Anti-Wolbachia pyrido[2,3-d]pyrimidine compounds

Abstract

The present invention relates to compounds of Formulae (I) and (II) as defined herein, and salts and solvates thereof. ##STR00001##
The present invention also relates to pharmaceutical compositions comprising compounds of Formulae (I) and (II), and to the use of compounds of Formulae (I) and (II) in the treatment or prevention of filarial worm infection, as well as other diseases or conditions in which filarial worm infection is implicated.

Claims

1. A compound, or a salt or solvate thereof, according to Formula Ia: ##STR00703## wherein, R.sup.6 is selected from hydrogen, methyl, or ethyl; R.sup.7 is hydrogen; or R.sup.6 and R.sup.7, together with the atoms to which they are attached form an azetidinyl, pyrrolidinyl, piperidinyl, or morpholinyl ring; X.sup.4 is N; R.sup.2 is NR.sup.c1R.sup.d1 or is selected from ##STR00704##  each of which may optionally be substituted with one or more R.sup.e, wherein each R.sup.e is selected from hydroxyl, ═O, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, and —NR.sup.cR.sup.d; where R.sup.c1 is C.sub.1-6 alkyl, and R.sup.d1 is selected from C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl; R.sup.b is selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, and O—C.sub.1-6 alkyl; R.sup.c is independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl; R.sup.d is independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl, C.sub.6-11 aryl; and R.sup.4 and R.sup.5 are independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, and C.sub.1-6 alkyl.

2. A compound according to claim 1, or a salt or solvate thereof, wherein R.sup.4 and R.sup.5 are hydrogen.

3. A compound according to claim 1, or a salt or solvate thereof, wherein R.sup.b is selected from fluoro, chloro, and CF.sub.3.

4. A compound according to claim 1, wherein R.sup.6 and R.sup.7 are both hydrogen.

5. A compound according to claim 1, or a salt or solvate thereof, wherein R.sup.2 is selected from ##STR00705## each of which may optionally be substituted with one or more R.sup.e.

6. A compound according to claim 1, or a salt or solvate thereof, wherein each R.sup.e is independently selected from fluoro, chloro, CN, CF.sub.3, OCF.sub.3, and methyl.

7. A compound, or a salt or solvate thereof, selected from: N.sup.2-isopropyl-N.sup.2,N.sup.4-dimethyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine; N.sup.2-isopropyl-N.sup.2-methyl-N.sup.4-(2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine; N.sup.2-isopropyl-N.sup.2-methyl-N.sup.4-(2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine methanesulfonate; 2-(azetidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 3-methyl-1-(4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)azetidin-3-ol; 2-(2-methylazetidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(2,2-dimethylazetidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(pyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; N.sup.2-cyclopropyl-N.sup.2-methyl-N.sup.4-(2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine; 2-morpholino-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine methanesulfonate; 2-(3,3-difluoropyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(3,3-difluoropyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine methanesulfonate; 2-(4-fluoropiperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(4,4-difluoropiperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(4-chloropiperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(3-fluoroazetidin-1-yl)-N-[2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(3,3-difluoroazetidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(3-(trifluoromethyl)azetidin-1-yl)-N-[2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; (S)-2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; (R)-2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(4-chloropiperidin-1-yl)-4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidine; 2-(4,4-difluoropiperidin-1-yl)-4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidin; 3-methyl-4-(4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine; 2-(3,3-difluoropyrrolidin-1-yl)-4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidine; 2-(3-(trifluoromethyl)azetidin-1-yl)-4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidine; 2-((4-chloropiperidin-1-yl)methyl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-((4,4-difluoropiperidin-1-yl)methyl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-((3-methylmorpholino)methyl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-((3,3-difluoropyrrolidin-1-yl)methyl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-((3-(trifluoromethyl)azetidin-1-yl)methyl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-((4-chloropiperidin-1-yl)methyl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-((4,4-difluoropiperidin-1-yl)methyl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-((3-methylmorpholino)methyl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-((3,3-difluoropyrrolidin-1-yl)methyl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-((3-(trifluoromethyl)azetidin-1-yl)methyl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(4-(methylsulfonyl)piperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(4,4-dimethylpiperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 1-(4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)piperidine-4-carbonitrile; 2-(4-(trifluoromethyl)piperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyr-imidin-4-amine; N-((2-(trifluoromethyl)pyridin-3-yl)methyl)-2-(3-(trifluoromethyl)pyrrolidin-1-yl)pyrido[2,3-d]pyrimidin-4-amine; 1-(4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)azetidine-3-carbonitrile; 1-(4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)pyrrolidine-2-carbonitrile; 2-(2,2-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(3,3-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(2-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(3-fluoropyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(3-(trifluoromethyl)piperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 4-methyl-1-(4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)piperidine-4-carbonitrile; 1-(4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)piperidine-3-carbonitrile; 2-(2,2-difluoro-7-azaspiro[3.5]nonan-7-yl)-N-[2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(2,2-difluoro-7-azaspiro[3.5]nonan-7-yl)-N-[2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine methanesulfonate; 2-(3-cyclopropylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-((6S)-2,6-dimethylmorpholino)-N-[2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(2-oxa-5-azabicyclo[2.2.1]heptan-5-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(4-oxa-7-azaspiro[2.5]octan-7-yl)-N-[2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 4-(4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)morpholine-2-carbonitrile; 2-(3-(fluoromethyl)piperidin-1-yl)-N-[2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyri-midin-4-amine; 2-(2-(trifluoromethyl)piperidin-1-yl)-N-[2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(3-(methylsulfonyl)pyrrolidin-1-yl)-N-[2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; N-((2-(trifluoromethyl)pyridin-3-yl)methyl)-2-(2-(trifluoromethyl)pyrrolidin-1-yl)pyrido[2,3-d]pyrimidin-4-amine; 2-(3-chloropyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(3-isopropylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-((2R,3R)-2, 3-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-((2 S, 5R)-2, 5-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(6-oxa-9-azaspiro[4.5]decan-9-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(4-(trifluoromethoxy)piperidin-1-yl)-N-((2-(trifluoromethyl)pyri din-3-yl)methyl)pyrido[2, 3-d]pyrimidin-4-amine; 2-(4-(trifluoromethoxy)piperidin-1-yl)-N-((2-(trifluoromethyl)pyri din-3-yl)methyl)pyrido[2, 3-d]pyrimidin-4-amine methanesulfonate; 2-(3-(difluoromethyl)azetidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-((3R)-3,5-dimethylmorpholino)-N-[2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2, 3-d]pyrimidin-4-amine; 2-(2-cyclopropylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2, 3-d]pyrimidin-4-amine; 2-((2 S, 5 S)-2, 5-dimethylmorpholino)-N-[2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; (R)-2-(3-(difluoromethoxy)pyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2, 3-d]pyrimidin-4-amine; (S)-2-(3-(difluoromethoxy)pyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2, 3-d]pyrimidin-4-amine; 2-(2-(difluoromethyl)morpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido [2,3-d]pyrimidin-4-amine; 2-((2R,3 S)-2,3-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; (3R)-3-methyl-4-(4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine; (3S)-3-methyl-4-(4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine; 2-(3-(difluoromethoxy)piperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(6-oxa-3-azabicyclo[3.1.1]heptan-3-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(2-oxa-5-azabicyclo[4.1.0]heptan-5-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(2,2,6,6-tetrafluoromorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(4-azaspiro[2.5]octan-4-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(3-(trifluoromethoxy)pyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(5-azaspiro[3.4]octan-5-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 2-(2-((trifluoromethoxy)methyl)pyrrolidin-1-yl)-N-[2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 6-fluoro-2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 6-methoxy-2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 7-methoxy-2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 5-methoxy-2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; 6,7-dimethoxy-2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine; or 2-(3-methylmorpholino)-7-(2-morpholinoethoxy)-N-[2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine.

8. A pharmaceutical composition comprising a compound of Formula Ia according to claim 1, or a pharmaceutically acceptable salt or solvate thereof, in admixture with a pharmaceutically acceptable diluent or carrier.

9. A method of treating or preventing a filarial worm infection in a subject, said method comprising administering to a subject a therapeutically effective amount of a compound of Formula Ia according to claim 1, or a pharmaceutically acceptable salt or solvate thereof; wherein the infection is with one or more filarial worms selected from Wuchereria bancrofti, Brugia malayi, Brugia timori and Onchocerca volvulus.

10. A compound according to claim 1, or a salt or solvate thereof, wherein R.sup.b is CF.sub.3.

11. A compound according to claim 1, or a salt or solvate thereof, wherein R.sup.e is selected from hydroxyl, ═O, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.

12. A compound according to claim 1, or a salt or solvate thereof, wherein R.sup.2 is selected from ##STR00706##

13. A method of treating or preventing a disease or condition mediated by a filarial worm infection, said method comprising administering to a subject in need thereof a therapeutically effective amount of a compound of Formula Ia according to claim 1; wherein the disease or condition mediated by a filarial worm infection is selected from onchocerciasis or lymphatic filariasis.

14. The compound of claim 7, or a salt or solvate thereof, which is 2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine: ##STR00707##

15. The compound of claim 7, or a salt or solvate thereof, which is (S)-2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine: ##STR00708##

16. The compound of claim 7, or a salt or solvate thereof, which is N.sup.2-isopropyl-N.sup.2-methyl-N.sup.4-((2-(trifluoromethyl)pyridin-3 -yl)methyl)pyrido [2,3 -d]pyrimidine-2,4-diamine: ##STR00709##

17. The compound of claim 7, or a salt or solvate thereof, which is 2-(4-(trifluoromethoxy)piperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine: ##STR00710##

Description

DETAILED DESCRIPTION OF THE INVENTION

Definitions

(1) The compounds and intermediates described herein may be named according to either the IUPAC (International Union for Pure and Applied Chemistry) or CAS (Chemical Abstracts Service) nomenclature systems. It should be understood that unless expressly stated to the contrary, the terms “compounds of Formula I”, “compounds of Formula Ia”, “compounds of Formula II” and “compounds of Formula IIa”, and the more general term “compounds” refer to and include any and all compounds described by and/or with reference to Formula I, Ia, II and IIa respectively. It should also be understood that these terms encompasses all stereoisomers, i.e. cis and trans isomers, as well as optical isomers, i.e. R and S enantiomers, of such compounds and all salts thereof, in substantially pure form and/or any mixtures of the foregoing in any ratio. This understanding extends to pharmaceutical compositions and methods of treatment that employ or comprise one or more compounds of the Formula I, Ia, II and IIa, either by themselves or in combination with additional agents.

(2) The various hydrocarbon-containing moieties provided herein may be described using a prefix designating the minimum and maximum number of carbon atoms in the moiety, e.g. “(C.sub.a-b)” or “C.sub.a-C.sub.b” or “(a-b)C”. For example, (C.sub.a-b)alkyl indicates an alkyl moiety having the integer “a” to the integer “b” number of carbon atoms, inclusive. Certain moieties may also be described according to the minimum and maximum number of members with or without specific reference to a particular atom or overall structure. For example, the terms “a to b membered ring” or “having between a to b members” refer to a moiety having the integer “a” to the integer “b” number of atoms, inclusive.

(3) “About” when used herein in conjunction with a measurable value such as, for example, an amount or a period of time and the like, is meant to encompass reasonable variations of the value, for instance, to allow for experimental error in the measurement of said value.

(4) As used herein by themselves or in conjunction with another term or terms, “alkyl” and “alkyl group” refer to a branched or unbranched saturated hydrocarbon chain. Unless specified otherwise, alkyl groups typically contain 1-10 carbon atoms, such as 1-6 carbon atoms or 1-4 carbon atoms or 1-3 carbon atoms, and can be substituted or unsubstituted. Representative examples include, but are not limited to, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, n-pentyl, n-hexyl, n-heptyl, n-octyl, n-nonyl, n-decyl, isopropyl, tert-butyl, isobutyl, etc.

(5) As used herein by themselves or in conjunction with another term or terms, “alkylene” and “alkylene group” refer to a branched or unbranched saturated hydrocarbon chain. Unless specified otherwise, alkylene groups typically contain 1-10 carbon atoms, such as 1-6 carbon atoms or 1-3 carbon atoms, and can be substituted or unsubstituted. Representative examples include, but are not limited to, methylene (—CH.sub.2—), the ethylene isomers (—CH(CH.sub.3)— and —CH.sub.2CH.sub.2—), the propylene isomers (—CH(CH.sub.3)CH.sub.2—, —CH(CH.sub.2CH═)—, —C(CH.sub.3)—, and —CH.sub.2CH.sub.2CH.sub.2—), etc.

(6) As used herein by themselves or in conjunction with another term or terms, “alkenyl” and “alkenyl group” refer to a branched or unbranched hydrocarbon chain containing at least one double bond. Unless specified otherwise, alkenyl groups typically contain 2-10 carbon atoms, such as 2-6 carbon atoms or 2-4 carbon atoms, and can be substituted or unsubstituted. Representative examples include, but are not limited to, ethenyl, 3-buten-1-yl, 2-ethenylbutyl, and 3-hexen-1-yl.

(7) As used herein by themselves or in conjunction with another term or terms, “alkynyl” and “alkynyl group” refer to a branched or unbranched hydrocarbon chain containing at least one triple bond. Unless specified otherwise, alkynyl groups typically contain 2-10 carbon atoms, such as 2-6 carbon atoms or 2-4 carbon atoms, and can be substituted or unsubstituted. Representative examples include, but are not limited to, ethynyl, 3-butyn-1-yl, propynyl, 2-butyn-1-yl, and 3-pentyn-1-yl.

(8) As used herein by itself or in conjunction with another term or terms, “aromatic” refers to monocyclic and polycyclic ring systems containing 4n+2 pi electrons, where n is an integer. Aromatic should be understood as referring to and including ring systems that contain only carbon atoms (i.e. “aryl”) as well as ring systems that contain at least one heteroatom selected from N, O or S (i.e. “heteroaromatic” or “heteroaryl”). An aromatic ring system can be substituted or unsubstituted.

(9) As used herein by itself or in conjunction with another term or terms, “non-aromatic” refers to a monocyclic or polycyclic ring system having at least one double bond that is not part of an extended conjugated pi system. As used herein, non-aromatic refers to and includes ring systems that contain only carbon atoms as well as ring systems that contain at least one heteroatom selected from N, O or S. A non-aromatic ring system can be substituted or unsubstituted.

(10) As used herein by themselves or in conjunction with another term or terms, “aryl” and “aryl group” refer to phenyl and 7-15 membered bicyclic or tricyclic hydrocarbon ring systems, including bridged, spiro, and/or fused ring systems, in which at least one of the rings is aromatic. Aryl groups can be substituted or unsubstituted. Unless specified otherwise, an aryl group may contain 6 ring atoms (i.e., phenyl) or a ring system containing 9 to 15 atoms, such as 9 to 11 ring atoms, or 9 or 10 ring atoms. Representative examples include, but are not limited to, naphthyl, indanyl, 1,2,3,4-tetrahydronaphthalenyl, 6,7,8,9-tetrahydro-5H-benzocycloheptenyl, and 6,7,8,9-tetrahydro-5H-benzocycloheptenyl. Suitably an aryl group is phenyl and naphthyl, suitably phenyl.

(11) As used herein by themselves or in conjunction with another term or terms, “arylene” and “arylene group” refer to a phenylene (—C.sub.6H.sub.4—) or to 7 to 15 membered bicyclic or tricyclic hydrocarbon ring systems, including bridged, spiro, and/or fused ring systems, in which at least one of the rings is aromatic. Arylene groups can be substituted or unsubstituted. In some embodiments, an arylene group may contain 6 (i.e., phenylene) ring atoms or be a ring system containing 9 to 15 atoms; such as 9 to 11 ring atoms; or 9 or 10 ring atoms. Arylene groups can be substituted or unsubstituted.

(12) As used herein by themselves or in conjunction with another term or terms, “alkylaryl” and “alkylaryl group” refer to an alkyl group in which a hydrogen atom is replaced by an aryl group, wherein alkyl group and aryl group are as previously defined, such as, for example, benzyl (C.sub.6H.sub.5CH.sub.2—). Alkylaryl groups can be substituted or unsubstituted.

(13) As used herein by themselves or in conjunction with another term or terms, “carbocyclic group” and “carbocycle” refer to monocyclic and polycyclic ring systems that contain only carbon atoms in the ring(s), i.e., hydrocarbon ring systems, without regard or reference to aromaticity or degree of unsaturation. Thus, carbocyclic group should be understood as referring to and including ring systems that are fully saturated (such as, for example, a cyclohexyl group), ring systems that are aromatic (such as, for example, a phenyl group), as well as ring systems having fully saturated, aromatic and/or unsaturated portions (such as, for example, cyclohexenyl, 2,3-dihydro-indenyl, and 1,2,3,4-tetrahydronaphthalenyl). The terms carbocyclic and carbocycle further include bridged, fused, and spirocyclic ring systems.

(14) As used herein by themselves or in conjunction with another term or terms, “cycloalkyl” and “cycloalkyl group” refer to a non-aromatic carbocyclic ring system, that may be monocyclic, bicyclic, or tricyclic, saturated or unsaturated, and may be bridged, spiro, and/or fused. A cycloalkyl group may be substituted or unsubstituted. Unless specified otherwise, a cycloalkyl group typically contains from 3 to 12 ring atoms. In some instances a cycloalkyl group may contain 4 to 10 ring atoms (e.g., 4 ring atoms, 5 ring atoms, 6 ring atoms, 7 ring atoms, etc.). Representative examples include, but are not limited to, cyclopropyl, cyclopropenyl, cyclobutyl, cyclobutenyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, norbornyl, norbornenyl, bicyclo[2.2.1]hexane, bicyclo[2.2.1]heptane, bicyclo[2.2.1]heptene, bicyclo[3.1.1]heptane, bicyclo[3.2.1]octane, bicyclo[2.2.2]octane, bicyclo[3.2.2]nonane, bicyclo[3.3.1]nonane, and bicyclo[3.3.2]decane. Suitably, cycloalkyl groups are selected from cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl groups.

(15) As used herein by themselves or in conjunction with another term or terms, “alkylcycloalkyl” and “alkylcycloalkyl group” refer to an alkyl group in which a hydrogen atom is replaced by a cycloalkyl group, wherein alkyl group and cycloalkyl group are as previously defined, such as, for example, cyclohexylmethyl (C.sub.6H.sub.11CH.sub.2—). Alkylcycloalkyl groups can be substituted or unsubstituted.

(16) As used herein by themselves or in conjunction with another term or terms, “haloalkyl” and “haloalkyl group” refer to alkyl groups in which one or more hydrogen atoms are replaced by halogen atoms. Haloalkyl includes both saturated alkyl groups as well as unsaturated alkenyl and alkynyl groups. Representative examples include, but are not limited to, —CF.sub.3, —CHF.sub.2, —CH.sub.2F, —CF.sub.2CF.sub.3, —CHFCF.sub.3, —CH.sub.2CF.sub.3, —CF.sub.2CH.sub.3, —CHFCH.sub.3, —CF.sub.2CF.sub.2CF.sub.3, —CF.sub.2CH.sub.2CH.sub.3, —CF═CF.sub.2, —CCl═CH.sub.2, —CBr═CH.sub.2, —Cl═CH.sub.2, —C≡C—CF.sub.3, —CHFCH.sub.2CH.sub.3 and —CHFCH.sub.2CF.sub.3. Haloalkyl groups can be substituted or unsubstituted. Suitably, a haloalkyl group is selected from CHF.sub.2 and CF.sub.3, suitably CF.sub.3.

(17) As used herein by themselves or in conjunction with another term or terms, “haloalkoxy” and “haloalkoxy group” refer to alkoxy groups (i.e. O-alkyl groups) in which one or more hydrogen atoms are replaced by halogen atoms. Haloalkoxy includes both saturated alkoxy groups as well as unsaturated alkenyl and alkynyl groups. Representative examples include, but are not limited to, —OCF.sub.3, —OCHF.sub.2, —OCH.sub.2F, —OCF.sub.2CF.sub.3, —OCHFCF.sub.3, —OCH.sub.2CF.sub.3, —OCF.sub.2CH.sub.3, —OCHFCH.sub.3, —OCF.sub.2CF.sub.2CF.sub.3, —OCF.sub.2CH.sub.2CH.sub.3, —OCF═CF.sub.2, —OCCl═CH.sub.2, —OCBr═CH.sub.2, —OCHFCH.sub.2CH.sub.3 and —OCHFCH.sub.2CF.sub.3. Haloalkoxy groups can be substituted or unsubstituted. Suitably, a haloalkyoxy group is selected from —OCHF.sub.2 and —OCF.sub.3, suitably —OCF.sub.3.

(18) As used herein by themselves or in conjunction with another term or terms, “halo” and “halogen” include fluorine, chlorine, bromine and iodine atoms and substituents.

(19) As used herein by themselves or in conjunction with another term or terms, “heteroaryl” and “heteroaryl group” refer to (a) 5 and 6 membered monocyclic aromatic rings, which contain, in addition to carbon atom(s), at least one heteroatom, such as nitrogen, oxygen or sulfur, and (b) 7 to 15 membered bicyclic and tricyclic rings, which contain, in addition to carbon atom(s), at least one heteroatom, such as nitrogen, oxygen or sulfur, and in which at least one of the rings is aromatic. In some instances, a heteroaryl group can contain two or more heteroatoms, which may be the same or different. Heteroaryl groups can be substituted or unsubstituted, and may be bridged, spiro, and/or fused. In some instances, a heteroaryl group may contain 5, 6, or 8 to 15 ring atoms. In other instances, a heteroaryl group may contain 5 to 10 ring atoms, such as 5, 6, 9, or 10 ring atoms. Representative examples include, but are not limited to, 2,3-dihydrobenzofuranyl, 1,2-dihydroquinolinyl, 3,4-dihydroisoquinolinyl, 1,2,3,4-tetrahydroisoquinolinyl, 1,2,3,4-tetrahydroquinolinyl, benzoxazinyl, benzothiazinyl, chromanyl, furanyl, 2-furanyl, 3-furanyl, imidazolyl, isoxazolyl, isothiazolyl, oxadiazolyl, oxazolyl, pyridinyl, 2-, 3-, or 4-pyridinyl, pyrimidinyl, 2-, 4-, or 5-pyrimidinyl, pyrazolyl, pyrrolyl, 2- or 3-pyrrolyl, pyrazinyl, pyridazinyl, 3- or 4-pyridazinyl, 2-pyrazinyl, thienyl, 2-thienyl, 3-thienyl, tetrazolyl, thiazolyl, thiadiazolyl, triazinyl, triazolyl, pyridin-2-yl, pyridin-4-yl, pyrimidin-2-yl, pyridazin-4-yl, pyrazin-2-yl, naphthyridinyl, pteridinyl, phthalazinyl, purinyl, alloxazinyl, benzimidazolyl, benzofuranyl, benzofurazanyl, 2H-1-benzopyranyl, benzothiadiazine, benzothiazinyl, benzothiazolyl, benzothiophenyl, benzoxazolyl, cinnolinyl, furopyridinyl, indolinyl, indolizinyl, indolyl, or 2-, 3-, 4-, 5-, 6-, or 7-indolyl, 3H-indolyl, quinazolinyl, quinoxalinyl, isoindolyl, isoquinolinyl, 10-aza-tricyclo[6.3.1.0.sup.2,7]dodeca-2(7),3,5-trienyl, 12-oxa-10-aza-tricyclo[6.3.1.0.sup.2,7]dodeca-2(7),3,5-trienyl, 12-aza-tricyclo[7.2.1.0.sup.2,7]dodeca-2(7),3,5-trienyl, 10-aza-tricyclo[6.3.2.0.sup.2,7]trideca-2(7),3,5-trienyl, 2,3,4,5-tetrahydro-1H-benzo[d]azepinyl, 1,3,4,5-tetrahydro-benzo[d]azepin-2-onyl, 1,3,4,5-tetrahydro-benzo[b]azepin-2-onyl, 2,3,4,5-tetrahydro-benzo[c]azepin-1-onyl, 1,2,3,4-tetrahydro-benzo[e][1,4]diazepin-5-onyl, 2,3,4,5-tetrahydro-1H-benzo[e][1,4]diazepinyl, 5,6,8,9-tetrahydro-7-oxa-benzocycloheptenyl, 2,3,4,5-tetrahydro-1H-benzo[b]azepinyl, 1,2,4,5-tetrahydro-benzo[e][1,3]diazepin-3-onyl, 3,4-dihydro-2H-benzo[b][1,4]dioxepinyl, 3,4-dihydro-2H-benzo[f][1,4]oxazepin-5-onyl, 6,7,8,9-tetrahydro-5-thia-8-aza-benzocycloheptenyl, 5,5-dioxo-6,7,8,9-tetrahydro-5-thia-8-aza-benzocycloheptenyl, and 2,3,4,5-tetrahydro-benzo[f][1,4]oxazepinyl. Suitably, a heteroaryl is a 5- or 6-membered heteroaryl ring comprising one, two or three heteroatoms selected from N, O or S.

(20) As used herein by themselves or in conjunction with another term or terms, “alkylheteroaryl” and “alkylheteroaryl group” refer to an alkyl group in which a hydrogen atom is replaced by a heteroaryl group, wherein alkyl group and heteroaryl group are as previously defined. Alkylheteroaryl groups can be substituted or unsubstituted. Where carbon numbers are provided, e.g. (C.sub.n-m)alkylheteroaryl, the range refers to the whole group. Suitably, the constituent alkyl group has 1-6 carbons, suitable 1-3 carbons.

(21) As used herein by themselves or in conjunction with another term or terms, “heterocyclic group” and “heterocycle” refer to monocyclic and polycyclic ring systems that contain carbon atoms and at least one heteroatom selected from nitrogen, oxygen, sulfur or phosphorus in the ring(s), without regard or reference to aromaticity or degree of unsaturation. Thus, a heterocyclic group should be understood as referring to and including ring systems that are fully saturated (such as, for example, a piperidinyl group), ring systems that are aromatic (such as, for example, a pyrindinyl group), as well as ring systems having fully saturated, aromatic and/or unsaturated portions (such as, for example, 1,2,3,6-tetrahydropyridinyl and 6,8-dihydro-5H-[1,2,4]triazolo[4,3-a]pyrizinyl). The terms heterocyclic and heterocycle further include bridged, fused, and spirocyclic ring systems.

(22) As used herein by themselves or in conjunction with another term or terms, “heterocycloalkyl” and “heterocycloalkyl group” refer to 3 to 15 membered monocyclic, bicyclic, and tricyclic non-aromatic ring systems, which contain, in addition to carbon atom(s), at least one heteroatom, such as nitrogen, oxygen, sulfur or phosphorus. Heterocycloalkyl groups may be fully saturated or contain unsaturated portions and may be bridged, spiro, and/or fused ring systems. In some instances a heterocycloalkyl group may contain at least two or heteroatoms, which may be the same or different. Heterocycloalkyl groups can be substituted or unsubstituted. In some instances a heterocycloalkyl group may contain from 3 to 10 ring atoms or from 3 to 7 ring atoms or from 5 to 7 ring atoms, such as 5 ring atoms, 6 ring atoms, or 7 ring atoms. Representative examples include, but are not limited to, tetrahydrofuranyl, pyrrolidinyl, pyrrolinyl, imidazolidinyl, imidazolinyl, pyrazolidinyl, pyrazolinyl, piperidyl, piperazinyl, indolinyl, isoindolinyl, morpholinyl, thiomorpholinyl, homomorpholinyl, homopiperidyl, homopiperazinyl, thiomorpholinyl-5-oxide, thiomorpholinyl-S,S-dioxide, pyrrolidinyl, tetrahydropyranyl, piperidinyl, tetrahydrothienyl, homopiperidinyl, homothiomorpholinyl-S,S-dioxide, oxazolidinonyl, dihydropyrazolyl, dihydropyrrolyl, dihydropyrazinyl, dihydropyridinyl, dihydropyrimidinyl, dihydrofuryl, dihydropyranyl, tetrahydrothienyl-5-oxide, tetrahydrothienyl-S,S-dioxide, homothiomorpholinyl-5-oxide, quinuclidinyl, 2-oxa-5-azabicyclo[2.2.1]heptanyl, 8-oxa-3-aza-bicyclo[3.2.1]octanyl, 3,8-diaza-bicyclo[3.2.1]octanyl, 2,5-diaza-bicyclo[2.2.]heptanyl, 3,8-diaza-bicyclo[3.2.1]octanyl, 3,9-diaza-bicyclo[4.2.1]nonanyl, 2,6-diaza-bicyclo[3.2.2]nonanyl, [1,4]oxaphosphinanyl-4-oxide, [1,4]azaphosphinanyl-4-oxide, [1,2]oxaphospholanyl-2-oxide, phosphinanyl-1-oxide, [1,3]azaphospholidinynl-3-oxide, [1,3]oxaphospholanyl-3-oxide, 7-oxabicyclo[2.2.1]heptanyl, 6,8-dihydro-5H-[1,2,4]triazolo[4,3-a]pyrazin-7-yl, 6,8-dihydro-5H-imidazo[1,5-a]pyrazin-7-yl, 6,8-dihydro-5H-imidazo[1,2-a]pyrazin-7-yl, 5,6,8,9-tetrahydro-[1,2,4]triazolo[4,3-d][1,4]diazepin-7-yl and 6,8-dihydro-5H-[1,2,4]triazolo[4,3-a]pyrazin-7-yl. Suitably, a heterocyclylalkyl group as defined herein is a monocyclic, bicyclic or spiro heterocyclyl group comprising one, two or three heteroatoms selected from N, O or S.

(23) As used herein by themselves or in conjunction with another term or terms, “heterocycloalkylene” and “heterocycloalkylene group” refer to 3 to 15 membered monocyclic, bicyclic, or tricyclic non-aromatic ring systems, which contain, in addition to carbon atom(s), at least one heteroatom, such as nitrogen, oxygen, sulfur or phosphorus. Heterocycloalkylene groups may be fully saturated or contain unsaturated portions and may be bridged, spiro, and/or fused. Heterocycloalkylene groups can be substituted or unsubstituted. In some instances, a heterocycloalkylene group may contain from 3 to 10 ring atoms; such as from 3 to 7 ring atoms. In other instances a heterocycloalkylene group may contain from 5 to 7 ring atoms, such as 5 ring atoms, 6 ring atoms, or 7 ring atoms.

(24) As used herein by themselves or in conjunction with another term or terms, “alkylheterocycloalkyl” and “alkylheterocycloalkyl group” refer to an alkyl group in which a hydrogen atom is replaced by a heterocycloalkyl group, wherein alkyl group and heterocycloalkyl group are as previously defined, such as, for example, pyrrolidinylmethyl (C.sub.4H.sub.8NCH.sub.2—). Alkylheteroycloalkyl groups can be substituted or unsubstituted. Where carbon numbers are provided, e.g. (C.sub.n-m)alkylheterocycloalkyl, the range refers to the whole group. Suitably, the constituent alkyl group has 1-6 carbons, suitable 1-3 carbons.

(25) As used herein by itself or in conjunction with another term or terms, “pharmaceutically acceptable” refers to materials that are generally chemically and/or physically compatible with other ingredients (such as, for example, with reference to a formulation), and/or is generally physiologically compatible with the recipient (such as, for example, a subject) thereof.

(26) As used herein by itself or in conjunction with another term or terms, “pharmaceutical composition” refers to a composition that can be used to treat a disease, condition, or disorder in a subject, including a human.

(27) As used herein by itself or in conjunction with another term or terms, “pseudohalogen” refers to —OCN, —SCN, —CF.sub.3, and —CN.

(28) As used herein by themselves or in conjunction with another term or terms, “stable” and “chemically stable” refer to a compound that is sufficiently robust to be isolated from a reaction mixture with a useful degree of purity. The present application is directed solely to the preparation of stable compounds. When lists of alternative substituents include members which, owing to valency requirements, chemical stability, or other reasons, cannot be used to substitute a particular group, the list is intended to be read in context to include those members of the list that are suitable for substituting the particular group. For example, when considering the degree of optional substitution of a particular moiety, it should be understood that the number of substituents does not exceed the valency appropriate for that moiety. For example, if R.sup.1 is a methyl group (—CH.sub.3), it can be optionally substituted by 1 to 3 R.sup.5.

(29) As used herein by themselves or in conjunction with another term or terms, “subject(s)” and “patient(s)”, suitably refer to mammals, in particular humans.

(30) As used herein by itself or in conjunction with another term or terms, “substituted” indicates that a hydrogen atom on a molecule has been replaced with a different atom or group of atoms and the atom or group of atoms replacing the hydrogen atom is a “substituent.” It should be understood that the terms “substituent”, “substituents”, “moiety”, “moieties”, “group”, or “groups” refer to substituent(s).

(31) As used herein by themselves or in conjunction with another term or terms, “therapeutic” and “therapeutically effective amount” refer to an amount a compound, composition or medicament that (a) inhibits or causes an improvement in a particular disease, condition or disorder; (b) attenuates, ameliorates or eliminates one or more symptoms of a particular disease, condition or disorder; (c) or delays the onset of one or more symptoms of a particular disease, condition or disorder described herein. It should be understood that the terms “therapeutic” and “therapeutically effective” encompass any one of the aforementioned effects (a)-(c), either alone or in combination with any of the others (a)-(c). It should be understood that in, for example, a human or other mammal, a therapeutically effective amount can be determined experimentally in a laboratory or clinical setting, or a therapeutically effective amount may be the amount required by the guidelines of the United States Food and Drug Administration (FDA) or equivalent foreign regulatory body, for the particular disease and subject being treated. It should be appreciated that determination of proper dosage forms, dosage amounts, and routes of administration is within the level of ordinary skill in the pharmaceutical and medical arts.

(32) As used herein whether by themselves or in conjunction with another term or terms, “treating”, “treated” and “treatment”, refer to and include prophylactic, ameliorative, palliative, and curative uses and results. In some embodiments, the terms “treating”, “treated”, and “treatment” refer to curative uses and results as well as uses and results that diminish or reduce the severity of a particular condition, characteristic, symptom, disorder, or disease described herein. For example, treatment can include diminishment of several symptoms of a condition or disorder or complete eradication of said condition or disorder. It should be understood that the term “prophylactic” as used herein is not absolute but rather refers to uses and results where the administration of a compound or composition diminishes the likelihood or seriousness of a condition, symptom, or disease state, and/or delays the onset of a condition, symptom, or disease state for a period of time.

(33) As used herein, a “therapeutically active agent”, whether used alone or in conjunction with another term or terms, refers to any compound, i.e. a drug, that has been found to be useful in the treatment of a disease, disorder or condition and is not described by Formula I. It should be understood that a therapeutically active agent may not be approved by the FDA or an equivalent foreign regulatory body.

(34) A “therapeutically effective amount” means the amount of a compound that, when administered to a subject or patient for treating a disease, is sufficient to effect such treatment for the disease. The “therapeutically effective amount” will vary depending on the compound, the disease and its severity and the age, weight, etc., of the subject or patient to be treated.

(35) Compounds

(36) In one aspect, the present invention relates to compounds of Formula I:

(37) ##STR00002##
or a salt or solvate thereof, wherein,

(38) A represents a fused aromatic ring selected from,

(39) ##STR00003##

(40) X.sup.1, X.sup.2 and X.sup.3 are independently selected from N and CH; Q is a group selected from an C.sub.3-11cycloalkyl optionally substituted by one or more R.sup.b, 3-15 membered heterocycloalkyl optionally substituted by one or more R.sup.b, C.sub.6-11 aryl group optionally substituted with by one or more R.sup.b, 5-15 membered heteroaryl optionally substituted by one or more R.sup.b;

(41) R.sup.6 is selected from hydrogen and C.sub.1-6 alkyl;

(42) R.sup.7 and R.sup.7′ are independently selected from hydrogen, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, where said C.sub.3-6 cycloalkyl and C.sub.1-6 alkyl are optionally substituted by one or more R.sup.a; or

(43) R.sup.7 and R.sup.7′, together with the carbon to which they are attached form a 3-7 membered cycloalkyl ring, optionally substituted with one or more R.sup.a, or R.sup.7 and R.sup.7′, together with the carbon to which they are attached form a carbonyl group; or

(44) R.sup.6 and R.sup.7, together with the atoms to which they are attached form a 3-7 membered heterocyclic ring, optionally substituted with one or more R.sup.a;

(45) n is a number selected from 1, 2 and 3;

(46) R.sup.2 is selected from —CN, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —C(O)C(═O)R.sup.d, —NR.sup.cR.sup.d, —NR.sup.c(C.sub.1-6alkyl)NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —NR.sup.cC(═O)OR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d, —OC(═O)R.sup.d, —OC(═O)NR.sup.cR.sup.d, —OC(═O)OR.sup.d, —S(═O)R.sup.d, —S(═O).sub.2R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, —S(═O).sub.2NR.sup.cR.sup.d, C.sub.1-10 haloalkyl, C.sub.1-10alkyl optionally substituted by one or more R.sup.e, C.sub.2-6alkenyl optionally substituted by one or more R.sup.e, C.sub.2-6alkynyl optionally substituted by one or more R.sup.e, C.sub.6-11aryl optionally substituted by one or more R.sup.e, (C.sub.7-16)alkylaryl optionally substituted by one or more R.sup.e, C.sub.3-11cycloalkyl optionally substituted by one or more R.sup.e, (C.sub.4-17)cycloalkylalkyl optionally substituted by one or more R.sup.e, 3-15 membered heterocycloalkyl optionally substituted by one or more R.sup.e, 4-21 membered alkylheterocycloalkyl optionally substituted by one or more R.sup.e, 5-15 membered heteroaryl optionally substituted by one or more R.sup.e, and 6-21 membered alkylheteroaryl optionally substituted by one or more R.sup.e;

(47) each R.sup.a is independently selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, wherein said C.sub.3-6 cycloalkyl and 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(48) each R.sup.b and R.sup.e is independently selected from hydroxyl, ═O, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —C(O)C(═O)R.sup.d, —NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —NR.sup.cC(═O)OR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d, —OC(═O)R.sup.d, —OC(═O)NR.sup.cR.sup.d, —OC(═O)OR.sup.d, —S(═O).sub.2R.sup.d, —S(═O)R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, and —S(═O).sub.2NR.sup.cR.sup.d, where said C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, and 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, ═O, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(49) each R.sup.c is independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(50) each R.sup.d is independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, 3-7 membered heterocycloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, amino, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl; or

(51) R.sup.c and R.sup.d, when attached to the same atom, together with the atom to which they are attached form a 3-7 membered ring, optionally containing one or more for heteroatoms selected from O, NH and S, and wherein said ring is optionally substituted with one or more R.sup.a;

(52) R.sup.3, R.sup.4 and R.sup.5 are independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, phenyl and cyclopropyl, wherein said C.sub.1-6 alkyl, phenyl and cyclopropyl are optionally substituted by one or more R.sup.a;

(53) with the provisos that:

(54) (i) when X.sup.1 is N, X.sup.2 and X.sup.3 cannot both be CH;

(55) (ii) when Q is phenyl, R.sup.b is not such that Q is a 3,4-di-O—C.sub.1-6 alkyl phenyl, a 3,5-di-O—C.sub.1-6 alkyl phenyl or a 3,4,5-tri-O—C.sub.1-6 alkyl phenyl; and

(56) (iii) the compound of Formula (I) is not

(57) N-(4-fluorobenzyl)-2-(piperidinyl-1-yl)pyrido[2,3-d]pyrimidin-4-amine, N-(4-fluorobenzyl)-2-(piperidinyl-1-yl)pyrido[3,2-d]pyrimidin-4-amine, N-(4-fluorobenzyl)-2-(piperidinyl-1-yl)thieno[3,2-d]pyrimidin-4-amine.

