surrounding it, creases a binding site that is recognized by SH2 domaons found in other proteins, in particular members of the signal transducers and activators of transcription (STATs) family of transcription factors. There are seven STATS (1-4, 5, 5b and 6), which reide in the cytoplasm in an inactive form until activated by cytokine receptors. The receptor specificity of each STAT is determined by the recognition of the distinctive phosphotyrosine sequence on each activated receptor by the different SH2 domains within the various STAT proteins.
[0173] Signal transducer and activator of transcription 3 (STAT3) is a transcription factor encoded by the Stat3 gene. (Levy, D E, and Lee, C-k, What does Stat3 do? (2002) J. Clin. Invest. 109(9): 1143-48). Ablation of Stat3 leads to embryonic lethality (Id. Citing Takeda, K. et all, Tageted disruption of the mouse Stat3 gene3 leads to early embryonic lethality, (1997) Proc. Natl Acad. Sci. USA 94: 3801-3804). STAT3 plays a role in mediating the cell growth, differentiation and survival signals relayed through the IL-6 family of cytokine receptors, and induces distinct sets of target genes in different cells. (Id. citing Hirano, T. et al, Roles of STAT3 in mediating the cell growth, differentiation and survival signals relayed through the IL-6 family of cytokine receptors (2000) Oncogene 19: 2548-56). For instance, Stat3 stimulates B cell proliferation, in part, through inhibition of apoptosis, a function mediated by induction of the antiapoptotic gene Bcl-2. Id. In contrast, activation of Stat3 in monocytic cells leads to downregulation of c-myc and c-myb and induction of junB and IRF-1, a pattern of gene regulation consistent with differentiation and growth arrest. Id. A different set of Stat3-dependent genes are upregulated in IL-6-stimulated hepatocytes, genes for the secreted proteins of the acute-phase response. Ic.
[0174] As used herein, a stem cell is a multipotent or pluripotent cell that (i) is capable of self-renewal; and (ii) can give rise to more than one type of cell through asymmetric cell division. The term renewal or self renewal as used herein, refers to the process by which a stem cell divides to generate one (asymmetric division) or two (symmetric division) daughter cells having development potential indistinguishable from the mother cell. Self renewal involves both proliferation and the maintenance of an undifferentiated state.
[0175] The term Surfactant Protein C (SP-C) is used to refer to a protein encoded by the SFTPC gene. In the lung, surfactant lowers surface tension, easing breathing and avoiding lung collapse. The SP-C protein helps spread the surfactant across the surface of the lung tissue, aiding in the surface tension-lowering property of surfactant (see https://ghr.nlm.nih.gov/gene/SFTPC).
[0176] As used herein, the term therapeutic or active agent means an agent utilized to treat, combat, ameliorate, prevent or improve an unwanted condition or disease of a patient. In part, embodiments of the present invention are directed to decreasing one or more symptoms of a fibrotic lung disease, increasing renewal of alveolar epithelial cell 2 (AEC2) cells, increasing repair of a lung injury, reducing lung fibrosis, reducing or eliminating the need for other active agents or therapeutics; and slowing progression of fibrotic lung disease.
[0177] A therapeutically effective amount, therapeutic amount or effective amount of a composition (e.g., an IL-6 polypeptide or hyaluronan) is a predetermined amount calculated to achieve the desired effect, i.e., to improve or increase AEC2 stem cell renewal, repair a lung injury, and/or to decrease one or more symptoms of IPF. The activity contemplated by the present methods includes both medical therapeutic and/or prophylactic treatment, as appropriate. The specific dose of a compound administered according to this invention to obtain therapeutic and/or prophylactic effects will, of course, be determined by the particular circumstances surrounding the case, including, for example, the compound administered, the route of administration, and the condition being treated. The compounds are effective over a wide dosage range and, for example, dosages per day will normally fall within the range of from about 0.001 to about 10 mg/kg, more usually in the range of from about 0.01 to about 1 mg/kg. According to some embodiments, the therapeutically effective dose of IL-6 polypeptide or hyaluronan is about 0.1 mg/kg, about 0.2 mg/kg, about 0.3 mg/kg, about 0.4 mg/kg, about 0.5 mg/kg, about 0.6 mg/kg, about 0.7 mg/kg, about 0.8 mg/kg, about 0.9 mg/kg, and about 1 mg/kg. However, it will be understood that the effective amount administered will be determined by the physician in the light of the relevant circumstances including the condition to be treated, the choice of compound to be administered, and the chosen route of administration, and therefore the above dosage ranges are not intended to limit the scope of the invention in any way. A therapeutically effective amount of compound of embodiments of this invention is typically an amount such that when it is administered in a physiologically tolerable excipient composition, it is sufficient to achieve an effective systemic concentration or local concentration in the tissue.
[0178] The term therapeutic component as used herein refers to a therapeutically effective dosage (i.e., dose and frequency of administration) that eliminates, reduces, or prevents the progression of a particular disease manifestation in a percentage of a population. An example of a commonly used therapeutic component is the ED50 which describes the dose in a particular dosage that is therapeutically effective for a particular disease manifestation in 50% of a population.
[0179] The term therapeutic effect as used herein refers to a consequence of treatment, the results of which are judged to be desirable and beneficial. A therapeutic effect may include, directly or indirectly, the arrest, reduction, or elimination of a disease manifestation. A therapeutic effect may also include, directly or indirectly, the arrest reduction or elimination of the progression of a disease manifestation.
[0180] Therapeutic window, potency and efficacy. The term potency as used herein refers to efficacy, effectiveness, or strength of a drug. The potency of a drug is the reciprocal of dose, and has the units of persons/unit weight of drug or body weight/unit weight of drug. Relative potency compares the relative activity of drugs in a series relative to some prototypic member of the series. Efficacy connotes the property of a drug to achieve the desired response, and maximum efficacy denotes the maximum achievable effect.
[0181] The intensity of effect of a drug (y-axis) can be plotted as a function of the dose of drug administered (X-axis). Goodman & Gilman's The Pharmacological Basis of Therapeutics, Ed. Joel G. Hardman, Lee E. Limbird, Eds., 10th Ed., McGraw Hill, New York (2001), p. 25, 50). These plots are referred to as dose-effect curves. Such a curve can be resolved into simpler curves for each of its components. These concentration-effect relationships can be viewed as having four characteristic variables: potency, slope, maximal efficacy, and individual variation.
[0182] The location of the dose-effect curve along the concentration axis is an expression of the potency of a drug. Id. If the drug is to be administered by transdermal absorption, a highly potent drug is required, since the capacity of the skin to absorb drugs is limited.
[0183] The slope of the dose-effect curve reflects the mechanism of action of a drug. The steepness of the curve dictates the range of doses useful for achieving a clinical effect.
[0184] Maximal or clinical efficacy refers to the maximal effect that can be produced by a drug. Maximal efficacy is determined principally by the properties of the drug and its receptor-effector system and is reflected in the plateau of the curve. In clinical use, a drug's dosage may be limited by undesired effects.
[0185] Biological variability. An effect of varying intensity may occur in different individuals at a specified concentration or a drug. It follows that a range of concentrations may be required to produce an effect of specified intensity in all subjects.
[0186] Lastly, different individuals may vary in the magnitude of their response to the same concentration of a drug when the appropriate correction has been made for differences in potency, maximal efficacy and slope.
[0187] The duration of a drug's action is determined by the time period over which concentrations exceed the MEC. Following administration of a dose of drug, its effects usually show a characteristic temporal pattern. A plot of drug effect vs. time illustrates the temporal characteristics of drug effect and its relationship to the therapeutic window. A lag period is present before the drug concentration exceeds the minimum effective concentration (MEC) for the desired effect. Following onset of the response, the intensity of the effect increases as the drug continues to be absorbed and distributed. This reaches a peak, after which drug elimination results in a decline in the effect's intensity that disappears when the drug concentration falls back below the MEC. The therapeutic window reflects a concentration range that provides efficacy without unacceptable toxicity. Accordingly another dose of drug should be given to maintain concentrations within the therapeutic window.
[0188] The term Toll-like receptors (TLRs) is used to refer to sensors for microbes present in extracellular spaces. Some are cell surface receptors (e.g., TLR-1, TLR-2, TLR-5, TLR-6), but others (e.g., TLR3, TLR-7, TLR-8, TLR-9) are located intracellularly in the membrane of endosomes, where they detect pathogens or their components that have been taken into cells by phagocytosis, receptor-mediated endocytosis or micropinocytosis. (Janeway's Immunology, 9.sup.th Ed. 2017, Garland Science, New York, Chapter 2, at 88).