(58) The invention will now be further described by way of the following numbered paragraphs:

(59) 1. A compound of Formula I, or a salt or solvate thereof, wherein,

(60) A represents a fused aromatic ring selected from,

(61) ##STR00004##

(62) X.sup.1, X.sup.2 and X.sup.3 are independently selected from N and CH; Q is a group selected from an C.sub.3-11cycloalkyl optionally substituted by 1-21 R.sup.b, 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.b, C.sub.6-11 aryl group optionally substituted with by 1-11 R.sup.b, 5-15 membered heteroaryl optionally substituted by 1-15 R.sup.b;

(63) R.sup.6 is selected from hydrogen and C.sub.1-6 alkyl;

(64) R.sup.7 and R.sup.7′ are independently selected from hydrogen, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, where said C.sub.3-6 cycloalkyl and C.sub.1-6 alkyl are optionally substituted by one or more R.sup.a; or

(65) R.sup.7 and R.sup.7′, together with the carbon to which they are attached form a 3-7 membered cycloalkyl ring, optionally substituted with one or more R.sup.8, or R.sup.7 and R.sup.7′, together with the carbon to which they are attached form a carbonyl group; or

(66) R.sup.6 and R.sup.7, together with the atoms to which they are attached form a 3-7 membered heterocyclic ring, optionally substituted with one or more R.sup.a;

(67) n is a number selected from 1, 2 and 3;

(68) R.sup.2 is selected from —CN, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —C(O)C(═O)R.sup.d, —NR.sup.cR.sup.d, —NR.sup.c(C.sub.1-6alkyl)NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —NR.sup.cC(═O)OR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d, —OC(═O)R.sup.d, —OC(═O)NR.sup.cR.sup.d, —OC(═O)OR.sup.d, —S(═O)R.sup.d, —S(═O).sub.2R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, —S(═O).sub.2NR.sup.cR.sup.d, C.sub.1-10 haloalkyl, C.sub.1-10alkyl optionally substituted by 1-13 R.sup.e, C.sub.2-6alkenyl optionally substituted by 1-11 R.sup.e, C.sub.2-6alkynyl optionally substituted by 1-9 R.sup.e, C.sub.6-11aryl optionally substituted by 1-11 R.sup.e, (C.sub.7-16)alkylaryl optionally substituted by 1-9 R.sup.e, C.sub.3-11 cycloalkyl optionally substituted by 1-21 R.sup.e, (C.sub.4-17)cycloalkylalkyl optionally substituted by 1-32 R.sup.e, 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.e, 4-21 membered alkylheterocycloalkyl optionally substituted by 1-40 R.sup.e, 5-15 membered heteroaryl optionally substituted by 1-15 R.sup.e, and 6-21 membered heteroarylalkyl optionally substituted by 1-27 R.sup.e;

(69) each R.sup.a is independently selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, wherein said C.sub.3-6 cycloalkyl and 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(70) each R.sup.b and R.sup.e is independently selected from hydroxyl, ═O, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —C(O)C(═O)R.sup.d, —NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —NR.sup.cC(═O)OR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d, —OC(═O)R.sup.d, —OC(═O)NR.sup.cR.sup.d, —OC(═O)OR.sup.d, —S(═O).sub.2R.sup.d, —S(═O)R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, and —S(═O).sub.2NR.sup.cR.sup.d, where said C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, and 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, ═O, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(71) each R.sup.c is independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(72) each R.sup.d is independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, 3-7 membered heterocycloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, amino, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl; or

(73) R.sup.c and R.sup.d, when attached to the same atom, together with the atom to which they are attached form a 3-7 membered ring, optionally containing one or more for heteroatoms selected from O, NH and S, and wherein said ring is optionally substituted with one or more R.sup.a;

(74) R.sup.3, R.sup.4 and R.sup.5 are independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, phenyl and cyclopropyl, wherein said C.sub.1-6 alkyl, phenyl and cyclopropyl are optionally substituted by one or more R.sup.e;

(75) with the provisos that:

(76) (i) when X.sup.1 is N, X.sup.2 and X.sup.3 cannot both be CH;

(77) (ii) when Q is phenyl, R.sup.b is not such that Q is a 3,4-di-O—C.sub.1-6 alkyl phenyl, a 3,5-di-O—C.sub.1-6 alkyl phenyl or a 3,4,5-tri-O—C.sub.1-6 alkyl phenyl; and

(78) (iii) the compound of Formula (I) is not

(79) N-(4-fluorobenzyl)-2-(piperidinyl-1-yl)pyrido[2,3-d]pyrimidin-4-amine, N-(4-fluorobenzyl)-2-(piperidinyl-1-yl)pyrido[3,2-d]pyrimidin-4-amine, N-(4-fluorobenzyl)-2-(piperidinyl-1-yl)thieno[3,2-d]pyrimidin-4-amine.
2. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein A is

(80) ##STR00005##
3. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein X.sup.1 is N.
4. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein one of X.sup.2 and X.sup.3 is N and the other is CH.
5. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein X.sup.2 is CH and X.sup.3 is N.
6. A compound according to any one of paragraphs 1 to 3, or a salt or solvate thereof, wherein X.sup.1 is N and A is selected from

(81) ##STR00006##
7. A compound according to any one of paragraphs 1 to 3, or a salt or solvate thereof, wherein A is

(82) ##STR00007##
8. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein Q is a group selected from a 3-15 membered heterocycloalkyl optionally substituted by one or more R.sup.b, C.sub.6-11 aryl group optionally substituted with by one or more R.sup.b, and a 5-15 membered heteroaryl optionally substituted by one or more R.sup.b.
9. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein Q is a group selected from a 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.b, C.sub.6-11 aryl group optionally substituted with by 1-11 R.sup.b, and a 5-15 membered heteroaryl optionally substituted by 1-15 R.sup.b.
10. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein Q is a group selected from a C.sub.6-11 aryl group optionally substituted with by 1-11 R.sup.b and a 5-15 membered heteroaryl optionally substituted by 1-15 R.sup.b.
11. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein Q is a group selected from a C.sub.6 aryl group optionally substituted with by one or more R.sup.b and a 5-6 membered heteroaryl optionally substituted by one or more R.sup.b.
12. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein Q is selected from a phenyl or pyridyl group optionally substituted with 1-5 R.sup.b.
13. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein Q is a group of Formula III (wherein the dotted line indicates the point of attachment):

(83) ##STR00008##
wherein

(84) X.sup.4 is selected from CH and N;

(85) m is selected from 0, 1 and 2; and

(86) R.sup.b is as previously defined.

(87) 14. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein Q is a group of Formula IIIa:

(88) ##STR00009##
wherein

(89) X.sup.4 is selected from CH and N, suitably N; and

(90) R.sup.b is as previously defined.

(91) 15. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein each R.sup.b is independently selected from hydroxyl, ═O, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, —NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —OR.sup.d, —SR.sup.d, —S(═O).sub.2R.sup.d, —S(═O)R.sup.d, —S(═O)NR.sup.cR.sup.d, and —S(═O).sub.2NR.sup.cR.sup.d, where said C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, and 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, ═O, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
16. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein each R.sup.b is independently selected from hydroxyl, ═O, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, —NR.sup.cR.sup.d, and —S(═O).sub.2R.sup.d, where said C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, and 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, ═O, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
17. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein each R.sup.b is independently selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
18. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein each R.sup.b is independently selected from fluoro, chloro, and CF.sub.3.
19. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein Q is selected from:

(92) ##STR00010##
20. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein R.sup.6 is selected from hydrogen, methyl and ethyl.
21. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein R.sup.6 is selected from hydrogen and methyl.
22. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein R.sup.7 and R.sup.7′ are independently selected from hydrogen, methyl and cyclopropyl.
23. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein R.sup.7 and R.sup.7′ are independently selected from hydrogen and methyl.
24. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein R.sup.7′ is hydrogen.
25. A compound according to any one of paragraphs 1 to 21, or a salt or solvate thereof, wherein R.sup.7 and R.sup.7′, together with the atom to which they are attached form a C.sub.3-6 cycloalkyl ring, optionally substituted by one or more R.sup.a.
26. A compound according to any one of paragraphs 1 to 21, or a salt or solvate thereof, wherein R.sup.7 and R.sup.7′, together with the atom to which they are attached form a cyclopropyl ring, optionally substituted by one or more R.sup.a.
27. A compound according to any one of paragraphs 1 to 24 wherein R.sup.6 and R.sup.7′ are both hydrogen.
28. A compound according to any one of paragraphs 1 to 24 wherein R.sup.6, R.sup.7 and R.sup.7′ are each hydrogen.
29. A compound according to any one of paragraphs 1 to 19, or a salt or solvate thereof, wherein R.sup.6 and R.sup.7 together with the atoms to which they are attached form an azetidinyl, pyrrolidinyl, piperidinyl or morpholinyl ring.
30. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein n is 1 or 2.
31. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein n is 1.
32. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein R.sup.2 is selected from —CN, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —C(O)C(═O)R.sup.d, —NR.sup.cR.sup.d, —NR.sup.c(C.sub.1-6alkyl)NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —NR.sup.cC(═O)OR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d—OC(═O)R.sup.d, —OC(═O)NR.sup.cR.sup.d, —OC(═O)OR.sup.d, —S(═O)R.sup.d, —S(═O).sub.2R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, —S(═O).sub.2NR.sup.cR.sup.d, C.sub.1-10 haloalkyl, C.sub.1-10alkyl optionally substituted by 1-13 R.sup.e, C.sub.2-6alkenyl optionally substituted by 1-11 R.sup.e, C.sub.2-6alkynyl optionally substituted by 1-9 R.sup.e, C.sub.6-11aryl optionally substituted by 1-11 R.sup.e, (C.sub.7-16)alkylaryl optionally substituted by 1-9 R.sup.e, C.sub.3-11cycloalkyl optionally substituted by 1-21 R.sup.e, (C.sub.4-17)cycloalkylalkyl optionally substituted by 1-32 R.sup.e, 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.e, 4-21 membered alkylheterocycloalkyl optionally substituted by 1-40 R.sup.e, 5-15 membered heteroaryl optionally substituted by 1-15 R.sup.e, and 6-21 membered alkylheteroaryl optionally substituted by 1-27 R.sup.e;
33. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein R.sup.2 is selected from —CN, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —C(O)C(═O)R.sup.d, —NR.sup.cR.sup.d, —NR.sup.c(C.sub.1-6alkyl)NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —NR.sup.cC(═O)OR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d—OC(═O)R.sup.d, —OC(═O)NR.sup.cR.sup.d, —OC(═O)OR.sup.d, —S(═O)R.sup.d, —S(═O).sub.2R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, —S(═O).sub.2NR.sup.cR.sup.d, C.sub.1-10 haloalkyl, C.sub.1-10alkyl optionally substituted by 1-13 R.sup.e, C.sub.2-6alkenyl optionally substituted by 1-11 R.sup.e, C.sub.2-6alkynyl optionally substituted by 1-9 R.sup.e, C.sub.6-11aryl optionally substituted by 1-11 R.sup.e, (C.sub.7-16)alkylaryl optionally substituted by 1-9 R.sup.e, C.sub.3-11cycloalkyl optionally substituted by 1-21 R.sup.e, (C.sub.4-17)cycloalkylalkyl optionally substituted by 1-32 R.sup.e, 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.e, 4-21 membered alkylheterocycloalkyl optionally substituted by 1-40 R.sup.e, 5-15 membered heteroaryl optionally substituted by 1-15 R.sup.e, and 6-21 membered alkylheteroaryl optionally substituted by 1-27 R.sup.e;
34. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein R.sup.2 is selected from —CN, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —NR.sup.cR.sup.d, —NR(C.sub.1-6alkyl)NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d—OC(═O)R.sup.d, —S(═O)R.sup.d, —S(═O).sub.2R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, —S(═O).sub.2NR.sup.cR.sup.d, C.sub.1-10 haloalkyl, C.sub.1-10alkyl optionally substituted by 1-13 R.sup.e, C.sub.6-11aryl optionally substituted by 1-11 R.sup.e, C.sub.3-11cycloalkyl optionally substituted by 1-21 R.sup.e, 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.e, and 5-15 membered heteroaryl optionally substituted by 1-15 R.sup.e.
35. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein R.sup.2 is selected from —CN, —C(═O)R.sup.d, C(═O)NR.sup.cR.sup.d, —NR.sup.cR.sup.d, —NR.sup.c(C.sub.1-6alkyl)NR.sup.cR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d, —S(═O).sub.2R.sup.d, C.sub.1-10 haloalkyl, C.sub.1-10alkyl optionally substituted by 1-13 R.sup.e, C.sub.6-11aryl optionally substituted by 1-11 R.sup.e, C.sub.3-11cycloalkyl optionally substituted by 1-21 R.sup.e, 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.e, and 5-15 membered heteroaryl optionally substituted by 1-15 R.sup.e.
36. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein R.sup.2 is selected from NR.sup.cR.sup.d, —NR.sup.c(C.sub.1-6alkyl)NR.sup.cR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d, C.sub.1-10 haloalkyl, C.sub.1-10alkyl optionally substituted by 1-13 R.sup.e, C.sub.6-11aryl optionally substituted by 1-11 R.sup.e, C.sub.3-11cycloalkyl optionally substituted by 1-21 R.sup.e, 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.e, and 5-15 membered heteroaryl optionally substituted by 1-15 R.sup.e.
37. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein R.sup.2 is selected from NR.sup.cR.sup.d, —NR(C.sub.1-6alkyl)NR.sup.cR.sup.d, C.sub.1-10alkyl optionally substituted by 1-13 R.sup.e, C.sub.6-11aryl optionally substituted by 1-11 R.sup.e, C.sub.3-11cycloalkyl optionally substituted by 1-21 R.sup.e, 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.e, and 5-15 membered heteroaryl optionally substituted by 1-15 R.sup.e.
38. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein R.sup.2 is selected from NR.sup.cR.sup.d, —NR.sup.c(C.sub.1-6alkyl)NR.sup.cR.sup.d, C.sub.1-10alkyl optionally substituted by 1-13 R.sup.e, and 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.e. Suitably, R.sup.c is C.sub.1-6 alkyl, and R.sup.d is independently selected from C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
39. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein R.sup.2 is selected from NR.sup.cR.sup.d and a 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.e. Suitably, R.sup.c is C.sub.1-6alkyl, and R.sup.d is independently selected from C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
40. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein R.sup.2 is selected from NR.sup.cR.sup.d and a 5-10 membered heterocycloalkyl optionally substituted by one or more R.sup.e. Suitably, R.sup.c is C.sub.1-6 alkyl, and R.sup.d is independently selected from C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
41. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein R.sup.2 is selected from NR.sup.cR.sup.d and a 5-7 membered heterocycloalkyl optionally substituted by one or more R.sup.e. Suitably, R.sup.c is C.sub.1-6 alkyl, and R.sup.d is independently selected from C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
42. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein R.sup.2 is selected from NR.sup.cR.sup.d, azetidinyl, pyrrolidinyl, piperidinyl, piperazinyl and morpholinyl, wherein said azetidinyl, pyrrolidinyl, piperidinyl, piperazinyl and morpholinyl are optionally substituted by one or more R.sup.e. Suitably, R.sup.c is C.sub.1-6 alkyl, and R.sup.d is independently selected from C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
43. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein R.sup.2 is selected from NR.sup.cR.sup.d; and

(93) ##STR00011##
each of which may optionally be substituted with one or more R.sup.e. Suitably, R.sup.c is C.sub.1-6 alkyl, and R.sup.d is independently selected from C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
44. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein R.sup.2 is selected from

(94) ##STR00012##
each of which may optionally be substituted with one or more R.sup.e.
45. A compound according to any one of paragraphs 1 to 43, or a salt or solvate thereof, wherein R.sup.2 is selected from

(95) ##STR00013##
46. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein R.sup.e is independently selected from hydroxyl, ═O, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, —NR.sup.cR.sup.d, where said C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, and 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, ═O, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
47. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein R.sup.e is independently selected from hydroxyl, ═O, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
48. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein R.sup.e is independently selected from halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
49. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein R.sup.e is independently selected from halogen, CN, C.sub.1-3 haloalkyl, C.sub.1-3 haloalkoxy, C.sub.1-3 alkyl and O—C.sub.1-3 alkyl.
50. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein R.sup.e is independently selected from fluoro, chloro, CN, CF.sub.3, OCF.sub.3 and C.sub.1-3 alkyl.
51. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein each R.sup.e is independently selected from fluoro, chloro, CN, CF.sub.3, OCF.sub.3, and methyl.
52. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein each R.sup.c is independently selected from hydrogen, hydroxyl, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;
53. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein each R.sup.c is independently selected from hydrogen and C.sub.1-6 alkyl, suitably C.sub.1-6 alkyl.
54. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein each R.sup.c is independently selected from hydrogen and C.sub.1-3 alkyl, suitably C.sub.1-3 alkyl.
55. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein each R.sup.d is independently selected from hydrogen, 3-7 membered heterocycloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
56. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein each R.sup.d is independently selected from 3-7 membered heterocycloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
57. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein each R.sup.d is independently selected from C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
58. A compound according to any one of the preceding paragraphs, or a salt or solvate thereof, wherein R.sup.c and R.sup.d are independently selected from C.sub.1-6 alkyl.
59. A compound according to any one of the preceding paragraphs wherein R.sup.3, R.sup.4 and R.sup.5 are independently selected from hydrogen, halogen and C.sub.1-6 alkyl.
60. A compound according to any one of the preceding paragraphs wherein R.sup.3 is H.
61. A compound according to any one of the preceding paragraphs wherein R.sup.4 is H.
62. A compound according to any one of the preceding paragraphs wherein R.sup.5 is H.
63. A compound according to any one of the preceding paragraphs wherein R.sup.4 and R.sup.5 are H.
64. A compound according to any one of the preceding paragraphs wherein R.sup.3, R.sup.4 and R.sup.5 are H.
65. A compound according to paragraph 1, or a salt or solvate thereof, which is a sub-Formula Ia:

(96) ##STR00014##
wherein,

(97) R.sup.6 is selected from hydrogen and C.sub.1-6 alkyl;

(98) R.sup.7 is selected from hydrogen, ═O, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, where said C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl are optionally substituted by one or more R.sup.a; or

(99) R.sup.6 and R.sup.7, together with the atoms to which they are attached form a 3-7 membered heterocyclic ring, optionally substituted with one or more R.sup.a;

(100) R.sup.2 is selected from —CN, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —C(O)C(═O)R.sup.d, —NR.sup.cR.sup.d, —NR.sup.c(C.sub.1-6alkyl)NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —NR.sup.cC(═O)OR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d—OC(═O)R.sup.d, —OC(═O)NR.sup.cR.sup.d, —OC(═O)OR.sup.d, —S(═O)R.sup.d, —S(═O).sub.2R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, —S(═O).sub.2NR.sup.cR.sup.d, C.sub.1-10 haloalkyl, C.sub.1-10alkyl optionally substituted by 1-13 R.sup.e, C.sub.2-6alkenyl optionally substituted by 1-11 R.sup.e, C.sub.2-6alkynyl optionally substituted by 1-9 R.sup.e, C.sub.6-11aryl optionally substituted by 1-11 R.sup.e, (C.sub.7-16)alkylaryl optionally substituted by 1-9 R.sup.e, C.sub.3-11 cycloalkyl optionally substituted by 1-21 R.sup.e, (C.sub.4-17)cycloalkylalkyl optionally substituted by 1-32 R.sup.e, 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.e, 4-21 membered alkylheterocycloalkyl optionally substituted by 1-40 R.sup.e, 5-15 membered heteroaryl optionally substituted by 1-15 R.sup.e, and 6-21 membered alkylheteroaryl optionally substituted by 1-27 R.sup.e;

(101) each R.sup.a is independently selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, wherein said C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(102) each R.sup.b and R.sup.e is independently selected from hydroxyl, ═O, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —C(O)C(═O)R.sup.d, —NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —NR.sup.cC(═O)OR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d, —OC(═O)R.sup.d, —OC(═O)NR.sup.cR.sup.d, —OC(═O)OR.sup.d, —S(═O).sub.2R.sup.d, —S(═O)R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, and —S(═O).sub.2NR.sup.cR.sup.d, where said C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, and 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, ═O, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(103) each R.sup.c is independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(104) each R.sup.d is independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, 3-7 membered heterocycloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl, C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, ═O, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl; or

(105) R.sup.c and R.sup.d, when attached to the same atom, together with the atom to which they are attached form a 3-7 membered ring, optionally substituted with one or more R.sup.a; and

(106) R.sup.4 and R.sup.5 are independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, and C.sub.1-6 alkyl; optionally substituted by one or more R.sup.a.

(107) 66. A compound according to paragraph 65, or a salt or solvate thereof, wherein R.sup.4 and R.sup.5 are hydrogen.

(108) 67. A compound according to any one of paragraphs 65 and 66, or a salt or solvate thereof, wherein each R.sup.b is independently selected from fluoro, chloro, and CF.sub.3.

(109) 68. A compound according to any one of paragraphs 65 to 67 wherein R.sup.6 and R.sup.7 are both hydrogen.

(110) 69. A compound according to any one of paragraphs 65 to 68, or a salt or solvate thereof, wherein R.sup.2 is selected from —CN, —C(═O)R.sup.d, C(═O)NR.sup.cR.sup.d, —NR.sup.cR.sup.d, —NR.sup.c(C.sub.1-6alkyl)NR.sup.cR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d, —S(═O).sub.2R.sup.d, C.sub.1-10 haloalkyl, C.sub.1-10alkyl optionally substituted by 1-13 R.sup.e, C.sub.6-11aryl optionally substituted by 1-11 R.sup.e, C.sub.3-11cycloalkyl optionally substituted by 1-21 R.sup.e, 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.e, and 5-15 membered heteroaryl optionally substituted by 1-15 R.sup.e. Suitably, R.sup.c is C.sub.1-6 alkyl, and R.sup.d is independently selected from C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
70. A compound according to any one of paragraphs 65 to 69, or a salt or solvate thereof, wherein R.sup.2 is selected from NR.sup.cR.sup.d, —NR.sup.c(C.sub.1-6alkyl)NR.sup.cR.sup.d, C.sub.1-10alkyl optionally substituted by 1-13 R.sup.e, and 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.e. Suitably, R.sup.c is C.sub.1-6alkyl, and R.sup.d is independently selected from C.sub.3-6 cycloalkyl, C.sub.1-6alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
71. A compound according to any one of paragraphs 65 to 70, or a salt or solvate thereof, wherein R.sup.2 is selected from NR.sup.cR.sup.d; and

(111) ##STR00015##
each of which may optionally be substituted with one or more R.sup.e. Suitably, R.sup.c is C.sub.1-6 alkyl, and R.sup.d is independently selected from C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
72. A compound according to any one of paragraphs 65 to 71, or a salt or solvate thereof, wherein R.sup.2 is selected from

(112) ##STR00016##
each of which may optionally be substituted with one or more R.sup.e.
73. A compound according to any one of paragraphs 65 to 72, or a salt or solvate thereof, wherein R.sup.2 is selected from

(113) ##STR00017##
74. A compound according to any one of paragraphs 65 to 72, or a salt or solvate thereof, wherein each R.sup.e is independently selected from fluoro, chloro, CN, CF.sub.3, OCF.sub.3, and methyl.
75. A compound according to any one of paragraphs 65 to 74, or a salt or solvate thereof, wherein R.sup.c and R.sup.d are independently selected from C.sub.1-6 alkyl.
76. A compound, or a salt or solvate thereof, selected from: 2-chloro-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine N.sup.2-isopropyl-N.sup.4-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.4-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidine-2,4-diamine methanesulfonate 2-chloro-N-(2-fluorobenzyl)thieno[3,2-d]pyrimidin-4-amine N.sup.4-(2-fluorobenzyl)-N.sup.2-isopropylthieno[3,2-d]pyrimidine-2,4-diamine N.sup.4-benzyl-N.sup.2-isopropylthieno[3,2-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.4-(4-methoxybenzyl)thieno[3,2-d]pyrimidine-2,4-diamine N.sup.4-(3-fluorobenzyl)-N.sup.2-isopropylthieno[3,2-d]pyrimidine-2,4-diamine N.sup.4-(4-fluorobenzyl)-N.sup.2-isopropylthieno[3,2-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.4-(3-methoxybenzyl)thieno[3,2-d]pyrimidine-2,4-diamine N.sup.4-(2-chlorobenzyl)-N.sup.2-isopropylthieno[3,2-d]pyrimidine-2,4-diamine N.sup.4-(3-chlorobenzyl)-N.sup.2-isopropylthieno[3,2-d]pyrimidine-2,4-diamine N.sup.4-(4-chlorobenzyl)-N.sup.2-isopropylthieno[3,2-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.4-(2-methoxybenzyl)thieno[3,2-d]pyrimidine-2,4-diamine 2-chloro-N-(2-chlorobenzyl)thieno[3,2-d]pyrimidin-4-amine N-(2-fluorobenzyl)thieno[3,2-d]pyrimidin-4-amine N-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine N-(2-(trifluoromethoxy)benzyl)thieno[3,2-d]pyrimidin-4-amine N.sup.4-((2,2-difluorobenzo[d][1,3]dioxol-5-yl)methyl)-N.sup.2-isopropylthieno[3,2-d]pyrimidine-2,4-diamine N.sup.4-(2-fluoro-3-methoxybenzyl)-N.sup.2-isopropylthieno[3,2-d]pyrimidine-2,4-diamine N.sup.4-(2,6-dichlorobenzyl)-N.sup.2-isopropylthieno[3,2-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.4-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.4-(2-(trifluoromethoxy)benzyl)thieno[3,2-d]pyrimidine-2,4-diamine N.sup.4-(2-chloro-6-fluorobenzyl)-N.sup.2-isopropylthieno[3,2-d]pyrimidine-2,4-diamine N-(2,4-dimethylphenyl)thieno[3,2-d]pyrimidin-4-amine N.sup.4-(2,4-dimethylphenyl)-N.sup.2-isopropylthieno[3,2-d]pyrimidine-2,4-diamine N.sup.4-(2-chlorobenzyl)-N.sup.2-isopropyl-N.sup.2-methylthieno[3,2-d]pyrimidine-2,4-diamine 1-(3-(thieno[3,2-d]pyrimidin-4-ylamino)propyl)pyrrolidin-2-one 1-(3-((2-((2-methoxybenzyl)amino)thieno[3,2-d]pyrimidin-4-yl)amino)propyl)pyrrolidin-2-one 1-(3-((2-(benzyl(methyl)amino)thieno[3,2-d]pyrimidin-4-yl)amino)propyl)pyrrolidin-2-one N-(thieno[3,2-d]pyrimidin-4-yl)-2-(trifluoromethyl)benzamide N-(1-(2-chlorophenyl)ethyl)thieno[3,2-d]pyrimidin-4-amine 2-chloro-N-(thieno[3,2-d]pyrimidin-4-yl)benzamide N.sup.2-(tert-butyl)-N.sup.4-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidine-2,4-diamine N.sup.2-(2,2,2-trifluoroethyl)-N.sup.4-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidine-2,4-diamine N.sup.2-cyclopropyl-N.sup.4-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidine-2,4-diamine N-methyl-N-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine N.sup.2-isopropyl-N.sup.4-(2-(trifluoromethyl) phenethyl)thieno[3,2-d]pyrimidine-2,4-diamine 2-chloro-N-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine 2-chloro-N-(1-(2-chlorophenyl)cyclopropyl)thieno[3,2-d]pyrimidin-4-amine N.sup.4-(1-(2-chlorophenyl)cyclopropyl)-N.sup.2-isopropylthieno[3,2-d]pyrimidine-2,4-diamine 2-chloro-N-methyl-N-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine N.sup.2-isopropyl-N.sup.4-methyl-N.sup.4-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidine-2,4-diamine N-(3-methoxy-2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine 2-chloro-N-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidin-4-amine N.sup.2-isopropyl-N.sup.4-(1-(2-(trifluoromethyl)phenyl)e)thieno[3,2-d]pyrimidine-2,4-diamine N-ethyl-N-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine 2-methyl-N-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine 2-(trifluoromethyl)-N-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine 2-chloro-N-(2-(trifluoromethyl)benzyl)quinazolin-4-amine N.sup.2-isopropyl-N.sup.4-(2-(trifluoromethyl)benzyl)quinazoline-2,4-diamine N.sup.2-isopropyl-N.sup.4-(2-(trifluoromethyl)phenyl)thieno[3,2-d]pyrimidine-2,4-diamine N-(4-fluoro-2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine N-((3-(trifluoromethyl)pyridin-2-yl)methyl)thieno[3,2-d]pyrimidin-4-amine N-methyl-2-(trifluoromethyl)-N-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine N,2-dimethyl-N-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine N,6-dimethyl-2-(trifluoromethyl)-N-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine 2-methyl-N-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidin-4-amine N,2-dimethyl-N-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidin-4-amine 2-chloro-N-methyl-N-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidin-4-amine 2-methoxy-N-methyl-N-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidin-4-amine N,2,6-trimethyl-N-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidin-4-amine 2-(2-methyl-4-(methyl(1-(2-(trifluoromethyl)phenyl)ethyl)amino)thieno[3,2-d]pyrimidin-6-yl)propan-2-ol N-(4-fluoro-2-(trifluoromethyl)benzyl)quinazolin-4-amine N-(4-fluoro-2-(trifluoromethyl)benzyl)-2-methylquinazolin-4-amine 4-(methyl(1-(2-(trifluoromethyl)phenyl)ethyl)amino)thieno[3,2-d]pyrimidine-2-carbonitrile N-(4-fluoro-2-(trifluoromethyl)benzyl)-N-methylquinazolin-4-amine 1-(3-((4-((2-(trifluoromethyl)benzyl)amino)thieno[3,2-d]pyrimidin-2-yl)amino)propyl)pyrrolidin-2-one N.sup.2-(2-(dimethylamino)ethyl)-N.sup.4-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidine-2,4-diamine N.sup.2-(2-morpholinoethyl)-N.sup.4-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidine-2,4-diamine N.sup.2-(2-(pyrrolidin-1-yl)ethyl)-N.sup.4-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidine-2,4-diamine N.sup.2-(2-(4-methylpiperazin-1-yl)ethyl)-N.sup.4-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidine-2,4-diamine 2-(pyrrolidin-1-yl)-N-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine 2-morpholino-N-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine 2-(4-methylpiperazin-1-yl)-N-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine 6-iodo-N-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidin-4-amine N-(2-(methylsulfonyl)benzyl)thieno[3,2-d]pyrimidin-4-amine 6-phenyl-N-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidin-4-amine 6-cyclopropyl-N-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidin-4-amine 6-(1-methyl-1H-pyrazol-4-yl)-N-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidin-4-amine 4-((1-(2-(trifluoromethyl)phenyl)ethyl)amino)thieno[3,2-d]pyrimidine-6-carbonitrile N-((2-(trifluoromethyl)pyridin-3-yl)methyl)thieno[3,2-d]pyrimidin-4-amine 2-(((2-chlorothieno[3,2-d]pyrimidin-4-yl)amino)methyl)benzonitrile 7-methyl-N-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidin-4-amine 7-bromo-N-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidin-4-amine N-(2-(trifluoromethyl)benzyl)thieno[2,3-d]pyrimidin-4-amine 4-((1-(2-(trifluoromethyl)phenyl)ethyl)amino)thieno[3,2-d]pyrimidine-7-carbonitrile N.sup.2-isopropyl-N.sup.4-(4-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.4-(4-(methylsulfonyl)benzyl)quinazoline-2,4-diamine N.sup.2-isopropyl-N.sup.4-(4-(trifluoromethyl)benzyl)quinazoline-2,4-diamine N.sup.2-isopropyl-N.sup.4-(2-(methylsulfonyl)benzyl)quinazoline-2,4-diamine N.sup.2-isopropyl-N.sup.4-((6-(trifluoromethyl)pyridin-3-yl)methyl)quinazoline-2,4-diamine N.sup.4-(4-cyanobenzyl)-N.sup.2-isopropylthieno[3,2-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.4-(2-(methylsulfonyl)benzyl)thieno[3,2-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.4-(4-(methylsulfonyl)benzyl)thieno[3,2-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.4-((6-(trifluoromethyl)pyridin-3-yl)methyl)thieno[3,2-d]pyrimidine-2,4-diamine N.sup.4-(4-cyanobenzyl)-N.sup.2-isopropylquinazoline-2,4-diamine N.sup.4-(4-cyanobenzyl)-N.sup.2-isopropylpyrido[3,2-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.4-(2-(methylsulfonyl)benzyl)pyrido[3,2-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.4-(4-(methylsulfonyl)benzyl)pyrido[3,2-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.4-(4-(trifluoromethyl)benzyl)pyrido[3,2-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.4-((6-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[3,2-d]pyrimidine-2,4-diamine N.sup.4-(4-cyanobenzyl)-N.sup.2-isopropylpyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.4-(2-(methylsulfonyl)benzyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.4-(4-(methylsulfonyl)benzyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.4-(4-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.4-((6-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.4-(4-methoxybenzyl)thieno[3,2-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.4-(2-methoxybenzyl)thieno[3,2-d]pyrimidine-2,4-diamine N.sup.4-(3,4-dimethoxybenzyl)-N.sup.2-isopropylthieno[3,2-d]pyrimidine-2,4-diamine N.sup.4-(4-fluorobenzyl)-N.sup.2-isopropylquinazoline-2,4-diamine N.sup.4-(2-fluorobenzyl)-N.sup.2-isopropylquinazoline-2,4-diamine N.sup.4-(4-chlorobenzyl)-N.sup.2-isopropylquinazoline-2,4-diamine N.sup.4-(2-chlorobenzyl)-N.sup.2-isopropylquinazoline-2,4-diamine N.sup.2-isopropyl-N.sup.4-(4-methoxybenzyl)quinazoline-2,4-diamine N.sup.2-isopropyl-N.sup.4-(2-methoxybenzyl)quinazoline-2,4-diamine N.sup.4-(3,4-dimethoxybenzyl)-N.sup.2-isopropylquinazoline-2,4-diamine N.sup.2-(azetidin-3-yl)-N.sup.4-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-(1-methylazetidin-3-yl)-N.sup.4-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-methyl-N.sup.4-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-(oxetan-3-yl)-N.sup.4-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidine-2,4-diamine 2-((methylamino)methyl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 4-((2-(trifluoromethyl)benzyl)amino)pyrido[2,3-d]pyrimidine-2-carboxamide N.sup.2-(azetidin-3-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-(1-methylazetidin-3-yl)-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-methyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.4-((2-(fluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine methanesulfonate N.sup.2-isopropyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)quinazoline-2,4-diamine N.sup.2-isopropyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[3,2-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)thieno[3,2-d]pyrimidine-2,4-diamine 2-((methylamino)methyl)-N-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine 4-(2-(trifluoromethyl)benzyl)amino)thieno[3,2-d]pyrimidine-2-carboxamide N.sup.2-cyclopropyl-N.sup.4-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-cyclopropyl-N.sup.4-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidine-2,4-diamine methanesulfonate 4-((2-(trifluoromethyl)benzyl)amino)pyrido[2,3-d]pyrimidin-2-ol N.sup.2-(oxetan-3-yl)-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-cyclopropyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-cyclopropyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine methanesulfonate N.sup.2-isopropyl-N.sup.4-methyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.2,N.sup.4-dimethyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.2-methyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.2-methyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine methanesulfonate 2-(azetidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(isopropylthio)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine N.sup.2-isopropyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)-1,8-naphthyridine-2,4-diamine N.sup.4-(2-fluoro-6-(trifluoromethyl)benzyl)-N.sup.2-isopropylpyrido[2,3-d]pyrimidine-2,4-diamine 4-(6-chloro-5-methyl-7-((pyridin-2-ylmethyl)amino)pyrazolo[1,5-a]pyrimidin-3-yl)morpholin-3-one N.sup.2-(tert-butyl)-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.4-(2-fluoro-6-(trifluoromethyl)benzyl)-N.sup.2,N.sup.2-dimethylpyrido[2,3-d]pyrimidine-2,4-diamine N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 3-methyl-1-(4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)azetidin-3-ol 2-(2-methylazetidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2,2-dimethylazetidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(pyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine N.sup.2-cyclopropyl-N.sup.2-methyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.2-methyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)quinazoline-2,4-diamine 2-methyl-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(isopropylsulfinyl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(isopropylsulfonyl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-ol N-isopropyl-4-(2-(2-(trifluoromethyl)phenyl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-amine N-isopropyl-N-methyl-4-(2-(2-(trifluoromethyl)phenyl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-amine N-isopropyl-4-(2-(2-(trifluoromethyl)phenyl)piperidin-1-yl)pyrido[2,3-d]pyrimidin-2-amine N-isopropyl-N-methyl-4-(2-(2-(trifluoromethyl)phenyl)piperidin-1-yl)pyrido[2,3-d]pyrimidin-2-amine N-isopropyl-4-(3-(2-(trifluoromethyl)phenyl)morpholino)pyrido[2,3-d]pyrimidin-2-amine N-isopropyl-N-methyl-4-(3-(2-(trifluoromethyl)phenyl)morpholino)pyrido[2,3-d]pyrimidin-2-amine N-isopropyl-4-(2-(2-(trifluoromethyl)phenyl)pyrazolidin-1-yl)pyrido[2,3-d]pyrimidin-2-amine N-isopropyl-N-methyl-4-(2-(2-(trifluoromethyl)phenyl)pyrazolidin-1-yl)pyrido[2,3-d]pyrimidin-2-amine 2-((difluoromethyl)thio)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-morpholino-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine methanesulfonate 2-(3,3-difluoropyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3,3-difluoropyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine methanesulfonate 2-(4-fluoropiperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4,4-difluoropiperidin-1-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4,4-difluoropiperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine N.sup.2-isopropyl-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine methanesulfonate 2-(4-chloropiperidin-1-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4-chloropiperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-fluoroazetidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3,3-difluoroazetidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-(trifluoromethyl)azetidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4-(trifluoromethyl)-1H-pyrazol-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 1-(4-fluorophenyl)-3-(4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)urea 1-(3-fluorophenyl)-3-(4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)urea 1-(2-fluorophenyl)-3-(4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)urea 1-ethyl-3-(4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)urea (S)-2-(3-methylmorpholino)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine (S)-2-(3-methylmorpholino)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine methanesulfonate (R)-2-(3-methylmorpholino)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine (S)-2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine (R)-2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4-chloropiperidin-1-yl)-4-(2-(2-(trifluoromethyl)phenyl)azetidin-1-yl)pyrido[2,3-d]pyrimidine 2-(4,4-difluoropiperidin-1-yl)-4-(2-(2-(trifluoromethyl)phenyl)azetidin-1-yl)pyrido[2,3-d]pyrimidine 3-methyl-4-(4-(2-(2-(trifluoromethyl)phenyl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine 2-(3,3-difluoropyrrolidin-1-yl)-4-(2-(2-(trifluoromethyl)phenyl)azetidin-1-yl)pyrido[2,3-d]pyrimidine 2-(3-(trifluoromethyl)azetidin-1-yl)-4-(2-(2-(trifluoromethyl)phenyl)azetidin-1-yl)pyrido[2,3-d]pyrimidine 2-(4-chloropiperidin-1-yl)-4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidine 2-(4,4-difluoropiperidin-1-yl)-4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidine 3-methyl-4-(4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine 2-(3,3-difluoropyrrolidin-1-yl)-4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidine 2-(3-(trifluoromethyl)azetidin-1-yl)-4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidine 2-((4-chloropiperidin-1-yl)methyl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-((4,4-difluoropiperidin-1-yl)methyl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-((3-methylmorpholino)methyl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-((3,3-difluoropyrrolidin-1-yl)methyl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-((3-(trifluoromethyl)azetidin-1-yl)methyl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-((4-chloropiperidin-1-yl)methyl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-((4,4-difluoropiperidin-1-yl)methyl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-((3-methylmorpholino)methyl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-((3,3-difluoropyrrolidin-1-yl)methyl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-((3-(trifluoromethyl)azetidin-1-yl)methyl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4-(methylsulfonyl)piperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4,4-dimethylpiperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 1-(4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)piperidine-4-carbonitrile 2-(4-(trifluoromethyl)piperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine N-((2-(trifluoromethyl)pyridin-3-yl)methyl)-2-(3-(trifluoromethyl)pyrrolidin-1-yl)pyrido[2,3-d]pyrimidin-4-amine 1-(4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)azetidine-3-carbonitrile 1-(4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)pyrrolidine-2-carbonitrile 2-(2,2-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3,3-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-fluoropyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4-(methylsulfonyl)piperidin-1-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4,4-dimethylpiperidin-1-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 1-(4-((2-(trifluoromethyl)benzyl)amino)pyrido[2,3-d]pyrimidin-2-yl)azetidine-3-carbonitrile 2-(3,3-dimethylmorpholino)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2,2-dimethylmorpholino)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-methylmorpholino)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-(trifluoromethyl)piperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 4-methyl-1-(4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)piperidine-4-carbonitrile 1-(4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)piperidine-3-carbonitrile 2-(2,2-difluoro-7-azaspiro[3.5]nonan-7-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2,2-difluoro-7-azaspiro[3.5]nonan-7-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine methanesulfonate 2-(3-cyclopropylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-((6S)-2,6-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-oxa-5-azabicyclo[2.2.1]heptan-5-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4-oxa-7-azaspiro[2.5]octan-7-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 4-(4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)morpholine-2-carbonitrile 2-(3-(fluoromethyl)piperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-(trifluoromethyl)piperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2,2-difluoro-7-azaspiro[3.5]nonan-7-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine (2-(trifluoromethyl)pyridin-3-yl)metha 4-methyl-1-(4-((2-(trifluoromethyl)benzyl)amino)pyrido[2,3-d]pyrimidin-2-yl)piperidine-4-carbonitrile 1-(4-((2-(trifluoromethyl)benzyl)amino)pyrido[2,3-d]pyrimidin-2-yl)piperidine-3-carbonitrile 2-(3-(methylsulfonyl)pyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine N-((2-(trifluoromethyl)pyridin-3-yl)methyl)-2-(2-(trifluoromethyl)pyrrolidin-1-yl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-chloropyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine N-(2-(trifluoromethyl)benzyl)-2-(3-(trifluoromethyl)pyrrolidin-1-yl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-oxa-5-azabicyclo[2.2.1]heptan-5-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-((6S)-2,6-dimethylmorpholino)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-isopropylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-((2R,3R)-2,3-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-((2S,5R)-2,5-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(6-oxa-9-azaspiro[4.5]decan-9-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4-(trifluoromethoxy)piperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4-(trifluoromethoxy)piperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine methanesulfonate 2-(3-(difluoromethyl)azetidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-((3R)-3,5-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-(difluoromethyl)azetidin-1-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-((3R)-3,5-dimethylmorpholino)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-cyclopropylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-((2S,5S)-2,5-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine (R)-2-(3-(difluoromethoxy)pyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine (S)-2-(3-(difluoromethoxy)pyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-(difluoromethyl)morpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 4-(4-((2-(trifluoromethyl)benzyl)amino)pyrido[2,3-d]pyrimidin-2-yl)morpholine-2-carbonitrile 2-(2-(difluoromethyl)morpholino)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-(8-oxa-5-azaspiro[3.5]nonan-5-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-(9-oxa-6-azaspiro[4.5]decan-6-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-((2R,3S)-2,3-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine (3R)-3-methyl-4-(4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine (3S)-3-methyl-4-(4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine (3R)-3-methyl-4-(4-(2-(2-(trifluoromethyl)phenyl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine (3S)-3-methyl-4-(4-(2-(2-(trifluoromethyl)phenyl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine 2-(3-(difluoromethoxy)piperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(6-oxa-3-azabicyclo[3.1.1]heptan-3-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-oxa-5-azabicyclo[4.1.0]heptan-5-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2,2,6,6-tetrafluoromorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4-azaspiro[2.5]octan-4-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-(trifluoromethoxy)pyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(5-azaspiro[3.4]octan-5-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-((trifluoromethoxy)methyl)pyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(6-oxa-3-azabicyclo[3.1.1]heptan-3-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-oxa-5-azabicyclo[4.1.0]heptan-5-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-((3R)-3,5-dimethylmorpholino)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 6-fluoro-2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 6-methoxy-2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 7-methoxy-2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrimido[4,5-d]pyrimidin-4-amine 2-(3-methylmorpholino)-N-(2-(trifluoromethyl)benzyl)pyrimido[4,5-d]pyrimidin-4-amine 5-methoxy-2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 6,7-dimethoxy-2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pteridin-4-amine 2-(3-methylmorpholino)-N-(2-(trifluoromethyl)benzyl) pteridin-4-amine 2-(3-methylmorpholino)-7-(2-morpholinoethoxy)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-methylmorpholino)-7-(2-morpholinoethoxy)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl) quinazolin-4-amine.
77. A compound, or salt or solvate thereof, according to paragraph 76 selected from: (3R)-3-methyl-4-(4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine 2-(3-(difluoromethyl)azetidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-((2R,3R)-2,3-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-isopropylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine N-(2-(trifluoromethyl)benzyl)-2-(3-(trifluoromethyl)pyrrolidin-1-yl)pyrido[2,3-d]pyrimidin-4-amine 2-(2,2-difluoro-7-azaspiro[3.5]nonan-7-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-oxa-5-azabicyclo[2.2.1]heptan-5-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-cyclopropylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 1-(4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)piperidine-3-carbonitrile 1-(4-((2-(trifluoromethyl)benzyl)amino)pyrido[2,3-d]pyrimidin-2-yl)azetidine-3-carbonitrile 2-(4,4-dimethylpiperidin-1-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-fluoropyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 1-(4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)piperidine-4-carbonitrile 2-(3-(trifluoromethyl)azetidin-1-yl)-4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidine 3-methyl-4-(4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine (S)-2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-(trifluoromethyl)azetidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4-chloropiperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4-chloropiperidin-1-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine N.sup.2-isopropyl-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine methanesulfonate 2-(4,4-difluoropiperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4-fluoropiperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3,3-difluoropyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine methanesulfonate 2-(3,3-difluoropyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine methanesulfonate 2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine N-isopropyl-4-(2-(2-(trifluoromethyl)phenyl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-amine N.sup.2-cyclopropyl-N.sup.2-methyl-N4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine 2-(2,2-dimethylazetidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine N.sup.2-(tert-butyl)-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.2,N.sup.4-dimethyl-N4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-cyclopropyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine methanesulfonate N.sup.2-cyclopropyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-cyclopropyl-N.sup.4-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidine-2,4-diamine N,2-dimethyl-N-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidin-4-amine N-ethyl-N-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine N.sup.2-isopropyl-N.sup.4-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidine-2,4-diamine 2-chloro-N-methyl-N-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine N.sup.2-isopropyl-N.sup.4-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidine-2,4-diamine methanesulfonate N.sup.2-isopropyl-N.sup.4-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.2-methyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.2-methyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine methanesulfonate N.sup.4-(2-fluoro-6-(trifluoromethyl)benzyl)-N.sup.2-isopropylpyrido[2,3-d]pyrimidine-2,4-diamine 2-(2-methylazetidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(pyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine N-isopropyl-N-methyl-4-(2-(2-(trifluoromethyl)phenyl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-amine 2-(4,4-difluoropiperidin-1-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 3-methyl-4-(4-(2-(2-(trifluoromethyl)phenyl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine 2-(4,4-difluoropiperidin-1-yl)-4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidine 2-(3,3-difluoropyrrolidin-1-yl)-4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidine 2-(4-(trifluoromethyl)piperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2,2-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3,3-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-methylmorpholino)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 4-methyl-1-(4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)piperidine-4-carbonitrile 2-(2,2-difluoro-7-azaspiro[3.5]nonan-7-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2,2-difluoro-7-azaspiro[3.5]nonan-7-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine methanesulfonate 2-(2-(trifluoromethyl)piperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2,2-difluoro-7-azaspiro[3.5]nonan-7-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 1-(4-((2-(trifluoromethyl)benzyl)amino)pyrido[2,3-d]pyrimidin-2-yl)piperidine-3-carbonitrile 2-((2S,5R)-2,5-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(6-oxa-9-azaspiro[4.5]decan-9-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-((3R)-3,5-di methyl morpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-cyclopropylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-((2S,5S)-2,5-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine (R)-2-(3-(difluoromethoxy)pyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine (S)-2-(3-(difluoromethoxy)pyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-(difluoromethyl)morpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 4-(4-((2-(trifluoromethyl)benzyl)amino)pyrido[2,3-d]pyrimidin-2-yl)morpholine-2-carbonitrile 2-((2R,3S)-2,3-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine (3S)-3-methyl-4-(4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine (3R)-3-methyl-4-(4-(2-(2-(trifluoromethyl)phenyl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine (3S)-3-methyl-4-(4-(2-(2-(trifluoromethyl)phenyl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine 2-(2-oxa-5-azabicyclo[4.1.0]heptan-5-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-oxa-5-azabicyclo[4.1.0]heptan-5-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine (S)-2-(3-methylmorpholino)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine (S)-2-(3-methylmorpholino)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine methanesulfonate 2-(4-chloropiperidin-1-yl)-4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidine N-((2-(trifluoromethyl)pyridin-3-yl)methyl)-2-(3-(trifluoromethyl)pyrrolidin-1-yl)pyrido[2,3-d]pyrimidin-4-amine 2-(2,2-dimethylmorpholino)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4-oxa-7-azaspiro[2.5]octan-7-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-(fluoromethyl)piperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine (2-(trifluoromethyl)pyridin-3-yl)metha 4-methyl-1-(4-((2-(trifluoromethyl)benzyl)amino)pyrido[2,3-d]pyrimidin-2-yl)piperidine-4-carbonitrile N-((2-(trifluoromethyl)pyridin-3-yl)methyl)-2-(2-(trifluoromethyl)pyrrolidin-1-yl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-chloropyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-oxa-5-azabicyclo[2.2.1]heptan-5-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4-(trifluoromethoxy)piperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4-(trifluoromethoxy)piperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine methanesulfonate 2-(3-(difluoromethyl)azetidin-1-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-(difluoromethyl)morpholino)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4-azaspiro[2.5]octan-4-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-(trifluoromethoxy)pyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(5-azaspiro[3.4]octan-5-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-((trifluoromethoxy)methyl)pyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(6-oxa-3-azabicyclo[3.1.1]heptan-3-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-((3R)-3,5-dimethylmorpholino)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine.
78. A pharmaceutical composition comprising a compound according to paragraphs 1 to
77, or a pharmaceutically acceptable salt or solvate thereof, in admixture with a pharmaceutically acceptable diluent or carrier.
79. A compound according to any one of paragraphs 1 to 77, or a pharmaceutically acceptable salt or solvate thereof, for use in therapy.
80. A combination comprising a compound according to any one of paragraphs 1 to 77, or a pharmaceutically acceptable salt or solvate thereof, with one or more additional therapeutic agents.
81. A compound of Formula II:

(114) ##STR00018##
or a salt or solvate thereof, wherein,

(115) A represents a fused aromatic ring selected from,

(116) ##STR00019##

(117) X.sup.1, X.sup.2 and X.sup.3 are independently selected from N and CH;

(118) Q is a group selected from an C.sub.3-11cycloalkyl optionally substituted by one or more R.sup.b, 3-15 membered heterocycloalkyl optionally substituted by one or more R.sup.b, C.sub.6-11 aryl group optionally substituted with by one or more R.sup.b, 5-15 membered heteroaryl optionally substituted by one or more R.sup.b;

(119) R.sup.6 is selected from hydrogen and C.sub.1-6 alkyl;

(120) R.sup.7 and R.sup.7′ are independently selected from hydrogen, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, where said C.sub.3-6 cycloalkyl and C.sub.1-6 alkyl are optionally substituted by one or more R.sup.a; or

(121) R.sup.7 and R.sup.7′, together with the carbon to which they are attached form a 3-7 membered cycloalkyl ring, optionally substituted with one or more R.sup.a, or R.sup.7 and R.sup.7′, together with the carbon to which they are attached form a carbonyl group; or

(122) R.sup.6 and R.sup.7, together with the atoms to which they are attached form a 3-7 membered heterocyclic ring, optionally substituted with one or more R.sup.a;

(123) n is a number selected from 0, 1, 2 and 3

(124) R.sup.2 is selected from hydrogen, hydroxyl, halogen, —CN, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —C(O)C(═O)R.sup.d, —NR.sup.cR.sup.d, —NR.sup.c(C.sub.1-6alkyl)NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —NR.sup.cC(═O)OR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d—OC(═O)R.sup.d, —OC(═O)NR.sup.cR.sup.d, —OC(═O)OR.sup.d, —S(═O)R.sup.d, —S(═O).sub.2R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, —S(═O).sub.2NR.sup.cR.sup.d, C.sub.1-10 haloalkyl, C.sub.1-10alkyl optionally substituted by one or more R.sup.e, C.sub.2-6alkenyl optionally substituted by one or more R.sup.e, C.sub.2-6alkynyl optionally substituted by one or more R.sup.e, C.sub.6-11aryl optionally substituted by one or more R.sup.e, (C.sub.7-16)alkylaryl optionally substituted by one or more R.sup.e, C.sub.3-11cycloalkyl optionally substituted by one or more R.sup.e, (C.sub.4-17)cycloalkylalkyl optionally substituted by one or more R.sup.e, 3-15 membered heterocycloalkyl optionally substituted by one or more R.sup.e, 4-21 membered alkylheterocycloalkyl optionally substituted by one or more R.sup.e, 5-15 membered heteroaryl optionally substituted by one or more R.sup.e, and 6-21 membered alkylheteroaryl optionally substituted by one or more R.sup.e;

(125) each R.sup.a is independently selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, wherein said C.sub.3-6 cycloalkyl and 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(126) each R.sup.b and R.sup.e is independently selected from hydroxyl, ═O, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —C(O)C(═O)R.sup.d, —NR.sup.cR.sup.d, —NR.sup.c(═O)R.sup.d, —NR.sup.cC(═O)OR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d, —OC(═O)R.sup.d, —OC(═O)NR.sup.cR.sup.d, —OC(═O)OR.sup.d, —S(═O).sub.2R.sup.d, —S(═O)R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, and —S(═O).sub.2NR.sup.cR.sup.d, where said C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, and 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, ═O, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(127) each R.sup.c is independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(128) each R.sup.d is independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, 3-7 membered heterocycloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, amino, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl; or

(129) R.sup.c and R.sup.d, when attached to the same atom, together with the atom to which they are attached form a 3-7 membered ring, optionally containing one or more for heteroatoms selected from O, NH and S, and wherein said ring is optionally substituted with one or more R.sup.a;

(130) R.sup.3, R.sup.4 and R.sup.5 are independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, phenyl and cyclopropyl, wherein said C.sub.1-6 alkyl, phenyl and cyclopropyl are optionally substituted by one or more R.sup.a;

(131) or a pharmaceutically acceptable salt or solvate thereof, for use in the treatment or prevention of a filarial worm infection.

(132) 82. A compound for use according to paragraph 81, wherein the infection is with one or more filarial worms selected from Wuchereria bancrofti, Brugia malayi, Brugia timori and Onchocerca volvulus.

(133) 83. A compound of Formula II:

(134) ##STR00020##
or a salt or solvate thereof, wherein,

(135) A represents a fused aromatic ring selected from,

(136) ##STR00021##

(137) X.sup.1, X.sup.2 and X.sup.3 are independently selected from N and CH;

(138) Q is a group selected from an C.sub.3-11cycloalkyl optionally substituted by one or more R.sup.b, 3-15 membered heterocycloalkyl optionally substituted by one or more R.sup.b, C.sub.6-11 aryl group optionally substituted with by one or more R.sup.b, 5-15 membered heteroaryl optionally substituted by one or more R.sup.b;

(139) R.sup.6 is selected from hydrogen and C.sub.1-6 alkyl;

(140) R.sup.7 and R.sup.7′ are independently selected from hydrogen, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, where said C.sub.3-6 cycloalkyl and C.sub.1-6 alkyl are optionally substituted by one or more R.sup.a; or

(141) R.sup.7 and R.sup.7′, together with the carbon to which they are attached form a 3-7 membered cycloalkyl ring, optionally substituted with one or more R.sup.8, or R.sup.7 and R.sup.7′, together with the carbon to which they are attached form a carbonyl group; or

(142) R.sup.6 and R.sup.7, together with the atoms to which they are attached form a 3-7 membered heterocyclic ring, optionally substituted with one or more R.sup.a;

(143) n is a number selected from 0, 1, 2 and 3

(144) R.sup.2 is selected from hydrogen, hydroxyl, halogen, —CN, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —C(O)C(═O)R.sup.d, —NR.sup.cR.sup.d, —NR.sup.c(C.sub.1-6alkyl)NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —NR.sup.cC(═O)OR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d—OC(═O)R.sup.d, —OC(═O)NR.sup.cR.sup.d, —OC(═O)OR.sup.d, —S(═O)R.sup.d, —S(═O).sub.2R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, —S(═O).sub.2NR.sup.cR.sup.d, C.sub.1-10 haloalkyl, C.sub.1-10alkyl optionally substituted by one or more R.sup.e, C.sub.2-6alkenyl optionally substituted by one or more R.sup.e, C.sub.2-6alkynyl optionally substituted by one or more R.sup.e, C.sub.6-11aryl optionally substituted by one or more R.sup.e, (C.sub.7-16)alkylaryl optionally substituted by one or more R.sup.e, C.sub.3-11cycloalkyl optionally substituted by one or more R.sup.e, (C.sub.4-17)cycloalkylalkyl optionally substituted by one or more R.sup.e, 3-15 membered heterocycloalkyl optionally substituted by one or more R.sup.e, 4-21 membered alkylheterocycloalkyl optionally substituted by one or more R.sup.e, 5-15 membered heteroaryl optionally substituted by one or more R.sup.e, and 6-21 membered alkylheteroaryl optionally substituted by one or more R.sup.e;

(145) each R.sup.e is independently selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, wherein said C.sub.3-6 cycloalkyl and 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(146) each R.sup.b and R.sup.e is independently selected from hydroxyl, ═O, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —C(O)C(═O)R.sup.d, —NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —NR.sup.cC(═O)OR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d, —OC(═O)R.sup.d, —OC(═O)NR.sup.cR.sup.d, —OC(═O)OR.sup.d, —S(═O).sub.2R.sup.d, —S(═O)R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, and —S(═O).sub.2NR.sup.cR.sup.d, where said C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, and 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, ═O, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(147) each R.sup.c is independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(148) each R.sup.d is independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, 3-7 membered heterocycloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, amino, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl; or

(149) R.sup.c and R.sup.d, when attached to the same atom, together with the atom to which they are attached form a 3-7 membered ring, optionally containing one or more for heteroatoms selected from O, NH and S, and wherein said ring is optionally substituted with one or more R.sup.a;

(150) R.sup.3, R.sup.4 and R.sup.5 are independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, phenyl and cyclopropyl, wherein said C.sub.1-6 alkyl, phenyl and cyclopropyl are optionally substituted by one or more R.sup.a;

(151) or a pharmaceutically acceptable salt or solvate thereof, for use in the treatment or prevention of a disease or condition mediated by a filarial worm infection.

(152) 84. A compound for use according to paragraph 83, wherein the disease or condition is mediated by infection with one or more of Wuchereria bancrofti, Brugia malayi, Brugia timori and Onchocerca volvulus.

(153) 85. A compound for use according to paragraph 83, wherein the disease or condition is selected from onchocerciasis or lymphatic filariasis.

(154) 86. A compound of Formula II:

(155) ##STR00022##
or a salt or solvate thereof, wherein,

(156) A represents a fused aromatic ring selected from,

(157) ##STR00023##

(158) X.sup.1, X.sup.2 and X.sup.3 are independently selected from N and CH;

(159) Q is a group selected from an C.sub.3-11cycloalkyl optionally substituted by one or more R.sup.b, 3-15 membered heterocycloalkyl optionally substituted by one or more R.sup.b, C.sub.6-11 aryl group optionally substituted with by one or more R.sup.b, 5-15 membered heteroaryl optionally substituted by one or more R.sup.b;

(160) R.sup.6 is selected from hydrogen and C.sub.1-6 alkyl;

(161) R.sup.7 and R.sup.7′ are independently selected from hydrogen, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, where said C.sub.3-6 cycloalkyl and C.sub.1-6 alkyl are optionally substituted by one or more R.sup.a; or

(162) R.sup.7 and R.sup.7′, together with the carbon to which they are attached form a 3-7 membered cycloalkyl ring, optionally substituted with one or more R.sup.e, or R.sup.7 and R.sup.7′, together with the carbon to which they are attached form a carbonyl group; or

(163) R.sup.6 and R.sup.7, together with the atoms to which they are attached form a 3-7 membered heterocyclic ring, optionally substituted with one or more R.sup.a;

(164) n is a number selected from 0, 1, 2 and 3

(165) R.sup.2 is selected from hydrogen, hydroxyl, halogen, —CN, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —C(O)C(═O)R.sup.d, —NR.sup.cR.sup.d, —NR.sup.c(C.sub.1-6alkyl)NR.sup.cR.sup.d, —NR.sup.c(═O)R.sup.d, —NR.sup.cC(═O)OR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d—OC(═O)R.sup.d, —OC(═O)NR.sup.cR.sup.d, —OC(═O)OR.sup.d, —S(═O)R.sup.d, —S(═O).sub.2R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, —S(═O).sub.2NR.sup.cR.sup.d, C.sub.1-10 haloalkyl, C.sub.1-10alkyl optionally substituted by one or more R.sup.e, C.sub.2-6alkenyl optionally substituted by one or more R.sup.e, C.sub.2-6alkynyl optionally substituted by one or more R.sup.e, C.sub.6-11aryl optionally substituted by one or more R.sup.e, (C.sub.7-16)alkylaryl optionally substituted by one or more R.sup.e, C.sub.3-11cycloalkyl optionally substituted by one or more R.sup.e, (C.sub.4-17)cycloalkylalkyl optionally substituted by one or more R.sup.e, 3-15 membered heterocycloalkyl optionally substituted by one or more R.sup.e, 4-21 membered alkylheterocycloalkyl optionally substituted by one or more R.sup.e, 5-15 membered heteroaryl optionally substituted by one or more R.sup.e, and 6-21 membered alkylheteroaryl optionally substituted by one or more R.sup.e;

(166) each R.sup.a is independently selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, wherein said C.sub.3-6 cycloalkyl and 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(167) each R.sup.b and R.sup.e is independently selected from hydroxyl, ═O, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —C(O)C(═O)R.sup.d, —NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —NR.sup.cC(═O)OR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d, —OC(═O)R.sup.d, —OC(═O)NR.sup.cR.sup.d, —OC(═O)OR.sup.d, —S(═O).sub.2R.sup.d, —S(═O)R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, and —S(═O).sub.2NR.sup.cR.sup.d, where said C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, and 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, ═O, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(168) each R.sup.c is independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(169) each R.sup.d is independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, 3-7 membered heterocycloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, amino, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl; or

(170) R.sup.c and R.sup.d, when attached to the same atom, together with the atom to which they are attached form a 3-7 membered ring, optionally containing one or more for heteroatoms selected from O, NH and S, and wherein said ring is optionally substituted with one or more R.sup.a;

(171) R.sup.3, R.sup.4 and R.sup.5 are independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, phenyl and cyclopropyl, wherein said C.sub.1-6 alkyl, phenyl and cyclopropyl are optionally substituted by one or more R.sup.a;

(172) or a pharmaceutically acceptable salt or solvate thereof, for use in the treatment of a microbial infection.

(173) 87. A compound for use according to paragraph 86 wherein the microbial infection is a bacterial infection.

(174) 88. A compound for use according to paragraph 87 wherein the bacterial infection is Wolbachia infection.

(175) 89. A method of treating or preventing a filarial worm infection in a subject, said method comprising administering to a subject a therapeutically effective amount of a compound of Formula II:

(176) ##STR00024##
or a salt or solvate thereof, wherein,

(177) A represents a fused aromatic ring selected from,

(178) ##STR00025##

(179) X.sup.1, X.sup.2 and X.sup.3 are independently selected from N and CH;

(180) Q is a group selected from an C.sub.3-11cycloalkyl optionally substituted by one or more R.sup.b, 3-15 membered heterocycloalkyl optionally substituted by one or more R.sup.b, C.sub.6-11 aryl group optionally substituted with by one or more R.sup.b, 5-15 membered heteroaryl optionally substituted by one or more R.sup.b;

(181) R.sup.6 is selected from hydrogen and C.sub.1-6 alkyl;

(182) R.sup.7 and R.sup.7′ are independently selected from hydrogen, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, where said C.sub.3-6 cycloalkyl and C.sub.1-6 alkyl are optionally substituted by one or more R.sup.a; or

(183) R.sup.7 and R.sup.7′, together with the carbon to which they are attached form a 3-7 membered cycloalkyl ring, optionally substituted with one or more R.sup.a, or R.sup.7 and R.sup.7′, together with the carbon to which they are attached form a carbonyl group; or

(184) R.sup.6 and R.sup.7, together with the atoms to which they are attached form a 3-7 membered heterocyclic ring, optionally substituted with one or more R.sup.a;

(185) n is a number selected from 0, 1, 2 and 3

(186) R.sup.2 is selected from hydrogen, hydroxyl, halogen, —CN, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —C(O)C(═O)R.sup.d, —NR.sup.cR.sup.d, —NR.sup.c(C.sub.1-6alkyl)NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —NR.sup.cC(═O)OR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d—OC(═O)R.sup.d, —OC(═O)NR.sup.cR.sup.d, —OC(═O)OR.sup.d, —S(═O)R.sup.d, —S(═O).sub.2R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, —S(═O).sub.2NR.sup.cR.sup.d, C.sub.1-10 haloalkyl, C.sub.1-10alkyl optionally substituted by one or more R.sup.e, C.sub.2-6alkenyl optionally substituted by one or more R.sup.e, C.sub.2-6alkynyl optionally substituted by one or more R.sup.e, C.sub.6-11aryl optionally substituted by one or more R.sup.e, (C.sub.7-16)alkylaryl optionally substituted by one or more R.sup.e, C.sub.3-11cycloalkyl optionally substituted by one or more R.sup.e, (C.sub.4-17)cycloalkylalkyl optionally substituted by one or more R.sup.e, 3-15 membered heterocycloalkyl optionally substituted by one or more R.sup.e, 4-21 membered alkylheterocycloalkyl optionally substituted by one or more R.sup.e, 5-15 membered heteroaryl optionally substituted by one or more R.sup.e, and 6-21 membered alkylheteroaryl optionally substituted by one or more R.sup.e;

(187) each R.sup.a is independently selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, wherein said C.sub.3-6 cycloalkyl and 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(188) each R.sup.b and R.sup.e is independently selected from hydroxyl, ═O, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —C(O)C(═O)R.sup.d, —NR.sup.cR.sup.d, —NR.sup.c(═O)R.sup.d, —NR.sup.cC(═O)OR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d, —OC(═O)R.sup.d, —OC(═O)NR.sup.cR.sup.d, —OC(═O)OR.sup.d, —S(═O).sub.2R.sup.d, —S(═O)R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, and —S(═O).sub.2NR.sup.cR.sup.d, where said C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, and 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, ═O, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(189) each R.sup.c is independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(190) each R.sup.d is independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, 3-7 membered heterocycloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, amino, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl; or

(191) R.sup.c and R.sup.d, when attached to the same atom, together with the atom to which they are attached form a 3-7 membered ring, optionally containing one or more for heteroatoms selected from O, NH and S, and wherein said ring is optionally substituted with one or more R.sup.a;

(192) R.sup.3, R.sup.4 and R.sup.5 are independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, phenyl and cyclopropyl, wherein said C.sub.1-6 alkyl, phenyl and cyclopropyl are optionally substituted by one or more R.sup.a;

(193) or a pharmaceutically acceptable salt or solvate thereof.

(194) 90. A method according to paragraph 89 wherein the infection is with one or more filarial worms selected from Wuchereria bancrofti, Brugia malayi, Brugia timori and Onchocerca volvulus.

(195) 91. A method of treating or preventing a disease or condition mediated by a filarial worm infection, said method comprising administering to a subject in need thereof a therapeutically effective amount of a compound of Formula II:

(196) ##STR00026##
or a salt or solvate thereof, wherein,

(197) A represents a fused aromatic ring selected from,

(198) ##STR00027##

(199) X.sup.1, X.sup.2 and X.sup.3 are independently selected from N and CH;

(200) Q is a group selected from an C.sub.3-11cycloalkyl optionally substituted by one or more R.sup.b, 3-15 membered heterocycloalkyl optionally substituted by one or more R.sup.b, C.sub.1-6 aryl group optionally substituted with by one or more R.sup.b, 5-15 membered heteroaryl optionally substituted by one or more R.sup.b;

(201) R.sup.6 is selected from hydrogen and C.sub.1-6 alkyl;

(202) R.sup.7 and R.sup.7′ are independently selected from hydrogen, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, where said C.sub.3-6 cycloalkyl and C.sub.1-6 alkyl are optionally substituted by one or more R.sup.a; or

(203) R.sup.7 and R.sup.7′, together with the carbon to which they are attached form a 3-7 membered cycloalkyl ring, optionally substituted with one or more R.sup.e, or R.sup.7 and R.sup.7′, together with the carbon to which they are attached form a carbonyl group; or

(204) R.sup.6 and R.sup.7, together with the atoms to which they are attached form a 3-7 membered heterocyclic ring, optionally substituted with one or more R.sup.a;

(205) n is a number selected from 0, 1, 2 and 3

(206) R.sup.2 is selected from hydrogen, hydroxyl, halogen, —CN, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —C(O)C(═O)R.sup.d, —NR.sup.cR.sup.d, —NR.sup.c(C.sub.1-6alkyl)NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —NR.sup.cC(═O)OR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d—OC(═O)R.sup.d, —OC(═O)NR.sup.cR.sup.d, —OC(═O)OR.sup.d, —S(═O)R.sup.d, —S(═O).sub.2R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, —S(═O).sub.2NR.sup.cR.sup.d, C.sub.1-10 haloalkyl, C.sub.1-10alkyl optionally substituted by one or more R.sup.e, C.sub.2-6alkenyl optionally substituted by one or more R.sup.e, C.sub.2-6alkynyl optionally substituted by one or more R.sup.e, C.sub.6-11aryl optionally substituted by one or more R.sup.e, (C.sub.7-16)alkylaryl optionally substituted by one or more R.sup.e, C.sub.3-11cycloalkyl optionally substituted by one or more R.sup.e, (C.sub.4-17)cycloalkylalkyl optionally substituted by one or more R.sup.e, 3-15 membered heterocycloalkyl optionally substituted by one or more R.sup.e, 4-21 membered alkylheterocycloalkyl optionally substituted by one or more R.sup.e, 5-15 membered heteroaryl optionally substituted by one or more R.sup.e, and 6-21 membered alkylheteroaryl optionally substituted by one or more R.sup.e;

(207) each R.sup.e is independently selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, wherein said C.sub.3-6 cycloalkyl and 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(208) each R.sup.b and R.sup.e is independently selected from hydroxyl, ═O, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —C(O)C(═O)R.sup.d, —NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —NR.sup.cC(═O)OR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d, —OC(═O)R.sup.d, —OC(═O)NR.sup.cR.sup.d, —OC(═O)OR.sup.d, —S(═O).sub.2R.sup.d, —S(═O)R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, and —S(═O).sub.2NR.sup.cR.sup.d, where said C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, and 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, ═O, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(209) each R.sup.c is independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(210) each R.sup.d is independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, 3-7 membered heterocycloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, amino, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl; or

(211) R.sup.c and R.sup.d, when attached to the same atom, together with the atom to which they are attached form a 3-7 membered ring, optionally containing one or more for heteroatoms selected from O, NH and S, and wherein said ring is optionally substituted with one or more R.sup.a;

(212) R.sup.3, R.sup.4 and R.sup.5 are independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, phenyl and cyclopropyl, wherein said C.sub.1-6 alkyl, phenyl and cyclopropyl are optionally substituted by one or more R.sup.a;

(213) or a pharmaceutically acceptable salt or solvate thereof.

(214) 92. A method according to paragraph 91 wherein the disease or condition is mediated by infection with one or more of Wuchereria bancrofti, Brugia malayi, Brugia timori and Onchocerca volvulus.

(215) 93. The method of any one of paragraphs 91 and 92, wherein the disease or condition is selected from onchocerciasis or lymphatic filariasis.

(216) 94. A method of treating a microbial infection, said method comprising administering to a subject in need thereof a therapeutically effective amount of a compound of Formula II:

(217) ##STR00028##
or a salt or solvate thereof, wherein,

(218) A represents a fused aromatic ring selected from,

(219) ##STR00029##

(220) X.sup.1, X.sup.2 and X.sup.3 are independently selected from N and CH;

(221) Q is a group selected from an C.sub.3-11 cycloalkyl optionally substituted by one or more R.sup.b, 3-15 membered heterocycloalkyl optionally substituted by one or more R.sup.b, C.sub.6-11 aryl group optionally substituted with by one or more R.sup.b, 5-15 membered heteroaryl optionally substituted by one or more R.sup.b;

(222) R.sup.6 is selected from hydrogen and C.sub.1-6 alkyl;

(223) R.sup.7 and R.sup.7′ are independently selected from hydrogen, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, where said C.sub.3-6 cycloalkyl and C.sub.1-6 alkyl are optionally substituted by one or more R.sup.a; or

(224) R.sup.7 and R.sup.7′, together with the carbon to which they are attached form a 3-7 membered cycloalkyl ring, optionally substituted with one or more R.sup.a, or R.sup.7 and R.sup.7′, together with the carbon to which they are attached form a carbonyl group; or

(225) R.sup.6 and R.sup.7, together with the atoms to which they are attached form a 3-7 membered heterocyclic ring, optionally substituted with one or more R.sup.a;

(226) n is a number selected from 0, 1, 2 and 3

(227) R.sup.2 is selected from hydrogen, hydroxyl, halogen, —CN, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —C(O)C(═O)R.sup.d, —NR.sup.cR.sup.d, —NR.sup.c(C.sub.1-6alkyl)NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —NR.sup.cC(═O)OR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d—OC(═O)R.sup.d, —OC(═O)NR.sup.cR.sup.d, —OC(═O)OR.sup.d, —S(═O)R.sup.d, —S(═O).sub.2R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, —S(═O).sub.2NR.sup.cR.sup.d, C.sub.1-10 haloalkyl, C.sub.1-10alkyl optionally substituted by one or more R.sup.e, C.sub.2-6alkenyl optionally substituted by one or more R.sup.e, C.sub.2-6alkynyl optionally substituted by one or more R.sup.e, C.sub.6-11aryl optionally substituted by one or more R.sup.e, (C.sub.7-16)alkylaryl optionally substituted by one or more R.sup.e, C.sub.3-11cycloalkyl optionally substituted by one or more R.sup.e, (C.sub.4-17)cycloalkylalkyl optionally substituted by one or more R.sup.e, 3-15 membered heterocycloalkyl optionally substituted by one or more R.sup.e, 4-21 membered alkylheterocycloalkyl optionally substituted by one or more R.sup.e, 5-15 membered heteroaryl optionally substituted by one or more R.sup.e, and 6-21 membered alkylheteroaryl optionally substituted by one or more R.sup.e;

(228) each R.sup.a is independently selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, wherein said C.sub.3-6 cycloalkyl and 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(229) each R.sup.b and R.sup.e is independently selected from hydroxyl, ═O, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —C(O)C(═O)R.sup.d, —NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —NR.sup.cC(═O)OR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d, —OC(═O)R.sup.d, —OC(═O)NR.sup.cR.sup.d, —OC(═O)OR.sup.d, —S(═O).sub.2R.sup.d, —S(═O)R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, and —S(═O).sub.2NR.sup.cR.sup.d, where said C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, and 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, ═O, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(230) each R.sup.c is independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(231) each R.sup.d is independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, 3-7 membered heterocycloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, amino, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl; or

(232) R.sup.c and R.sup.d, when attached to the same atom, together with the atom to which they are attached form a 3-7 membered ring, optionally containing one or more for heteroatoms selected from O, NH and S, and wherein said ring is optionally substituted with one or more R.sup.a;

(233) R.sup.3, R.sup.4 and R.sup.5 are independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, phenyl and cyclopropyl, wherein said C.sub.1-6 alkyl, phenyl and cyclopropyl are optionally substituted by one or more R.sup.a;

(234) or a pharmaceutically acceptable salt or solvate thereof.

(235) 95. A method according to paragraph 94 wherein the microbial infection is a bacterial infection.

(236) 96. A method according to paragraph 95 wherein the bacterial infection is Wolbachia infection.

(237) 97. A compound for use according to paragraphs 81 to 88 or a method according to paragraphs 89 to 96 wherein in the compound of Formula II, or a salt or solvate thereof,

(238) A represents a fused aromatic ring selected from,

(239) ##STR00030##

(240) X.sup.1, X.sup.2 and X.sup.3 are independently selected from N and CH;

(241) Q is a group selected from an C.sub.3-11cycloalkyl optionally substituted by 1-21 R.sup.b, 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.b, C.sub.6-11 aryl group optionally substituted with by 1-11 R.sup.b, 5-15 membered heteroaryl optionally substituted by 1-15 R.sup.b;

(242) R.sup.6 is selected from hydrogen and C.sub.1-6 alkyl;

(243) R.sup.7 and R.sup.7′ are independently selected from hydrogen, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, where said C.sub.3-6 cycloalkyl and C.sub.1-6 alkyl are optionally substituted by one or more R.sup.a; or

(244) R.sup.7 and R.sup.7′, together with the carbon to which they are attached form a 3-7 membered cycloalkyl ring, optionally substituted with one or more R.sup.a, or R.sup.7 and R.sup.7′, together with the carbon to which they are attached form a carbonyl group; or

(245) R.sup.6 and R.sup.7, together with the atoms to which they are attached form a 3-7 membered heterocyclic ring, optionally substituted with one or more R.sup.a;

(246) n is a number selected from 1, 2 and 3;

(247) R.sup.2 is selected from —CN, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —C(O)C(═O)R.sup.d, —NR.sup.cR.sup.d, —NR.sup.c(C.sub.1-6alkyl)NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —NR.sup.cC(═O)OR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d—OC(═O)R.sup.d, —OC(═O)NR.sup.cR.sup.d, —OC(═O)OR.sup.d, —S(═O)R.sup.d, —S(═O).sub.2R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, —S(═O).sub.2NR.sup.cR.sup.d, C.sub.1-10 haloalkyl, C.sub.1-10alkyl optionally substituted by 1-13 R.sup.e, C.sub.2-6alkenyl optionally substituted by 1-11 R.sup.e, C.sub.2-6alkynyl optionally substituted by 1-9 R.sup.e, C.sub.6-11aryl optionally substituted by 1-11 R.sup.e, (C.sub.7-16)alkylaryl optionally substituted by 1-9 R.sup.e, C.sub.3-11cycloalkyl optionally substituted by 1-21 R.sup.e, (C.sub.4-17)cycloalkylalkyl optionally substituted by 1-32 R.sup.e, 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.e, 4-21 membered alkylheterocycloalkyl optionally substituted by 1-40 R.sup.e, 5-15 membered heteroaryl optionally substituted by 1-15 R.sup.e, and 6-21 membered alkylheteroaryl optionally substituted by 1-27 R.sup.e;

(248) each R.sup.a is independently selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, wherein said C.sub.3-6 cycloalkyl and 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(249) each R.sup.b and R.sup.e is independently selected from hydroxyl, ═O, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —C(O)C(═O)R.sup.d, —NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —NR.sup.cC(═O)OR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d, —OC(═O)R.sup.d, —OC(═O)NR.sup.cR.sup.d, —OC(═O)OR.sup.d, —S(═O).sub.2R.sup.d, —S(═O)R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, and —S(═O).sub.2NR.sup.cR.sup.d, where said C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, and 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, ═O, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(250) each R.sup.c is independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(251) each R.sup.d is independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, 3-7 membered heterocycloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, amino, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl; or

(252) R.sup.c and R.sup.d, when attached to the same atom, together with the atom to which they are attached form a 3-7 membered ring, optionally containing one or more for heteroatoms selected from O, NH and S, and wherein said ring is optionally substituted with one or more R.sup.a;

(253) R.sup.3, R.sup.4 and R.sup.5 are independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, phenyl and cyclopropyl, wherein said C.sub.1-6 alkyl, phenyl and cyclopropyl are optionally substituted by one or more R.sup.a;

(254) with the provisos that:

(255) (i) when X.sup.1 is N, X.sup.2 and X.sup.3 cannot both be CH;

(256) (ii) when Q is phenyl, R.sup.b is not such that Q is a 3,4-di-O—C.sub.1-6 alkyl phenyl, a 3,5-di-O—C.sub.1-6 alkyl phenyl or a 3,4,5-tri-O—C.sub.1-6 alkyl phenyl; and

(257) (iii) the compound of Formula (I) is not

(258) N-(4-fluorobenzyl)-2-(piperidinyl-1-yl)pyrido[2,3-d]pyrimidin-4-amine, N-(4-fluorobenzyl)-2-(piperidinyl-1-yl)pyrido[3,2-d]pyrimidin-4-amine, N-(4-fluorobenzyl)-2-(piperidinyl-1-yl)thieno[3,2-d]pyrimidin-4-amine.
98. A compound for use or a method according to any one of paragraphs 81 to 97 wherein A is,

(259) ##STR00031##
99. A compound for use or a method according to any one of paragraphs 81 to 98, wherein X.sup.1 is N.
100. A compound for use or a method according to any one of paragraphs 81 to 99, wherein one of X.sup.2 and X.sup.3 is N and the other is CH.
101. A compound for use or a method according to any one of paragraphs 81 to 100, wherein X.sup.2 is CH and X.sup.3 is N.
102. A compound for use or a method according to any one of paragraphs 81 to 101, wherein X.sup.1 is N and A is selected from

(260) ##STR00032##
103. A compound for use or a method according to any one of paragraphs 81 to 97, wherein A is

(261) ##STR00033##
104. A compound for use or a method according to any one of paragraphs 81 to 103, wherein Q is a group selected from a 3-15 membered heterocycloalkyl optionally substituted by one or more R.sup.b, C.sub.6-11 aryl group optionally substituted with by one or more R.sup.b, and a 5-15 membered heteroaryl optionally substituted by one or more R.sup.b.
105. A compound for use or a method according to any one of paragraphs 81 to 104, wherein Q is a group selected from a 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.b, C.sub.6-11 aryl group optionally substituted with by 1-11 R.sup.b, and a 5-15 membered heteroaryl optionally substituted by 1-15 R.sup.b.
106. A compound for use or a method according to any one of paragraphs 81 to 105, wherein Q is a group selected from a C.sub.6-11 aryl group optionally substituted with by 1-11 R.sup.b and a 5-15 membered heteroaryl optionally substituted by 1-15 R.sup.b.
107. A compound for use or a method according to any one of paragraphs 81 to 106, wherein Q is a group selected from a C.sub.6 aryl group optionally substituted with by one or more R.sup.b and a 5-6 membered heteroaryl optionally substituted by one or more R.sup.b.
108. A compound for use or a method according to any one of paragraphs 81 to 107, wherein Q is selected from a phenyl or pyridyl group optionally substituted with 1-5 R.sup.b.
109. A compound for use or a method according to any one of paragraphs 81 to 108, wherein Q is a group of Formula III (wherein the dotted line indicates the point of attachment):

(262) ##STR00034##
wherein

(263) X.sup.4 is selected from CH and N;

(264) m is selected from 0, 1 and 2; and

(265) R.sup.b is as previously defined.

(266) 110. A compound for use or a method according to any one of paragraphs 81 to 109, wherein Q is a group of Formula IIa:

(267) ##STR00035##
wherein

(268) X.sup.4 is selected from CH and N; and

(269) R.sup.b is as previously defined.

(270) 111. A compound for use or a method according to any one of paragraphs 81 to 110, wherein each R.sup.b is independently selected from hydroxyl, ═O, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, —NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —OR.sup.d, —SR.sup.d, —S(═O).sub.2R.sup.d, —S(═O)R.sup.d, —S(═O)NR.sup.cR.sup.d, and S(═O).sub.2NR.sup.cR.sup.d, where said C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, and 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, ═O, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
112. A compound for use or a method according to any one of paragraphs 81 to 111, wherein each R.sup.b is independently selected from hydroxyl, ═O, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, —NR.sup.cR.sup.d, and —S(═O).sub.2R.sup.d, where said C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, and 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, ═O, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
113. A compound for use or a method according to any one of paragraphs 81 to 112, wherein each R.sup.b is independently selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
114. A compound for use or a method according to any one of paragraphs 81 to 113, wherein each R.sup.b is independently selected from fluoro, chloro, and CF.sub.3.
115. A compound for use or a method according to any one of paragraphs 81 to 114, wherein Q is selected from:

(271) ##STR00036##
116. A compound for use or a method according to any one of paragraphs 81 to 115, wherein R.sup.6 is selected from hydrogen, methyl and ethyl.
117. A compound for use or a method according to any one of paragraphs 81 to 116, wherein R.sup.6 is selected from hydrogen and methyl.
118. A compound for use or a method according to any one of paragraphs 81 to 117, wherein R.sup.7 and R.sup.7′ are independently selected from hydrogen, methyl and cyclopropyl.
119. A compound for use or a method according to any one of paragraphs 81 to 118, wherein R.sup.7 and R.sup.7′ are independently selected from hydrogen and methyl.
120. A compound for use or a method according to any one of paragraphs 81 to 119, wherein R.sup.7′ is hydrogen.
121. A compound for use or a method according to any one of paragraphs 81 to 117, wherein R.sup.7 and R.sup.7′, together with the atom to which they are attached form a C.sub.3-7 cycloalkyl ring, optionally substituted by one or more R.sup.8.
122. A compound for use or a method according to any one of paragraphs 81 to 117, wherein R.sup.7 and R.sup.7′, together with the atom to which they are attached form a cyclopropyl ring, optionally substituted by one or more R.sup.8.
123. A compound for use or a method according to any one of paragraphs 81 to 120, wherein R.sup.6 and R.sup.7′ are both hydrogen.
124. A compound for use or a method according to any one of paragraphs 81 to 120, wherein R.sup.6, R.sup.7 and R.sup.7′ are each hydrogen.
125. A compound for use or a method according to any one of paragraphs 81 to 115, wherein R.sup.6 and R.sup.7 together with the atoms to which they are attached form an azetidinyl, pyrrolidinyl, piperidinyl or morpholinyl ring.
126. A compound for use or a method according to any one of paragraphs 81 to 125, wherein n is 1 or 2.
127. A compound for use or a method according to any one of paragraphs 81 to 126, wherein n is 1.
128. A compound for use or a method according to any one of paragraphs 81 to 127, wherein R.sup.2 is selected from —CN, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —C(O)C(═O)R.sup.d, —NR.sup.cR.sup.d, —NR.sup.c(C.sub.1-6alkyl)NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —NR.sup.cC(═O)OR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d—OC(═O)R.sup.d, —OC(═O)NR.sup.cR.sup.d, —OC(═O)OR.sup.d, —S(═O)R.sup.d, —S(═O).sub.2R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, —S(═O).sub.2NR.sup.cR.sup.d, C.sub.1-10 haloalkyl, C.sub.1-10alkyl optionally substituted by 1-13 R.sup.e, C.sub.2-6alkenyl optionally substituted by 1-11 R.sup.e, C.sub.2-6alkynyl optionally substituted by 1-9 R.sup.e, C.sub.6-11aryl optionally substituted by 1-11 R.sup.e, (C.sub.7-16)alkylaryl optionally substituted by 1-9 R.sup.e, C.sub.6-11cycloalkyl optionally substituted by 1-21 R.sup.e, (C.sub.4-17)cycloalkylalkyl optionally substituted by 1-32 R.sup.e, 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.e, 4-21 membered alkylheterocycloalkyl optionally substituted by 1-40 R.sup.e, 5-15 membered heteroaryl optionally substituted by 1-15 R.sup.e, and 6-21 membered alkylheteroaryl optionally substituted by 1-27 R.sup.e;
129. A compound for use or a method according to any one of paragraphs 81 to 128, wherein R.sup.2 is selected from —CN, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —C(O)C(═O)R.sup.d, —NR.sup.cR.sup.d, —NR.sup.c(C.sub.1-6alkyl)NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —NR.sup.cC(═O)OR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d—OC(═O)R.sup.d, —OC(═O)NR.sup.cR.sup.d, —OC(═O)OR.sup.d, —S(═O)R.sup.d, —S(═O).sub.2R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, —S(═O).sub.2NR.sup.cR.sup.d, C.sub.1-10 haloalkyl, C.sub.1-10alkyl optionally substituted by 1-13 R.sup.e, C.sub.2-6alkenyl optionally substituted by 1-11 R.sup.e, C.sub.2-6alkynyl optionally substituted by 1-9 R.sup.e, C.sub.6-11aryl optionally substituted by 1-11 R.sup.e, (C.sub.7-16)alkylaryl optionally substituted by 1-9 R.sup.e, C.sub.3-11cycloalkyl optionally substituted by 1-21 R.sup.e, (C.sub.4-17)cycloalkylalkyl optionally substituted by 1-32 R.sup.e, 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.e, 4-21 membered alkylheterocycloalkyl optionally substituted by 1-40 R.sup.e, 5-15 membered heteroaryl optionally substituted by 1-15 R.sup.e, and 6-21 membered alkylheteroaryl optionally substituted by 1-27 R.sup.e;
130. A compound for use or a method according to any one of paragraphs 81 to 129, wherein R.sup.2 is selected from —CN, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —NR.sup.cR.sup.d, —NR.sup.c(C.sub.1-6alkyl)NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d—OC(═O)R.sup.d, —S(═O)R.sup.d, —S(═O).sub.2R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, —S(═O).sub.2NR.sup.cR.sup.d, C.sub.1-10 haloalkyl, C.sub.1-10alkyl optionally substituted by 1-13 R.sup.e, C.sub.6-11aryl optionally substituted by 1-11 R.sup.e, C.sub.3-11cycloalkyl optionally substituted by 1-21 R.sup.e, 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.e, and 5-15 membered heteroaryl optionally substituted by 1-15 R.sup.e.
131. A compound for use or a method according to any one of paragraphs 81 to 130, wherein R.sup.2 is selected from —CN, —C(═O)R.sup.d, C(═O)NR.sup.cR.sup.d, —NR.sup.cR.sup.d, —NR(C.sub.1-6alkyl)NR.sup.cR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d, —S(═O).sub.2R.sup.d, C.sub.1-10 haloalkyl, C.sub.1-10alkyl optionally substituted by 1-13 R.sup.e, C.sub.6-11aryl optionally substituted by 1-11 R.sup.e, C.sub.3-11cycloalkyl optionally substituted by 1-21 R.sup.e, 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.e, and 5-15 membered heteroaryl optionally substituted by 1-15 R.sup.e.
132. A compound for use or a method according to any one of paragraphs 81 to 131, wherein R.sup.2 is selected from NR.sup.cR.sup.d, —NR.sup.c(C.sub.1-6 alkyl)NR.sup.cR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d, C.sub.1-10 haloalkyl, C.sub.1-10alkyl optionally substituted by 1-13 R.sup.e, C.sub.6-11aryl optionally substituted by 1-11 R.sup.e, C.sub.3-11cycloalkyl optionally substituted by 1-21 R.sup.e, 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.e, and 5-15 membered heteroaryl optionally substituted by 1-15 R.sup.e.
133. A compound for use or a method according to any one of paragraphs 81 to 132, wherein R.sup.2 is selected from NR.sup.cR.sup.d, —NR.sup.c(C.sub.1-6alkyl)NR.sup.cR.sup.d, C.sub.1-10alkyl optionally substituted by 1-13 R.sup.e, C.sub.6-11aryl optionally substituted by 1-11 R.sup.e, C.sub.3-11cycloalkyl optionally substituted by 1-21 R.sup.e, 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.e, and 5-15 membered heteroaryl optionally substituted by 1-15 R.sup.e.
134. A compound for use or a method according to any one of paragraphs 81 to 133, wherein R.sup.2 is selected from NR.sup.cR.sup.d, —NR.sup.c(C.sub.1-6alkyl)NR.sup.cR.sup.d, C.sub.1-10alkyl optionally substituted by 1-13 R.sup.e, and 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.e. Suitably, R.sup.c is C.sub.1-6 alkyl, and R.sup.d is independently selected from C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
135. A compound for use or a method according to any one of paragraphs 81 to 134, wherein R.sup.2 is selected from NR.sup.cR.sup.d and a 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.e. Suitably, R.sup.c is C.sub.1-6 alkyl, and R.sup.d is independently selected from C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
136. A compound for use or a method according to any one of paragraphs 81 to 135, wherein R.sup.2 is selected from NR.sup.cR.sup.d and a 5-10 membered heterocycloalkyl optionally substituted by one or more R.sup.e. Suitably, R.sup.c is C.sub.1-6 alkyl, and R.sup.d is independently selected from C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
137. A compound for use or a method according to any one of paragraphs 81 to 136, wherein R.sup.2 is selected from NR.sup.cR.sup.d and a 5-7 membered heterocycloalkyl optionally substituted by one or more R.sup.e. Suitably, R.sup.c is C.sub.1-6 alkyl, and R.sup.d is independently selected from C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
138. A compound for use or a method according to any one of paragraphs 81 to 137, wherein R.sup.2 is selected from NR.sup.cR.sup.d, azetidinyl, pyrrolidinyl, piperidinyl, piperazinyl and morpholinyl, wherein said azetidinyl, pyrrolidinyl, piperidinyl, piperazinyl and morpholinyl are optionally substituted by one or more R.sup.e. Suitably, R.sup.c is C.sub.1-6 alkyl, and R.sup.d is independently selected from C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
139. A compound for use or a method according to any one of paragraphs 81 to 138, wherein R.sup.2 is selected from NR.sup.cR.sup.d; and

(272) ##STR00037##
each of which may optionally be substituted with one or more R.sup.e. Suitably, R.sup.c is C.sub.1-6 alkyl, and R.sup.d is independently selected from C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
140. A compound according to any one of paragraphs 81 to 139, or a salt or solvate thereof, wherein R.sup.2 is selected from

(273) ##STR00038##
each of which may optionally be substituted with one or more R.sup.e.
141. A compound according to any one of paragraphs 81 to 140, or a salt or solvate thereof, wherein R.sup.2 is selected from

(274) ##STR00039##
142. A compound for use or a method according to any one of paragraphs 81 to 141, wherein R.sup.6 is independently selected from hydroxyl, ═O, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, —NR.sup.cR.sup.d, where said C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, and 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, ═O, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
143. A compound for use or a method according to any one of paragraphs 81 to 142, wherein R.sup.6 is independently selected from hydroxyl, ═O, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
144. A compound for use or a method according to any one of paragraphs 81 to 143, wherein R.sup.e is independently selected from halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
145. A compound for use or a method according to any one of paragraphs 81 to 144, wherein R.sup.e is independently selected from halogen, CN, C.sub.1-3 haloalkyl, C.sub.1-3 haloalkoxy, C.sub.1-3 alkyl and O—C.sub.1-3 alkyl.
146. A compound for use or a method according to any one of paragraphs 81 to 145, wherein R.sup.e is independently selected from fluoro, chloro, CN, CF.sub.3, OCF.sub.3 and C.sub.1-3alkyl.
147. A compound for use or a method according to any one of paragraphs 81 to 146, wherein each R.sup.e is independently selected from fluoro, chloro, CN, CF.sub.3, OCF.sub.3, and methyl.
148. A compound for use or a method according any one of paragraphs 81 to 147, wherein each R.sup.c is independently selected from hydrogen, hydroxyl, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl; 149. A compound for use or a method according to any one of paragraphs 81 to 148, wherein each R.sup.c is independently selected from hydrogen and C.sub.1-6 alkyl, suitably C.sub.1-6 alkyl.
150. A compound for use or a method according to any one of paragraphs 81 to 149, wherein each R.sup.c is independently selected from hydrogen and C.sub.1-3 alkyl, suitably C.sub.1-3 alkyl.
151. A compound for use or a method according to any one of paragraphs 81 to 150, wherein each R.sup.d is independently selected from hydrogen, 3-7 membered heterocycloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
152. A compound for use or a method according to any one of paragraphs 81 to 151, wherein each R.sup.d is independently selected from 3-7 membered heterocycloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
153. A compound for use or a method according to any one of paragraphs 81 to 152, wherein each R.sup.d is independently selected from C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
154. A compound for use or a method according to any one of paragraphs 81 to 153, wherein R.sup.c and R.sup.d are independently selected from C.sub.1-6 alkyl.
155. A compound for use or a method according to any one of paragraphs 81 to 154, wherein R.sup.3, R.sup.4 and R.sup.5 are independently selected from hydrogen, halogen and C.sub.1-6 alkyl.
156. A compound for use or a method according to any one of paragraphs 81 to 155, wherein R.sup.3 is H.
157. A compound for use or a method according to any one of paragraphs 81 to 156, wherein R.sup.4 is H.
158. A compound for use or a method according to any one of paragraphs 81 to 157, wherein R.sup.5 is H.
159. A compound for use or a method according to any one of paragraphs 81 to 159, wherein R.sup.4 and R.sup.5 are H.
160. A compound for use or a method according to any one of paragraphs 81 to 159, wherein R.sup.3, R.sup.4 and R.sup.5 are H.
161. A compound for use or a method according to any one of paragraphs 97, which is a sub-Formula IIa:

(275) ##STR00040##
wherein,

(276) R.sup.6 is selected from hydrogen and C.sub.1-6 alkyl;

(277) R.sup.7 is selected from hydrogen, ═O, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, where said C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl are optionally substituted by one or more R.sup.a; or

(278) R.sup.6 and R.sup.7, together with the atoms to which they are attached form a 3-7 membered heterocyclic ring, optionally substituted with one or more R.sup.a;

(279) X.sup.4 is selected from CH and N;

(280) R.sup.2 is selected from —CN, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —C(O)C(═O)R.sup.d, —NR.sup.cR.sup.d, —NR.sup.c(C.sub.1-6alkyl)NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —NR.sup.cC(═O)OR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d—OC(═O)R.sup.d, —OC(═O)NR.sup.cR.sup.d, —OC(═O)OR.sup.d, —S(═O)R.sup.d, —S(═O).sub.2R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, —S(═O).sub.2NR.sup.cR.sup.d, C.sub.1-10 haloalkyl, C.sub.1-10alkyl optionally substituted by 1-13 R.sup.e, C.sub.2-6alkenyl optionally substituted by 1-11 R.sup.e, C.sub.2-6alkynyl optionally substituted by 1-9 R.sup.e, C.sub.6-11aryl optionally substituted by 1-11 R.sup.e, (C.sub.7-16)alkylaryl optionally substituted by 1-9 R.sup.e, C.sub.3-11cycloalkyl optionally substituted by 1-21 R.sup.e, (C.sub.4-17)cycloalkylalkyl optionally substituted by 1-32 R.sup.e, 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.e, 4-21 membered alkylheterocycloalkyl optionally substituted by 1-40 R.sup.e, 5-15 membered heteroaryl optionally substituted by 1-15 R.sup.e, and 6-21 membered alkylheteroaryl optionally substituted by 1-27 R.sup.e;

(281) each R.sup.a is independently selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, wherein said C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(282) each R.sup.b and R.sup.e is independently selected from hydroxyl, ═O, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, O—C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, 3-7 membered heterocycloalkyl, —C(═O)R.sup.d, —C(═O)OR.sup.d, —C(═O)NR.sup.cR.sup.d, —C(O)C(═O)R.sup.d, —NR.sup.cR.sup.d, —NR.sup.cC(═O)R.sup.d, —NR.sup.cC(═O)OR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —NR.sup.cS(═O).sub.2R.sup.d, —NR.sup.cS(═O).sub.2NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d, —OC(═O)R.sup.d, —OC(═O)NR.sup.cR.sup.d, —OC(═O)OR.sup.d, —S(═O).sub.2R.sup.d, —S(═O)R.sup.d, —OS(═O)R.sup.d, —OS(═O).sub.2R.sup.d, —OS(═O).sub.2OR.sup.d, —S(═O)NR.sup.cR.sup.d, —OS(═O).sub.2NR.sup.cR.sup.d, and —S(═O).sub.2NR.sup.cR.sup.d, where said C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl, and 3-7 membered heterocycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, ═O, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(283) each R.sup.c is independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl;

(284) each R.sup.d is independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, 3-7 membered heterocycloalkyl, C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl, C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, ═O, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl; or

(285) R.sup.c and R.sup.d, when attached to the same atom, together with the atom to which they are attached form a 3-7 membered ring, optionally substituted with one or more R.sup.a; and

(286) R.sup.4 and R.sup.5 are independently selected from hydrogen, hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.1-6 haloalkoxy, and C.sub.1-6 alkyl, optionally substituted by one or more R.sup.e.

(287) 162. A compound for use or a method according to paragraph 161, wherein R.sup.4 and R.sup.5 are hydrogen.

(288) 163. A compound for use or a method according to any one of paragraphs 161 to 162, wherein each R.sup.b is independently selected from fluoro, chloro, and CF.sub.3.

(289) 164. A compound for use or a method according to any one of paragraphs 161 to 163, wherein R.sup.6 and R.sup.7 are both hydrogen.

(290) 165. A compound for use or a method according to any one of paragraphs 161 to 164, wherein R.sup.2 is selected from —CN, —C(═O)R.sup.d, C(═O)NR.sup.cR.sup.d, —NR.sup.cR.sup.d, —NR.sup.c(C.sub.1-6alkyl)NR.sup.cR.sup.d, —NR.sup.cC(═O)NR.sup.cR.sup.d, —OR.sup.d, —SR.sup.d, —S(═O).sub.2R.sup.d, C.sub.1-10 haloalkyl, C.sub.1-10alkyl optionally substituted by 1-13 R.sup.e, C.sub.6-11aryl optionally substituted by 1-11 R.sup.e, C.sub.3-11cycloalkyl optionally substituted by 1-21 R.sup.e, 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.e, and 5-15 membered heteroaryl optionally substituted by 1-15 R.sup.e. Suitably, R.sup.c is C.sub.1-6 alkyl, and R.sup.d is independently selected from C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
166. A compound for use or a method according to any one of paragraphs 161 to 165, wherein R.sup.2 is selected from NR.sup.cR.sup.d, C.sub.1-10alkyl optionally substituted by 1-13 R.sup.e, and 3-15 membered heterocycloalkyl optionally substituted by 1-28 R.sup.e. Suitably, R.sup.c is C.sub.1-6 alkyl, and R.sup.d is independently selected from C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
167. A compound for use or a method according to any one of paragraphs 161 to 166, wherein R.sup.2 is selected from NR.sup.cR.sup.d; and

(291) ##STR00041##
each of which may optionally be substituted with one or more R.sup.e. Suitably, R.sup.c is C.sub.1-6 alkyl, and R.sup.d is independently selected from C.sub.3-6 cycloalkyl, C.sub.1-6 alkyl and C.sub.6-11 aryl, wherein said C.sub.1-6 alkyl, C.sub.6-11 aryl, 3-7 membered heterocycloalkyl and C.sub.3-6 cycloalkyl are optionally substituted with one or more groups selected from hydroxyl, halogen, CN, C.sub.1-6 haloalkyl, C.sub.3-6 cycloalkyl, C.sub.6-11 aryl, C.sub.1-6 alkyl and O—C.sub.1-6 alkyl.
168. A compound according to any one of paragraphs 161 to 167, or a salt or solvate thereof, wherein R.sup.2 is selected from

(292) ##STR00042##
each of which may optionally be substituted with one or more R.sup.e.
169. A compound according to any one of paragraphs 161 to 168, or a salt or solvate thereof, wherein R.sup.2 is selected from

(293) ##STR00043##
170. A compound for use or a method according to any one of paragraphs 161 to 169, wherein each R.sup.e is independently selected from fluoro, chloro, CN, CF.sub.3, OCF.sub.3, and methyl.
171. A compound for use or a method according to any one of paragraphs 161 to 170, wherein R.sup.c and R.sup.d are independently selected from C.sub.1-6 alkyl.
172. A compound for use or a method according to any one of paragraphs 161 to 171, wherein the compound is selected from: (3R)-3-methyl-4-(4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine 2-(3-(difluoromethyl)azetidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-((2R,3R)-2,3-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-isopropylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine N-(2-(trifluoromethyl)benzyl)-2-(3-(trifluoromethyl)pyrrolidin-1-yl)pyrido[2,3-d]pyrimidin-4-amine 2-(2,2-difluoro-7-azaspiro[3.5]nonan-7-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-oxa-5-azabicyclo[2.2.1]heptan-5-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-cyclopropylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 1-(4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)piperidine-3-carbonitrile 1-(4-((2-(trifluoromethyl)benzyl)amino)pyrido[2,3-d]pyrimidin-2-yl)azetidine-3-carbonitrile 2-(4,4-dimethylpiperidin-1-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-fluoropyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 1-(4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)piperidine-4-carbonitrile 2-(3-(trifluoromethyl)azetidin-1-yl)-4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidine 3-methyl-4-(4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine (S)-2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-(trifluoromethyl)azetidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4-chloropiperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4-chloropiperidin-1-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine N.sup.2-isopropyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine methanesulfonate 2-(4,4-difluoropiperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4-fluoropiperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3,3-difluoropyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine methanesulfonate 2-(3,3-difluoropyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine methanesulfonate 2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine N-isopropyl-4-(2-(2-(trifluoromethyl)phenyl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-amine N.sup.2-cyclopropyl-N.sup.2-methyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine 2-(2,2-dimethylazetidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine N.sup.2-(tert-butyl)-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.2,N.sup.4-dimethyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-cyclopropyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine methanesulfonate N.sup.2-cyclopropyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-cyclopropyl-N.sup.4-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidine-2,4-diamine N,2-dimethyl-N-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidin-4-amine N-ethyl-N-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine N.sup.2-isopropyl-N.sup.4-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidine-2,4-diamine 2-chloro-N-methyl-N-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine N.sup.2-isopropyl-N.sup.4-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidine-2,4-diamine methanesulfonate N.sup.2-isopropyl-N.sup.4-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.2-methyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine N.sup.2-isopropyl-N.sup.2-methyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine methanesulfonate N.sup.4-(2-fluoro-6-(trifluoromethyl)benzyl)-N.sup.2-isopropylpyrido[2,3-d]pyrimidine-2,4-diamine 2-(2-methylazetidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(pyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine N-isopropyl-N-methyl-4-(2-(2-(trifluoromethyl)phenyl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-amine 2-(4,4-difluoropiperidin-1-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 3-methyl-4-(4-(2-(2-(trifluoromethyl)phenyl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine 2-(4,4-difluoropiperidin-1-yl)-4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidine 2-(3,3-difluoropyrrolidin-1-yl)-4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidine 2-(4-(trifluoromethyl)piperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2,2-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3,3-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-methylmorpholino)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 4-methyl-1-(4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)piperidine-4-carbonitrile 2-(2,2-difluoro-7-azaspiro[3.5]nonan-7-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2,2-difluoro-7-azaspiro[3.5]nonan-7-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine methanesulfonate 2-(2-(trifluoromethyl)piperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2,2-difluoro-7-azaspiro[3.5]nonan-7-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 1-(4-((2-(trifluoromethyl)benzyl)amino)pyrido[2,3-d]pyrimidin-2-yl)piperidine-3-carbonitrile 2-((2S,5R)-2,5-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(6-oxa-9-azaspiro[4.5]decan-9-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-((3R)-3,5-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-cyclopropylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-((2S,5S)-2,5-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine (R)-2-(3-(difluoromethoxy)pyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine (S)-2-(3-(difluoromethoxy)pyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-(difluoromethyl)morpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 4-(4-((2-(trifluoromethyl)benzyl)amino)pyrido[2,3-d]pyrimidin-2-yl)morpholine-2-carbonitrile 2-((2R,3S)-2,3-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine (3S)-3-methyl-4-(4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine (3R)-3-methyl-4-(4-(2-(2-(trifluoromethyl)phenyl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine (3S)-3-methyl-4-(4-(2-(2-(trifluoromethyl)phenyl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine 2-(2-oxa-5-azabicyclo[4.1.0]heptan-5-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-oxa-5-azabicyclo[4.1.0]heptan-5-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine (S)-2-(3-methyl morpholino)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine (S)-2-(3-methylmorpholino)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine methanesulfonate 2-(4-chloropiperidin-1-yl)-4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3-d]pyrimidine N-((2-(trifluoromethyl)pyridin-3-yl)methyl)-2-(3-(trifluoromethyl)pyrrolidin-1-yl)pyrido[2,3-d]pyrimidin-4-amine 2-(2,2-dimethylmorpholino)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4-oxa-7-azaspiro[2.5]octan-7-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-(fluoromethyl)piperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine (2-(trifluoromethyl)pyridin-3-yl)metha 4-methyl-1-(4-((2-(trifluoromethyl)benzyl)amino)pyrido[2,3-d]pyrimidin-2-yl)piperidine-4-carbonitrile N-((2-(trifluoromethyl)pyridin-3-yl)methyl)-2-(2-(trifluoromethyl)pyrrolidin-1-yl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-chloropyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-oxa-5-azabicyclo[2.2.1]heptan-5-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4-(trifluoromethoxy)piperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4-(trifluoromethoxy)piperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine methanesulfonate 2-(3-(difluoromethyl)azetidin-1-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-(difluoromethyl)morpholino)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-(4-azaspiro[2.5]octan-4-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(3-(trifluoromethoxy)pyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(5-azaspiro[3.4]octan-5-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(2-((trifluoromethoxy)methyl)pyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 2-(6-oxa-3-azabicyclo[3.1.1]heptan-3-yl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 2-((3R)-3,5-dimethylmorpholino)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine.
173. A compound for use according to any one of paragraphs 81 to 88 when X.sup.1, X.sup.2 and X.sup.3 are CH, R.sup.4 is not Cl.
174. A method according to any one of paragraphs 89 to 96 wherein when X.sup.1, X.sup.2 and X.sup.3 are CH, R.sup.4 is not Cl.

(294) Though the present invention may relate to any compound or particular group of compounds defined herein by way of optional, preferred or suitable features or otherwise in terms of particular embodiments, the present invention may also relate to any compound or particular group of compounds that specifically excludes said optional, preferred or suitable features or particular embodiments.

(295) Suitably, the present invention excludes any individual compounds not possessing the biological activity defined herein.

(296) Salts and Solvates

(297) The compounds (including final products and intermediates) described herein may be isolated and used per se or may be isolated in the form of a salt, suitably pharmaceutically acceptable salts. It should be understood that the terms “salt(s)” and “salt form(s)” used by themselves or in conjunction with another term or terms encompasses all inorganic and organic salts, including industrially acceptable salts, as defined herein, and pharmaceutically acceptable salts, as defined herein, unless otherwise specified. As used herein, industrially acceptable salts are salts that are generally suitable for manufacturing and/or processing (including purification) as well as for shipping and storage, but may not be salts that are typically administered for clinical or therapeutic use. Industrially acceptable salts may be prepared on a laboratory scale, i.e. multi-gram or smaller, or on a larger scale, i.e. up to and including a kilogram or more.

(298) Pharmaceutically acceptable salts, as used herein, are salts that are generally chemically and/or physically compatible with the other ingredients comprising a formulation, and/or are generally physiologically compatible with the recipient thereof. Pharmaceutically acceptable salts may be prepared on a laboratory scale, i.e. multi-gram or smaller, or on a larger scale, i.e. up to and including a kilogram or more. It should be understood that pharmaceutically acceptable salts are not limited to salts that are typically administered or approved by the FDA or equivalent foreign regulatory body for clinical or therapeutic use in humans. A practitioner of ordinary skill will readily appreciate that some salts are both industrially acceptable as well as pharmaceutically acceptable salts. It should be understood that all such salts, including mixed salt forms, are within the scope of the application.

(299) In one embodiment, the compounds of Formula I and II are isolated as pharmaceutically acceptable salts.

(300) A suitable pharmaceutically acceptable salt of a compound of the invention is, for example, an acid-addition salt of a compound of the invention which is sufficiently basic, for example, an acid-addition salt with, for example, an inorganic or organic acid, for example hydrochloric, hydrobromic, sulfuric, phosphoric, trifluoroacetic, formic, citric or maleic acid. In addition a suitable pharmaceutically acceptable salt of a compound of the invention which is sufficiently acidic is an alkali metal salt, for example a sodium or potassium salt, an alkaline earth metal salt, for example a calcium or magnesium salt, an ammonium salt or a salt with an organic base which affords a physiologically-acceptable cation, for example a salt with methylamine, dimethylamine, trimethylamine, piperidine, morpholine or tris-(2-hydroxyethyl)amine.

(301) In general, salts of the present application can be prepared in situ during the isolation and/or purification of a compound (including intermediates), or by separately reacting the compound (or intermediate) with a suitable organic or inorganic acid or base (as appropriate) and isolating the salt thus formed. The degree of ionisation in the salt may vary from completely ionised to almost non-ionised. In practice, the various salts may be precipitated (with or without the addition of one or more co-solvents and/or anti-solvents) and collected by filtration or the salts may be recovered by evaporation of solvent(s). Salts of the present application may also be formed via a “salt switch” or ion exchange/double displacement reaction, i.e. reaction in which one ion is replaced (wholly or in part) with another ion having the same charge. One skilled in the art will appreciate that the salts may be prepared and/or isolated using a single method or a combination of methods.

(302) Representative salts include, but are not limited to, acetate, aspartate, benzoate, besylate, bicarbonate/carbonate, bisulphate/sulphate, borate, camsylate, citrate, edisylate, esylate, formate, fumarate, gluceptate, gluconate, glucuronate, hexafluorophosphate, hibenzate, hydrochloride/chloride, hydrobromide/bromide, hydroiodide/iodide, isethionate, lactate, malate, maleate, malonate, mesylate, methylsulphate, naphthylate, 2-napsylate, nicotinate, nitrate, orotate, oxalate, palmitate, pamoate, phosphate/hydrogen phosphate/dihydrogen phosphate, saccharate, stearate, succinate, tartrate, tosylate, trifluoroacetate and the like. Other examples of representative salts include alkali or alkaline earth metal cations such as sodium, lithium, potassium, calcium, magnesium, and the like, as well as non-toxic ammonium, quaternary ammonium and amine cations including, but not limited to, ammonium, tetramethylammonium, tetraethylammonium, lysine, arginine, benzathine, choline, tromethamine, diolamine, glycine, meglumine, olamine and the like.

(303) Certain compounds of the Formula I may exist in solvated as well as unsolvated forms such as, for example, hydrated forms. It is to be understood that the invention encompasses all such solvated forms that possess antiproliferative activity.