[0189] TLR-4 is expressed by several types of immune system cells, including dendritic cells and macrophages, and recognizes the LPS of gram negative bacteria by a mechanism that is partly direct and partly indirect. Systemic injection of LPS causes a collapse of the circulatory and respiratory system (shock), due to an overwhelming secretion of cytokines, particularly TNF-, causing systemic vascular permeability. To recognize LPS, the ectodomain of TLR-4 uses an accessory protein, MD-2, which initially binds to TLR-4 within the cell and is necessary both for the correct trafficking of TLR-4 to the cell surface and for the recognition of LPS. TLR-4 activation involves two other accessory proteins, LPS-binding protein, present in the blood and in extracellular fluid in tissues, and CD14, which is present on the surface of macrophages, neutrophils and dendritic cells. On its own, CD14 can act as a phagocytic receptor, but on macrophages and dendritic cells it also acts as an accessory protein for TLR-4. Id. at 92.
[0190] Mammalian TLRs recognize molecules characteristic of bacteria, fungi and viruses, including the lipoteichoic acids of Gram-positive bacterial cell walls, and the lipopolysaccharide (LPS) of the outer membrane of Gram negative bacteria. Although TLRs have limited specificity compared with the antigen receptors of the adaptive immune system, they can recognize elements of most pathogenic microbes and are expressed by many types of cells, including macrophages, dendritic cells, B cells, stromal cells, and certain epithelial cells. Id. at 88
[0191] Signaling by mammalian TLRs in various cell types induces a diverse range of intracellular responses by activating several different signaling pathways that each activate different transcription factors, which, together result in the production of inflammatory cytokines, chemotactic factors, antimicrobial peptides, and the antiviral cytokines interferon and . Id. At 92 The outcome of TLR activation can vary depending on the cell type in which it occurs. Id. at 95.
[0192] Signaling by mammalian TLRs is activated when binding of a ligand induces formation of a dimer, or induces conformational changes in a preformed TLR dimer. All mammalian TLR proteins have in their cytoplasmic tail a Toll-IL-1 receptor (TIR) domain, which interacts with other T1R-type domains, usually in other signaling molecules, and is also found in the cytoplasmic tail of the receptor for the cytokine interleukin-1-. Id. at 88 Dimerization brings the cytoplasmic T1R domains together, allowing them to interact with the T1R domains of cytoplasmic adaptor molecules that initiate intracellular signaling. There are four adaptors used by mammalian TLRs: MyD88, MAL (also known as TIRAP), TRIF, and TRAM. The T1R domains of the different TLRs interact with different combinations of these adaptors. Id. At 92-93.
[0193] For example, TLR-3 interacts only with TRIF. TLR-21 and TLR2/6 require MyD88/MAL. TLR-4 signaling uses both MyD8/MAL and TRIF/TRAM, which is used during endosomal signaling by TLR-4. The choice of adaptor influences which of the several downstream signals will be activated by the TLR. Id. at 94.
[0194] Signaling by most TLRs activates the transcription factor NFB, several members of the interferon regulatory factor (IRF) transcription factor family through a second pathway, and members of the activator protein 1 (AP-1) family, such as c-Jun, through another signaling pathway involving mitogen-activated protein kinases (MAPKs). NFB and AP-1 act primarily to induce the expression of proinflammatory cytokines and chemotactic factors. Id. At 94.
[0195] The terms treat, treated, or treating as used herein refers to both therapeutic treatment and/or prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) an undesired physiological condition, disorder or disease, or to obtain beneficial or desired clinical results. For the purposes of this invention, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of the extent of the condition, disorder or disease; stabilization (i.e., not worsening) of the state of the condition, disorder or disease; delay in onset or slowing of the progression of the condition, disorder or disease; amelioration of the condition, disorder or disease state; and remission (whether partial or total), whether detectable or undetectable, or enhancement or improvement of the condition, disorder or disease. Treatment includes eliciting a clinically significant response without excessive levels of side effects. Treatment also includes prolonging survival as compared to expected survival if not receiving treatment.
[0196] The described invention relates to methods of using compounds and compositions comprising polypeptides or polysaccharides described herein. These compounds and compositions modulate signaling pathways that provide significant therapeutic benefit in the treatment of a lung injury or fibrotic lung disease. The compounds of the described invention may exist in unsolvated forms as well as solvated forms, including hydrated forms of the polypeptides and polysaccharides disclosed herein. The compounds of the described invention also are capable of forming pharmaceutically acceptable salts, including but not limited to acid addition and/or base addition salts. Furthermore, compounds of the described invention may exist in various solid states including an amorphous form (non-crystalline form), and in the form of clathrates, prodrugs, polymorphs, bio-hydrolyzable esters, racemic mixtures, non-racemic mixtures, or as purified stereoisomers including, but not limited to, optically pure enantiomers and diastereomers. In general, all of these forms can be used as an alternative form to the free base or free acid forms of the compounds, as described above and are intended to be encompassed within the scope of the described invention.
[0197] The term polymorph is used herein to refer to solid crystalline forms of a compound. Different polymorphs of the same compound can exhibit different physical, chemical and/or spectroscopic properties. Different physical properties include, but are not limited to stability (e.g., to heat or light), compressibility and density (important in formulation and product manufacturing), and dissolution rates (which can affect bioavailability). Different physical properties of polymorphs can affect their processing. According to some embodiments, the composition comprises at least one polymorph of any of the compositions disclosed herein.
[0198] The compounds and compositions of the described invention described invention can be administered, inter alia, as pharmaceutically acceptable salts, esters, amides or prodrugs.
The term salts is used herein to refer to inorganic and organic salts of compounds of the described invention. The salts can be prepared in situ during the final isolation and purification of a compound, or by separately reacting a purified compound in its free base or acid form with a suitable organic or inorganic base or acid and isolating the salt thus formed. Representative salts include the hydrobromide, hydrochloride, sulfate, bisulfate, nitrate, acetate, oxalate, palmitiate, stearate, laurate, borate, benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, naphthylate, mesylate, glucoheptonate, lactobionate, and laurylsulphonate salts, and the like. The salts may include cations based on the alkali and alkaline earth metals, such as sodium, lithium, potassium, calcium, magnesium, and the like, as well as non-toxic ammonium, quaternary ammonium, and amine cations including, but not limited to, ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like. See, for example, S. M. Berge, et al., Pharmaceutical Salts, J Pharm Sci, 66: 1-19 (1977). The term salt refers to acidic salts formed with inorganic and/or organic acids, as well as basic salts formed with inorganic and/or organic bases. Examples of these acids and bases are well known to those of ordinary skill in the art. Such acid addition salts will normally be pharmaceutically acceptable although salts of non-pharmaceutically acceptable acids may be of utility in the preparation and purification of the compound in question. Salts include those formed from hydrochloric, hydrobromic, sulphuric, phosphoric, citric, tartaric, lactic, pyruvic, acetic, succinic, fumaric, maleic, methanesulphonic and benzenesulphonic acids.
[0199] According to some embodiments, the pharmaceutical compositions comprise an IL-6 polypeptide, hyaluronan, a mimetic or pharmaceutically acceptable salt thereof, and at least one pharmaceutically acceptable carrier.
[0200] The phrase pharmaceutically acceptable carrier is art recognized. It is used to mean any substantially non-toxic carrier conventionally useable for administration of pharmaceuticals in which the isolated polypeptide of the present invention will remain stable and bioavailable. The pharmaceutically acceptable carrier must be of sufficiently high purity and of sufficiently low toxicity to render it suitable for administration to the mammal being treated. It further should maintain the stability and bioavailability of an active agent. The pharmaceutically acceptable carrier can be liquid or solid and is selected, with the planned manner of administration in mind, to provide for the desired bulk, consistency, etc., when combined with an active agent and other components of a given composition. described invention Exemplary carriers include liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the subject agent from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be acceptable in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials which can serve as pharmaceutically acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; phosphate buffer solutions; and other non-toxic compatible substances employed in pharmaceutical formulations. Suitable pharmaceutical carriers are described in Remington's Pharmaceutical Sciences by E. W. Martin, which is incorporated herein by reference in its entirety. According to some embodiments, the pharmaceutically acceptable carrier is sterile and pyrogen-free water. According to some embodiments, the pharmaceutically acceptable carrier is Ringer's Lactate, sometimes known as lactated Ringer's solution.
[0201] Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.
[0202] Examples of pharmaceutically acceptable antioxidants include: water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, .alpha.-tocopherol, and the like; and metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.
[0203] Formulations of the described invention include those suitable for oral, nasal, topical, buccal, sublingual, rectal, vaginal and/or parenteral administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingredient that can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound that produces a therapeutic effect. Generally, out of one hundred percent, this amount will range from about 1 percent to about ninety-nine percent of active ingredient, preferably from about 5 percent to about 70 percent, most preferably from about 10 percent to about 40 percent.
[0204] Some examples of suitable carriers, excipients, and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate alginates, calcium salicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, tragacanth, gelatin, syrup, methyl cellulose, methyl- and propylhydroxybenzoates, tale, magnesium stearate, water, and mineral oil. The formulations can additionally include lubricating agents, wetting agents, emulsifying and suspending agents, preserving agents, sweetening agents or flavoring agents. The compositions may be formulated so as to provide quick, sustained, or delayed release of the active ingredient after administration to the patient by employing procedures well known in the art.
[0205] For oral administration, a compound can be admixed with carriers and diluents, molded into tablets, or enclosed in gelatin capsules. The mixtures can alternatively be dissolved in liquids such as 10% aqueous glucose solution, isotonic saline, sterile water, or the like, and administered intravenously or by injection.
[0206] The local delivery of therapeutic amounts of a compound for the treatment of a lung injury or fibrotic lung disease can be by a variety of techniques that administer the compound at or near the targeted site. Examples of local delivery techniques are not intended to be limiting but to be illustrative of the techniques available. Examples include local delivery catheters, site specific carriers, implants, direct injection, or direct applications, such as topical application and, for the lungs, administration by inhalation.
[0207] Local delivery by an implant describes the surgical placement of a matrix that contains the pharmaceutical agent into the affected site. The implanted matrix releases the pharmaceutical agent by diffusion, chemical reaction, or solvent activators.
[0208] Specific modes of administration will depend on the indication. The selection of the specific route of administration and the dose regimen is to be adjusted or titrated by the clinician according to methods known to the clinician in order to obtain the optimal clinical response. The amount of compound to be administered is that amount sufficient to provide the intended benefit of treatment. The dosage to be administered will depend on the characteristics of the subject being treated, e.g., the particular mammal or human treated, age, weight, health, types of concurrent treatment, if any, and frequency of treatments, and can be easily determined by one of skill in the art (e.g., by the clinician).
[0209] Pharmaceutical formulations containing the compounds of the described invention and a suitable carrier can be solid dosage forms which include, but are not limited to, tablets, capsules, cachets, pellets, pills, powders and granules; topical dosage forms which include, but are not limited to, solutions, powders, fluid emulsions, fluid suspensions, semi-solids, ointments, pastes, creams, gels, jellies, and foams; and parenteral dosage forms which include, but are not limited to, solutions, suspensions, emulsions, and dry powder; comprising an effective amount of a polymer or copolymer of the described invention. It is also known in the art that the active ingredients can be contained in such formulations with pharmaceutically acceptable diluents, fillers, disintegrants, binders, lubricants, surfactants, hydrophobic vehicles, water soluble vehicles, emulsifiers, buffers, humectants, moisturizers, solubilizers, preservatives and the like. The means and methods for administration are known in the art and an artisan can refer to various pharmacologic references for guidance. For example, Modern Pharmaceutics, Banker & Rhodes, Marcel Dekker, Inc. (1979); and Goodman & Gilman's The Pharmaceutical Basis of Therapeutics, 6th Edition, MacMillan Publishing Co., New York (1980) can be consulted.
[0210] The compositions or pharmaceutical compositions of the described invention can be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. The compounds can be administered by continuous infusion subcutaneously over a predetermined period of time. Formulations for injection can be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions can take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and can contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
[0211] For oral administration, the compounds can be formulated readily by combining these compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the compounds of the disclosure to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a patient to be treated. Pharmaceutical preparations for oral use can be obtained by adding a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, alter adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients include, but are not limited to, fillers such as sugars, including, but not limited to, lactose, sucrose, mannitol, and sorbitol; cellulose preparations such as, but not limited to, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragecanth, methyl cellulose, hydroxypropylmethyl-celllose, sodium carboxymethylcellulose, and polyvinylpyrrolidone (PVP). If desired, disintegrating agents can be added, such as, but not limited to, the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
[0212] Dragee cores can be provided with suitable coatings. For this purpose, concentrated sugar solutions can be used, which can optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments can be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
[0213] Pharmaceutical preparations that can be used orally include, but are not limited to, push-fit capsules made of gelatin, as well as soft, scaled capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with filler such as, e.g., lactose, binders such as, e.g., starches, and/or lubricants such as, e.g., talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers can be added. All formulations for oral administration should be in dosages suitable for such administration.
[0214] For buccal administration, the compositions can take the form of, e.g., tablets or lozenges formulated in a conventional manner.
[0215] For administration by inhalation, the compounds for use according to the described invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit can be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e.g., gelatin for use in an inhaler or insufflator can be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
[0216] The compounds of the described invention can also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
[0217] In addition to the formulations described previously, the compounds of the described invention can also be formulated as a depot preparation. Such long acting formulations can be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection.
[0218] Depot injections can be administered at about 1 to about 6 months or longer intervals. Thus, for example, the compounds can be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
[0219] In transdermal administration, the compounds of the described invention, for example, can be applied to a plaster, or can be applied by transdermal, therapeutic systems that are consequently supplied to the organism.
[0220] Pharmaceutical compositions comprising any one or plurality of compounds disclosed herein also can comprise suitable solid or gel phase carriers or excipients. Examples of such carriers or excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivates, gelatin, and polymers such as, e.g., polyethylene glycols.
[0221] For parenteral administration, a composition or pharmaceutical composition can be, for example, formulated as a solution, suspension, emulsion or lyophilized powder in association with a pharmaceutically acceptable parenteral vehicle. Examples of such vehicles are water, saline, Ringer's solution, dextrose solution, and 5% human serum albumin. Liposomes and nonaqueous vehicles such as fixed oils may also be used. The vehicle or lyophilized powder may contain additives that maintain isotonicity (e.g., sodium chloride, mannitol) and chemical stability (e.g., buffers and preservatives). The formulation is sterilized by commonly used techniques. For example, a parenteral composition suitable for administration by injection is prepared by dissolving 1.5% by weight of analog in 0.9% sodium chloride solution.
[0222] The described invention relates to all routes of administration including intramuscular, subcutaneous, sublingual, intravenous, intraperitoneal, intrathecal, intranasal, intratracheal, topical, intradermal, intramucosal, intracavernous, intraocular, intrarectal, into a sinus, gastrointestinal, intraductal, intrathecal, subdural, extradural, intraventricular, intrapulmonary, into an abscess, intraarticular, into a bursa, subpericardial, into an axilla, intrauterine, into the pleural space, intravaginal, intraurethral, intradermal, intrabuccal, transmucosal, transdermal, via inhalation, via nebulizer and via subcutaneous injection. Alternatively, the pharmaceutical composition may be introduced by various means into cells that are removed from the individual. Such means include, for example, microprojectile bombardment and liposome or other nanoparticle device.
[0223] Solid dosage forms for oral administration include capsules, tablets, pills, powders and granules. In solid dosage forms, the composition or pharmaceutical compositions are generally admixed with at least one inert pharmaceutically acceptable carrier such as sucrose, lactose, starch, or other generally regarded as safe (GRAS) additives. Such dosage forms can also comprise, as is normal practice, an additional substance other than an inert diluent, e.g., lubricating agent such as magnesium state. With capsules, tablets, and pills, the dosage forms may also comprise a buffering agent. Tablets and pills can additionally be prepared with enteric coatings, or in a controlled release form, using techniques know in the art.
[0224] Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions and syrups, with the elixirs containing an inert diluent commonly used in the art, such as water. These compositions can also include one or more adjuvants, such as wetting agent, an emulsifying agent, a suspending agent, a sweetening agent, a flavoring agent or a perfuming agent.
[0225] According to some embodiments the pharmaceutical compositions of the claimed invention comprises at least one or a plurality of therapeutics other than the IL-6 polypeptide, hyaluronan, compositions thereof, mimetics thereof, pharmaceutically acceptable salts thereof, or combinations thereof. According to some embodiments, the one or plurality of therapeutics includes one or a combination of immunomodulators, analgesics, anti-inflammatory compounds, anti-fibrotic compounds, proton pump inhibitors, or oxygen therapy.
[0226] Examples of immunomodulators include corticosteroids, for example, prednisone, azathioprine, mycophenolate, mycophenolate mofetil, colchicine, and interferon-gamma 1b.
[0227] Examples of analgesics include codeine, hydrocodone, oxycodone, methadone, hydromorphone, morphine, and fentanyl.
[0228] Examples of anti-inflammatory compounds include aspirin, celecoxib, diclofenac, diflunisal, etodolac, ibuprofen, indomethacin, ketoprofen, ketorolac nabumetone, naproxen, nintedanib, oxaprozin, pirfenidone, piroxicam, salsalate, sulindac, and tolmetin.
[0229] Examples of anti-fibrotic compounds are nintedanib and pirfenidone.
[0230] Examples of proton pump inhibitors are omeprazole, lansoprazole, dexlansoprazole, esomeprazole, pantoprazole, rabeprazole, and ilaprazole.
[0231] According to the foregoing embodiments, the compound, composition or pharmaceutical composition may be administered once, for a limited period of time or as a maintenance therapy over an extended period of time, for example until the condition is ameliorated, cured or for the life of the subject). A limited period of time may be for 1 week, 2 weeks, 3 weeks, 4 weeks and up to one year, including any period of time between such values, including endpoints. According to some embodiments, the composition or pharmaceutical composition may be administered for about 1 day, for about 3 days, for about 1 week, for about 10 days, for about 2 weeks, for about 18 days, for about 3 weeks, or for any range between any of these values, including endpoints. According to some embodiments, the compound, composition or pharmaceutical composition may be administered for more than one year, for about 2 years, for about 3 years, for about 4 years, or longer.