(304) Polymorphs

(305) It is also to be understood that certain compounds of the Formula I may exhibit polymorphism, and that the invention encompasses all such forms that possess antiproliferative activity.

(306) N-Oxides

(307) Compounds of the Formula I containing an amine function may also form N-oxides. A reference herein to a compound of the Formula I that contains an amine function also includes the N-oxide. Where a compound contains several amine functions, one or more than one nitrogen atom may be oxidised to form an N-oxide. Particular examples of N-oxides are the N-oxides of a tertiary amine or a nitrogen atom of a nitrogen-containing heterocycle. N-Oxides can be formed by treatment of the corresponding amine with an oxidizing agent such as hydrogen peroxide or a per-acid (e.g. a peroxycarboxylic acid), see for example Advanced Organic Chemistry, by Jerry March, 4.sup.th Edition, Wiley Interscience, pages. More particularly, N-oxides can be made by the procedure of L. W. Deady (Syn. Comm. 1977, 7, 509-514) in which the amine compound is reacted with m-chloroperoxybenzoic acid (mCPBA), for example, in an inert solvent such as dichloromethane.

(308) Tautomers

(309) Compounds of the Formula I may exist in a number of different tautomeric forms and references to compounds of the Formula I include all such forms. For the avoidance of doubt, where a compound can exist in one of several tautomeric forms, and only one is specifically described or shown, all others are nevertheless embraced by Formula I. Examples of tautomeric forms include keto-, enol-, and enolate-forms, as in, for example, the following tautomeric pairs: keto/enol (illustrated below), pyrimidone/hydroxypyrimidine, imine/enamine, amide/imino alcohol, amidine/amidine, nitroso/oxime, thioketone/enethiol, and nitro/aci-nitro.

(310) ##STR00044##
Isomers

(311) Compounds that have the same molecular formula but differ in the nature or sequence of bonding of their atoms or the arrangement of their atoms in space are termed “isomers”. Isomers that differ in the arrangement of their atoms in space are termed “stereoisomers”. Stereoisomers that are not mirror images of one another are termed “diastereomers” and those that are non-superimposable mirror images of each other are termed “enantiomers”. When a compound has an asymmetric center, for example, it is bonded to four different groups, a pair of enantiomers is possible. An enantiomer can be characterized by the absolute configuration of its asymmetric center and is described by the R- and S-sequencing rules of Cahn and Prelog, or by the manner in which the molecule rotates the plane of polarized light and designated as dextrorotatory or levorotatory (i.e., as (+) or (−)-isomers respectively). A chiral compound can exist as either individual enantiomer or as a mixture thereof. A mixture containing equal proportions of the enantiomers is called a “racemic mixture”.

(312) Certain compounds of Formula I may have one or more asymmetric centers and therefore can exist in a number of stereoisomeric configurations. Consequently, such compounds can be synthesized and/or isolated as mixtures of enantiomers and/or as individual (pure) enantiomers, and, in the case of two or more asymmetric centers, single diastereomers and/or mixtures of diastereomers. It should be understood that the present application includes all such enantiomers and diastereomers and mixtures thereof in all ratios.

(313) Isotopes

(314) The compounds of the present invention are described herein using structural formulas that do not specifically recite the mass numbers or the isotope ratios of the constituent atoms. As such it is intended that the present application includes compounds in which the constituent atoms are present in any ratio of isotope forms. For example, carbon atoms may be present in any ratio of .sup.12C, .sup.13C, and .sup.14C; hydrogen atoms may be present in any ratio of .sup.1H, .sup.2H, and .sup.3H; etc. Preferably, the constituent atoms in the compounds of the present invention are present in their naturally occurring ratios of isotope forms.

(315) Prodrugs and Metabolites

(316) The compounds of Formula I may be administered in the form of a pro-drug which is broken down in the human or animal body to release a compound of the invention. A pro-drug may be used to alter the physical properties and/or the pharmacokinetic properties of a compound of the invention. A pro-drug can be formed when the compound of the invention contains a suitable group or substituent to which a property-modifying group can be attached. Examples of pro-drugs include in vivo cleavable ester derivatives that may be formed at a carboxy group or a hydroxy group in a compound of the Formula I and in-vivo cleavable amide derivatives that may be formed at a carboxy group or an amino group in a compound of the Formula I.

(317) Accordingly, the present invention includes those compounds of the Formula I as defined hereinbefore when made available by organic synthesis and when made available within the human or animal body by way of cleavage of a pro-drug thereof. Accordingly, the present invention includes those compounds of the Formula I that are produced by organic synthetic means and also such compounds that are produced in the human or animal body by way of metabolism of a precursor compound, that is a compound of the Formula I may be a synthetically-produced compound or a metabolically-produced compound.

(318) A suitable pharmaceutically acceptable pro-drug of a compound of the Formula I is one that is based on reasonable medical judgement as being suitable for administration to the human or animal body without undesirable pharmacological activities and without undue toxicity.

(319) Various forms of pro-drug have been described, for example in the following documents:— a) Methods in Enzymology. Vol. 42, p. 309-396, edited by K. Widder, et al. (Academic Press, 1985); b) Design of Pro-drugs, edited by H. Bundgaard, (Elsevier, 1985); c) A Textbook of Drug Design and Development, edited by Krogsgaard-Larsen and H. Bundgaard, Chapter 5 “Design and Application of Pro-drugs”, by H. Bundgaard p. 113-191 (1991); d) H. Bundgaard, Advanced Drug Delivery Reviews, 8, 1-38 (1992); e) H. Bundgaard, et al., Journal of Pharmaceutical Sciences, 77, 285 (1988); f) N. Kakeya, et al., Chem. Pharm. Bull., 32, 692 (1984); g) T. Higuchi and V. Stella, “Pro-Drugs as Novel Delivery Systems”, A.C.S. Symposium Series, Volume 14; and h) E. Roche (editor), “Bioreversible Carriers in Drug Design”, Pergamon Press, 1987.

(320) A suitable pharmaceutically acceptable pro-drug of a compound of the Formula I that possesses a carboxy group is, for example, an in vivo cleavable ester thereof. An in vivo cleavable ester of a compound of the Formula I containing a carboxy group is, for example, a pharmaceutically acceptable ester which is cleaved in the human or animal body to produce the parent acid. Suitable pharmaceutically acceptable esters for carboxy include C.sub.1-6alkyl esters such as methyl, ethyl and tert-butyl, C.sub.1-6alkoxymethyl esters such as methoxymethyl esters, C.sub.1-6alkanoyloxymethyl esters such as pivaloyloxymethyl esters, 3-phthalidyl esters, C.sub.3-6 cycloalkylcarbonyloxy-C.sub.1-6 alkyl esters such as cyclopentylcarbonyloxymethyl and 1-cyclohexylcarbonyloxyethyl esters, 2-oxo-1,3-dioxolenylmethyl esters such as 5-methyl-2-oxo-1,3-dioxolen-4-ylmethyl esters and C.sub.1-6alkoxycarbonyloxy-C.sub.1-6alkyl esters such as methoxycarbonyloxymethyl and 1-methoxycarbonyloxyethyl esters.

(321) A suitable pharmaceutically acceptable pro-drug of a compound of the Formula I that possesses a hydroxy group is, for example, an in vivo cleavable ester or ether thereof. An in vivo cleavable ester or ether of a compound of the Formula I containing a hydroxy group is, for example, a pharmaceutically acceptable ester or ether which is cleaved in the human or animal body to produce the parent hydroxy compound. Suitable pharmaceutically acceptable ester forming groups for a hydroxy group include inorganic esters such as phosphate esters (including phosphoramidic cyclic esters). Further suitable pharmaceutically acceptable ester forming groups for a hydroxy group include C.sub.1-10alkanoyl groups such as acetyl, benzoyl, phenylacetyl and substituted benzoyl and phenylacetyl groups, C.sub.1-10alkoxycarbonyl groups such as ethoxycarbonyl, N,N—(C.sub.1-6).sub.2carbamoyl, 2-dialkylaminoacetyl and 2-carboxyacetyl groups. Examples of ring substituents on the phenylacetyl and benzoyl groups include aminomethyl, N-alkylaminomethyl, N,N-dialkylaminomethyl, morpholinomethyl, piperazin-1-ylmethyl and 4-(C.sub.1-4alkyl)piperazin-1-ylmethyl. Suitable pharmaceutically acceptable ether forming groups for a hydroxy group include α-acyloxyalkyl groups such as acetoxymethyl and pivaloyloxymethyl groups.

(322) A suitable pharmaceutically acceptable pro-drug of a compound of the Formula I that possesses a carboxy group is, for example, an in vivo cleavable amide thereof, for example an amide formed with an amine such as ammonia, a C.sub.1-4alkylamine such as methylamine, a (C.sub.1-4alkyl).sub.2amine such as dimethylamine, N-ethyl-N-methylamine or diethylamine, a C.sub.1-4 alkoxy-C.sub.2-4alkylamine such as 2-methoxyethylamine, a phenyl-C.sub.1-4alkylamine such as benzylamine and amino acids such as glycine or an ester thereof.

(323) A suitable pharmaceutically acceptable pro-drug of a compound of the Formula I that possesses an amino group is, for example, an in vivo cleavable amide derivative thereof. Suitable pharmaceutically acceptable amides from an amino group include, for example an amide formed with C.sub.1-10alkanoyl groups such as an acetyl, benzoyl, phenylacetyl and substituted benzoyl and phenylacetyl groups. Examples of ring substituents on the phenylacetyl and benzoyl groups include aminomethyl, N-alkylaminomethyl, N,N-dialkylaminomethyl, morpholinomethyl, piperazin-1-ylmethyl and 4-(C.sub.1-4alkyl)piperazin-1-ylmethyl.

(324) The in vivo effects of a compound of the Formula I may be exerted in part by one or more metabolites that are formed within the human or animal body after administration of a compound of the Formula I. As stated hereinbefore, the in vivo effects of a compound of the Formula I may also be exerted by way of metabolism of a precursor compound (a pro-drug).

(325) Pharmaceutical Compositions

(326) According to a further aspect of the invention there is provided a pharmaceutical composition which comprises a compound of the invention as defined hereinbefore, or a pharmaceutically acceptable salt, hydrate or solvate thereof, in association with a pharmaceutically acceptable diluent or carrier.

(327) The compositions of the invention may be in a form suitable for oral use (for example as tablets, lozenges, hard or soft capsules, aqueous or oily suspensions, emulsions, dispersible powders or granules, syrups or elixirs), for topical use (for example as creams, ointments, gels, or aqueous or oily solutions or suspensions), for administration by inhalation (for example as a finely divided powder or a liquid aerosol), for administration by insufflation (for example as a finely divided powder) or for parenteral administration (for example as a sterile aqueous or oily solution for intravenous, subcutaneous, intramuscular, intraperitoneal or intramuscular dosing or as a suppository for rectal dosing).

(328) The compositions of the invention may be obtained by conventional procedures using conventional pharmaceutical excipients, well known in the art. Thus, compositions intended for oral use may contain, for example, one or more colouring, sweetening, flavouring and/or preservative agents.

(329) An effective amount of a compound of the present invention for use in therapy is an amount sufficient to treat or prevent a proliferative condition referred to herein, slow its progression and/or reduce the symptoms associated with the condition.

(330) The amount of active ingredient that is combined with one or more excipients to produce a single dosage form will necessarily vary depending upon the individual treated and the particular route of administration. For example, a formulation intended for oral administration to humans will generally contain, for example, from 0.5 mg to 0.5 g of active agent (more suitably from 0.5 to 100 mg, for example from 1 to 30 mg) compounded with an appropriate and convenient amount of excipients which may vary from about 5 to about 98 percent by weight of the total composition.

(331) The size of the dose for therapeutic or prophylactic purposes of a compound of the Formula I will naturally vary according to the nature and severity of the conditions, the age and sex of the animal or patient and the route of administration, according to well known principles of medicine.

(332) It is to be noted that dosages and dosing regimens may vary with the type and severity of the condition to be alleviated, and may include the administration of single or multiple doses, i.e. QD (once daily), BID (twice daily), etc., over a particular period of time (days or hours). It is to be further understood that for any particular subject or patient, specific dosage regimens may need to be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the pharmaceutical compositions. For example, doses may be adjusted based on pharmacokinetic or pharmacodynamic parameters, which may include clinical effects such as toxic effects and/or laboratory values. Thus, the present application encompasses intra-patient dose-escalation as determined by the person skilled in the art. Procedures and processes for determining the appropriate dosage(s) and dosing regimen(s) are well-known in the relevant art and would readily be ascertained by the skilled artisan. As such, one of ordinary skill would readily appreciate and recognize that the dosage ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the pharmaceutical compositions described herein.

(333) In using a compound of the invention for therapeutic or prophylactic purposes it will generally be administered so that a daily dose in the range, for example, 0.1 mg/kg to 75 mg/kg body weight is received, given if required in divided doses. In general lower doses will be administered when a parenteral route is employed. Thus, for example, for intravenous or intraperitoneal administration, a dose in the range, for example, 0.1 mg/kg to 30 mg/kg body weight will generally be used. Similarly, for administration by inhalation, a dose in the range, for example, 0.05 mg/kg to 25 mg/kg body weight will be used. Oral administration may also be suitable, particularly in tablet form. Typically, unit dosage forms will contain about 0.5 mg to 0.5 g of a compound of this invention.

(334) Therapeutic Uses and Applications

(335) In another aspect, the present invention provides a compound of Formula I or II as defined herein, or a pharmaceutically acceptable salt or solvate thereof, or a pharmaceutical composition as defined herein, for use in therapy.

(336) In another aspect, the present invention provides a compound of Formula I or II as defined herein, or a pharmaceutically acceptable salt or solvate thereof, or a pharmaceutical composition as defined herein, for use in the treatment or prevention of a filarial worm infection.

(337) In another aspect, the present invention provides a compound of Formula I or II as defined herein, or a pharmaceutically acceptable salt or solvate thereof, or a pharmaceutical composition as defined herein, for use in the treatment or prevention of a disease or condition mediated by a filarial worm infection.

(338) In another aspect, the present invention provides a compound of Formula I or II as defined herein, or a pharmaceutically acceptable salt or solvate thereof, or a pharmaceutical composition as defined herein, for use in the treatment of a microbial infection.

(339) In one embodiment, the present invention provides a compound of Formula I or II as defined herein, or a pharmaceutically acceptable salt or solvate thereof, or a pharmaceutical composition as defined herein, for use in the treatment of filariasis, suitably lymphatic filariasis, or onchocerciasis.

(340) In another aspect, the present invention provides the use of a compound of Formula I or II as defined herein, or a pharmaceutically acceptable salt or solvate thereof, in the manufacture of a medicament for the treatment or prevention of a filarial worm infection.

(341) In another aspect, the present invention provides the use of a compound of Formula I or II as defined herein, or a pharmaceutically acceptable salt or solvate thereof, in the manufacture of a medicament for the treatment or prevention of a disease or condition mediated by a filarial worm infection.

(342) In another aspect, the present invention provides the use of a compound of Formula I or II as defined herein, or a pharmaceutically acceptable salt or solvate thereof, in the manufacture of a medicament for the treatment of a microbial infection.

(343) In another aspect, the present invention provides a method of treating or preventing a filarial worm infection, said method comprising administering to a subject in need thereof an effective amount of a compound of Formula I or II as defined herein, or a pharmaceutically acceptable salt or solvate thereof.

(344) In another aspect, the present invention provides a method of treating or preventing a disease mediated by a filarial worm infection, said method comprising administering to a subject in need thereof an effective amount of a compound of Formula I or II as defined herein, or a pharmaceutically acceptable salt or solvate thereof.

(345) In another aspect, the present invention provides a method of treating a microbial infection, said method comprising administering to a subject in need thereof a therapeutically effective amount of a compound of Formula I or II as defined herein, or a pharmaceutically acceptable salt or solvate thereof, or a pharmaceutical composition as defined herein.

(346) In each of the above aspects or embodiments, the subject or patient treated is suitably a carrier of a filarial worm infection. In each of the above aspects or embodiments, the subject or patient treated is suitably a human.

(347) In another aspect, the present invention provides a combination comprising a compound of Formula I or II, or a pharmaceutically acceptable salt or solvate thereof, as defined herein, with one or more additional therapeutic agents.

(348) In each of the above aspects, in one embodiment, the infection is with one or more filarial worms selected from Wuchereria bancrofti. Brugia malayi, Brugia timori and Onchocerca volvulus.

(349) In each of the above aspects, in another embodiment, the infection is with one or more filarial worms selected from Wuchereria bancrofti, Brugia malayi and Brugia timori.

(350) In each of the above aspects, in another embodiment, the infection is with one or more filarial worms selected from Onchocerca volvulus.

(351) In each of the above aspects, in one embodiment, the disease or condition is mediated by a filarial worm infection with one or more filarial worms selected from Wuchereria bancrofti, Brugia malayi, Brugia timori and Onchocerca volvulus.

(352) In each of the above aspects, in another embodiment, the disease or condition is mediated by a filarial worm infection with one or more filarial worms selected from Wuchereria bancrofti, Brugia malayi and Brugia timori.

(353) In each of the above aspects, in another embodiment, the disease or condition is mediated by a filarial worm infection with one or more filarial worms selected from Onchocerca volvulus.

(354) In each of the above aspects, in another embodiment, the disease or condition is filariasis, suitably lymphatic filariasis.

(355) In each of the above aspects, in another embodiment, the disease or condition is selected from onchocerciasis or lymphatic filariasis.

(356) In each of the above aspects, in one embodiment, the microbial infection is a bacterial infection.

(357) In each of the above aspects, in another embodiment, the microbial infection is Wolbachia infection.

(358) Routes of Administration

(359) The compounds of the invention or pharmaceutical compositions comprising these compounds may be administered to a subject by any convenient route of administration, whether systemically/peripherally or topically (i.e., at the site of desired action).

(360) Routes of administration include, but are not limited to, oral (e.g., by ingestion); buccal; sublingual; transdermal (including, e.g., by a patch, plaster, etc.); transmucosal (including, e.g., by a patch, plaster, etc.); intranasal (e.g., by nasal spray); ocular (e.g., by eye drops); pulmonary (e.g., by inhalation or insufflation therapy using, e.g., via an aerosol, e.g., through the mouth or nose); rectal (e.g., by suppository or enema); vaginal (e.g., by pessary); parenteral, for example, by injection, including subcutaneous, intradermal, intramuscular, intravenous, intra-arterial, intracardiac, intrathecal, intraspinal, intracapsular, subcapsular, intraorbital, intraperitoneal, intratracheal, subcuticular, intraarticular, subarachnoid, and intrasternal; by implant of a depot or reservoir, for example, subcutaneously or intramuscularly.

EXAMPLES

(361) Chemistry

(362) The following examples are provided solely to illustrate the present invention and are not intended to limit the scope of the invention, as described herein.

(363) The compounds of the invention may be prepared using synthetic techniques that are known in the art (as illustrated by the examples herein).

(364) Several methods for the chemical synthesis of the compounds of the present application are described herein. These and/or other well-known methods may be modified and/or adapted in various ways in order to facilitate the synthesis of additional compounds within the scope of the present application and claims. Such alternative methods and modifications should be understood as being within the spirit and scope of this application and claims. Accordingly, it should be understood that the methods set forth in the following descriptions, schemes and examples are intended for illustrative purposes and are not to be construed as limiting the scope of the disclosure.

(365) Synthesis and Characterisation

(366) .sup.1H Nuclear Magnetic Resonance spectra were recorded on Bruker (300, 400 or 500 MHz) NMR spectrometers. Data analysis are reported as follows: chemical shift relative to TMS (δ, ppm), multiplicity (s=singlet, d=doublet, t=triplet, m=multiplet), coupling constant (J, Hz), integration.

(367) High resolution mass spectrometry (HRMS) was recorded on a VG analytical 7070E machine and Fisons TRIO spectrometers using electron ionisation (EI) and chemical ionisation (Cl). LCMS was performed and recorded on Agilent 1200\G6110A or 1100\G1956A (LC) and SHIMADZU LCMS-2020 (MS) using electron spread ionisation (ESI). Data was reported as follows: (ionization method) main peak shift.

(368) General Synthetic Route 1 (Route 1):

(369) ##STR00045##

Example 1

Preparation of 2-chloro-N-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine

(370) ##STR00046##

(371) To a suspension of 2,4-dichlorothieno[3,2-d]pyrimidine (205 mg, 1.0 mmol) in THF (5 ml), 2-(trifluoromethyl)-benzylamine (214 mg, 0.17 ml, 1.2 mmol, 1.2 eq) and triethylamine (0.28 ml, 2.0 mmol, 2.0 eq) were added. The resulting mixture was heated to 65° C. for 3 hours. After cooled down to room temperature, ice-water (50 ml) was added to the reaction mixture, and the resulting mixture was kept stirring for 5˜10 min. The precipitation was collected by filtration, washed with water and redissolved with EtOAc. The solution was dried with MgSO.sub.4, and concentrated under vacuum to give the product 2-chloro-N-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine (330 mg, >95%) as a pale yellow solid. The product was used directly in the next step without any further purification.

Preparation of N.SUP.2.-isopropyl-N.SUP.4.-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidine-2,4-diamine

(372) ##STR00047##

(373) To the suspension of 2-chloro-N-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine (330 mg) in 1,4-dioxane (5 ml), isopropylamine (0.60 g, 0.87 ml, 10 mmol, 10 eq.) was heated to 120° C. in seal-tube for 48 hours. After that, 1,4-dioxane and the excess isopropylamine was removed under vacuum. The residue was purified by flash column chromatograph eluting with 5-10% MeOH in DCM to give the product N.sup.2-isopropyl-N.sup.4-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidine-2,4-diamine (175 mg, 48%) as an off-white solid.

(374) General Synthetic Route 2 (Route 2):

(375) ##STR00048##

Example 2

Preparation of 2-methyl-N-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine

(376) ##STR00049##

(377) To a suspension of 4-chloro-2-methylthieno[3,2-d]pyrimidine (185 mg, 1.0 mmol) in THF (5 ml), 2-(trifluoromethyl)-benzylamine (214 mg, 0.17 ml, 1.2 mmol, 1.2 eq) and triethylamine (0.28 ml, 2.0 mmol, 2.0 eq) were added. The resulting mixture was heated to 75° C. for 36 hours. After cooled down to room temperature, ice-water (50 ml) was added to the reaction mixture, and the resulting mixture was kept stirring for 5-10 min. The precipitation was collected by filtration, washed with water and redissolved with EtOAc. The solution was dried with MgSO.sub.4, and concentrated under vacuum to give the crude product. The crude was further purified by flash column chromatograph to give the product 2-methyl-N-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine (150 mg, 46%) as a pale yellow solid.

(378) General Synthetic Route 3 (Route 3):

(379) ##STR00050##

Example 3

Preparation of 4-chloro-6-iodothieno[3,2-d]pyrimidine

(380) ##STR00051##

(381) The reaction was performed in anhydrous conditions and under nitrogen. 4-chlorothieno[3,2-d]pyrimidine (5 mmol, 850 mg) was dissolved in anhydrous THF (25 ml) in a 100 ml round bottomed flask. The mixture was cooled with dry-ice/acetone bath for 10 minutes. LDA 2M (1.2 eq, 6 mmol, in THF) was added drop-wise to the mixture. The mixture was left to react for half an hour. I.sub.2 (1.3 eq, 6.5 mmol) was dissolved in anhydrous THF (10 ml) and the mixture was slowly added to the reaction. After an hour the cold bath was removed and the mixture was left to stir for 2 more hours. Work up: H.sub.2O (2 ml) was added to quench the reaction. The solvent was removed to dryness. H.sub.2O (100 ml) was added to the residue and the mixture was stirred for 30 minutes. The precipitate was collected through filtration. The solid was washed with a Na.sub.2S.sub.2O.sub.3 solution to remove the excess I.sub.2. Purification: the product was dissolved in DCM and purified by silica filtration (5% EtOAc in DCM, 10% EtOAc in DCM). Product: 4-chloro-6-iodothieno[3,2-d]pyrimidine, 0.85 g, yield=57%, white solid. .sup.1H NMR (400 MHz, DMSO) δ 8.97 (s, 1H), 8.14 (s, 1H).

Preparation of 6-iodo-N-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidin-4-amine

(382) ##STR00052##

(383) The reaction was performed under nitrogen atmosphere. 4-chloro-6-iodothieno[3,2-d]pyrimidine (2.7 mmol, 800 mg), diisopropylethylamine (2 eq, 0.94 ml), α-methyl-2-trifluoromethylbenzylamine (1.2 eq, 620 mg) and 1-butanol (15 ml) were placed in a sealed tube and heated to 110° C. overnight. The solvent was evaporated in vacuo. Purification: the product was purified by flash column chromatography (2% EtOAc in DCM). Product: 6-iodo-N-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidin-4-amine, 1.00 g, yield=81%, pale yellow solid. .sup.1H NMR (400 MHz, CDCl3) δ 8.46 (s, 1H), 7.69 (d, J=7.8 Hz, 1H), 7.60 (d, J=7.4 Hz, 2H), 7.54 (t, J=7.5 Hz, 1H), 7.38 (t, J=7.6 Hz, 1H), 5.81 (p, J=6.7 Hz, 1H), 4.95 (d, J=5.9 Hz, 1H), 1.65 (d, J=6.7 Hz, 3H).

Preparation of 6-phenyl-N-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidin-4-amine

(384) ##STR00053##

(385) The reaction was performed in anhydrous conditions and under nitrogen atmosphere. 6-iodo-N-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidin-4-amine (1 mmol, 450 mg), phenylboronic acid (1.5 eq, 180 mg), and KaPO.sub.4 (4 eq, 850 mg) were placed in a 50 ml flask. Anhydrous toluene (20 ml) was added. The reaction was degassed using a nitrogen-vacuum line and stirred. Pd(PPh.sub.3).sub.4 (0.05 eq, 60 mg) was added to the mixture. After completion the reaction was left to cool down at room temperature. Purification: the product was purified by silica filtration (50% EtOAc in Hexane) and then by flash column chromatography (30% EtOAc in Hexane). Product: 6-phenyl-N-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidin-4-amine, 0.28 g, yield=70%, pale yellow solid.

(386) General Synthetic Route 4 (Route 4):

(387) ##STR00054##

Example 4

Preparation of 2-chloro-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)quinazolin-4-amine

(388) ##STR00055##

(389) A mixture of [2-(trifluoromethyl)-3-pyridyl]methanamine (176 mg, 1.00 mmol, 1.00 eq), 2,4-dichloroquinazoline (200 mg, 1.00 mmol, 1.00 eq) and Et.sub.3N (202 mg, 2.00 mmol, 2.00 eq) in THF (10.00 mL) was stirred at 10-20° C. for 12 hours. LCMS showed all of 2,4-dichloroquinazoline was consumed and a new peak with desired MS. The mixture was concentrated to give a residue. The residue was triturated with EtOAc (2 mL). 2-chloro-N-[[2-(trifluoromethyl)-3-pyridyl]methyl]quinazolin-4-amine (110 mg, 195 umol, 19% yield, 60% purity) was obtained as a light yellow solid.

Preparation of N.SUP.2.-isopropyl-N.SUP.4.-((2-(trifluoromethyl)pyridin-3-yl)methyl)quinazoline-2,4-diamine

(390) ##STR00056##

(391) A mixture of propan-2-amine (31 mg, 530 umol, 2.99 eq), 2-chloro-N-[[2-(trifluoromethyl)-3-pyridyl]methyl]quinazolin-4-amine (100 mg, 177 umol, 1.00 eq) and TEA (54 mg, 531 umol, 3.00 eq) in DMSO (2.00 mL) was stirred at 110° C. for 12 hours. LCMS showed all of 2-chloro-N-[[2-(trifluoromethyl)-3-pyridyl]methyl]quinazolin-4-amine was consumed and a new peak with desired MS. TLC (EtOAc/MeOH=15/1) showed all of 2-chloro-N-[[2-(trifluoromethyl)-3-pyridyl]methyl]quinazolin-4-amine was consumed and a new spot. The mixture was diluted with water (10 mL) and extracted with EtOAc (20 mL*3). The organic layer was dried over Na.sub.2SO.sub.4 and concentrated to give a residue. The residue was purified by prep-TLC (EtOAc/MeOH=15/1). N.sup.2-isopropyl-N.sup.4-[[2-(trifluoromethyl)-3-pyridyl]methyl]quinazoline-2,4-diamine (20 mg, 54 umol, 30% yield, 98% purity) was obtained as a light yellow solid.

(392) General Synthetic Route 5 (Route 5):

(393) ##STR00057##

Example 5

Preparation of N-(4-fluoro-2-(trifluoromethyl)benzyl)-2-methylquinazolin-4-amine

(394) ##STR00058##

(395) To a suspension of 4-chloro-2-methylquinazoline (188 mg, 1.0 mmol) in nBuOH (5 ml), 4-Fluoro-2-(trifluoromethyl)-benzylamine (239 mg, 1.2 mmol, 1.2 eq) and diisopropylethylamine (0.35 ml, 2.0 mmol, 2.0 eq) were added. The resulting mixture was heated to 120° C. for 12 hours. After cooled down to room temperature, ice-water (50 ml) was added to the reaction mixture, and the resulting mixture was kept stirring for 5-10 min. The precipitation was collected by filtration and dried to give the crude product. The crude was further purified by flash column chromatograph to give the product N-(4-fluoro-2-(trifluoromethyl)benzyl)-2-methylquinazolin-4-amine (170 mg, 50%) as an off-white solid.

(396) General Synthetic Route 6 (Route 6):

(397) ##STR00059##

Example 6

Preparation of 2-chloro-N-((2-(trifluoromethyl)pyridin-4-amine

(398) ##STR00060##

(399) To a mixture of [2-(trifluoromethyl)-3-pyridyl]methanamine (118.00 g, 549.34 mmol, 1.00 eq) and 2,4-dichloropyrido[2,3-d]pyrimidine (109.88 g, 549.34 mmol, 1.00 eq) in THF (200.00 mL) was added TEA (111.17 g, 1.10 mol, 152.29 mL, 2.00 eq) at 0° C. The mixture was stirred at 20° C. for 3 h. TLC (Ethyl acetate:Petroleum ether=2:1) showed a major new spot. The mixture was concentrated to remove half of solvent. The resultant mixture was diluted with H.sub.2O (200 mL), then filtered to collected the yellow solid. The yellow solid was triturated from Ethyl acetate:Petroleum ether (2:1, 30 mL) and dried under high vacuum to give 2-chloro-N-[[2-(trifluoromethyl)-3-pyridyl]methyl]pyrido[2,3-d]pyrimidin-4-amine (161.00 g, 469.21 mmol, 85% yield, 99% purity) as a white solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 9.62 (s, 1H), 9.02 (d, J=2.8 Hz, 1H), 8.78-8.80 (d, J=8.0 Hz, 1H), 8.65-8.66 (d, J=4.0 Hz, 1H), 8.04-8.06 (d, J=8.0 Hz, 1H), 7.61-7.70 (m, 2H), 4.94-4.95 (d, J=4.0 Hz, 1H).

Preparation of 2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine

(400) ##STR00061##

(401) To a mixture of 2-chloro-N-[[2-(trifluoromethyl)-3-pyridyl]methyl]pyrido[2,3-d]pyrimidin-4-amine (14.35 g, 42.24 mmol, 1.00 eq) and DIEA (10.92 g, 84.48 mmol, 14.76 mL, 2.00 eq) in DMSO (150.00 mL) was added 3-methylmorpholine (5.12 g, 50.68 mmol, 1.2 eq). The mixture was stirred at 90° C. for 16 h. LCMS showed a major peak with desired mass. The mixture was diluted with H.sub.2O (300 mL) and the resulted mixture was stirred at 20° C. for 3 h. LCMS showed 88% of a major peak with desired mass. The mixture was filtered to collect the light yellow solid. The light yellow solid was trituration with Petroleum ether. Ethyl acetate (1:1, 50 mL), followed by filtration and the solid was dried under high vacuum to give crude product (16 g). Then the crude product was trituration with MeCN (120.00 mL) at 20° C. for 12 h. The mixture was filtered to collect the solid which was dried under high vacuum to give 2-(3-methylmorpholin-4-yl)-N-[[2-(trifluoromethyl)-3-pyridyl]methyl]pyrido[2,3-d]pyrimidin-4-amine (12.60 g, 30.78 mmol, 78% yield, 98.1% purity) as a light yellow solid.

(402) General Synthetic Route 7 (Route 7):

(403) ##STR00062##

Example 7

Preparation of 2-chloro-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[3,2-d]pyrimidin-4-amine

(404) ##STR00063##

(405) A mixture of [2-(trifluoromethyl)-3-pyridyl]methanamine (132 mg, 750 umol, 1.00 eq), 2,4-dichloropyrido[3,2-d]pyrimidine (150 mg, 750 umol, 1.00 eq) and Et.sub.3N (152 mg, 1.50 mmol, 2.00 eq) in THF (10.00 mL) was stirred at 10-20° C. for 12 hours. LCMS showed all of 2,4-dichloropyrido[3,2-d]pyrimidine was consumed and a new peak with desired MS. The mixture was concentrated to give a residue. The residue was triturated with EtOAc (2 mL). 2-chloro-N-[[2-(trifluoromethyl)-3-pyridyl]methyl]pyrido[3,2-d]pyrimidin-4-amine (120 mg, 177 umol, 23% yield, 50% purity) was obtained as an off-white solid.

Preparation of N.SUP.2.-isopropyl-N.SUP.4.-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[3,2-d]pyrimidine-2,4-diamine

(406) ##STR00064##

(407) A mixture of propan-2-amine (31 mg, 530 umol, 3.00 eq), 2-chloro-N-[[2-(trifluoromethyl)-3-pyridyl]methyl]pyrido[3,2-d]pyrimidin-4-amine (120 mg, 177 umol, 1.00 eq) and TEA (54 mg, 530 umol, 3.00 eq) in DMSO (2.00 mL) was stirred at 110° C. for 5 hours. LCMS showed all of 2-chloro-N-[[2-(trifluoromethyl)-3-pyridyl]methyl]pyrido[3,2-d]pyrimidin-4-amine was consumed and a new major peak with desired MS. 2 mL water was added to the mixture and filtered. The precipitate was washed with 0.5 mL EtOAc and dried. N.sup.2-isopropyl-N.sup.4-[[2-(trifluoromethyl)-3-pyridyl]methyl]pyrido[3,2-d]pyrimidine-2,4-diamine (44 mg, 122 umol, 68% yield, 99.2% purity) was obtained as a light yellow solid.

(408) General Synthetic Route 8 (Route 8)

(409) ##STR00065##

Example 8

Preparation of N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine

(410) ##STR00066##

(411) To a solution of 4-chloropyrido[2,3-d]pyrimidine (100 mg, 604 umol, 1.00 eq) and [2-(trifluoromethyl)-3-pyridyl]methanamine (160 mg, 906 umol, 1.50 eq) in THF (5.00 mL) was added TEA (122 mg, 1.21 mmol, 167 uL, 2.00 eq). The reaction mixture was stirred at 15° C. for 3 h. TLC (Dichloromethane:Methanol=10:1) showed 4-chloropyrido[2,3-d]pyrimidine was consumed completely and a new spot was formed. The mixture was diluted with water (5 mL) and a lot of white solid was precipitated out. The mixture was filtered and the filter cake was washed with water (15 mL) and dried in vacuo to give N-[[2-(trifluoromethyl)-3-pyridyl] methyl]pyrido[2,3-d]pyrimidin-4-amine (36 mg, 117 umol, 19% yield, 100% purity) as a white solid.

(412) General Synthetic Route 9 (Route 9):

(413) ##STR00067##

Example 9

Preparation of 4-chloro-N-isopropyl-1,8-naphthyridin-2-amine

(414) ##STR00068##

(415) To a solution of 2,4-dichloro-1,8-naphthyridine (50 mg, 251 umol, 1 eq) and propan-2-amine (22 mg, 377 umol, 32 uL, 1.5 eq) in dioxane (6 mL) was added TEA (51 mg, 502 umol, 69 uL, 2 eq). The mixture was stirred at 90° C. for 16 hours. TLC (Petroleum ether:EtOAc=1:1) showed that 2,4-dichloro-1,8-naphthyridine was consumed completely and several new spots. LCMS showed that a major peak of desired product's MS was detected. The mixture was concentrated directly. The residue was purified by trituration from (H.sub.2O:Petroleum ether:EtOAc=10:10:1) to obtain compound 4-chloro-N-isopropyl-1,8-naphthyridin-2-amine (35 mg, 158 umol, 63% yield) as a light brown solid. 1H NMR (400 MHz, CDCl3-d) 6 ppm 8.83 (dd, J=4.4, 1.6 Hz, 1H), 8.28 (dd, J=8.0, 1.9 Hz, 1H), 7.20 (dd, J=8.0, 4.5 Hz, 1H), 6.76 (s, 1H), 4.95 (br. s., 1H), 4.44 (d, J=5.6 Hz, 1H), 1.29 (d, J=6.5 Hz, 6H).

Preparation of N.SUP.2.-isopropyl-N.SUP.4.-((2-(trifluoromethyl)pyridin-3-yl)methyl)-1,8-naphthyridine-2,4-diamine

(416) ##STR00069##

(417) A mixture of 4-chloro-N-isopropyl-1,8-naphthyridin-2-amine (150 mg, 676.6 umol, 1 eq) and [2-(trifluoromethyl)-3-pyridyl]methanamine (1.2 g, 6.8 mmol, 10 eq) was stirred at 180° C. for 0.5 hour under microwave and N.sub.2. TLC (EtOAc) showed that 4-chloro-N-isopropyl-1,8-naphthyridin-2-amine was consumed completely and several new spots. LCMS showed that several peaks and 20% of desired product. To the mixture was added water (40 mL) and extracted with EtOAc (40 mL*2). The organic layers were washed with brine (40 mL), dried over Na.sub.2SO.sub.4 and concentrated. The residue was purified by prep-TLC (EtOAc). Then the crude product was further purified by prep-HPLC (Column: Phenomenex Synergi C18 150*30 mm4 um; Condition: water (0.225% FA)-ACN). The salt product was basified by strong basic anion exchange resin. Then the residue was purified by prep-TLC (Dichloromethane:Methanol=10:1) to obtain N.sup.2-isopropyl-N.sup.4-[[2-(trifluoromethyl)-3-pyridyl]methyl]-1,8-naphthyridine-2,4-diamine (5.4 mg, 15 umol, 2% yield) as a light yellow solid.

(418) General Synthetic Route 10 (Route 10):

(419) ##STR00070##

Example 10

Preparation of N.SUP.4.-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine

(420) ##STR00071##

(421) To a mixture of 2-chloro-N-[[2-(trifluoromethyl)-3-pyridyl]methyl]pyrido[2,3-d]pyrimidin-4-amine (50 mg, 147 umol, 1.00 eq) in DMSO (2.00 mL) was added NH.sub.3.H.sub.2O (10 mg, 294 umol, 11 uL, 2.00 eq). The mixture was stirred at 95° C. for 12 h. TLC (Ethyl acetate) showed most of 2-chloro-N-[[2-(trifluoromethyl)-3-pyridyl]methyl]pyrido[2,3-d]pyrimidin-4-amine was consumed and a major new spot. The mixture was diluted with water (10 mL). The precipitate was collected by filtration and purified by triturated from EtOAc (1 mL) to give N.sup.4-[[2-(trifluoromethyl)-3-pyridyl]methyl]pyrido[2,3-d]pyrimidine-2,4-diamine (20 mg, 62 umol, 42% yield) as a light yellow solid. .sup.1H NMR (300 MHz, DMSO-d6) δ ppm 8.62-8.67 (m, 3H), 8.40-8.43 (dd, J=6.0 Hz, J=3.0 Hz, 1H), 7.96-7.99 (d, J=9.0 Hz, 1H), 7.65-7.70 (dd, J=6.0 Hz, J=3.0 Hz, 1H), 7.05-7.09 (dd, J=6.0 Hz, J=3.0 Hz, 1H), 6.44 (bs, 2H), 4.90-4.92 (d, J=6.0 Hz, 2H).

Preparation of 1-(4-fluorophenyl)-3-(4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)urea

(422) ##STR00072##

(423) A mixture of N.sup.4-[[2-(trifluoromethyl)-3-pyridyl]methyl]pyrido[2,3-d]pyrimidine-2,4-diamine (100 mg, 312 umol, 1.00 eq), 1-fluoro-4-isocyanato-benzene (128 mg, 937 umol, 105 uL, 3.00 eq) in dioxane (2.00 mL) was stirred at 120° C. under microwave for 30 min. TLC (Ethyl acetate:Petroleum ether=2:1) showed most of N.sup.4-[[2-(trifluoromethyl)-3-pyridyl]methyl]pyrido[2,3-d]pyrimidine-2,4-diamine was consumed and two major new spots. The mixture was diluted with MeOH (5 mL). The precipitate was collected by filtration and purified by prep-HPLC (column: Phenomenex Synergi C18 150*30 mm*4 um; mobile phase: [water (0.225% FA)-ACN]; B %: 30%-60%, 12 min), then adjust the pH=7-8 with anion resin, followed by lyophilization to give 1-(4-fluorophenyl)-3-[4-[[2-(trifluoromethyl)phenyl]methylamino]pyrimidin-2-yl]urea (10.6 mg, 23 umol, 7% yield) as a white solid.

(424) General Synthetic Route 11 (Route 11):

(425) ##STR00073##

Example 11

Preparation of methyl 4-((2-(trifluoromethyl)benzyl)amino)pyrido[2,3-d]pyrimidine-2-carboxylate

(426) ##STR00074##

(427) The mixture of 2-chloro-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine (3.00 g, 8.96 mmol, 1.00 eq), Pd(dppf)Cl.sub.2 (131 mg, 179 umol, 0.15 eq), TEA (2.92 g, 28.86 mmol, 4.00 mL, 3.22 eq) in MeOH (30 mL) was stirred at 80° C. under CO (45 psi) for 18 h. TLC (Ethyl acetate:Methanol=20:1) showed most of the 2-chloro-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine was consumed and a new spot. The mixture was concentrated directly to remove the solvent. The residue was purified by chromatography (Ethyl acetate to Ethyl acetate:Methanol=20:1) to get methyl 4-((2-(trifluoromethyl)benzyl)amino)pyrido[2,3-d]pyrimidine-2-carboxylate (2.20 g, 5.10 mmol, 57% yield, 84% purity) as a light yellow solid.

Preparation of (4-((2-(trifluoromethyl)benzyl)amino)pyrido[2,3-d]pyrimidin-2-yl)methanol

(428) ##STR00075##

(429) To a mixture of methyl 4-[[2-(trifluoromethyl)phenyl]methylamino]pyrido[2,3-d]pyrimidine-2-carboxylate (2.20 g, 6.07 mmol, 1.00 eq) in THF (30.00 mL) was added LiBH.sub.4 (265 mg, 12.14 mmol, 2.00 eq) at 0° C. The mixture was stirred at 0° C. for 10 min. TLC (Ethyl acetate:Methanol=10:1) showed methyl 4-[[2-(trifluoromethyl)phenyl]methylamino]pyrido[2,3-d]pyrimidine-2-carboxylate was consumed completely and three new spots. The mixture was diluted with H.sub.2O (100 mL), then the resultant mixture was extracted with ethyl acetate (100 mL*3). The combined organic layers were washed with saturated brine (40 mL), dried with anhydrous Na.sub.2SO.sub.4, filtered and concentrated in vacuo. The residue was purified by chromatography (Ethyl acetate:Methanol=10:1) to give (4-((2-(trifluoromethyl)benzyl)amino)pyrido[2,3-d]pyrimidin-2-yl)methanol (1.20 g, 2.58 mmol, 43% yield, 72% purity) as a yellow solid.

Preparation of 2-(chloromethyl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine

(430) ##STR00076##

(431) To a mixture of [4-[[2-(trifluoromethyl)phenyl]methylamino]pyrido[2,3-d]pyrimidin-2-yl]methanol (80 mg, 239 umol, 1.00 eq) and TEA (85 mg, 838 umol, 116 uL, 3.50 eq) in DCM (2.00 mL) was added MsCl (41 mg, 359 umol, 28 uL, 1.50 eq) at 0° C. Then the mixture was stirred at 20° C. for 12 h. TLC (EtOAc) showed little of [4-[[2-(trifluoromethyl)phenyl]methylamino]pyrido[2,3-d]pyrimidin-2-yl]methanol remained and a major new spot. The mixture was purified by prep-TLC (EtOAc) to give 2-(chloromethyl)-N-(2-(trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine (30 mg, 83 umol, 34% yield, 97% purity) was obtained as a light yellow solid. .sup.1H NMR (400 MHz, DMSO-d6) δ ppm 9.25-9.27 (t, J=4.0 Hz, 1H), 9.03-9.04 (dd, J=4.0, 1.6 Hz, 1H), 8.79-8.82 (dd, J=8.0, 4.0 Hz, 1H), 7.75-7.77 (d, J=8.0 Hz, 1H), 7.57-7.64 (m, 3H), 7.47-7.51 (d, J=8.0 Hz, 1H), 4.99-5.00 (d, J=8.0 Hz, 1H), 4.58 (s, 2H).

Preparation of 2-((4-chloropiperidin-1-yl)methyl)-N-((trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine

(432) ##STR00077##

(433) To a solution of 2-(chloromethyl)-N-[[2-(trifluoromethyl)phenyl]methyl]pyrido[2,3-d]pyrimidin-4-amine (85 mg, 241 umol, 1 eq) and 4-chloropiperidine (45 mg, 289 umol, 1.2 eq, HCl salt) in DMSO (2 mL) was added TEA (97 mg, 964 umol, 133 uL, 4 eq). The mixture was stirred at 60° C. for 2 hour. LCMS showed the starting material was consumed completely and a major peak with desired product mass. The residue was purified by prep-HPLC (column: Gemini 150*25 5 u; mobile phase: [water (0.05% ammonia hydroxide v/v)-ACN]; B %: 36%-66%, 12 min), followed by lyophilisation to give 2-((4-chloropiperidin-1-yl)methyl)-N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine (32.4 mg, 70 umol, 29% yield, 94.6% purity) as a light yellow solid.

(434) The compounds of Table 1 were prepared using the general methodology outlined above:

(435) TABLE-US-00001 TABLE 1  4 2-chloro-N-(2-(trifluoromethyl)benzyl)pyrido[2,3- d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ (ppm) 9.61 (t, J = 5.33 Hz, 1H), 9.03 (dd, J = 1.76, 4.39 Hz, 1H), 8.82 (dd, J = 1.76, 8.28 Hz, 1H), 7.79 (d, J = 7.53 Hz, 1H), 7.61-7.67 (m, 2H), 7.48-7.60 (m, 2H), 4.94 (d, J = 5.27 Hz, 2H). LCMS (ES) C.sub.15H.sub.11N.sub.4F3Cl [M + H].sup.+ 339.1.  5 N.sup.2-isopropyl-N.sup.4-(2-(trifluoromethyl)benzyl)pyrido[2,3- d]pyrimidine-2,4-diamine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 10.04 (br. s., 1H), 8.48-8.95 (m, 2H), 7.77 (d, J = 7.78 Hz, 2H), 7.44-7.68 (m, 3H), 7.00-7.38 (m, 1H), 4.94 (d, J = 4.89 Hz, 2H), 3.83-4.22 (m, 1H), 0.91-1.22 (m, 6H). LCMS (ES) C.sub.18H.sub.19N.sub.5F3 [M + H].sup.+ 362.2. 5_S N.sup.2-isopropyl-N.sup.4-(2-(trifluoromethyl)benzyl)pyrido[2,3- d]pyrimidine-2,4-diamine methanesulfonate 0embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ (ppm) 12.55 (br. s., 1H), 10.33 (br. s., 1H), 8.69-8.85 (m, 2H), 8.02 (d, J = 7.4 Hz, 1H), 7.79 (d, J = 7.7 Hz, 1H), 7.46-7.67 (m, 4H), 4.99 (d, J = 4.3 Hz, 2H), 3.96 (qd, J = 6.5, 13.3 Hz, 1H), 2.37 (s, 3H), 0.96-1.22 (m, 6H). LCMS (ES) C.sub.18H.sub.19N.sub.5F3 [M + H].sup.+ 362.2.  10 2-chloro-N-(2-fluorobenzyl)thieno[3,2-d]pyrimidin-4-amine embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.73 (d, J = 5.4 Hz, 1H), 7.49 (td, J = 7.6, 1.6 Hz, 1H), 7.35 (d, J = 5.3 Hz, 1H), 7.34- 7.27 (m, 1H), 7.14 (td, J = 7.5, 1.1 Hz, 1H), 7.12-7.05 (m, 1H), 5.47 (br. s, 1H), 4.91 (d, J = 5.6 Hz, 2H). HRMS (ES) C.sub.13H.sub.10N.sub.3FClS [M + H].sup.+ 294.0260.  11 N.sup.4-(2-fluorobenzyl)-N.sup.2-isopropylthieno[3,2-d]pyrimidine-2,4- diamine embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.54 (d, J = 5.3 Hz, 1H), 7.42 (td, J = 7.5, 1.5 Hz, 1H), 7.33-7.21 (m, 1H), 7.17-7.01 (m, 3H), 5.12 (br. s, 1H), 5.08 (br. s, 1H), 4.85 (d, J = 5.8 Hz, 2H), 4.28-4.04 (m, 1H), 1.23 (d, J = 6.5 Hz, 6H). HRMS (ES) C.sub.16H.sub.18N.sub.4FS [M + H].sup.+ 317.1225.  12 N.sup.4-benzyl-N.sup.2-isopropylthieno[3,2-d]pyrimidine-2,4-diamine embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.54 (d, J = 5.3 Hz, 1H), 7.42-7.27 (m, 5H), 7.12 (d, J = 5.3 Hz, 1H), 5.26 (br. s, 1H), 5.16 (br. s, 1H), 4.80 (d, J = 5.6 Hz, 2H), 4.26-4.12 (m, 1H), 1.23 (d, J = 6.5 Hz, 6H). HRMS (ES) C.sub.16H.sub.19N.sub.4S [M + H].sup.+ 299.1329.  13 N.sup.2-isopropyl-N.sup.4-(4-methoxybenzyl)thieno[3,2-d]pyrimidine- 2,4-diamine embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.52 (d, J = 5.3 Hz, 1H), 7.34-7.28 (m, 2H), 7.11 (d, J = 5.3 Hz, 1H), 6.91-6.86 (m, 2H), 4.98 (br. s, 1H), 4.92 (br. s, 1H), 4.72 (d, J = 5.5 Hz, 2H), 4.27-4.14 (m, 1H), 3.81 (s, 3H), 1.24 (d, J = 6.5 Hz, 6H). HRMS (ES) C.sub.17H.sub.21N.sub.4OS [M + H].sup.+ 329.1431.  14 N.sup.4-(3-fluorobenzyl)-N.sup.2-isopropylthieno[3,2-d]pyrimidine-2,4- diamine embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.55 (d, J = 5.3 Hz, 1H), 7.31 (td, J = 7.9, 5.9 Hz, 1H), 7.18-7.06 (m, 3H), 6.98 (td, J = 8.4, 2.6 Hz, 1H), 5.07 (br. s, 1H), 4.84 (br. s, 1H), 4.79 (d, J = 5.7 Hz, 2H), 4.20-4.09 (m, 1H), 1.21 (d, J = 6.5 Hz, 6H). HRMS (ES) C.sub.16H.sub.18N.sub.4FS [M + H].sup.+ 317.1226.  15 N.sup.4-(4-fluorobenzyl)-N.sup.2-isopropylthieno[3,2-d]pyrimidine-2,4- diamine embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.55 (d, J = 5.3 Hz, 1H), 7.38-7.32 (m, 2H), 7.12 (d, J = 5.3 Hz, 1H), 7.07-6.99 (m, 2H), 5.00 (br. s, 1H), 4.89 (br. s, 1H), 4.76 (d, J = 5.5 Hz, 2H), 4.23-4.10 (m, 1H), 1.23 (d, J = 6.5 Hz, 6H). HRMS (ES) C.sub.16H.sub.18N.sub.4FS [M + H].sup.+ 317.1230.  16 N.sup.2-isopropyl-N.sup.4-(3-methoxybenzyl)thieno[3,2-d]pyrimidine- 2,4-diamine embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.53 (d, J = 5.3 Hz, 1H), 7.27 (t, J = 7.9 Hz, 1H), 7.11 (d, J = 5.3 Hz, 1H), 6.97 (d, J = 8.0 Hz, 1H), 6.94-6.91 (m, 1H), 6.84 (dd, J = 8.2, 2.1 Hz, 1H), 5.02 (br. s, 1H), 4.85 (br. s, 1H), 4.77 (d, J = 5.6 Hz, 2H), 4.24- 4.13 (m, 1H), 3.80 (s, 3H), 1.23 (d, J = 6.5 Hz, 6H). HRMS (ES) C.sub.17H.sub.21N.sub.4OS [M + H].sup.+ 329.1427.  17 N.sup.4-(2-chlorobenzyl)-N.sup.2-isopropylthieno[3,2-d]pyrimidine-2,4- diamine embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.55 (d, J = 5.3 Hz, 1H), 7.45 (dd, J = 5.6, 3.8 Hz, 1H), 7.39 (dd, J = 5.5, 3.8 Hz, 1H), 7.25-7.20 (m, 2H), 7.11 (d, J = 5.3 Hz, 1H), 5.16 (br. s, 1H), 4.89 (d, J = 5.9 Hz, 2H), 4.84 (br. s, 1H), 4.22-4.09 (m, 1H), 1.22 (d, J = 6.5 Hz, 6H). HRMS (ES) C.sub.16H.sub.18N.sub.4S.sup.35Cl [M + H].sup.+ 333.0934.  18 N.sup.4-(3-chlorobenzyl)-N.sup.2-isopropyithieno[3,2-d]pyrimidine-2,4- diamine embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.56 (d, J = 5.3 Hz, 1H), 7.37 (s, 1H), 7.29-7.23 (m, 3H), 7.12 (d, J = 5.3 Hz, 1H), 5.09 (br. s, 1H), 4.91 (br. s, 1H), 4.77 (d, J = 5.6 Hz, 2H), 4.21-4.09 (m, 1H), 1.21 (d, J = 6.5 Hz, 6H). HRMS (ES) C.sub.16H.sub.18N.sub.4S.sup.35Cl [M + H].sup.+ 333.0930.  19 N.sup.4-(4-chlorobenzyl)-N.sup.2-isopropylthieno[3,2-d]pyrimidine-2,4- diamine 0embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.55 (d, J = 5.3 Hz, 1H), 7.31 (s, 4H), 7.12 (d, J = 5.3 Hz, 1H), 5.05 (br. s, 1H), 4.92 (br. s, 1H), 4.76 (d, J = 5.8 Hz, 2H), 4.22-4.08 (m, 1H), 1.22 (d, J = 6.5 Hz, 6H). HRMS (ES) C.sub.16H.sub.18N.sub.4S.sup.35Cl [M + H].sup.+ 333.0930.  20 N.sup.2-isopropyl-N.sup.4-(2-methoxybenzyl)thieno[3,2-d]pyrimidine- 2,4-diamine embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.53 (d, J = 5.3 Hz, 1H), 7.35 (dd, J = 7.3, 1.5 Hz, 1H), 7.32-7.27 (m, 1H), 7.10 (d, J = 5.3 Hz, 1H), 6.96-6.89 (m, 2H), 4.79 (d, J = 5.7 Hz, 2H), 4.29- 4.17 (m, 1H), 3.90 (s, 3H), 1.26 (d, J = 6.5 Hz, 6H). HRMS (ES) C.sub.17H.sub.21N.sub.4OS [M + H].sup.+ 329.1440.  21 2-chloro-N-(2-chlorobenzyl)thieno[3,2-d]pyrimidin-4-amine embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.74 (d, J = 5.4 Hz, 1H), 7.57-7.51 (m, 1H), 7.45-7.38 (m, 1H), 7.36 (d, J = 5.4 Hz, 1H), 7.30-7.24 (m, 2H), 5.52 (br. s, 1H), 4.95 (d, J = 5.9 Hz, 2H). HRMS (Cl) C.sub.13H.sub.9N.sub.3Cl.sub.2S [M + H].sup.+ 309.9959.  22 N-(2-fluorobenzyl)thieno[3,2-d]pyrimidin-4-amine embedded image Synthesised via Route 2 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.66 (s, 1H), 7.71 (d, J = 5.4 Hz, 1H), 7.49-7.40 (m, 2H), 7.33-7.24 (m, 1H), 7.15- 7.04 (m, 2H), 5.40 (br. s, 1H), 4.94 (d, J = 5.7 Hz, 2H). HRMS (Cl) C.sub.13H.sub.10N.sub.3FS [M + H].sup.+ 260.0660.  23 N-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine embedded image Synthesised via Route 2 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.68 (s, 1H), 7.73 (d, J = 5.4 Hz, 1H), 7.70 (d, J = 7.8 Hz, 1H), 7.67 (d, J = 7.8 Hz, 1H), 7.52 (t, J = 7.4 Hz, 1H), 7.46 (d, J = 5.4 Hz, 1H), 7.41 (t, J = 7.7 Hz, 1H), 5.29 (br. s, 1H), 5.10 (d, J = 5.6 Hz, 2H). HRMS (Cl) C.sub.14H.sub.10N.sub.3F.sub.3S [M + H].sup.+ 310.0618.  24 N-(2-(trifluoromethoxy)benzyl)thieno[3,2-d]pyrimidin-4- amine embedded image Synthesised via Route 2 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.66 (s, 1H), 7.73 (d, J = 5.4 Hz, 1H), 7.53 (dd, J = 7.5, 1.4 Hz, 1H), 7.45 (d, J = 5.4 Hz, 1H), 7.38-7.32 (m, 1H), 7.32-7.24 (m, 2H), 5.28 (br. s, 1H), 4.98 (d, J = 5.9 Hz, 2H). HRMS (Cl) C.sub.14H.sub.10N.sub.3F.sub.3OS [M + H].sup.+ 326.0568.  25 N.sup.4-((2,2-difluorobenzo[d][1,3]dioxol-5-yl)methyl)-N.sup.2- isopropylthieno[3,2-d]pyrimidine-2,4-diamine embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.58 (d, J = 5.3 Hz, 1H), 7.15-7.09 (m, 2H), 7.04 (t, J = 7.9 Hz, 1H), 6.98 (dd, J = 7.9, 1.3 Hz, 1H), 4.85 (d, J = 5.8 Hz, 2H), 4.43-4.08 (m, 1H), 1.20 (d, J = 6.5 Hz, 6H). HRMS (Cl) C.sub.17H.sub.16N.sub.4F.sub.2O.sub.2S [M + H].sup.+ 379.1038.  26 N.sup.4-(2-fluoro-3-methoxybenzyl)-N.sup.2-isopropylthieno[3,2- d]pyrimidine-2,4-diamine embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.54 (d, J = 5.3 Hz, 1H), 7.11 (d, J = 5.3 Hz, 1H), 7.06-7.00 (m, 1H), 7.00-6.95 (m, 1H), 6.90 (td, J = 8.0, 1.8 Hz, 1H), 4.85 (d, J = 5.4 Hz, 2H), 4.24-4.14 (m, 1H), 3.89 (s, 3H), 1.23 (d, J = 6.5 Hz, 6H). HRMS (Cl) C.sub.17H.sub.19N.sub.4FOS [M + H].sup.+ 347.1339.  27 N.sup.4-(2,6-dichlorobenzyl)-N-isopropylthieno[3,2-d]pyrimidine- 2,4-diamine embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.54 (d, J = 5.3 Hz, 1H), 7.36 (d, J = 8.1 Hz, 2H), 7.22 (dd, J = 8.6, 7.5 Hz, 1H), 7.12 (d, J = 5.3 Hz, 1H), 5.10 (d, J = 5.2 Hz, 2H), 4.34-4.23 (m, 1H), 1.27 (d, J = 6.5 Hz, 6H). HRMS (Cl) C.sub.16H.sub.16N.sub.4Cl.sub.2S [M + H].sup.+ 367.0538.  28 N.sup.2-isopropyl-N.sup.4-(2-(trifluoromethyl)benzyl)thieno[3,2- d]pyrimidine-2,4-diamine embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.68 (d, J = 7.8 Hz, 1H), 7.61 (d, J = 7.8 Hz, 1H), 7.55 (d, J = 5.3 Hz, 1H), 7.50 (t, J = 7.6 Hz, 1H), 7.38 (t, J = 7.6 Hz, 1H), 7.11 (d, J = 5.3 Hz, 1H), 5.09 (br. s, 1H), 5.01 (d, J = 5.7 Hz, 2H), 4.79 (br. s, 1H), 4.20-4.06 (m, 1H), 1.18 (d, J = 6.5 Hz, 6H). HRMS (Cl) C.sub.17H.sub.17N.sub.4F.sub.3S [M + H].sup.+ 367.1196.  29 N.sup.2-isopropyl-N.sup.4-(2-(trifluoromethoxy)benzyl)thieno[3,2- d]pyrimidine-2,4-diamine 00embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.5S (d, J = 5.3 Hz, 1H), 7.48 (dd, J = 7.4, 1.3 Hz, 1H), 7.35-7.23 (m, 3H), 7.11 (d, J = 5.3 Hz, 1H), 5.08 (br. s, 1H), 4.88 (d, J = 5.9 Hz, 2H), 4.83 (br. s, 1H), 4.22-4.07 (m, 1H), 1.20 (d, J = 6.5 Hz, 6H). HRMS (Cl) C.sub.17H.sub.17N.sub.4F.sub.3OS [M + H].sup.+ 383.1149.  30 N.sup.4-(2-chloro-6-fluorobenzyl)-N.sup.2-isopropylthieno[3,2- d]pyrimidine-2,4-diamine 01embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.52 (d, J = 5.3 Hz, 1H), 7.25-7.19 (m, 2H), 7.08 (d, J = 5.3 Hz, 1H), 7.02 (ddd, J = 9.4, 6.7, 2.8 Hz, 1H), 5.11 (br, s, 1H), 4.97 (d, J = 5.7 Hz, 2H), 4.85 (d, J = 7.0 Hz, 1H), 4.34-4.21 (m, 1H), 1.25 (d, J = 6.5 Hz, 6H). HRMS (Cl) C.sub.16H.sub.16N.sub.4FClS [M + H].sup.+ 351.0842.  31 N-(2,4-dimethylphenyl)thieno[3,2-d]pyrimidin-4-amine 02embedded image Synthesised via Route 2 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.61 (s, 1H), 7.64 (d, J = 5.5 Hz, 1H), 7.37 (d, J = 5.5 Hz, 1H), 7.32 (d, J = 7.9 Hz, 1H), 7.16 (s, 1H), 7.11 (d, J = 7.9 Hz, 1H), 2.42 (s, 3H), 2.26 (s, 3H). HRMS (Cl) C.sub.14H.sub.13N.sub.3S [M + H].sup.+ 256.0910.  32 N.sup.4-(2,4-dimethylphenyl)-N.sup.2-isopropylthieno[3,2- d]pyrimidine-2,4-diamine 03embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.46 (d, J = 5.4 Hz, 1H), 7.36 (d, J = 7.9 Hz, 1H), 7.11 (s, 1H), 7.06 (dd, J = 6.5, 4.8 Hz, 2H), 4.65 (br. s, 1H), 4.23-4.11 (m, 1H), 2.38 (s, 3H), 2.25 (s, 3H), 1.21 (d, J = 6.4 Hz, 6H). HRMS (Cl) C.sub.17H.sub.20N.sub.4S [M + H].sup.+ 313.1488.  33 N.sup.4-(2-chlorobenzyl)-N.sup.2-isopropyl-N.sup.2-methylthieno[3,2- d]pyrimidine-2,4-diamine 04embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.52 (d, J = 5.3 Hz, 1H), 7.48-7.44 (m, 1H), 7.41-7.35 (m, 1H), 7.24-7.18 (m, 3H), 5.17-5.06 (m, 2H), 4.89 (d, J = 5.8 Hz, 2H), 2.99 (s, 3H), 1.14 (d, J = 6.8 Hz, 6H). HRMS (Cl) C.sub.17H.sub.19N.sub.4ClS [M + H].sup.+ 347.1097.  34 1-(3-(thieno[3,2-d]pyrimidin-4-ylamino)propyl)pyrrolidin-2- one 05embedded image Synthesised via Route 2 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.58 (s, 1H), 7.70 (d, J = 5.4 Hz, 1H), 7.39 (d, J = 5.4 Hz, 1H), 6.76 (t, J = 5.5 Hz, 1H), 3.64 (dd, J = 12.1, 6.2 Hz, 2H), 3.47-3.41 (m, 4H), 2.48 (t, J = 8.1 Hz, 2H), 2.14-2.01 (m, 2H), 1.91-1.82 (m, 2H). HRMS (Cl) C.sub.13H.sub.16N.sub.4OS [M + H].sup.+ 277.1129.  35 1-(3-((2-((2-methoxybenzyl)amino)thieno[3,2-d]pyrimidin-4- yl)amino)propyl)pyrrolidin-2-one 06embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.54 (d, J-5.3 Hz, 1H), 7.35 (d, J = 7.1 Hz, 1H), 7.22 (td, J = 7.9, 1.7 Hz, 1H), 7.11 (d, J = 5.3 Hz, 1H), 6.91-6.84 (m, 2H), 6.51 (br. s, 1H), 5.90 (br. s, 1H), 4.66 (d, J = 6.2 Hz, 2H), 3.87 (s, 3H), 3.57 (dd, J = 12.1, 6.1 Hz, 2H), 3.39 (t, J = 6.9 Hz, 4H), 2.44 (t, J = 8.1 Hz, 2H), 2.10-1.99 (m, 2H), 1.84-1.72 (m, 2H). HRMS (ES) C.sub.21H.sub.26N.sub.5O.sub.2S [M + H].sup.+ 412.1797.  36 1-(3-((2-(benzyl(methyl)amino)thieno[3,2-d]pyrimidin-4- yl)amino)propyl)pyrrolidin-2-one 07embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.54 (d, J = 5.3 Hz, 1H), 7.32-7.27 (m, 4H), 7.25-7.13 (m, 2H), 6.06 (br. s, 1H), 4.94 (s, 2H), 3.54-3.47 (m, 2H), 3.38-3.30 (m, 4H), 3.18 (s, 3H), 2.41 (t, J = 8.1 Hz, 2H), 2.04-1.95 (m, 2H), 1.76-1.67 (m, 2H). HRMS (Cl) C.sub.21H.sub.25N.sub.5OS [M + H].sup.+ 396.1868.  37 N-(thieno[3,2-d]pyrimidin-4-yl)-2- (trifluoromethyl)benzamide 08embedded image Synthesised via Route 2 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 9.67 (br. s, 1H), 8.40 (s, 1H), 8.06 (d, J = 5.6 Hz, 1H), 7.81 (dd, J = 5.4, 3.7 Hz, 1H), 7.74 (dd, J = 5.1, 3.7 Hz, 1H), 7.71-7.65 (m, 2H), 7.53 (d, J = 5.6 Hz, 1H). HRMS (Cl) C.sub.14H.sub.8N.sub.3F.sub.3OS [M + H].sup.+ 324.0401.  38 N-(1-(2-chlorophenyl)ethyl)thieno[3,2-d]pyrimidin-4-amine 09embedded image Synthesised via Route 2 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.59 (s, 1H), 7.71 (d, J = 5.4 Hz, 1H), 7.46-7.36 (m, 3H), 7.26-7.18 (m, 2H), 5.83 (p, J = 6.9 Hz, 1H), 5.40 (d, J = 5.2 Hz, 1H), 1.68 (d, J = 6.9 Hz, 3H). HRMS (Cl) C.sub.14H.sub.12N.sub.3ClS [M + H].sup.+ 290.0525.  40 2-chloro-N-(thieno[3,2-d]pyrimidin-4-yl)benzamide 0embedded image Synthesised via Route 2 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 9.89 (s, 1H), 8.50 (s, 1H), 8.05 (d, J = 5.6 Hz, 1H), 7.85-7.80 (m, 1H), 7.52 (d, J = 5.6 Hz, 1H), 7.50-7.46 (m, 2H), 7.42 (ddd, J = 7.6, 5.7, 2.9 Hz, 1H). HRMS (Cl) C.sub.13H.sub.8N.sub.3OClS [M + H].sup.+ 290.0161.  41 N.sup.2-(tert-butyl)-N.sup.4-(2-(trifluoromethyl)benzyl)thieno[3,2- d]pyrimidine-2,4-diamine embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.68 (d, J = 7.7 Hz, 1H), 7.61-7.43 (m, 3H), 7.37 (t, J = 7.0 Hz, 1H), 7.09 (d, J = 5.3 Hz, 1H), 5.44 (br. s, 1H), 5.30 (br. s, 1H), 5.04 (d, J = 5.5 Hz, 2H), 1.34 (s, 9H). HRMS (Cl) C.sub.18H.sub.19N.sub.4F.sub.3S [M + H].sup.+ 381.1339.  42 N.sup.2-(2,2,2-trifluoroethyl)-N.sup.4-(2- (trifluoromethyl)benzyl)thieno[3,2-d]pyrimidine-2,4-diamine embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.69 (d, J = 7.7 Hz, 1H), 7.63-7.55 (m, 2H), 7.50 (t, J = 7.2 Hz, 1H), 7.39 (t, J = 7.5 Hz, 1H), 7.14 (d, J = 5.3 Hz, 1H), 5.32-5.10 (m, 2H), 5.00 (d, J = 5.7 Hz, 2H), 4.12 (qd, J = 9.2, 6.9 Hz, 2H). HRMS (Cl) C.sub.16H.sub.12N.sub.4F.sub.6S [M + H].sup.+ 407.0744.  43 N.sup.2-cyclopropyl-N.sup.4-(2-(trifluoromethyl)benzyl)thieno[3,2- d]pyrimidine-2,4-diamine embedded image Synthesised via Route 1 .sup.1H NMR (500 MHz, CDCl.sub.3) δ (ppm) 7.70 (d, J = 8.1 Hz, 2H), 7.59 (d, J = 5.3 Hz, 1H). 7.52 (t, J = 7.6 Hz, 1H), 7.41 (t, J = 7.6 Hz, 1H), 7.20 (d, J = 5.3 Hz, 1H), 5.42 (br. s, 1H), 5.20 (br. s, 1H), 5.05 (d, J = 5.9 Hz, 2H), 2.84-2.77 (m, 1H), 0.80-0.74 (m, 2H), 0.57-0.51 (m, 2H). HRMS (Cl) C.sub.17H.sub.15N.sub.4F.sub.3S [M + H].sup.+ 365.1029.  44 N-methyl-N-(2-(trifluoromethyl)benzyl)thieno[3,2- d]pyrimidin-4-amine embedded image Synthesised via Route 2 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.58 (s, 1H), 7.76-7.70 (m, 2H), 7.48 (t, J = 7.6 Hz, 1H), 7.44 (d, J = 5.6 Hz, 1H), 7.39 (t, J = 7.5 Hz, 1H), 7.29 (d, J = 7.8 Hz, 1H), 5.30 (s, 2H), 3.47 (s, 3H). HRMS (ES) C.sub.15H.sub.13N.sub.3F.sub.3S [M + H].sup.+ 324.0792.  45 N.sup.2-isopropyl-N.sup.4-(2-(trifluoromethyl)phenethyl)thieno(3,2- d]pyrimidine-2,4-diamine embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.67 (d, J = 7.8 Hz, 1H), 7.53 (d, J = 5.3 Hz, 1H), 7.48 (t, J = 7.5 Hz, 1H), 7.39-7.30 (m, 2H), 7.10 (d, J = 5.3 Hz, 1H), 4.98-4.71 (m, 2H), 4.30-4.17 (m, 1H), 3.84 (dd, J = 13.8, 6.6 Hz, 2H), 3.18 (t, J = 7.2 Hz, 2H), 1.27 (d, J = 6.5 Hz, 6H). HRMS (Cl) C.sub.18H.sub.19N.sub.4F.sub.3S [M + H].sup.+ 381.1353.  46 2-chloro-N-(2-(trifluoromethyl)benzyl)thieno[3,2- d]pyrimidin-4-amine embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.74 (d, J = 5.3 Hz, 1H), 7.70 (d, J = 7.8 Hz, 2H), 7.55 (t, J = 7.6 Hz, 1H), 7.43 (t, J = 7.6 Hz, 1H), 7.36 (d, J = 5.3 Hz, 1H), 5.46 (br. s, 1H), 5.06 (d, J = 5.7 Hz, 2H). HRMS (Cl) C.sub.14H.sub.10N.sub.3F.sub.3Cl.sub.2S [M + H].sup.+ 378.9921.  47 2-chloro-N-(1-(2-chlorophenyl)cyclopropyl)thieno[3,2- d]pyrimidine-4-diamine embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.93 (d, J = 7.6 Hz, 1H), 7.70 (d, J = 5.3 Hz, 1H), 7.36-7.28 (m, 2H), 7.27-7.23 (m, 1H), 7.19 (td, J = 7.6, 1.7 Hz, 1H), 6.16 (br. s, 1H), 1.41 (d, J = 7.3 Hz, 4H). HRMS (Cl) C.sub.15H.sub.11N.sub.3Cl.sub.2S [M + H].sup.+ 336.0118.  48 N.sup.4-(1-(2-chlorophenyl)cyclopropyl)-N.sup.2-isopropylthieno[3,2- d]pyrimidine-2,4-diamine embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.78 (dd, J = 7.1, 2.2 Hz, 1H), 7.49 (d, J = 5.3 Hz, 1H), 7.32 (dd, J = 7.2, 1.9 Hz, 1H), 7.22-7.13 (m, 2H), 7.01 (d, J = 5.3 Hz, 1H), 5.81 (s, 1H), 4.77 (d, J = 6.5 Hz, 1H), 4.36-4.21 (m, 1H), 1.42-1.30 (m, 4H), 1.29 (d, J = 6.5 Hz, 6H). HRMS (Cl) C.sub.18H.sub.19N.sub.4ClS [M + H].sup.+ 359.1099.  49 2-chloro-N-methyl-N-(2-(trifluoromethyl)benzyl)thieno[3,2- d]pyrimidin-4-amine embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.78 - 7.70 (m, 2H), 7.50 (t, J = 7.4 Hz, 1H), 7.41 (t, J = 7.5 Hz, 1H), 7.37 (d, J = 5.5 Hz, 1H), 7.28 (d, J = 7.8 Hz, 1H), 5.28 (s, 2H), 3.44 (s, 3H). HRMS (Cl) C.sub.15H.sub.11N.sub.3F.sub.3ClS [M + H].sup.+ 358.0397.  50 N.sup.2-isopropyl-N.sup.4-methyl-N.sup.4-(2- (trifluoromethyl)benzyl)thieno[3,2-d]pyrimidine-2,4-diamine 0embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.70 (d, J = 7.7 Hz, 1H), 7.57 (d, J = 5.5 Hz, 1H), 7.46 (t, J = 7.5 Hz, 1H), 7.36 (t, J = 7.5 Hz, 1H), 7.30 (d, J = 7.8 Hz, 1H), 7.11 (d, J = 5.5 Hz, 1H), 5.20 (s, 2H), 4.67 (d, J = 7.0 Hz, 1H), 4.04 (dq, J = 13.4, 6.5 Hz, 1H), 3.43 (s, 3H), 1.13 (d, J = 6.4 Hz, 6H). HRMS (ES) C.sub.18H.sub.20N.sub.4F.sub.3S [M + H].sup.+ 381.1351.  51 N-(3-methoxy-2-(trifluoromethyl)benzyl)thieno[3,2- d]pyrimidin-4-amine embedded image Synthesised via Route 2 .sup.1H NMR (400 MHz, DMSO) δ (ppm) 8.44-8.37 (m, 2H), 8.15 (d, J = 5.4 Hz, 1H), 7.51 (t, J = 8.1 Hz, 1H), 7.41 (d, J = 5.4 Hz, 1H), 7.17 (d, J = 8.4 Hz, 1H), 7.02 (d, J = 7.9 Hz, 1H), 4.87 (d, J = 2.7 Hz, 2H), 3.87 (s, 3H). HRMS (ES) C.sub.15H.sub.13N.sub.3F.sub.3OS [M + H].sup.+ 340.0728.  52 2-chloro-N-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2- d]pyrimidin-4-amine embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, DMSO) δ (ppm) 8.93 (d, J = 7.0 Hz, 1H), 8.21 (d, J = S.4 Hz, 1H), 7.81 (d, J = 7.9 Hz, 1H), 7.70 (d, J = 7.9 Hz, 1H), 7.65 (t, J = 7.7 Hz, 1H), 7.44 (t, J = 7.6 Hz, 1H), 7.33 (d, J = 5.4 Hz, 1H), 5.75-5.62 (m, 1H), 1.54 (d, J = 6.9 Hz, 3H). HRMS (ES) C.sub.15H.sub.12N.sub.3F.sub.3ClS [M + H].sup.+ 358.0391.  53 N.sup.2-isopropyl-N.sup.4-(1-(2- (trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidine-2,4- diamine embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.66 (d, J = 7.8 Hz, 1H), 7.60 (d, J = 7.9 Hz, 1H), 7.54 (d, J = 5.3 Hz, 1H), 7.49 (t, J = 7.6 Hz, 1H), 7.33 (t, J = 7.6 Hz, 1H), 7.07 (d, J = 5.3 Hz, 1H), 5.71 (p, J = 6.5 Hz, 1H), 4.98 (br. s, 1H), 4.65 (br. s, 1H), 4.06-3.90 (m, 1H), 1.61 (d, J = 6.8 Hz, 3H), 1.15 (d, J = 6.5 Hz, 3H), 0.90 (d, J = 6.1 Hz, 3H). HRMS (ES) C.sub.15H.sub.12N.sub.3F.sub.3ClS [M + H].sup.+ 381.1356.  54 N-ethyl-N-(2-(trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin- 4-amine embedded image Synthesised via Route 2 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.58 (s, 1H), 7.71 (dd, J = 6.8, 4.0 Hz, 2H), 7.49-7.41 (m, 2H), 7.38 (t, J = 7.5 Hz, 1H), 7.31 (d, J = 7.7 Hz, 1H), 5.29 (s, 2H), 3.85 (q, J = 7.1 Hz, 2H), 1.37 (t, J = 7.1 Hz, 3H). HRMS (ES) C.sub.16H.sub.15N.sub.3F.sub.3S [M + H].sup.+ 338.0930.  55 2-methyl-N-(2-(trifluoromethyl)benzyl)thieno[3,2- d]pyrimidin-4-amine embedded image Synthesised via Route 2 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.75-7.63 (m, 3H), 7.52 (t, J = 7.5 Hz, 1H), 7.44-7.33 (m, 2H), 5.22 (br. s, 1H), 5.09 (d, J = 5.3 Hz, 2H), 2.66 (s, 3H). HRMS (ES) C.sub.15H.sub.13N.sub.3F.sub.3S [M + H].sup.+ 324.0780.  56 2-(trifluoromethyl)-N-(2-(trifluoromethyl)benzyl)thieno(3,2- d]pyrimidin-4-amine embedded image Synthesised via Route 2 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.82 (d, J = 5.4 Hz, 1H), 7.79 (d, J = 7.7 Hz, 1H), 7.70 (d, J = 7.8 Hz, 1H), 7.54 (dd, J = 9.3, 3.9 Hz, 2H), 7.42 (t, J = 7.7 Hz, 1H), 5.49 (br. s, 1H), 5.10 (d, J = 5.9 Hz, 2H). HRMS (ES) C.sub.15H.sub.10N.sub.3F.sub.6S [M + H].sup.+ 378.0493.  57 2-chloro-N-(2-(trifluoromethyl)benzyl)quinazolin-4-amine embedded image Synthesised via Route 4 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.80-7.62 (m, 5H), 7.55 (t, J = 7.5 Hz, 1H), 7.44 (dd, J = 16.4, 8.2 Hz, 2H), 6.28 (br. s, 1H), 5.07 (d, J = 5.1 Hz, 2H). HRMS (ES) C.sub.16H.sub.12N.sub.3F.sub.3Cl [M + H].sup.+ 338.0670.  58 N.sup.2-isopropyl-N.sup.4-(2-(trifluoromethyl)benzyl)quinazoline-2,4- diamine embedded image Synthesised via Route 4 .sup.1H NMR (400 MHz, CDCl3) δ (ppm) 13.42 (s, 1H), 8.30-8.11 (m, 1H), 7.93 (d, J = 8.4 Hz, 1H), 7.79-7.61 (m, 2H), 7.52 (dd, J = 14.7, 7.8 Hz, 2H), 7.43 (t, J = 7.5 Hz, 1H), 7.32 (m, 1H), 5.10 (d, J = 5.4 Hz, 2H), 4.20-4.05 (m, 1H), 1.57 (d, J = 6.6 Hz, 2H), 1.20 (d, J = 6.6 Hz, 4H). HRMS (ES) C.sub.19H.sub.20N.sub.4F.sub.3 [M + H].sup.+ 361.1648.  59 N.sup.2-isopropyl-N.sup.4-(2-(trifluoromethyl)phenyl)thieno[3,2- d]pyrimidin-2,4-amine embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.21 (d, J = 8.2 Hz, 1H), 7.70 (d, J = 7.8 Hz, 1H), 7.61 (dd, J = 16.5, 6.7 Hz, 2H), 7.30 (dd, J = 9.8, 4.0 Hz, 1H), 7.17 (d, J = 5.3 Hz, 1H), 6.82 (br. s, 1H), 4.92 (br. s, 1H), 4.27-4.07 (m, 1H), 1.27 (d, J = 6.6 Hz, 6H). HRMS (ES) C.sub.16H.sub.16N.sub.4F.sub.3S [M + H].sup.+ 353.1039.  60 N-(4-fluoro-2-(trifluoromethyl)benzyl)thieno[3,2- d]pyrimidin-4-amine 0embedded image Synthesised via Route 2 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.69 (s, 1H), 7.76 (d, J = 5.4 Hz, 1H), 7.71 (dd, J = 8.6, 5.5 Hz, 1H), 7.49 (d, J = 5.4 Hz, 1H), 7.42 (dd, J = 8.9, 2.7 Hz, 1H), 7.23 (td, J = 8.2, 2.7 Hz, 1H), 5.34 (br. s, 1H), 5.08 (d, J = 5.7 Hz, 2H). HRMS (ES) C.sub.14H.sub.10N.sub.3F.sub.4S [M + H].sup.+ 328.0527.  61 N-((3-(trifluoromethyl)pyridin-2-yl)methyl)thieno[3,2- d]pyrimidin-4-amine embedded image Synthesised via Route 2 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.81 (d, J = 4.4 Hz, 1H), 8.70 (s, 1H), 8.04 (d, J = 7.9 Hz, 1H), 7.76 (d, J = 5.4 Hz, 1H), 7.47 (d, J = 5.4 Hz, 1H), 7.43 (dd, J = 7.5, 5.2 Hz, 1H), 7.02 (br. s, 1H), 5.14 (d, J = 3.8 Hz, 2H). HRMS (ES) C.sub.13H.sub.10N.sub.4F.sub.3S [M + H].sup.+ 311.0572.  62 N-methyl-2-(trifluoromethyl)-N-(2- (trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine embedded image Synthesised via Route 2 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.83 (d, J = 5.6 Hz, 1H), 7.74 (d, J = 7.7 Hz, 1H), 7.55 (d, J = 5.6 Hz, 1H), 7.49 (t, J = 7.5 Hz, 1H), 7.41 (t, J = 7.5 Hz, 1H), 7.30 (d, J = 7.7 Hz, 1H), 5.32 (s, 2H), 3.51 (s, 3H). HRMS (ES) C.sub.16H.sub.12N.sub.3F.sub.6S [M + H].sup.+ 392.0651.  63 N,2-dimethyl-N-(2-(trifluoromethyl)benzyl)thieno[3,2- d]pyrimidin-4-amine embedded image Synthesised via Route 2 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.72 (d, J = 7.7 Hz, 1H), 7.68 (d, J = 5.2 Hz, 1H), 7.47 (t, J = 7.6 Hz. 1H), 7.38 (t, J = 6.7 Hz, 2H), 7.29 (d, J = 7.7 Hz, 1H), 5.29 (s, 2H), 3.45 (s, 3H), 2.59 (s, 3H). HRMS (ES) C.sub.16H.sub.15N.sub.3F.sub.3S [M + H].sup.+ 338.0935.  64 N,6-dimethyl-2-(trifluoromethyl)-N-(2- (trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine embedded image Synthesised via Route 2 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.73 (d, J = 7.7 Hz, 1H), 7.49 (t, J = 7.5 Hz, 1H), 7.40 (t, J = 7.4 Hz, 1H), 7.30 (d, J = 7.6 Hz, 1H), 7.20 (s, 1H), 5.27 (s, 2H), 3.44 (s, 3H), 2.59 (s, 3H). HRMS (ES) C.sub.17H.sub.14N.sub.3F.sub.6S [M + H].sup.+ 406.0808.  65 2-methyl-N-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2- d]pyrimidin-4-amine embedded image Synthesised via Route 2 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.72-7.63 (m, 2H), 7.60 (d, J = 7.8 Hz, 1H), 7.49 (t, J = 7.6 Hz, 1H), 7.35 (d, J = 7.8 Hz, 1H), 7.33 (d, J = 5.4 Hz, 1H), 5.83 (p, J = 6.6 Hz, 1H), 5.19 (d, J = 5.7 Hz, 1H), 2.50 (s, 3H), 1.63 (d, J = 6.8 Hz, 3H). HRMS (ES) C.sub.16H.sub.15N.sub.3F.sub.3S [M + H].sup.+ 338.0933.  66 N,2-dimethyl-N-(1-(2- (trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidin-4- amine embedded image Synthesised via Route 2 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.70 (d, J = 7.8 Hz, 1H), 7.66 (d, J = 5.5 Hz, 1H), 7.63 (d, J = 7.8 Hz, 1H), 7.57 (t, J = 7.5 Hz, 1H), 7.42 (t, J = 7.6 Hz, 1H), 7.34 (d, J = 5.5 Hz, 1H), 6.62 (q, J = 6.8 Hz, 1H), 3.20 (s, 3H), 2.57 (s, 3H), 1.67 (d, J = 6.9 Hz, 3H). HRMS (ES) C.sub.17H.sub.17N.sub.3F.sub.3S [M + H].sup.+ 352.1091.  68 2-chloro-N-methyl-N-(1-(2- (trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidin-4- amine embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.74 (d, J = 5.6 Hz, 1H), 7.72 (d, J = 8.4 Hz, 1H), 7.69-7.58 (m, 2H), 7.46 (t, J = 7.5 Hz, 1H), 7.35 (d, J = 5.5 Hz, 1H), 6.54 (q, J = 6.8 Hz, 1H), 3.11 (s, 3H), 1.70 (d, J = 6.8 Hz, 3H). HRMS (ES) C.sub.16H.sub.14N.sub.3F.sub.3ClS [M + H].sup.+ 372.0541.  68 2-methoxy-N-methyl-N-(1-(2- (trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidin-4- amine embedded image Synthesised via Route 2 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.72 (d, J = 7.8 Hz, 1H), 7.67 (dd, J = 6.6, 4.4 Hz, 2H), 7.62 (t, J = 7.6 Hz, 1H), 7.46 (t, J = 7.6 Hz, 1H), 7.28 (s, 1H), 6.66 (q, J = 6.8 Hz, 1H), 4.00 (s, 3H), 3.08 (s, 3H), 1.69 (d, J = 6.8 Hz, 3H). HRMS (ES) C.sub.17H.sub.17N.sub.3F.sub.3OS [M + H].sup.+ 368.1037.  69 N,2,6-trimethyl-N-(1-(2- (trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidin-4- amine embedded image Synthesised via Route 2 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.70 (d, J = 7.8 Hz, 1H), 7.63 (d, J = 7.8 Hz, 1H), 7.57 (t, J = 7.5 Hz, 1H), 7.41 (t, J = 7.6 Hz, 1H), 7.01 (s, 1H), 6.56 (q, J = 6.8 Hz, 1H), 3.14 (s, 3H), 2.56 (d, J = 0.7 Hz, 3H), 2.54 (s, 3H), 1.66 (d, J = 6.8 Hz, 3H). HRMS (ES) C.sub.18H.sub.19N.sub.3F.sub.3S [M + H].sup.+ 366.1247.  70 2-(2-methyl-4-(methyl(1-(2- (trifluoromethyl)phenyl)ethyl)amino)thieno[3,2-d]pyrimidin- 6-yl)propan-2-ol 0embedded image Synthesised via Route 3 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 7.70 (d, J = 7.8 Hz, 1H), 7.63 (d, J = 7.8 Hz, 1H), 7.57 (t, J = 7.5 Hz, 1H), 7.42 (t, J = 7.5 Hz, 1H), 7.14 (s, 1H), 6.60 (q, J = 6.8 Hz, 1H), 3.19 (s, 3H), 2.55 (s, 3H), 1.69 (s, 6H), 1.66 (d, J = 6.9 Hz, 3H). HRMS (ES) C.sub.20H.sub.23N.sub.3F.sub.3OS [M + H].sup.+ 410.1505.  72 N-(4-fluoro-2-(trifluoromethyl)benzyl)quinazolin-4-amine embedded image Synthesised via Route 5 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.70 (s, 1H), 7.88 (d, J = 8.3 Hz, 1H), 7.80-7.73 (m, 1H), 7.73-7.66 (m, 2H), 7.52- 7.46 (m, 1H), 7.40 (dd, J = 8.9, 2.6 Hz, 1H), 7.20 (td, J = 8.3, 2.6 Hz, 1H), 6.14 (br. s, 1H), 5.07 (d, J = 5.7 Hz, 2H). HRMS (ES) C.sub.16H.sub.12N.sub.3F.sub.4 [M + H].sup.+ 322.0869.  73 N-(4-fluoro-2-(trifluoromethyl)benzyl)-2-methylquinazolin-4- amine embedded image Synthesised via Route 5 .sup.1H NMR (400 MHz, DMSO) δ (ppm) 8.75 (t, J = 5.7 Hz, 1H), 8.28 (d, J = 7.8 Hz, 1H), 7.75 (t, J = 8.2 Hz, 1H), 7.68-7.61 (m, 2H), 7.58 (dd, J = 8.6, 5.7 Hz, 1H), 7.52-7.44 (m, 2H), 4.93 (d, J = 5.4 Hz, 2H), 2.39 (s, 3H). HRMS (ES) C.sub.17H.sub.14N.sub.3F.sub.4 [M + H].sup.+ 336.1127.  74 4-(methyl(1-(2- (trifluoromethyl)phenyl)ethyl)amino)thieno[3,2- d]pyrimidine-2-carbonitrile embedded image Synthesised via Route 2 .sup.1H NMR (400 MHz, DMSO) δ (ppm) 8.41 (d, J = 5.6 Hz, 1H), 7.87 (d, J = 7.8 Hz, 1H), 7.82-7.72 (m, 2H), 7.59 (t, J = 7.6 Hz, 1H), 7.55 (d, J = 5.6 Hz, 1H), 6.37 (q, J = 6.8 Hz, 1H), 3.24 (s, 3H), 1.68 (d, J = 6.9 Hz, 3H). HRMS (ES) C.sub.17H.sub.14N.sub.4F.sub.3S [M + H].sup.+ 363.0888.  75 N-(4-fluoro-2-(trifluoromethyl)benzyl)-N-methylquinazolin-4- amine embedded image Synthesised via Route 5 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.70 (s, 1H), 7.92 (d, J = 8.4 Hz, 1H), 7.85 (d, J = 8.5 Hz, 1H), 7.78-7.69 (m, 1H), 7.59 (dd, J = 8.4, 5.5 Hz, 1H), 7.48 (dd, J = 8.8, 2.5 Hz, 1H), 7.41- 7.33 (m, 1H), 7.31-7.22 (m, 1H), 5.13 (s, 2H), 3.33 (s, 4H). HRMS (ES) C.sub.17H.sub.14N.sub.3F.sub.4 [M + H].sup.+ 336.1126.  88 1-(3-((4-((2-(trifluoromethyl)benzyl)amino)thieno[3,2- d]pyrimidin-2-yl)amino)propyl)pyrrolidin-2-one embedded image Synthesised via Route 1 1H NMR (400 MHz, Chloroform-d) δ (ppm) 7.68 (d, J = 7.8 Hz, 1H), 7.63 (d, J = 7.8 Hz, 1H), 7.55 (dd, J = 5.3, 1.0 Hz, 1H), 7.50 (t, J = 7.6 Hz, 1H), 7.38 (t, J = 7.6 Hz, 1H), 7.12 (dd, J = 5.3,1.0 Hz, 1H), 5.22 (m, 1H), 5.11 (br.s, 1H), 5.00 (d, J = 6.0 Hz, 2H), 3.41 (q, J = 6.5 Hz, 2H), 3.35 (td, J = 7.0, 3.2 Hz, 4H), 2.38 (t, J = 8.1 Hz, 2H), 2.07-1.93 (m, 2H), 1.76 (p, J = 6.8 Hz, 2H). HRMS (Cl+) C21H22F.sub.3N5OS [M + H].sup.+ 450.1582.  89 N.sup.2-(2-(dimethylamino)ethyl)-N.sup.4-(2- (trifluoromethyl)benzyl)thieno[3,2-d]pyrimidine-2,4-diamine embedded image Synthesised via Route 1 1H NMR (400 MHz, CDCl3) δ (ppm) 7.68 (d,J = 7.8 Hz, 1H), 7.62 (d, J-7.7 Hz, 1H), 7.54 (d, J = 5.3 Hz, 1H), 7.50 (t, J = 7.5 Hz, 1H), 7.37 (t, J = 7.6 Hz, 1H), 7.13 (d, J = 5.3 Hz, 1H), 5.30 (t, J = 4.7 Hz, 1H), 5.05 (d, J = 5.0 Hz, 1H), 5.01 (d, J = 5.5 Hz, 2H), 3.49 (dd, 1 = 11.6, 5.9 Hz, 2H), 2.49 (t, J = 6.1 Hz, 2H), 2.24 (s, 7H). HRMS (ES+) C18H20F3N5S [M + H].sup.+ 396.1460  90 N.sup.2-(2-morpholinoethyl)-N.sup.4-(2- (trifluoromethyl)benzyl)thieno[3,2-d]pyrimidine-2,4-diamine embedded image Synthesised via Route 1 1H NMR (400 MHz, CDCl3) δ (ppm) 7.68 (d, J = 7.8 Hz, 1H), 7.61 (d, J = 7.7 Hz, 1H), 7.56 (d, J = 5.3 Hz, 1H), 7.50 (t, J = 7.5 Hz, 1H), 7.37 (dd, J = 17.4, 9.9 Hz, 1H), 7.13 (d, J = 5.3 Hz, 1H), 5.38 (s, 1H), 5.16 (s, 1H), 5.02 (d, J = 5.9 Hz, 2H), 3.84- 3.61 (m, 5H), 3.50 (dd, J = 10.1, 4.3 Hz, 2H), 2.54 (dd, J = 11.2, 5.1 Hz, 2H), 2.45 (s, 4H). HRMS (Cl+) C20H22F3N5OS [M + H].sup.+ 438.1583  91 N.sup.2-(2-(pyrrolidin-1-yl)ethyl)-N.sup.4-(2- (trifluoromethyl)benzyl)thieno[3,2-d]pyrimidine-2,4-diamine embedded image Synthesised via Route 1 1H NMR (400 MHz, CDCl3) δ (ppm) 7.68 (d, J = 7.8 Hz, 1H), 7.62 (s, 1H), 7.55 (d, J = 5.3 Hz, 1H), 7.50 (t, J = 7.6 Hz, 1H), 7.38 (t, J = 7.6 Hz, 1H), 7.12 (d, J = 5.3 Hz, 1H), 5.40 (t, J = 4.9 Hz, 1H), 5.06 (d, J = 4.9 Hz, 1H), 5.01 (d, J = 5.6 Hz, 2H), 3.57 (dd, J = 11.8, 6.0 Hz, 2H), 2.74 (t, J = 6.0 Hz, 2H), 2.62 (s, 4H). HRMS (ES+) C20H22F3N5S [M + H].sup.+ 422.1612  92 N.sup.2-(2-(4-methyipiperazin-1-yl)ethyl)-N.sup.4-(2- (trifluoromethyl)benzyl)thieno[3,2-d]pyrimidine-2,4-diamine embedded image Synthesised via Route 1 1H NMR (400 MHz, CDCl3) δ (ppm) 7.60 (d, J = 7.8 Hz, 1H), 7.54 (d, J = 7.7 Hz, 1H), 7.47 (t, J = 4.9 Hz, 1H), 7.42 (t, J = 7.5 Hz, 1H), 7.30 (t, J = 7.6 Hz, 1H), 7.04 (d, J = 5.3 Hz, 1H), 5.37 (s, 1H), 5.16 (s, 1H), 4.94 (d, J = 5.9 Hz, 2H), 3.41 (dd, J = 11.5, 5.9 Hz, 2H), 2.47 (dd, J = 12.0, 5.9 Hz, 3H), 2.41 (dd, J = 13.8, 7.7 Hz, 5H), 1.18 (t, J = 7.1 Hz, 1H). HRMS (Cl+) C21H25F3N6S [M + H].sup.+ 451.1892  93 2-(pyrrolidin-1-yl)-N-(2-(trifluoromethyl)benzyl)thieno[3,2- d]pyrimidin-4-amine 0embedded image Synthesised via Route 1 1H NMR (400 MHz, CDCl3) δ (ppm) 8.58 (s, 1H), 7.73 (d, J = 5.6 Hz, 2H), 7.48 (t, J = 7.5 Hz, 1H), 7.43 (d, J = 5.6 Hz, 1H), 7.39 (t, J = 7.5 Hz, 1H), 7.29 (d, J = 7.7 Hz, 1H), 3.47 (s, 3H), 1.64 (s, 2H). HRMS (ES+) C18H17F3N4S [M + H].sup.+ 379.1196  94 2-morpholino-N-(2-(trifluoromethyl)benzyl)thieno[3,2- d]pyrimidin-4-amine embedded image Synthesised via Route 1 1H NMR (400 MHz, CDCl3) δ (ppm) 7.67 (t, J = 8.4 Hz, 1H), 7.60 (d, J = 7.5 Hz, 1H), 7.57 (d, J = 5.5 Hz, 1H), 7.49 (q, J = 7.5 Hz, 1H), 7.38 (t, J = 7.6 Hz, 1H), 7.16 (d, J = 5.3 Hz, 1H), 5.10 (t, J = 5.6 Hz, 1H), 5.00 (d, J = 5.9 Hz, 2H), 3.83-3.67 (m, 8H). HRMS (ES+) C18H17F3N4OS [M + H].sup.