[0232] According to the foregoing embodiments, the compound, composition or pharmaceutical composition may be administered once daily, twice daily, three times daily, four times daily or more.
[0233] The methods disclosed herein can be used with any of the compounds, compositions, preparations, and kits disclosed herein.
[0234] All referenced journal articles, patents, and other publications are incorporated by reference herein in their entirety.
[0235] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges which may independently be included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either both of those included limits are also included in the invention.
[0236] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, exemplary methods and materials have been described. All publications mentioned herein are incorporated herein by reference to disclose and described the methods and/or materials in connection with which the publications are cited.
EXAMPLES
[0237] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g. amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Centigrade, and pressure is at or near atmospheric.
Example 1
Materials and Methods
[0238] Mice. Tlr4.sup./ and Tlr2.sup./ mice were obtained (Takeuchi et al., 1999; Kawai et al., 1999), Has2.sup.flox/+ mice were generated using the Cre-loxP system (Li et al., 2011; Matsumoto et al., 2009), and SFTPC-Cre mice, SFTPC-CreER mice, SFTPC-GFP mice, and Rosa-Tomato.sup.flox/flox mice were generated (Barkauskas et al., 2013; Chen et al., 2012; Eblaghie et al., 2006). All mice were backcrossed on the C57Bl/6J background for more than six generations. Although the lungs from SFTPC-Cre mice on a 129/sv background showed abnormal dilated cysts (Jeannotte et al., 2011), SFTPC-Cre transgenic mice, as well as SFTPC-Cre;Has2.sup.flox/flox mice, developed normally, with no readily observable gross or histological abnormalities, consistent with previous reports (Morales-Nebreda et al., 2015). Has2.sup.flox/flox homozygous mice were crossed with SFTPC-Cre.sup.+ mice to generate SFTPC-Cre.sup.+;Has2.sup.flox/flox mice. Rosa-Tomato.sup.flox/flox mice were crossed with SFTPC-CreER mice to generate SFTPC-CreER.sup.+;Rosa-Tomato.sup.flox/flox mice. Animals were randomly assigned to treatment groups, and they were age- and sex-matched. 8- to 12-week-old mice of both sexes (male:female ratio 1:1) were used in the bleomycin lung injury model. Animals for experiments were selected by genotype, and no blinding was performed.
[0239] Bleomycin Instillation and Bronchioalveolar Lavage.
[0240] Bleomycin instillation and BAL procedures were described previously (Dong et al., 2015; Lovgren et al., 2011). Under anesthesia, the trachea was surgically exposed. 1.25-5 U/kg bleomycin (Hospira, Lake Forest, Ill.) in 25 l PBS was instilled into the mouse trachea with a 25-G needle inserted between the cartilaginous rings of the trachea. Control animals received saline alone. The tracheostomy site was sutured, and the animals were allowed to recover. Mice were euthanized at different time points, and lung tissue and BAL fluid were collected for experiments. 0.8-ml aliquots of PBS were used for lavage. Cell-free BAL fluid was stored in a 80 C. freezer for cytokine measurement.
[0241] Hydroxyproline.
[0242] Collagen contents in mouse lungs were measured using a conventional hydroxyproline method (Jiang et al., 2004). Lung tissues were vacuum-dried and hydrolyzed with 6 N hydrochloride acid at 120 C. overnight. Hydroxyproline content was expressed as g per lung, unless specified otherwise. The ability of the assay to completely hydrolyze and recover hydroxyproline from collagen was confirmed using samples containing known amounts of purified collagen.
[0243] Cell Lines.
[0244] The mouse lung fibroblast cell line, MLg2908, was from ATCC (Catalog CCL-206). Mycoplasma contamination was assessed with a MycoFluor Mycoplasma Detection Kit (Catalog M7006, Thermo Fisher Scientific), and cells used for experiments were free of mycoplasma contamination.
[0245] IL-6 Protein and Anti-IL-6 Administration.
[0246] Recombinant mouse IL-6 protein (Catalog 406-ML/CF, R&D Systems) was supplied in 50 mM sodium acetate and 1 mM EDTA and was diluted (1:5 or more depending on the stock concentration) in sterile PBS, and 2 g per mouse in 50 l was injected intramuscularly at 1 day before and at 1 day and 3 days after bleomycin instillation. Control buffer was made of the same volume of 50 mM sodium acetate and 1 mM EDTA solution and PBS. Mouse anti-IL-6 (MAB406, Clone # MP5-20F3, R&D Systems) or control IgG was reconstituted with sterile PBS. 250 g per mouse in 250 l sterile PBS was injected intraperitoneally to mice at 1 day before and at 1 day and 3 days after bleomycin instillation. Recombinant human IL-6 protein (Catalog 206-IL-010, R&D Systems) was reconstituted with sterile PBS containing 0.1% BSA. 200 ng/ml was used for organoid culture of human AEC2s.
[0247] RNA Analysis.
[0248] RNA was extracted from mouse lung tissues, mouse AEC2s, or human AEC2s using TRIzol reagent. For real-time PCR analysis, 0.5 g total RNA was used for reverse transcription with the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Carlsbad, Calif.). One microliter cDNA was subjected to real-time PCR by using Power SYBR Green PCR Master Mix (Applied Biosystems) and the ABI 7500 fast Real-Time PCR system (Applied Biosystems). The specific primers were designed on the basis of cDNA sequences deposited in the GenBank database. Mouse Tlr4 (NM_021297.2): forward, AAT CCC TGC ATA GAG GTA GTT CC; reverse, GTC TCC ACA GCC ACC AGA TT; with forward primer across exon junction. Mouse Acta2 (NM_007392, encodes -SMA): forward, GCTGGTGATGATGCTCCCA; reverse, GCCCATTCCAACCATTACTCC. Mouse Il6 (NM_031168.2): forward, CTCATTCTGCTCTGGAGCCC; reverse, TGCCATTGCACAACTCTTTTCT. Mouse Gapdh (NM_008084): forward, ATCATCTCCGCCCCTTCTG; reverse, GGTCATGAGCCCTTCCACAAC. Human HAS2 (NM_005328): forward, GCCTCATCTGTGGAGATGGT; reverse, TCCCAGAGGTCCACTAATGC. Human GAPDH: forward, AATGCATCCTGCACCACCAA; reverse, GTAGCCATATTCATTGTCATA.
TABLE-US-00002 Primer SEQ ID NO: Mouse Tlr4 (NM_021297.2): forward, AAT CCC TGC ATA GAG GTA GTT CC SEQ ID NO: 1 reverse, GTC TCC ACA GCC ACC AGA TT SEQ ID NO: 2 Mouse Acta2 (NM_007392, encodes -SMA): forward, GCTGGTGATGATGCTCCCA SEQ ID NO: 3 reverse, GTC TCC ACA GCC ACC AGA TT SEQ ID NO: 4 Mouse Il6 (NM_031168.2): forward, CTCATTCTGCTCTGGAGCCC SEQ ID NO: 5 reverse, TGCCATTGCACAACTCTTTTCT SEQ ID NO: 6 Mouse Gapdh (NM_008084): forward, ATCATCTCCGCCCCTTCTG SEQ ID NO: 7 reverse, GGTCATGAGCCCTTCCACAAC SEQ ID NO: 8 Human HAS2 (NM_005328): forward, GCCTCATCTGTGGAGATGGT SEQ ID NO: 9 reverse, TCCCAGAGGTCCACTAATGC SEQ ID NO: 10 Human GAPDH: forward, AATGCATCCTGCACCACCAA SEQ ID NO: 11 reverse, GTAGCCATATTCATTGTCATA SEQ ID NO: 12
[0249] The relative expression level of each gene was determined against the Gapdh level in the same sample. The fold change in target-gene expression was calculated by using the 2.sup.Ct method.
[0250] cDNA microarray. CD24.sup.Sca-1.sup.AEC2s were sorted from WT and Tlr4.sup./ mouse lungs. The CD24.sup.Sca-1.sup.AEC2s were pooled for RNA isolation from multiple mouse lungs for each category (for day 0: n=7 per group; for day 4: WT, n=8; Tlr4.sup./, n=7). Standard cDNA microarrays were carried out with GeneChip Mouse 430 2.0 (Affymetrix). Data were processed to subtract background and to normalize within the array using the LOESS normalization by Genespring GX 11 software. The complete microarray data set is available at the National Center for Biotechnology Information Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo/) under accession number GSE68704.
[0251] BrdU Labeling.
[0252] 5-bromo-2-deoxyuridine (BrdU, 50 mg/kg, from Sigma) was intraperitoneally injected into mice daily from day 1 to day 5 after bleomycin instillation. Mice were euthanized at day 5, 3 hours after the last BrdU injection. Cryosections were used for BrdU and SFTPC co-staining. BrdU-specific antibody was from Accurate Chemical (Clone: BU1/75, Westbury, N.Y.) and was used at 1:100 dilution. SFTPC-specific antibody was from Millipore (Catalog ABC 99) and was used at 1:2,000 dilution.
[0253] Histology and Immunofluorescence Staining.
[0254] Paraffin-embedded sections and cryosections were used for staining. Trichrome staining was done by following the conventional protocol as described previously (Dong et al., 2015; Jiang et al., 2004). -SMA in lung tissue was stained with anti--SMA (clone 1A4; Dako Cytomation) and followed by visualization with a Vectastain ABC kit (Vector Laboratories). Other primary antibodies used in the study include those specific for: Ki67 (rat anti-mouse-Ki67, 14-5698-82, 1:100, eBioscience), SFTPC (sc-7705, 1:50 dilution, Santa Cruz; or from Millipore, ABC99, 1:2,000), and Pdpn (T1) (clone 8.1.1, 1:1,000 dilution, DSHB at the University of Iowa) (Barkauskas et al., 2013; Liang et al., 2012).
[0255] Stained sections were imaged using a Zeiss AX10 Observer Z1 or Zeiss 780 reverse laser-scanning confocal microscope. The number of SP-C.sup.+ cells and SPC.sup.+BrdU.sup.+ cells, or SPC.sup.+ cells and SPC.sup.+Ki67.sup.+, were counted in three or more random 5 views of each lung section, and the percentage of SPC.sup.+BrdU.sup.+ or SPC.sup.+Ki67.sup.+ cells in the total SPC.sup.+ cell population of each lung section was calculated and averaged. Three to six mice were used for each experiment group.
[0256] Mouse Lung Dissociation and Flow Cytometry.
[0257] Single-cell suspensions from mouse lungs were isolated as described (Chen et al., 2012). Mouse lungs were perfused with 5 ml PBS and digested with elastase (4 U/ml; Worthington Biochemical Corporation) and DNase I (100 U/ml; Sigma) to obtain single-cell suspensions for flow cytometry. Primary antibodies to CD31, CD34, CD45, Sca-1, and CD24, and secondary antibody anti-streptavidin were all from eBioscience (San Diego, Calif.). Mouse anti-EpCAM (G8.8, catalog 118215) and anti-Ki67 (catalog 652403) were from BioLegend (San Diego, Calif.). 7-AAD was from BD Biosciences (San Diego, Calif.).
[0258] The procedures of staining the cells for flow cytometry and data analysis were described previously (Chen et al., 2012; Liang et al., 2012). In brief, cells were resuspended in Hank's balanced saline solution supplemented with 2% FBS (FBS), 10 mM HEPES, 0.1 mM EDTA, 100 IU/ml penicillin, 100 g/ml streptomycin (HBSS+ buffer). Labeled primary antibodies including anti-CD31-biotin, anti-CD34-biotin, anti-CD45-biotin, anti-CD24-phycoerythrin (PE), anti-EpCAM-PE-Cy7, and Sca-1-allophycocyanin (APC) were added to cells. Biotin-conjugated antibodies were detected following incubation with streptavidin-APC-Cy7. Dead cells were discriminated by 7-amino-actinomycin D (7-AAD) staining. Flow cytometry was performed using a FACSCanto II flow cytometer and FACSAria III sorter (BD Immunocytometry Systems, San Jose, Calif.) and analyzed using Flow Jo 9.6.4 software (Tree Star, Ashland, Oreg.).
[0259] Human Lung Dissociation and FACS.
[0260] All human lung experiments were approved by the Cedars-Sinai Medical Center Institutional Review Board (IRB) and were in accordance with the guidelines outlined by the Board. Informed consent was obtained from each subject (IRB: Pro00035396).
[0261] Single-cell suspensions from human lungs were isolated as described (Barkauskas et al., 2013). The procedures of staining the cells for flow cytometry and data analysis were described previously (Barkauskas et al., 2013; Liang et al., 2012). Human lung tissues were minced and digested in 2 mg/ml dispase II at 4 C. overnight and for an additional 30 minutes at 37 C. Lung tissues were then digested with elastase and DNase I. Digested lung tissues were passed through 70-m cell strainers to obtain single-cell suspension for FACS. Anti-human-CD31, anti-human-CD45, and anti-human-EpCAM antibodies were from BioLegend (San Diego, Calif.). Human type II cell marker, HTII-280 (ref. 29) was from L. Dobbs' lab at the University of California, San Francisco (UCSF). Anti-mouse-IgM was from Invitrogen. Biotinylated HA-binding protein (HABP) was from R&D systems (Minneapolis, Minn.). Flow cytometry was performed using a FACSCanto II flow cytometer and FACSAria III sorter (BD Immunocytometry Systems, San Jose, Calif.) and analyzed using Flow Jo 9.6.4 software (Tree Star, Ashland, Oreg.).
[0262] Matrigel Culture of Mouse and Human Type 2 Cells.
[0263] Flow-sorted mouse CD24.sup.Sca-1.sup.AEC2s or human HTII-280.sup.+AEC2s were cultured in Matrigel/medium (1:1) mixture in the presence of MLg2908 lung fibroblast cells (Barkauskas et al., 2013; Chen et al., 2012). 100 l Matrigel/medium mix containing 310.sup.3 type 2 cells and 210.sup.5 MLg2908 cells were plated into each 0.4-m Transwell insert of a 24-well plate. 400 l of medium was added in the lower chambers. Medium was described previously (Chen et al., 2012). Matrigel was from BD Biosciences (catalog 354230). Fresh medium was changed every other day. Cultures were maintained in a humidified 37 C. and 5% CO2 incubator. Colonies were visualized with a Zeiss Axiovert40 inverted fluorescent microscope (Carl Zeiss AG, Oberkochen, Germany). The number of colonies with a diameter of 50 m from each insert was counted, and the colony-forming efficiency (CFE) was determined by the number of colonies in each culture as a percentage of the number of input epithelial cells at day 12 after plating.
[0264] For passaging experiments, sorted CD24.sup.Sca-1.sup.AEC2s from bleomycin-treated WT mice were plated with lung fibroblasts isolated from CAG-ECFP transgenic (full name B6.129(ICR)-Tg(CAG-ECFP)CK6Nagy/J from Jackson Laboratory) mice. Colonies were dissociated from Matrigel and digested in 0.25% trypsin-EDTA to get single cells. Cells were then sorted via FACS and cyan-negative cells were replated.
[0265] For paraffin embedding, the Matrigel discs were fixed with formalin overnight and then removed and transitioned into paraffin by the standard protocol. The paraffin-embedded colony discs were then sliced for staining.
[0266] For culture with IL-6 protein or anti-IL-6, sorted type 2 cells were pretreated with IL-6 protein or anti-IL-6 at room temperature for 30 minutes. Type 2 cells were then mixed with fibroblasts in the Matrigel/medium mixture and plated into Transwell inserts. The same concentration of IL-6 protein or IL-6 antibody was added into the Matrigel/medium mix and into the medium placed in the lower chambers.
[0267] Organoid Size Measurement.
[0268] Organoids derived from flow-sorted mouse CD24.sup.Sca-1.sup.AEC2s or human HTII-280.sup.+AEC2s were pictured at day 12 after plating. ZEN pro 2012 software (Zeiss) was used to the measure surface area of the pictured organoids.
[0269] Immunofluorescence Staining of Flow-Sorted CD24.sup.Sca-1.sup.AEC2s.
[0270] Flow-sorted CD24.sup.Sca-1.sup.AEC2s were cytospun onto slides with 20,000 cells per slide. Cells were fixed and stained with an SFTPC-specific antibody from Santa Cruz (sc-7705).
[0271] Hyaluronan (HA) Concentration.
[0272] HA concentration was measured with a HABP-based ELISA-like protocol (Liang et al., 2011).
[0273] Enzyme-Linked Immunosorbent Assay (ELISA).
[0274] Duoset ELISA kits from R&D systems were used for IL-6, MIP-2, and TGF- detection, following the manufacturer's instructions.
[0275] Healon and HA-Blocking Peptide Pep-1.
[0276] Healon GV was purchased from Abbott Medical Optics (Abbot Park, Ill.). Pep-1 was synthesized by Sigma-Genosys and dissolved in DMSO to form a 100 g/l stock solution as described previously (Jiang et al., 2005; Mummert et al., 2000). For 3D matrigel culture, sorted type 2 cells were pretreated with Healon (200 g/ml) or pep-1 (125 g/ml) at room temperature for 30 minutes. Higher concentrations of Healon (400 g/ml, 600 g/ml, and 800 g/ml) were used for 3D matrigel culture of IPF AEC2s. Cells were then mixed with fibroblasts in Matrigel/medium mix and plated into Transwell inserts. The same concentrations of Healon or Pep-1 were added into the Matrigel/medium mix and medium that were placed in the lower chambers.
[0277] Stat3 Inhibitor.
[0278] The cell-permeable STAT3 inhibitor S3I-201 was purchased from Santa Cruz Biotechnology (Dallas, Tex.) and dissolved in DMSO to form stock solution of 10 mg/ml (MW 365.36). The dose for treating type 2 cells in colony-formation assays was 50 M and 100 M. The same amounts of DMSO were added into the control wells. Flow-sorted type 2 cells were pretreated with the STAT3 inhibitor at 50 M or 100 M concentrations, and with IL-6 protein (100 ng/ml), at room temperature for 30 minutes. Cells were then mixed with fibroblasts in Matrigel/medium mix and plated into Transwell inserts. Equal concentrations of the STAT3 inhibitor and IL-6 protein were added into the Matrigel/medium mix and medium placed in the lower chambers.
[0279] Cell Surface HA.
[0280] Biotinylated HA-binding protein (R&D Systems) and the secondary antibody anti-streptavidin (eBioscience) were used, along with other cell surface markers, for cell surface HA staining. Cells surface HA on gated CD24.sup.Sca-1.sup. mouse AEC2s or HTII-280.sup.+ human AEC2s were analyzed (Jiang et al., 2005).
[0281] Statistical Analysis.
[0282] Data are expressed as the means.e.m. The sample size for in vivo bleomycin fibrosis studies was based on previous studies in the lab (Li et al., 2011; Lovgren et al., 2011; Jiang et al., 2004; Jiang et al., 2010). No animals were excluded for analysis. All experiments were repeated two or more times. Data were normally distributed, and the variance between groups was not significantly different. Differences in measured variables between the experimental and control group were assessed by using the Student's t-tests or the Mann-Whitney U test. One-way or two-way ANOVA followed by Sidak's multiple-comparison test was used for multiple comparisons. The survival curves were compared using the log-rank test. Results were considered statistically significant at P<0.05. GraphPad Prism software was used for statistical analysis.
Results
Tlr4.SUP./ Mice are More Susceptible to Bleomycin Injury
[0283] It was previously demonstrated that epithelial cell surface expression of HA, TLR2 and TLR4 is necessary to sustain basal activation of the transcription factor NF-B and prevent epithelial cell apoptosis (Jiang et al., 2005). Here it was determined whether TLR-HA interactions could provide lung epithelial cells with signals to promote renewal, in addition to preventing apoptosis. Tlr4 expression was higher in the lungs of WT C57Bl/6 mice after bleomycin-induced injury than in the lungs of uninjured controls (
[0284] The inflammatory response of Tlr4.sup./ mice to bleomycin-induced lung injury was investigated, and it was found that the number of total bronchoalveolar lavage fluid (BALF) cells, as well as differential inflammatory cell counts, were not different between Tlr4.sup./ and WT mice (
Worse Alveolar Epithelial Cell Injury in Tlr4/ Mice
[0285] Flow cytometry analysis showed that AEC2s abundantly expressed TLR4 (
[0286] A mouse lung tissue dissociation and fractionation approach was used to generate an epithelial cell population (R3; CD45.sup.CD31.sup.CD34.sup.EpCAM.sup.+;
[0287] Bleomycin exposure is associated with both a lower percentage of CD24.sup.Sca-1.sup.AEC2s within the lung epithelial cell fraction (
AEC2 Proliferation and Renewal Require TLR4 Signaling
[0288] To assess the role of TLR4 on AEC2 proliferation in vivo, 5-bromo-2-deoxyuridine (BrdU) labeling was performed after bleomycin treatment. Immunofluorescence staining showed fewer SFTPC.sup.+BrdU.sup.+ cells in the lungs of Tlr4.sup./ mice as compared to those in WT mice 5 days after bleomycin treatment (
[0289] Next the colony-forming efficiency (CFE) of CD24.sup.Sca-1.sup.AEC2s that were isolated from Tlr4.sup./ and WT mice were compared at day 3 after bleomycin injury. Flow-sorted CD24.sup.Sca-1.sup.AEC2s were cocultured with mouse lung fibroblasts (Mlg 2908) embedded in matrigel medium mix for the generation of clonally derived 3D organoids. Immunofluorescence staining showed that the epithelial cells at the periphery of the organoids were SFTPC.sup.+ and that those within the interior were podoplanin (PDPN; also known as T1) positive, which are indicative of AEC2 or AEC1 differentiation, respectively (
[0290] Next the hypothesis that TLR4-promoted AEC2 renewal requires the interaction with HA was tested. Addition of high-molecular-mass HA (referred to as Healon) to the Matrigel medium mix increased the CFE of CD24.sup.Sca-1.sup.AEC2s isolated from lungs on day 3 after bleomycin treatment of WT but not Tlr4.sup./ mice (
HA on AEC2s Regulates AEC2 Renewal and Fibrosis
[0291] To further define the role of HA in AEC2 renewal, mice harboring loxP-flanked (foxed) alleles of Has2 (hereafter referred to as Has2.sup.flox/flox mice) (Li et al., 2011; Matsumoto et al., 2009) were crossed with SFTPC-Cre mice (Eblaghie et al., 2006) to generate SFTPC-Cre;Has2.sup.flox/flox mice. The SFTPC-Cre;Has2.sup.flox/flox mice have a targeted deletion of Has2 in distal lung epithelial cells, including the AEC2s, throughout lung development (Barkauskas et al., 2013; Chen et al., 2012). The lungs of SFTPC-Cre;Has2.sup.flox/flox mice, as well as those of Has2.sup.flox/flox and SFTPC-Cre transgenic mice, developed normally with no readily observable gross or histological abnormalities (
[0292] To determine whether lower HA expression affects the renewal capacity of AEC2s, CD24.sup.Sca-1.sup.AEC2s were isolated from bleomycin-injured mouse lungs and much fewer cells were recovered from the lungs of SFTPC-Cre;Has2.sup.flox/flox mice than from their littermates (
[0293] Lower cell surface expression of HA on AEC2s was hypothesized to lead to enhanced susceptibility to bleomycin injury. Indeed, SFTPC-Cre;Has2.sup.flox/flox mice showed less survival (
IL-6 Promotes AEC2 Renewal
[0294] Previous observations that HA-TLR4 interactions are associated with constitutive NF-B activation in AEC2 cells (Jiang et al., 2005) led to a search for factors downstream of this signaling pathway that might mediate the protective effects of HA and TLR4 on AEC2s. BALF composition was evaluated at various times after injury and it was found that IL-6 was lower in the BALF of both Tlr4.sup./ and SFTPC-Cre;Has2.sup.flox/flox mice, as compared to that in their corresponding controls (
[0295] To test the hypothesis that the impaired production of IL-6 might contribute to the impaired renewal capacity of CD24.sup.Sca-1.sup.AEC2s from Tlr4.sup./ and SFTPC-Cre;Has2.sup.flox/flox mice, the CFEs of CD24.sup.Sca-1.sup.AEC2s in 3D organoid culture following treatment with either recombinant IL-6 protein (rIL-6) or IL-6-specific antibodies were evaluated. Treatment with anti-IL-6 reduced, whereas treatment with rIL-6 increased, the CFEs of CD24.sup.Sca-1.sup.AEC2s from bleomycin-treated WT mice in a dose-dependent manner (
[0296] To determine whether IL-6 regulates the fibrotic phenotype in vivo, rIL-6 and anti-IL-6 were delivered to bleomycin-treated mice at the early stage of lung injury. rIL-6 treatment of Tlr4.sup./ mice resulted in more recovery of CD24.sup.Sca-1.sup.AEC2s, greater Ki67 staining of CD24.sup.Sca-1.sup.AEC2s, and lower concentration of total BALF proteins than in Tlr4.sup./ mice that were treated with a control buffer (
AEC2s from Patients with IPF have Lower Cell Surface Expression of HA
[0297] To determine whether our observations in the mouse model of Has2-deficient AEC2s have relevance to human disease, we isolated AEC2s from lung explants of human subjects who had undergone lung transplantation because of IPF. By using cell surface markers (Gonzalez et al., 2010), we were able to sort AEC2s as CD31.sup.CD45.sup.EpCAM.sup.+HTII-280.sup.+ cells from total single-cell suspensions of lung tissues (R3;
[0298] Human HTII-280.sup.+AEC2s expressed TLR4 (
AEC2s from IPF Patients have Impaired Colony Forming Capacity
[0299] The observation that HTII-280.sup.+AEC2s from lung tissue of patients with severe pulmonary fibrosis have lower cell surface expression of HA led to the investigation of the renewal capacity of these cells. The renewal capacity of human HTII-280.sup.+AEC2s were assessed using 3D matrigel culture (
[0300] To further investigate whether loss of cell surface expression of HA on HTII-280.sup.+AEC2 cells in the lungs from the patients with IPF contributed to the impaired renewal capacity of the cells, HTII-280.sup.+AEC2s that had high HA expression (HA.sup.hi) and low HA expression (HA.sup.lo) from the lungs of both patients with IPF and healthy donors were flow-sorted. The majority of HTII-280.sup.+AEC2s from healthy lung were HA.sup.hi cells, and in contrast, only a small portion of HTII-280.sup.+AEC2s in the diseased lung were HA.sup.hi cells (
[0301] Because IPF is histologically characterized as patchy areas of apparent pulmonary parenchymal fibrosis alternating with relatively normal lung architecture, AEC2s from severely fibrotic areas were tested to see if they behaved differently than those from portions of the lung with less fibrosis in the same lung explant from patients with IPF. Flow cytometry analysis showed that cell suspensions from less fibrotic areas contained relatively higher numbers of HTII-280.sup.+AEC2s than less severely fibrotic areas within the same lung (
Discussion
[0302] One of the critical issues in the pathobiology of lung fibrosis is an insufficient understanding of the molecular mechanisms that regulate AEC2 renewal both during tissue homeostasis and after injury. A goal of this study was to dissect the role of innate immune receptors and endogenous extracellular matrix molecules in regulating AEC2 renewal and lung fibrosis. It was found that the endogenous matrix glycosaminoglycan HA and the innate immune receptor TLR4 are required for optimal AEC2 renewal and for limiting fibrosis after lung injury. A loss in cell surface expression of HA was discovered in AEC2s isolated from the lungs of patients with IPF, and that this loss directly contributes to the impaired renewal capacity of such AEC2s.
[0303] Previous work demonstrated that HA, as well as TLR4 and TLR2, on epithelial cells were necessary to sustain basal NF-B activation and prevent epithelial cell apoptosis (Jiang et al., 2005). In this study, the hypothesis that HA and TLR4 on the cell surface are crucial for AEC2 renewal following injury was tested. It was shown that AEC2s with deletion of either Tlr4 or Has2 have lower self-renewal capacity in vitro and lead to greater bleomycin-induced lung injury in vivo. Exogenous HA promoted WT AEC2-mediated organoid formation, but this was not observed with AEC2s from Tlr4.sup./ mice, suggesting that the interaction between cell-surface-expressed HA and TLR4 is essential for promoting AEC2 renewal.
[0304] Epithelial cells from multiple organsincluding alveolar epithelial cells (Armstrong et al., 2004), intestinal epithelial cells (Abreu et al., 2001; Neal et al., 2012) and keratinocytes (Pivarcsi et al., 2003)express innate immune receptors such as TLR4. TLRs have a role not only in immunological responses but also in epithelial protection during homeostasis and after injury. The intestinal epithelial TLR4 and commensal bacteria have a key role in protection against bacterial infection (Rakoff-Nahoum et al., 2006; Rakoff-Nahoum et al., 2004). Evidence is provided here that distal alveolar epithelial TLR4 and HA are crucial in protecting AEC2s from injury and in promoting renewal. These data suggest that cell surface HA may function in a manner similar to commensal bacteria, as the distal alveolar space is devoid of bacteria.
[0305] Many downstream signaling events may be altered in the absence of HA-TLR interactions. The described data show that insufficient production of IL-6 resulted from HA or TLR4 deficiency and that this affected the biology of lung repair both in vitro and in vivo. AEC2s isolated from both injured Tlr4.sup./ and SFTPC-Cre;Has2.sup.flox/flox mice demonstrated impaired renewal capacity and that this was significantly reversed by rIL-6 treatment. In addition, exogenous IL-6 treatment during the period of AEC2 vulnerability enhanced AEC2 renewal and partially reversed the fibrotic phenotype in Tlr4.sup./ and SFTPC-Cre;Has2.sup.flox/flox mice in vivo. IL-6 is produced by a variety of cell types, including epithelial cells and macrophages (Oh et al., 2011). The role of IL-6 in lung injury may be multifold. First, IL-6 may be produced in the reparative niche to promote stem cell renewal (Tadokoro et al., 2014; Tebbutt et al., 2002; Zhang et al., 2014). Second, IL-6 is part of a cytokine network that modulates inflammatory responses after bleomycin (Le et al., 2014). Moreover, fibroblasts produce IL-6, and IL-6-STAT3 signaling regulates lung fibrosis (Le et al., 2014; O'Donoghue et al., 2012). It is conceivable that IL-6 has distinct effects on the biology of fibrosis at varying stages of the disease process.
[0306] Cell surface HA is significantly lower on AEC2s from patients with IPF than in those from healthy individuals. In contrast, there were no significant differences identified in cell surface TLR4 expression between AEC2s from patients with IPF and healthy donors. One of the reasons for the loss of AEC2 surface HA may be a result of the deficiency in HAS2 gene expression. AEC2s with low HA expression from the lungs of either patients with IPF or healthy individuals had dramatically lower organoid-forming ability, suggesting a direct link between the loss of cell surface HA expression and the impaired renewal capacity of AEC2s. The finding that exogenous HA was able to augment the colony-forming capacity of AEC2s from fibrotic lungs further supports the concept that the loss of cell surface HA is a cause of impaired renewal of AEC2s from diseased lungs. Higher concentrations of HA were required in human AEC2s, suggesting that there are differences with the mouse model system.
[0307] These findings support the concept that IPF is primarily a disease of AEC2 stem cell failure. The loss of the HA-synthesizing enzyme in AEC2s was identified as a primary defect leading to the susceptibility to fibrosis. In addition, innate immune receptors were shown to promote epithelial regeneration in addition to the established functions in inflammation. The mouse model using a targeted deletion of Has2 in distal lung epithelium recapitulates key aspects of severe pulmonary fibrosis in human disease. AEC2s isolated from lung explants of patients with chronic obstructive pulmonary disease (COPD), another severe lung disease but with a very different pathology, expressed cell surface HA levels similar to that in AEC2s from healthy donors (data not shown), suggesting that loss of cell surface HA on AEC2s is a unique feature of severe pulmonary fibrosis.
[0308] The entire contents of all patents, published patent applications, and other references cited herein are hereby expressly incorporated herein in their entireties by reference.
[0309] While the present invention has been described with reference to the specific embodiments thereof it should be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the true spirit and scope of the invention. In addition, many modifications may be made to adopt a particular situation, material, composition of matter, process, process step or steps, to the objective spirit and scope of the present invention. All such modifications are intended to be within the scope of the claims appended hereto
REFERENCES
[0310] 1. Rakoff-Nahoum, S., Hao, L. & Medzhitov, R. Role of toll-like receptors in spontaneous commensal-dependent colitis. Immunity 25, 319-329 (2006). [0311] 2. Rakoff-Nahoum, S., et al. Recognition of commensal microflora by toll-like receptors is required for intestinal homeostasis. Cell 118, 229-241 (2004). [0312] 3. Fukata, M. et al. Cox-2 is regulated by Toll-like receptor 4 (TLR4) signaling: role in proliferation and apoptosis in the intestine. Gastroenterology 131, 862-877 (2006). [0313] 4. Hogan, B. L. et al. Repair and regeneration of the respiratory system: complexity, plasticity and mechanisms of lung stem cell function. Cell Stem Cell 15, 123-138 (2014). [0314] 5. Kotton, D. N. & Morrisey, E. E. Lung regeneration: mechanisms, applications and emerging stem cell populations. Nat. Med. 20, 822-832 (2014). [0315] 6. Desai, T. J., Brownfield, D. G. & Krasnow, M. A. Alveolar progenitor and stem cells in lung development, renewal and cancer. Nature 507, 190-194 (2014). [0316] 7. Barkauskas, C. E. et al. Type 2 alveolar cells are stem cells in adult lung. J. Clin. Invest. 123, 3025-3036 (2013). [0317] 8. Hofer, C. C., et al. Infection of mice with influenza A/WSN/33 (H1N1) virus alters alveolar type II cell phenotype. Am. J. Physiol. Lung Cell. Mol. Physiol. 308, L628-L638 (2015). [0318] 9. Liu, Y., et al. Activation of type II cells into regenerative stem-cell-antigen-1+ cells during alveolar repair. Am. J. Respir. Cell Mol. Biol. 53, 113-124 (2015). [0319] 10. Rock, J. R. et al. Multiple stromal populations contribute to pulmonary fibrosis without evidence for epithelial-to-mesenchymal transition. Proc. Natl. Acad. Sci. USA 108, E1475-E1483 (2011). [0320] 11. Jiang, D. et al. Regulation of lung injury and repair by Toll-like receptors and hyaluronan. Nat. Med. 11, 1173-1179 (2005). [0321] 12. Jiang, D., Liang, J., Li, Y. & Noble, P. W. The role of Toll-like receptors in noninfectious lung injury. Cell Res. 16, 693-701 (2006). [0322] 13. Jiang, D., Liang, J. & Noble, P. W. Hyaluronan in tissue injury and repair. Annu. Rev. Cell Dev. Biol. 23, 435-461 (2007). [0323] 14. Noble, P. W. & Jiang, D. Matrix regulation of lung injury, inflammation and repair: the role of innate immunity. Proc. Am. Thorac. Soc. 3, 401-404 (2006). [0324] 15. Jiang, D., Liang, J. & Noble, P. W. Hyaluronan as an immune regulator in human diseases. Physiol. Rev. 91, 221-264 (2011). [0325] 16. Camenisch, T. D. et al. Disruption of hyaluronan synthase 2 abrogates normal cardiac morphogenesis and hyaluronan-mediated transformation of epithelium to mesenchyme. J. Clin. Invest. 106, 349-360 (2000). [0326] 17. American Thoracic Society. Idiopathic pulmonary fibrosis: diagnosis and treatment. International consensus statement. The joint statement of American Thoracic Society (ATS) and the European Respiratory Society (ERS). Am. J. Respir. Crit. Care Med. 161, 646-664 (2000). [0327] 18. Selman, M. et al. Idiopathic pulmonary fibrosis: pathogenesis and therapeutic approaches. Drugs 64, 405-430 (2004). [0328] 19. Noble, P. W., Barkauskas, C. E. & Jiang, D. Pulmonary fibrosis: patterns and perpetrators. J. Clin. Invest. 122, 2756-2762 (2012). [0329] 20. Amin, R. S. et al. Surfactant protein deficiency in familial interstitial lung disease. J. Pediatr. 139, 85-92 (2001). [0330] 21. Thomas, A. Q. et al. Heterozygosity for a surfactant protein C gene mutation associated with usual interstitial pneumonitis and cellular nonspecific interstitial pneumonitis in one kindred. Am. J. Respir. Crit. Care Med. 165, 1322-1328 (2002). [0331] 22. Garcia, C. K. Idiopathic pulmonary fibrosis: update on genetic discoveries. Proc. Am. Thorac. Soc. 8, 158-162 (2011). [0332] 23. Alder, J. K. et al. Telomere dysfunction causes alveolar stem cell failure. Proc. Natl. Acad. Sci. USA 112, 5099-5104 (2015). [0333] 24. Chen, H. et al. Airway epithelial progenitors are region specific and show differential responses to bleomycin-induced lung injury. Stem Cells 30, 1948-1960 (2012). [0334] 25. Mummert, M. E., et al. Development of a peptide inhibitor of hyaluronan-mediated leukocyte trafficking. J. Exp. Med. 192, 769-779 (2000). [0335] 26. Li, Y. et al. Severe lung fibrosis requires an invasive fibroblast phenotype regulated by hyaluronan and CD44. J. Exp. Med. 208, 1459-1471 (2011). [0336] 27. Matsumoto, K. et al. Conditional inactivation of Has2 reveals a crucial role for hyaluronan in skeletal growth, patterning, chondrocyte maturation and joint formation in the developing limb. Development 136, 2825-2835 (2009). [0337] 28. Eblaghie, M. C., et al. Evidence that autocrine signaling through Bmprla regulates the proliferation, survival and morphogenetic behavior of distal lung epithelial cells. Dev. Biol. 291, 67-82 (2006). [0338] 29. Gonzalez, R. F., et al. HTII-280, a biomarker specific to the apical plasma membrane of human lung alveolar type II cells. J. Histochem. Cytochem. 58, 891-901 (2010). [0339] 30. Armstrong, L. et al. Expression of functional toll-like receptor-2 and -4 on alveolar epithelial cells. Am. J. Respir. Cell Mol. Biol. 31, 241-245 (2004). [0340] 31. Abreu, M. T. et al. Decreased expression of Toll-like receptor 4 and MD-2 correlates with intestinal epithelial cell protection against dysregulated proinflammatory gene expression in response to bacterial lipopolysaccharide. J. Immunol. 167, 1609-1616 (2001). [0341] 32. Neal, M. D. et al. Toll-like receptor 4 is expressed on intestinal stem cells and regulates their proliferation and apoptosis via the p53-upregulated modulator of apoptosis. J. Biol. Chem. 287, 37296-37308 (2012). [0342] 33. Pivarcsi, A. et al. Expression and function of Toll-like receptors 2 and 4 in human keratinocytes. Int. Immunol. 15, 721-730 (2003). [0343] 34. Oh, K. et al. Epithelial transglutaminase 2 is needed for T cell interleukin-17 production and subsequent pulmonary inflammation and fibrosis in bleomycin-treated mice. J. Exp. Med. 208, 1707-1719 (2011). [0344] 35. Tadokoro, T. et al. IL-6-STAT3 promotes regeneration of airway ciliated cells from basal stem cells. Proc. Natl. Acad. Sci. USA 111, E3641-E3649 (2014). [0345] 36. Tebbutt, N. C. et al. Reciprocal regulation of gastrointestinal homeostasis by SHP2 and STAT-mediated trefoil gene activation in gp130-mutant mice. Nat. Med. 8, 1089-1097 (2002). [0346] 37. Zhang, S. et al. Interleukin 6 mediates the therapeutic effects of adipose-derived stromal-stem cells in lipopolysaccharide-induced acute lung injury. Stem Cells 32, 1616-1628 (2014). [0347] 38. Le, T. T. et al. Blockade of IL-6 trans-signaling attenuates pulmonary fibrosis. J. Immunol. 193, 3755-3768 (2014). [0348] 39. O'Donoghue, R. J. et al. Genetic partitioning of interleukin-6 signaling in mice dissociates Stat3 from Smad3-mediated lung fibrosis. EMBO Mol. Med. 4, 939-951 (2012). [0349] 40. Rafii, S. et al. Platelet-derived SDF-1 primes the pulmonary capillary vascular niche to drive lung alveolar regeneration. Nat. Cell Biol. 17, 123-136 (2015). [0350] 41. Cao, Z. et al. Targeting of the pulmonary capillary vascular niche promotes lung alveolar repair and ameliorates fibrosis. Nat. Med. 22, 154-162 (2016). [0351] 42. Guzy, R. D. et al. Fibroblast growth factor 2 is required for epithelial recovery, but not for pulmonary fibrosis, in response to bleomycin. Am. J. Respir. Cell Mol. Biol. 52, 116-128 (2015). [0352] 43. Chapman, H. A. et al. Integrin a6(34 identifies an adult distal lung epithelial population with regenerative potential in mice. J. Clin. Invest. 121, 2855-2862 (2011). [0353] 44. Lee, J. H. et al. Lung stem cell differentiation in mice directed by endothelial cells via a BMP4-NFATc1-thrombospondin-1 axis. Cell 156, 440-455 (2014). [0354] 45. Treutlein, B. et al. Reconstructing lineage hierarchies of the distal lung epithelium using single-cell RNA-seq. Nature 509, 371-375 (2014). [0355] 46. Vaughan, A. E. et al. Lineage-negative progenitors mobilize to regenerate lung epithelium after major injury. Nature 517, 621-625 (2015). [0356] 47. Takeuchi, O. et al. Differential roles of TLR2 and TLR4 in recognition of Gram-negative and Gram-positive bacterial cell wall components. Immunity 11, 443-451 (1999). [0357] 48. Kawai, T., Adachi, O., Ogawa, T., Takeda, K. & Akira, S. Unresponsiveness of MyD88-deficient mice to endotoxin. Immunity 11, 115-122 (1999). [0358] 49. Jeannotte, L. et al. Unsuspected effects of a lung-specific Cre deleter mouse line. Genesis 49, 152-159 (2011). [0359] 50. Morales-Nebreda, L. I. et al. Lung-specific loss of a3-laminin worsens bleomycin-induced pulmonary fibrosis. Am. J. Respir. Cell Mol. Biol. 52, 503-512 (2015). [0360] 51. Dong, Y. et al. Blocking follistatin-like 1 attenuates bleomycin-induced pulmonary fibrosis in mice. J. Exp. Med. 212, 235-252 (2015). [0361] 52. Lovgren, A. K. et al. -arrestin deficiency protects against pulmonary fibrosis in mice and prevents fibroblast invasion of extracellular matrix. Sci. Transl. Med. 3, 74ra23 (2011). [0362] 53. Jiang, D. et al. Regulation of pulmonary fibrosis by chemokine receptor CXCR3. J. Clin. Invest. 114, 291-299 (2004). [0363] 54. Liang, J. et al. A macrophage subpopulation recruited by CC chemokine ligand 2 clears apoptotic cells in non-infectious lung injury. Am. J. Physiol. Lung Cell. Mol. Physiol. 302, L933-L940 (2012). [0364] 55. Liang, J. et al. Role of hyaluronan and hyaluronan-binding proteins in human asthma. J. Allergy Clin. Immunol. 128, 403-411.e3 (2011). [0365] 56. Jiang, D. et al. Inhibition of pulmonary fibrosis in mice by CXCL10 requires glycosaminoglycan binding and syndecan 4. J. Clin. Invest. 120, 2049-2057 (2010).