+ 395.1161  95 2-(4-methylpiperazin-1-yl)-N-(2- (trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine embedded image Synthesised via Route 1 1H NMR (400 MHz, CDCl3) δ (ppm) 7.68 (d, J = 7.8 Hz, 1H), 7.61 (d, J = 7.7 Hz, 1H), 7.56 (d, J = 5.3 Hz, 1H), 7.49 (t, J = 7.5 Hz, 1H), 7.38 (t, J = 7.6 Hz, 1H), 7.15 (d, J = 5.3 Hz, 1H), 5.09-5.03 (m, 1H), 5.00 (d, J = 5.8 Hz, 2H), 3.90-3.77 (m, 4H), 2.52-2.41 (m, 4H), 2.33 (s, 3H). HRMS (Cl+) C19H20F3N5S [M + H].sup.+ 408.1475  96 6-iodo-N-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2- d]pyrimidin-4-amine embedded image Synthesised via Route 3 1H NMR (400 MHz, CDCl3) δ (ppm) 8.46 (s, 1H), 7.69 (d, J = 7.8 Hz, 1H), 7.60 (d, J = 7.4 Hz, 2H), 7.54 (t, J = 7.5 Hz, 1H), 7.38 (t, J = 7.6 Hz, 1H), 5.81 (p, J = 6.7 Hz, 1H), 4.95 (d, J = 5.9 Hz, 1H), 1.65 (d, J = 6.7 Hz, 3H). HRMS (Cl+) C15H11F3IN3S [M + H].sup.+ 449.9759  97 N-(2-(methylsulfonyl)benzyl)thieno[3,2-d]pyrimidin-4-amine embedded image Synthesised via Route 2 1H NMR (400 MHz, CDCl3) δ (ppm) 8.62 (s, 1H), 8.05 (dd, J = 7.9, 1.2 Hz, 1H), 7.85 (d, J = 7.7 Hz, 1H), 7.70 (d, J = 5.4 Hz, 1H), 7.61 (td, J = 7.6,1.3 Hz, 1H), 7.50 (td, J = 7.8, 1.2 Hz, 1H), 7.40 (d, J = 5.4 Hz, 1H), 6.05 (t, J = 5.9 Hz, 1H), 5.19 (d, J = 6.4 Hz, 2H), 3.24 (s, 3H). HRMS (Cl+) C14H13N3O2S2 [M + H].sup.+ 320.0533  98 6-phenyl-N-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2- d]pyrimidin-4-amine embedded image Synthesised via Route 3 1H NMR (400 MHz, CDCl3) δ (ppm) 8.55 (s, 1H), 7.76-7.68 (m, 3H), 7.66 (d, J = 7.9 Hz, 1H), 7.58 (s, 1H), 7.55 (t, J = 7.8 Hz, 1H), 7.50-7.42 (m, 3H), 7.39 (t, J = 7.5 Hz, 1H), 5.86 (p, J = 6.7 Hz, 1H), 5.08 (d, J = 6.0 Hz, 1H), 1.68 (d, J = 6.7 Hz, 3H). HRMS (Cl+) C21H16F3N3S [M + H].sup.+ 400.1104  99 6-cyclopropyl-N-(1-(2- (trifluoromethyl)phenyl)ethyl)thieno[3,2-d]pyrimidin-4- amine embedded image Synthesised via Route 3 1H NMR (400 MHz, CDCl3) δ (ppm) 8.49 (s, 1H), 7.73-7.63 (m, 1H), 7.61 (d, J = 7.8 Hz, 1H), 7.51 (dd, J = 18.3, 10.5 Hz, 1H), 7.41-7.32 (m, 1H), 7.03 (s, 1H), 5.89-5.75 (m, 1H), 5.00 (d, J = 5.7 Hz, 1H), 2.26-2.16 (m, 1H), 1.31-1.19 (m, 1H), 1.20-1.11 (m, 2H), 0.87 (tt, J = 14.7, 7.2 Hz, 2H). HRMS (Cl+) C18H16F3N3S [M + H].sup.+ 364.1094 102 4-((1-(2-(trifluoromethyl)phenyl)ethyl)amino)thieno[3,2- d]pyrimidine-6-carbonitrile embedded image Synthesised via Route 3 1H NMR (400 MHz, CDCl3) δ (ppm) 8.63 (s, 1H), 7.93 (d, J = 2.4 Hz, 1H), 7.69 (t, J = 10.1 Hz, 1H), 7.63 (d, J = 7.8 Hz, 1H), 7.55 (t, J = 7.6 Hz, 1H), 7.40 (t, J = 7.5 Hz, 1H), 5.96-5.80 (m, 1H), 5.46 (s, 1H), 1.70 (d, J = 6.7 Hz, 3H), 1.26 (d, J = 7.6 Hz, 1H). HRMS (Cl+) C16H11F3N4S [M + H].sup.+ 349.074 103 N-((2-(trifluoromethyl)pyridin-3-yl)methyl)thieno[3,2- d]pyrimidin-4-amine embedded image Synthesised via Route 2 1H NMR (400 MHz, CDCl3) δ (ppm) 8.58 (s, 1H), 8.54 (d, J = 4.3 Hz, 1H), 7.99 (d, J = 7.9 Hz, 1H), 7.68 (d, J = 5.4 Hz, 1H), 7.39 (dd, J = 10.1, 5.0 Hz, 2H), 5.41 (d, J = 5.2 Hz, 1H), 5.05 (d, J = 6.1 Hz, 2H). HRMS (ES+) C13H9F3N4S [M + H].sup.+ 311.0575 104 2-(((2-chlorothieno[3,2-d]pyrimidin-4- yl)amino)methyl)benzonitrile embedded image Synthesised via Route 1 1H NMR (400 MHz, CDCl3) δ (ppm) 7.77 (d, J = 5.4 Hz, 1H), 7.73-7.66 (m, 2H), 7.60 (t, J = 7.6 Hz, 1H), 7.41 (t, J = 7.7 Hz, 1H), 7.37 (d, J = 5.4 Hz, 1H), 5.88 (b, 1H), 5.04 (d, J = 6.2 Hz, 2H). HRMS (Cl+) C14H9ClN4S [M + H].sup.+ 301.0322 105 7-methyl-N-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2- d]pyrimidin-4-amine 0embedded image Synthesised via Route 2 1H NMR (400 MHz, CDCl3) δ (ppm) 8.61 (s, 1H), 7.64 (d, 1H, J = 7.9 Hz), 7.65 (d, 1H, J = 7.8 Hz), 7.52 (t, 1H, J = 7.9 Hz), 7.38 (t, 1H, J = 7.8 Hz), 7.32 (s, 1H), 5.86 (m, 1H, J = 6.6 Hz)), 5.07 (s, 1H), 2.44 (s, 3H), 1.67 (d, 3H, J = 6.6 Hz). HRMS: (Cl+, NH3) C16H15F3N3S [M + H].sup.+ 338.0945 106 7-bromo-N-(1-(2-(trifluoromethyl)phenyl)ethyl)thieno[3,2- d]pyrimidin-4-amine embedded image Synthesised via Route 2 1H NMR (400 MHz, CDCl3) δ (ppm) 8.68 (s, 1H), 7.72 (s, 1H), 7.71 (d, 1H, J = 8.8 Hz), 7.64 (d, 1H, J = 7.8 Hz), 7.59 (t, 1H, J = 8.8 Hz), 7.54 (t, 1H, J = 7.8 Hz), 5.86 (m , 1H), 5.14 (s, 1H), 1.68 (s, 3H). HRMS: (Cl+, NH3) C15H11BrF3N3S [M + H].sup.+ 401.9896. 108 4-((1-(2-(trifluoromethyl)phenyl)ethyl)amino)thieno[3,2- d]pyrimidine-7-carbonitrile embedded image Synthesised via Route 2 1H NMR (400 MHz, CDCl3) δ (ppm) 8.68 (s, 1H), 8.31 (s, 1H), 7.70 (d, 1H, J = 7.8 Hz), 7.60 (d, 1H, J = 7.7 Hz), 7.55 (t, 1H, J = 7.7 Hz), 7.41 (t, 1H, J = 7.8 Hz), 5.85 (m, 1H), 5.24 (s, 1H), 1.68 (d, 3H). HRMS: (Cl+, CH4) C16H11F3N4S [M + H].sup.+ 349.0739. 109 N.sup.2-isopropyl-N.sup.4-(4-(trifluoromethyl)benzyl)thieno[3,2- d]pyrimidine-2,4-diamine embedded image Synthesised via Route 1 1H NMR (400 MHz, MeOD) δ (ppm) 7.53 (d, J = 8.2 Hz, 2H), 7.50 (d, J = 5.3 Hz, 1H), 7.43 (d, J = 8.1 Hz, 2H), 7.07 (d, J = 5.3 Hz, 1H), 5.97 (s, 1H), 5.14 (s, 1H), 4.81 (d, J = 5.6 Hz, 2H), 4.09 (dq, J = 13.2, 6.5 Hz, 1H), 1.15 (d, J = 6.5 Hz, 6H). HRMS: (ES) C17H18F3N4S [M + H].sup.+ 367.1203. 110 N.sup.2-isopropyl-N.sup.4-(4-(methylsulfonyl)benzyl)quinazoline-2,4- diamine embedded image Synthesised via Route 4 1H NMR (400 MHz, CDCl3) δ (ppm) 8.01 (d, J = 6.9 Hz, 1H), 7.73 (d, J = 8.3 Hz, 2H), 7.50-7.47 (m, 2H), 7.47-7.44 (m, 1H), 7.32 (d, J = 8.3 Hz, 1H), 7.07 (t, J = 7.6 Hz, 1H), 4.85 (s, 2H), 4.13-4.01 (m, 1H), 2.97 (s, 3H), 1.109 (d, J = 6.4 Hz 6H). HRMS: (ES) C19H23N4O2S [M + H].sup.+ 371.1539. 111 N.sup.2-isopropyl-N.sup.4-(4-(trifluoromethyl)benzyl)quinazoline-2,4- diamine embedded image Synthesised via Route 4 1H NMR (400 MHz, CDCl3) δ (ppm) 7.65 (d, J = 8.0 Hz, 1H), 7.52 (t, J = 5.6 Hz, 2H), 7.48 (dd, J = 6.9, 1.2 Hz, 1H), 7.42 (d, J = 4.5 Hz, 2H), 7.41 (s, 1H), 7.07-7.00 (m, 1H), 6.62 (s, 1H), 4.82 (d, J = 5.0 Hz, 3H), 4.17 (dd, J = 12.4, 6.1 Hz, 1H), 1.14 (d, J = 6.5 Hz, 6H). HRMS: (ES) C19H20F3N4 [M + H].sup.+ 361.1639. 112 N.sup.2-isopropyl-N.sup.4-(2-(methylsulfonyl)benzyl)quinazoline-2,4- diamine embedded image Synthesised via Route 4 1H NMR (400 MHz, CDCl3) δ (ppm) 8.04 (dd, J = 7.9, 1.3 Hz, 1H), 7.71 (dd, J = 7.6, 0.8 Hz, 1H), 7.64-7.56 (m, 2H), 7.55- 7.47 (m, 2H), 7.39 (d, J = 8.0 Hz, 1H), 7.14-7.08 (m, 1H), 5.15 (d, J = 5.6 Hz, 2H), 4.29 (dq, J = 13.3, 6.5 Hz, 1H), 3.18 (s, 3H), 1.27 (d, J = 6.5 Hz, 6H). HRMS: (ES) C19H23N4O2S [M + H].sup.+ 371.1540. 114 N.sup.2-isopropyl-N.sup.4-((6-(trifluoromethyl)pyridin-3- yl)methyl)quinazoline-2,4-diamine embedded image Synthesised via Route 4 1H NMR (400 MHz, MeOD) δ (ppm) 8.78 (s, 1H), 8.08 (d, J = 6.3 Hz, 1H), 8.07 (s, 1H), 7.79 (d, J = 8.1 Hz, 1H), 7.70 (t, J = 7.7 Hz, 1H), 7.43 (d, J = 8.1 Hz, 1H), 7.33 (t, J = 7.7 Hz, 1H), 4.95 (s, 2H), 4.12 (dq, J = 12.5, 6.3 Hz, 1H), 1.17 (d, J = 6.4 Hz, 6H). HRMS: (ES) C19H20F3N4 [M + H].sup.+ 362.1590. 116 N.sup.4-(4-cyanobenzyl)-N.sup.2-isopropylthieno[3,2-d]pyrimidine-2,4- diamine embedded image Synthesised via Route 1 1H NMR (400 MHz, CDCl3) δ (ppm) 7.63-7.58 (m, 2H), 7.56 (d, J = 5.3 Hz, 1H), 7.46 (d, J = 8.4 Hz, 2H), 7.11 (d, J = 5.3 Hz, 1H), 5.43 (s, 1H), 4.96 (s, 1H), 4.84 (d, J = 5.8 Hz, 2H), 4.07 (tt, J = 13.1, 6.7 Hz, 1H), 1.16 (d, J = 6.5 Hz, 6H). HRMS: (ES) C17H17N5S [M + H].sup.+ 324.1281. 117 N.sup.2-isopropyl-N.sup.4-(2-(methylsuifonyl)benzyl)thieno[3,2- d]pyrimidine-2,4-diamine embedded image Synthesised via Route 1 1H NMR (400 MHz, CDCl3) δ (ppm) 8.03-7.99 (m, 1H), 7.72 (d, J = 7.5 Hz, 1H), 7.56 (t, J = 7.4 Hz, 1H), 7.50 (d, J = 5.3 Hz, 1H), 7.44 (t, J = 7.6 Hz, 1H), 7.04 (d, J = 5.3 Hz, 1H), 5.88 (s, 1H), 5.10 (d, J = 6.3 Hz, 2H), 4.70 (d, J = 8.0 Hz, 1H), 4.17 (dq, J = 13.0, 6.5 Hz, 1H), 3.14 (s, 3H), 1.20 (d, J = 6.5 Hz, 6H). HRMS: (ES) C17H20N2NaO2S2 [M + Na].sup.+ 399.0925. 118 N.sup.2-isopropyl-N.sup.4-(4-(methylsuifonyl)benzyl)thieno[3,2- d]pyrimidine-2,4-diamine 0embedded image Synthesised via Route 1 1H NMR (400 MHz, CDCl3) δ (ppm) 7.80 (d, J = 8.3 Hz, 2H), 7.52 (d, J = 5.3 Hz, 1H), 7.49 (d, J = 8.2 Hz, 2H), 7.07 (d, J = 5.3 Hz, 1H), 5.82 (s, 1H), 4.82 (d, J = 5.9 Hz, 2H), 4.75 (d, J = 7.9 Hz, 1H), 4.05 (dq, J = 13.1, 6.5 Hz, 1H), 3.00 (s, 3H), 1.12 (d, J = 6.5 Hz, 6H). HRMS: (ES) C17H20N2NaO2S2 [M + Na].sup.+ 399.0924. 119 N.sup.2-isopropyl-N.sup.4-((6-(trifluoromethyl)pyridin-3- yl)methyl)thieno[3,2-d]pyrimidine-2,4-diamine embedded image Synthesised via Route 1 1H NMR (400 MHz, CDCl3) δ (ppm) 8.71 (s, 1H), 7.85 (d, J = 7.1 Hz, 1H), 7.60 (d, J = 8.1 Hz, 1H), 7.53 (d, J = 5.3 Hz, 1H), 7.08 (d, J = 5.3 Hz, 1H), 5.69 (s, 1H), 4.84 (d, J = 5.7 Hz, 2H), 4.77 (d, J = 7.6 Hz, 1H), 4.05 (m, 1H), 1.14 (d, J = 6.5 Hz, 6H). HRMS: (ES) C16H16F3N5NaS [M + Na].sup.+ 390.0973. 120 N.sup.4-(4-cyanobenzyl)-N.sup.2-isopropylquinazoline-2,4-diamine embedded image Synthesised via Route 4 1H NMR (400 MHz, DMSO) δ (ppm) 10.35 (s, 1H), 8.38 (s, 1H), 7.80 (d, J = 8.3 Hz, 2H), 7.78-7.72 (m, 1H), 7.59 (d, J = 8.2 Hz, 2H), 7.37 (s, 1H), 4.84 (d, J = 5.5 Hz, 2H), 4.06 (s, 1H), 1.08 (s, 6H). HRMS: (ES) C19H20N5 [M + H].sup.+ 318.1719. 121 N.sup.4-(4-cyanobenzyl)-N.sup.2-isopropylpyrido[3,2-d]pyrimidine-2,4- diamine embedded image Synthesised via Route 7 1H NMR (400 MHz, CDCl3) δ (ppm) 8.28 (d, J = 3.4 Hz, 1H), 7.68 (d, J = 7.5 Hz, 1H), 7.57 (d, J = 7.9 Hz, 2H), 7.43 (d, J = 7.0 Hz, 2H), 7.40 (s, 1H), 5.19 (s, 1H), 4.80 (d, J = 5.9 Hz, 2H), 4.17 (m, 1H), 1.18 (d, J = 5.8 Hz, 6H). HRMS: (ES) C18H19N6 [M + H].sup.+ 319.1669. 122 N.sup.2-isopropyl-N.sup.4-(2-(methylsulfonyl)benzyl)pyrido[3,2- d]pyrimidine-2,4-diamine embedded image Synthesised via Route 7 1H NMR (400 MHz, CDCl3) δ (ppm) 8.30 (d, J = 4.2 Hz, 1H), 8.05 (d, J = 7.9 Hz, 1H), 7.75 (d, J = 8.4 Hz, 1H), 7.72 (d, J = 7.7 Hz, 1H), 7.65 (d, J = 8.4 Hz, 1H), 7.59 (t, J = 7.5 Hz, 1H), 7.48 (t, J = 7.6 Hz, 1H), 7.41 (dd, J = 8.5, 4.2 Hz, 1H), 5.17 (d, J = 6.5 Hz, 2H), 4.91 (s, 1H), 4.28-4.18 (m, 1H), 3.17 (s, 3H), 1.24 (d, J = 6.5 Hz, 6H). HRMS: (ES) C18H22N5O2S [M + H].sup.+ 372.1495. 123 N.sup.2-isopropyl-N.sup.4-(4-(methylsulfonyl)benzyl)pyrido[3,2- d]pyrimidine-2,4-diamine embedded image Synthesised via Route 7 1H NMR (400 MHz, CDCl3) δ (ppm) 8.32-8.28 (m, 1H), 7.90 (d, J = 8.3 Hz, 2H), 7.70 (d, J = 8.4 Hz, 1H), 7.58 (d, J = 8.1 Hz, 2.H), 7.44 (dd, J = 8.5, 4.2 Hz, 2.H), 4.87 (d, J = 6.2 Hz, 2H), 4.18 (dt, J = 13.4, 6.7 Hz, 1H), 3.03 (s, 3H), 1.21 (d, J = 6.5 Hz, 6H). HRMS: (ES) C18H22N5O2S [M + H].sup.+ 372.1491. 124 N.sup.2-isopropyl-N.sup.4-(4-(trifluoromethyl)benzyl)pyrido[3,2- d]pyrimidine-2,4-diamine embedded image Synthesised via Route 7 1H NMR (400 MHz, CDCl3) δ (ppm) 8.31 (d, J = 4.2 Hz, 1H), 7.72 (d, J = 8.5 Hz, 1H), 7.60 (d, J = 8.1 Hz, 2H), 7.50 (d, J = 8.0 Hz, 2H), 7.45 (dd, J = 8.5, 4.2 Hz, 1H), 4.85 (d, J = 6.1 Hz, 2H), 4.21 (dq, J = 13.4, 6.7 Hz, 1H), 1.23 (d, J = 6.5 Hz, 6H). HRMS: (ES) C18H19F3N5 [M + H].sup.+ 362.1595. 125 N.sup.2-isopropyl-N.sup.4-((6-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[3,2-d]pyrimidine-2,4-diamine embedded image Synthesised via Route 7 1H NMR (400 MHz, CDCl3) δ (ppm) 8.77 (s, 1H), 8.28 (dd, J = 4.2, 1.1 Hz, 1H), 7.88 (d, J = 7.9 Hz, 1H), 7.68 (d, J = 8.4 Hz, 1H), 7.63 (d, J = 8.1 Hz, 1H), 7.43 (dd, J = 8.5, 4.2 Hz, 1H), 4.94 (s, 1H), 4.85 (d, J = 6.2 Hz, 2H), 4.17 (d, J = 6.3 Hz, 1H), 1.20 (d, J = 6.4 Hz, 6H). HRMS: (ES) C17H18F3N6 [M + H].sup.+ 363.1546. 126 N.sup.4-(4-cyanobenzyl)-N.sup.2-isopropylpyrido[2,3-d]pyrimidine-2,4- diamine embedded image Synthesised via Route 6 1H NMR (400 MHz, MeOD) δ (ppm) 8.53 (dd, J = 4.5, 1.6 Hz, 1H), 8.27 (d, J = 7.7 Hz, 1H), 7.59 (d, J = 8.1 Hz, 2H), 7.47 (d, J = 8.2 Hz, 2H), 7.00 (dd, J = 8.0, 4.6 Hz, 1H), 4.77 (s, 2H), 4.11 (s, 1H), 3.28-3.26 (m, 1H), 1.12 (d, J = 23.6 Hz, 6H). HRMS: (ES) C18H18N6Na [M + Na].sup.+ 341.1489. 127 N.sup.2-isopropyl-N.sup.4-(2-(methylsulfonyl)benzyl)pyrido[2,3- d]pyrimidine-2,4-diamine embedded image Synthesised via Route 6 1H NMR (400 MHz, MeOD) δ (ppm) 8.64-8.60 (m, 1H), 8.34 (d, J = 7.5 Hz, 1H), 8.05 (d, J = 7.8 Hz, 1H), 7.63 (d, J = 5.5 Hz, 2.H), 7.51 (dd, J = 10.9, 5.5 Hz, 1H), 7.10 (dd, J = 7.9, 4.6 Hz, 1H), 5.22 (s, 2H), 4.18 (s, 1H), 3.31 (s, 3H), 1.12 (s, 6H). HRMS: (ES) C18H21NaN5O2S [M + Na].sup.+ 394.1313. 128 N.sup.2-isopropyl-N.sup.4-(4-(methylsulfonyl)benzyl)pyrido[2,3- d]pyrimidine-2,4-diamine 0embedded image Synthesised via Route 6 1H NMR (400 MHz, MeOD) δ (ppm) 8.56 (dd, J = 4.6, 1.6 Hz, 1H), 8.30 (d, J = 7.7 Hz, 1H), 7.84 (d, J = 8.3 Hz, 2H), 7.57 (d, J = 8.3 Hz, 2H), 7.02 (dd, J = 8.0, 4.6 Hz, 1H), 4.82 (s, 2H), 3.30- 3.27 (m, 1H), 3.04 (s, 3H), 1.14 (d, J = 34.1 Hz, 6H). HRMS: (ES) C18H21NaN5O2S [M + Na].sup.+ 394.1311. 129 N.sup.2-isopropyl-N.sup.4-(4-(trifluoromethyl)benzyl)pyrido[2,3- d]pyrimidine-2,4-diamine embedded image Synthesised via Route 6 1H NMR (400 MHz, DMSO) δ (ppm) 8.72-8.44 (m, 1H), 8.44 (d, J = 42.8 Hz, 1H), 7.62 (d, J = 8.1 Hz, 2H), 7.52 (d, J = 7.9 Hz, 2H), 7.05 (d, J = 35.0 Hz, 1H), 4.74 (d, J = 4.3 Hz, 2H), 4.14- 3.88 (m, 1H), 1.01 (dd, J = 23.4, 16.7 Hz, 6H). HRMS: (ES) C18H18F3N5Na [M + Na].sup.+ 384.1410. 130 N.sup.2-isopropyl-N.sup.4-((6-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine embedded image Synthesised via Route 6 1H NMR (400 MHz, MeOD) δ (ppm) 8.76 (s, 1H), 8.64 (s, 1H), 8.39 (s, 1H), 8.06 (d, J = 8.0 Hz, 1H), 7.78 (d, J = 8.1 Hz, 1H), 7.17 (s, 1H), 4.90 (d, J = 2.4 Hz, 2H), 4.18 (d, J = 8.2 Hz, 1H), 1.15 (s, 6H). HRMS: (ES) C17H17F3N6Na [M + Na].sup.+ 385.1366. 131 N.sup.2-isopropyl-N.sup.4-(4-methoxybenzyl)thieno[3,2-d]pyrimidine- 2,4-diamine embedded image Synthesised via Route 1 1H NMR (400 MHz, CDCl3) δ (ppm) 7.49 (d, J = 5.3 Hz, 1H), 7.29 (d, J = 8.5 Hz, 2H), 7.09 (d, J = 5.3 Hz, 1H), 6.86 (d, J = 8.6 Hz, 2H), 5.17 (s, 1H), 4.77 (d, J = 7.8 Hz, 1H), 4.70 (d, J = 5.5 Hz, 2H), 4.20 (m, 1H), 3.79 (s, 3H), 1.22 (d, J = 6.5 Hz, 6H). HRMS: (ES) C17H21N4OS [M + H].sup.+ 329.1432. 132 N.sup.2-isopropyl-N.sup.4-(2-methoxybenzyl)thieno[3,2-d]pyrimidine- 2,4-diamine embedded image Synthesised via Route 1 1H NMR (400 MHz, CDCl3) δ (ppm) 7.47 (d, J = 5.3 Hz, 1H), 7.34 (dd, J = 7.4, 1.3 Hz, 1H), 7.28-7.22 (m, 1H), 7.07 (d, J = 5.3 Hz, 1H), 6.90 (dd, J = 14.2, 7.7 Hz, 2H), 5.42 (s, 1H), 4.82 (d, J = 7.8 Hz, 1H), 4.78 (d, J = 5.8 Hz, 2H), 4.22 (m, 1H), 3.86 (s, 3H), 1.23 (d, J = 6.5 Hz, 6H). HRMS: (ES) C17H21N4OS [M + H].sup.+ 329.1434. 133 N.sup.4-(3,4-dimethoxybenzyl)-N.sup.2-isopropylthieno[3,2- d]pyrimidine-2,4-diamine embedded image Synthesised via Route 1 1H NMR (400 MHz, CDCl3) δ (ppm) 7.52 (d, J = 5.3 Hz, 1H), 7.10 (d, J = 5.3 Hz, 1H), 6.92 (d, J = 4.6 Hz, 2H), 6.86-6.81 {m, 1H), 5.05 (s, 1H), 4.83 (s, 1H), 4.71 (d, J = 5.4 Hz, 2H), 4.21 (td, J = 13.1, 6.5 Hz, 1H), 3.87 (d, J = 3.2 Hz, 3H), 3.85 (s, 3H), 1.24 (d, J = 6.5 Hz, 6H). HRMS: (ES) C18H23N4O2S [M + H].sup.+ 359.1542. 134 N.sup.4-(4-fluorobenzyl)-N.sup.2-isopropylquinazoline-2,4-diamine embedded image Synthesised via Route 4 1H NMR (400 MHz, CDCl3) δ (ppm) 9.71 (s, NH), 8.49 (s, 1H), 7.47 (t, J = 7.7 Hz, 1H), 7.37 (dd, J = 8.3, 5.5 Hz, 2H), 7.25 (d, J = 5.7 Hz, 1H), 7.14 (t, J = 7.6 Hz, 1H), 6.87 (t, J = 8.6 Hz, 2H), 4.80 (s, 2H), 4.17 (dd, J = 12.6, 6.3 Hz, 1H), 1.18 (d, J = 6.5 Hz, 6H). HRMS: (ES) C18H20N4 [M + H].sup.+ 311.1669. 135 N.sup.4-(2-fluorobenzyl)-N.sup.2-isopropylquinazoline-2,4-diamine embedded image Synthesised via Route 4 1H NMR (400 MHz, CDCl3) δ (ppm) 8.04 (d, J = 5.6 Hz, 1H), 7.51 (t, J = 7.7 Hz, 1H), 7.36 (t, J = 7.1 Hz, 2H), 7.19 (d, J = 7.8 Hz, 1H), 7.17 (dd, J = 4.7, 2.8 Hz, 1H), 7.05-7.00 (m, 1H), 6.98 (d, J = 10.0 Hz, 1H), 4.86 (d, J = 3.5 Hz, 2H), 4.14 (m, 3H), 1.15 (d, J = 6.7 Hz, 6H). HRMS: (ES) C18H20N4 [M + H].sup.+ 311.1669. 136 N.sup.4-(4-chlorobenzyl)-N.sup.2-isopropylquinazoline-2,4-diamine embedded image Synthesised via Route 4 1H NMR (400 MHz, CDCl3) δ (ppm) 8.09 (d, J = 7.7 Hz, 1H), 7.49 (t, J = 7.7 Hz, 1H), 7.35 (d, J = 8.3 Hz, 1H), 7.29 (d, J = 8.4 Hz, 2H), 7.22 (d, J = 8.4 Hz, 2H), 7.14 (t, J = 7.5 Hz, 1H), 6.21-6.09 (m, 2H), 4.76 (s, 2H), 4.14 (dt, J = 11.4, 5.0 Hz, 1H), 1.19 (d, J = 6.5 Hz, 6H). HRMS: (ES) C18H20ClN4 [M + H].sup.+ 327.1373. 137 N.sup.4-(2-chlorobenzyl)-N.sup.2-isopropylquinazoline-2,4-diamine embedded image Synthesised via Route 4 1H NMR (400 MHz, CDCl3) δ (ppm) 8.19-8.13 (m, 1H), 7.58 (td, J = 7.2, 3.2 Hz, 1H), 7.42 (d, J = 7.0 Hz, 1H), 7.37-7.27 (m, 3H), 7.21-7.15 (m, 2H), 4.90 (d, J = 2.3 Hz, 2H), 4.13 (m, 1H), 1.14 (d, J = 6.5 Hz 6H). HRMS: (ES) C18H20ClN4 [M + H].sup.+ 327.1374. 138 N.sup.2-isopropyl-N.sup.4-(4-methoxybenzyl)quinazoline-2,4-diamine 0embedded image Synthesised via Route 4 1H NMR (400 MHz, CDCl3) δ (ppm) 8.29 (s, 1H), 7.45 (t, J = 7.7 Hz, 1H), 7.35 (d, J = 8.6 Hz, 2H), 7.27 (d, J = 10.2 Hz, 1H), 7.13 (t, J = 7.6 Hz, 1H), 6.77 (d, J = 8.4 Hz, 2H), 4.78 (d, J = 4.2 Hz, 2H), 4.24 (m, 1H), 3.73 (s, 3H), 1.24 (d, J = 6.5 Hz, 6H). HRMS: (ES) C19H23N4O [M + H].sup.+ 323.1869. 139 N.sup.2-isopropyl-N.sup.4-(2-methoxybenzyl)quinazoline-2,4-diamine embedded image Synthesised via Route 4 1H NMR (400 MHz, CDCl3) δ (ppm) 7.87 (d, J = 7.4 Hz, 1H), 7.51 (t, J = 7.7 Hz, 1H), 7.38 (d, J = 8.2 Hz, 1H), 7.30-7.26 (m, 1H), 7.23 (d, J = 7.8 Hz, 1H), 7.18 (t, J = 7.6 Hz, 1H), 6.87 (d, J = 6.6 Hz, 1H), 6.85 (d, J = 6.6 Hz, 1H), 4.84 (d, J = 5.0 Hz, 2H), 4.23 (m, 1H), 3.88 (s, 3H), 1.25 (d, J = 6.5 Hz, 6H). HRMS: (ES) C19H23N4O [M + H].sup.+ 323.1870. 140 N.sup.4-(3,4-dimethoxybenzyl)-N.sup.2-isopropylquinazoline-2,4- diamine embedded image Synthesised via Route 4 1H NMR (400 MHz, CDCl3) δ (ppm) 8.24 (s, 1H), 7.44 (t, J = 7.7 Hz, 1H), 7.27 (d, J = 10.7 Hz, 1H), 7.11 (t, J = 7.6 Hz, 1H), 7.04 (d, J = 1.3 Hz, 1H), 6.95 (dd, J = 8.2, 1.4 Hz, 1H), 6.74 (d, J = 8.2 Hz, 1H), 4.77 (s, 2H), 4.25 (dd, J = 11.9, 5.8 Hz, 1H), 3.81 (s, 3H), 3.80 (s, 3H), 1.24 (d, J = 6.4 Hz, 6H). HRMS: (ES) C20H25N4O2 [M + H].sup.+ 353.1976. 141 N.sup.2-(azetidin-3-yl)-N.sup.4-(2-(trifluoromethyl)benzyl)pyrido[2,3- d]pyrimidine-2,4-diamine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.93-8.67 (m, 2H), 8.48 (d, 1H), 7.75 (d, 1H), 7.62-7.43 (m, 4H), 7.10 (s, 1H), 4.92 (brs, 2H), 3.75-3.30 (m,5H). LCMS (ES) C.sub.18H.sub.18N.sub.6F.sub.3 [M + H].sup.+ 375.0. 142 N.sup.2-(1-methylazetidin-3-yl)-N.sup.4-(2- (trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidine-2,4-diamine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ (ppm) 8.59-8.41 (m, 2H), 7.88 (d, J = 7.7 Hz, 1H), 7.68 (d, J = 7.6 Hz, 1H), 7.61 (t, J = 7.4 Hz, 1H), 7.41 (t, J = 7.5 Hz, 1H), 7.24 (dd, J = 7.5, 4.9 Hz, 1H), 5.00-4.77 (m, 2H), 4.26 (dd, J = 12.3, 3.3 Hz, 1H), 3.79 (dd, J = 12.6, 7.3 Hz, 1H), 3.57-3.15 (m, 3H), 3.10 (s, 3H). LCMS (ES) C.sub.19H.sub.20N.sub.6F.sub.3 [M + H].sup.+ 389.0. 143 N.sup.2-methyl-N.sup.4-(2-(trifluoromethyl)benzyl)pyrido[2,3- d]pyrimidine-2,4-diamine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ (ppm) 8.83-8.41 (m, 3H), 7.76 (d, J = 7.7 Hz, 1H), 7.63 (t, J = 7.6 Hz, 1H), 7.59-7.41 (m, 2H), 7.32-6.85 (m, 2H), 5.02-4.85 (m, 2H), 2.74 (d, J = 52.1 Hz, 3H). LCMS (ES) C.sub.16H.sub.15N.sub.5F.sub.3 [M + H].sup.+ 334.0. 144 N.sup.2-(oxetan-3-yl)-N.sup.4-(2-(trifluoromethyl)benzyl)pyrido[2,3- d]pyrimidine-2,4-diamine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.41-7.91 (m, 4H), 7.78 (d, J = 8.0 Hz, 1H), 7.63 (t, J = 6.6 Hz, 1H), 7.50 (dd, J = 15.9, 8.6 Hz, 2H), 7.30-7.08 (m, 1H), 5.05-4.84 (m, 2H), 4.80-4.67 (m, 2H), 4.57-4.47 (m, 1H), 4.46-4.18 (m, 2H). LCMS (ES) C.sub.18H.sub.17N.sub.5F.sub.3O [M + H].sup.+ 376.0. 145 2-((methylamino)methyl)-N-(2- (trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 8 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.99-9.00 (d, J = 4.0 Hz, 1H), 8.70-8.72 (d, J = 8.0 Hz, J = 4.0 Hz, 1H), 7.74-7.76 (d, J = 8.0 Hz, 1H) 7.53-7.60 (m, 3H), 7.43-7.47 (m, 1H), 5.09 (s, 2H), 3.86 (s, 2H), 2.39 (s, 3H). LCMS (ES) C.sub.17H.sub.17N.sub.5F.sub.3 [M + H].sup.+ 348.2. 146 4-((2-(trifluoromethyl)benzyl)amino)pyrido[2,3-d]pyrimidine- 2-carboxamide embedded image Synthesised via Route 8 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 9.12 (dd, J = 8.0 Hz, J = 4.0 Hz, 1H), 8.15 (d, J = 8.0 Hz, 1H), 8.06 (s, 1H), 7.92 (d, J = 8.0 Hz, 1H), 7.71 (d, J = 8.0 Hz, 1H), 7.57 (t, J = 8.0 Hz, 1H), 7.51-7.48 (dd, J = 8.0 Hz, J = 4.0 Hz, 1H), 7.45 (t, J = 8.0 Hz, 1H), 6.37 (s, 1H), 5.73 (s, 1H), 5.21 (d, J = 4.0 Hz, 2H). LCMS (ES) C.sub.16H.sub.13N.sub.5F.sub.3O [M + H].sup.+ 348.0. 147 N.sup.2-(azetidin-3-yl)-N.sup.4-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.76-8.75 (dd, J = 4.0 Hz, J = 1.6 Hz, 1H), 8.61-8.60 (d, J = 4.0 Hz, 1H), 7.97-7.93 (t, J = 8.0 Hz, 2H), 7.47-7.44 (dd, J = 8.0 Hz, J = 4.0 Hz, 1H), 7.04- 7.01 (dd, J = 8.0 Hz, J = 4.0 Hz, 1H), 6.40 (s, 0.4H), 5.53 (s, 0.8H), 5.03-5.01 (d, J = 8.0 Hz, 2H), 3.97 (s, 1H), 3.55-3.52 (t, J = 8.0 Hz, 2H), 1.78 (s, 2H). LCMS (ES) C.sub.17H.sub.17N.sub.7F.sub.3 [M + H].sup.+ 376.2. 148 N.sup.2-(1-methylazetidin-3-yl)-N.sup.4-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine 00embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.55-8.54 (d, J = 4.0 Hz, 1H), 8.47-8.43 (m, 2H), 8.34-8.32 (d, J = 8.0 Hz, 1H), 7.64- 7.62 (dd, J = 8.0 Hz, J = 4.0 Hz, 1H), 7.22-7.19 (dd, J = 8.0 Hz, J = 4.0 Hz, 1H), 4.83 (s, 2H), 4.27-4.23 (dd, J = 12.0 Hz, J = 4.0 Hz, 1H), 3.78-3.73 (dd, J = 12.0 Hz, J = 8.0 Hz, 1H), 3.52- 3.49 (dd, J = 8.0 Hz, J = 4.0 Hz, 1H), 3.34 (s, 1H), 3.19-3.15 (dd, J = 12.0 Hz, J = 4.0 Hz, 1H), 3.09 (s, 3H). LCMS (ES) C.sub.18H.sub.19N.sub.7F.sub.3 [M + H].sup.+ 390.0. 149 N.sup.2-methyl-N.sup.4-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine 01embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.78-8.77 (d, J = 4.0 Hz, 1H), 8.69-8.67 (d, J = 8.0 Hz, 1H), 8.62-8.61 (d, J = 4.0 Hz, 1H), 8.09-8.08 (d, J = 4.0 Hz, 1H), 7.67-7.63 (dd, J = 8.0 Hz, J = 4.0 Hz, 1H), 7.52-7.49 (dd, J = 8.0 Hz, J = 4.0 Hz, 1H), 5.14 (s, 2H), 2.90 (s, 2H). LCMS (ES) C.sub.15H.sub.14N.sub.6F.sub.3 [M + H].sup.+ 335.0. 150 N.sup.2-isopropyl-N.sup.4-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine 02embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.92 (s, 0.4H), 8.65- 8.61 (m, 2.6H), 8.42 (s, 1H), 7.94 (s, 1H), 7.66 (s, 1H), 7.07- 7.05 (dd, J = 8.0 Hz, J = 4.0 Hz, 1H), 6.85-6.64 (d, 1H), 4.90 (s, 2H), 4.15 (s, 0.5H), 3.76 (s, 0.4H), 1.13-0.83 (d, 6H). LCMS (ES) C.sub.17H.sub.18N.sub.6F.sub.3 [M + H].sup.+ 363.0. 150_S N.sup.2-isopropyl-N.sup.4-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine methanesulfonate 03embedded image Synthesised via Route .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 10.37 (s, 0.87H), 8.76- 8.80 (m, 2H), 8.64-8.67 (m, 1H), 8.00-8.08 (m, 2H), 7.66-7.69 (m, 1H), 7.53-7.56 (dd, J = 8.0 Hz, J = 4.0 Hz, 1H), 4.98-4.99 (d, J = 4.0 Hz, 2H), 3.87-3.95 (m, 1H), 2.36-2.38 (d, J = 8.0 Hz, 3H), 1.19-1.20 (d, J = 4.0 Hz, 1H), 0.96-0.97 (d, J = 4.0 Hz, 1H). LCMS (ES) C.sub.17H.sub.18N.sub.6F.sub.3 [M + H].sup.+ 363.2. 151 N.sup.2-isopropyl-N.sup.4-((2-(trifluoromethyl)pyridin-3- yl)methyl)quinazoline-2,4-diamine 04embedded image Synthesised via Route 4 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 12.06-12.48 (m, 1H), 9.89-10.32 (m, 1H), 8.65 (d, J = 4.14 Hz, 1H), 8.34 (brs, 1H), 8.00 (d, J = 7.78 Hz, 1H), 7.62-7.90 (m, 3H), 7.41 (brs, 1H), 4.98 (d, J = 3.64 Hz, 2H), 3.90 (brs, 1H), 0.96 (brs, 6H). LCMS (ES) C.sub.18H.sub.19N.sub.5F.sub.3 [M + H].sup.+ 362.2. 152 N.sup.2-isopropyl-N.sup.4-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[3,2-d]pyrimidine-2,4-diamine 05embedded image Synthesised via Route 7 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.49-9.02 (m, 2H), 8.37 (d, J = 3.51 Hz, 1H), 7.90 (d, J = 8.03 Hz, 1H), 7.51-7.74 (m, 3H), 6.55 (brs, 1H), 4.90 (d, J = 4.02 Hz, 2H), 3.59-4.24 (m, 1H), 0.62-1.27 (m, 6H). LCMS (ES) C.sub.17H.sub.18N.sub.6F.sub.3 [M + H].sup.+ 363.2. 153 N.sup.2-isopropyl-N.sup.4-((2-(trifluoromethyl)pyridin-3- yl)methyl)thieno[3,2-d]pyrimidine-2,4-diamine 06embedded image Synthesised via Route 1 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.60 (d, J = 4.27 Hz, 1H), 8.05(brs, 1H), 7.87-7.95 (m, 2H), 7.67 (dd, J = 8.03, 4.64 Hz, 1H), 7.03 (d, J = 5.14 Hz, 1H), 6.11 (d, J = 7.78 Hz, 1H), 4.85 (d, J = 5.14 Hz, 2H), 3.73-4.01 (m, 1H), 0.74-1.16 (m, 6H). LCMS (ES) C.sub.16H.sub.17N.sub.5F.sub.3S [M + H].sup.+ 368.2. 154 2-((methylamino)methyl)-N-(2- (trifluoromethyl)benzyl)thieno[3,2-d]pyrimidin-4-amine 07embedded image Synthesised via Route 2 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.55 (s, 1H), 8.12-8.13 (d, J = 4.0 Hz, 1H), 7.73-7.75 (d, J = 8.0 Hz, 1H), 7.57-7.61 (t, J = 8.0 Hz, 1H), 7.51-7.53 (d, J = 8.0 Hz, 1H), 7.43-7.47 (t, J = 8.0 Hz, 1H), 7.36-7.37 (d, J = 4.0 Hz, 1H), 4.90-4.91 (d, J = 4.0 Hz, 2H), 3.55 (s, 2H), 3.16 (s, 1H), 2.13 (s, 3H). LCMS (ES) C.sub.16H.sub.16N.sub.4F.sub.3S [M + H].sup.+ 353.2. 155 4-((2-(trifluoromethyl)benzyl)amino)thieno[3,2- d]pyrimidine-2-carboxamide 08embedded image Synthesised via Route 2 .sup.1H NMR (400 MHz, MeOD) δ (ppm) 8.08-8.10 (d, J = 8.0 Hz, 1H), 7.72-7.74 (d, J = 8.0 Hz, 1H), 7.51-7.60 (m, 3H), 7.41-7.45 (d, J = 8.0 Hz, 1H), 5.08 (s, 2H). LCMS (ES) C.sub.15H.sub.12N.sub.4F.sub.3OS [M + H].sup.+ 353.0. 156 N.sup.2-cyclopropyl-N.sup.4-(2-(trifluoromethyl)benzyl)pyrido[2,3- d]pyrimidine-2,4-diamine 09embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.05-8.53 (m, 2H), 8.47 (d, J = 7.5 Hz, 1H), 7.75 (d, J = 7.8 Hz, 1H), 7.62 (t, J = 7.6 Hz, 1H), 7.56-7.40 (m, 2H), 7.21-6.92 (m, 2H), 4.93 (b, 2H), 2.92-2.63 (m, 1H), 0.86-0.04 (m, 4H). LCMS (ES) C.sub.18H.sub.17N.sub.5F.sub.3 [M + H].sup.+ 360.2. 156_B2_S N.sup.2-cyclopropyl-N.sup.4-(2-(trifluoromethyl)benzyl)pyrido[2,3- d]pyrimidine-2,4-diamine methanesulfonate 0embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 10.35-9.61 (m, 1H), 9.20-8.16 (m, 3H), 7.80 (d, J = 7.7 Hz, 1H), 7.71-7.46 (m, 4H), 5.02 (d, J = 26.4 Hz, 2H), 2.94-2.59 (m, 1H), 2.33 (s, 3H), 0.98-0.37 (m, 4H). LCMS (ES) C.sub.18H.sub.17N.sub.5F.sub.3 [M + H].sup.+ 360.2. 157 4-((2-(trifluoromethyl)benzyl)amino)pyrido[2,3-d]pyrimidin- 2-ol embedded image Synthesised via Route 8 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 11.22 (s, 1H), 9.03 (t, J = 5.5 Hz, 1H), 8.64-8.48 (m, 2H), 7.82-7.74 (m, 1H), 7.68- 7.60 (m, 1H), 7.54-7.47 (m, 2H), 7.25 (dd, J = 4.7, 8.0 Hz, 1H), 4.89 (d, J = 5.1 Hz, 2H). LCMS (ES) C.sub.15H.sub.12N.sub.4F.sub.3O [M + H].sup.+ 321.2. 158 N.sup.2-(oxetan-3-yl)-N.sup.4-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.0 (s, 0.37H), 8.62- 8.68 (m, 2.48H), 8.46-8.48 (d, J = 8.0 Hz, 1H), 7.94 (s, 1H), 7.80 (s, 0.36H), 7.66 (s, 1H), 7.60 (s, 0.4H), 7.11-7.14 (dd, J = 8.0 Hz, J = 4.0 Hz, 1H), 4.20-5.08 (m, 7H). LCMS (ES) C.sub.17H.sub.16N.sub.6F.sub.3O [M + H].sup.+ 377.2. 159 N.sup.2-cyclopropyl-N.sup.4-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.79-8.11 (m, 4H), 7.72 (d, J = 7.8 Hz, 1H), 7.42 (dd, J = 7.8, 4.7 Hz, 1H), 7.09- 6.65 (m, 2H), 4.67 (b, 2H), 2.70-2.34 (m, 1H), 0.54--0.39 (m, 4H). LCMS (ES) C.sub.17H.sub.16N.sub.6F.sub.3 [M + H].sup.+ 361.2. 159_S N.sup.2-cyclopropyl-N.sup.4-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine methanesulfonate embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 10.46-9.78 (m, 1H), 9.28-8.41 (m, 4H), 8.08 (d, J = 7.8 Hz, 1H), 7.72 (t, J = 9.1 Hz, 1H), 7.64-7.49 (m, 1H), 5.03 (d, J = 26.1 Hz, 2H), 2.97-2.59 (m, 1H), 2.37 (s, 3H), 1.00-0.27 (m, 4H). LCMS (ES) C.sub.17H.sub.16N.sub.6F.sub.3 [M + H].sup.+ 361.2. 160 N.sup.2-isopropyl-N.sup.4-methyl-N4-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.62-8.63 (dd, J = 4.0 Hz, 2.H), 7.65-8.39 (m, 3H), 6.97-7.00 (dd, J = 4.0 Hz, J = 8.0 Hz, 1H), 6.75-6.85 (m, 1H), 5.08 (s, 2H), 4.15 (s, 0.45), 3.49-3.67 (m, 2H), 3.27 (s, 1H), 0.81-1.15 (d, 6H) LCMS (ES) C.sub.18H.sub.20N.sub.6F.sub.3 [M + H].sup.+ 377.1. 161 N.sup.2-isopropyl-N.sup.2,N.sup.4-dimethyl-N.sup.4-((2-(trifluoromethyl)pyridin- 3-yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.61-8.64 (dd, J = 4.0 Hz, J = 8.0 Hz, 2H), 8.37-8.39 (d, J = 8.0 Hz, 1H), 7.82 (bs, 1H), 7.61-7.64 (m, 1H), 7.00-7.03 (dd, J = 4.0 Hz, J = 8.0 Hz, 1H), 5.06 (s, 2H), 3.54 (s, 3H), 3.33 (s, 1H), 2.78 (s, 3H), 0.84- 1.06 (m, 6H). LCMS (ES) C.sub.19H.sub.22N.sub.6F.sub.3 [M + H].sup.+ 391.0. 162 N.sup.2-isopropyl-N.sup.2-methyl-N.sup.4-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, MeOD) δ (ppm) 8.65 (dd, J = 4.7, 1.9 Hz, 1H), 8.56 (d, J = 4.4 Hz, 1H), 8.42 (dd, J = 8.0, 1.9 Hz, 1H), 7.99 (d, J = 8.0 Hz, 1H), 7.58 (dd, J = 8.0, 4.7 Hz, 1H), 7.15 (dd, J = 7.9, 4.7 Hz, 1H), 4.99 (b, 2H), 4.73-4.43 (m, 1H), 2.93 (s, 3H), 1.01 (b, 6H). LCMS (ES) C.sub.18H.sub.20N.sub.6F.sub.3 [M + H].sup.+ 377.2. 162_S N.sup.2-isopropyl-N.sup.2-methyl-N.sup.4-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine methanesulfonate embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.80 (s, 1H), 8.89 (dd, J = 8.0, 1.7 Hz, 1H), 8.75 (dd, J = 5.2, 1.6 Hz, 1H), 8.65 (d, J = 4.5 Hz, 1H), 8.05 (d, J = 8.0 Hz, 1H), 7.66 (dd, J = 8.0, 4.6 Hz, 1H), 7.49 (dd, J = 7.9, 5.3 Hz, 1H), 4.99 (d, J = 4.9 Hz, 2H), 4.89-4.75 (m, 1H), 3.00 (s, 3H), 2.34 (s, 3H), 1.06 (d, J = 6.5 Hz, 6H). LCMS (ES) C.sub.18H.sub.20N.sub.6F.sub.3 [M + H].sup.+ 377.1. 163 2-(azetidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.91 (t, J = 5.33 Hz, 1 H), 8.68 (dd, J = 4.33, 1.69 Hz, 1 H), 8.61 (d, J = 4.39 Hz, 1 H), 8.48 (dd, J = 8.03, 1.76 Hz, 1 H), 7.99 (d, J = 7.91 Hz, 1 H), 7.65 (dd, J = 7.97, 4.58 Hz, 1 H), 7.12 (dd, J = 7.91, 4.39 Hz, 1 H), 4.86 (d, J = 4.77 Hz, 2 H), 3.87 (br. s., 4 H), 2.18 (m, 2 H). LCMS (ES) C.sub.17H.sub.16N.sub.6F.sub.3 [M + H].sup.+ 361.1. 164 2-(isopropylthio)-N-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 0embedded image Synthesised via Route 8 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.28 (t, J = 5.27 Hz, 1 H), 8.91 (dd, J = 4.39, 1.76 Hz, 1 H), 8.59-8.72 (m, 2 H), 7.98 (d, J = 7.91 Hz, 1 H), 7.66 (dd, J = 8.03, 4.64 Hz, 1 H), 7.48 (dd, J = 8.16, 4.39 Hz, 1 H), 4.93 (dd, J = 5.2 Hz, 2 H), 3.73 (m, 1 H), 1.18 (d, J = 6.78 Hz, 6 H). LCMS (ES) C.sub.17H.sub.17N.sub.5F.sub.3S [M + H].sup.+ 379.9. 165 N.sup.2-isopropyl-N.sup.4-((2-(trifluoromethyl)pyridin-3-yl)methyl)-1,8- naphthyridine-2,4-diamine embedded image Synthesised via Route 9 .sup.1H NMR (400 MHz, MeOD) δ (ppm) 8.70 (d, J = 3.3 Hz, 1H), 8.64 (d, J = 4.4 Hz, 1H), 8.57 (dd, J = 8.2, 1.6 Hz, 1H), 8.01 (d, J = 7.8 Hz, 1H), 7.65 (dd, J = 7.9, 4.8 Hz, 1H), 7.42 (dd, J = 8.1, 4.7 Hz, 1H), 5.59 (s, 1H), 4.60 (s, 2H), 3.98-4.19 (m, 1H), 1.22 (d, J = 6.0 Hz, 6H). LCMS (ES) C.sub.18H.sub.19N.sub.5F.sub.3 [M + H].sup.+ 362.0. 166 N.sup.4-(2-fluoro-6-(trifluoromethyl)benzyl)-N.sup.2- isopropylpyrido[2,3-d]pyrimidine-2,4-diamine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.66 (m., 1H), 8.47 (m, 2H), 7.57-7.68 (m, 2H), 7.50 (t, J = 9.03 Hz, 1H), 7.25 (br. s., 1H), 4.98-5.10 (m, 2H), 4.30-4.67 (m, 1H), 1.29 (d, J = 6.53 Hz, 6H). LCMS (ES) C.sub.18H.sub.18N.sub.5F.sub.4 [M + H].sup.+ 380.2. 167 4-(6-chloro-5-methyl-7-((pyridin-2- ylmethyl)amino)pyrazolo[1,5-a]pyrimidin-3-yl)morpholin-3- one embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.57 (dd, J = 4.39, 1.76 Hz, 1H), 8.24-8.36 (m, 1H), 7.79-8.19 (m, 1H), 6.98 (br. s., 1H), 6.56 (br. s., 1H), 4.16 (dd, J = 13.68, 6.78 Hz, 1H), 3.43- 3.57 (m, 2H), 3.27 (br. s., 1H), 3.11 (t, J = 7.40 Hz, 1H), 2.86 (dt, J = 12.05, 7.91 Hz, 1H), 2.61-2.68 (m, 1H), 2.33-2.39 (m, 1H), 1.93-2.06 (m, 1H), 1.67-1.85 (m, 5H), 1.15 (d, J = 6.53 Hz, 6H). LCMS (ES) C.sub.18H.sub.26N.sub.6F.sub.3 [M + H].sup.+ 383.2. 168 N.sup.2-(tert-butyl)-N.sup.4-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.61-8.68 (m, 2 H), 8.45 (d, J = 7.78 Hz, 1 H), 7.91 (br. s., 1 H), 7.66 (dd, J = 7.53, 4.89 Hz, 1 H), 7.08 (dd, J = 7.91, 4.39 Hz, 1 H), 4.93 (s., 2 H), 1.17 (br. s., 9 H). LCMS (ES) C.sub.18H.sub.20N.sub.6F.sub.3 [M + H].sup.+ 377.0. 169 N.sup.4-(2-fluoro-6-(trifluoromethyl)benzyl)-N.sup.2,N.sup.2- dimethylpyrido[2,3-d]pyrimidine-2,4-diamine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.64 (d, J = 3.26 Hz, 1H), 8.48 (dd, J = 7.97, 1.57 Hz, 1H), 8.44 (m., 1H), 7.57-7.68 (m, 2H), 7.45-7.54 (m, 1H), 7.17 (dd, J = 8.03, 4.77 Hz, 1H), 5.01 (s, 2H), 3.30 (s, 6H). LCMS (ES) C.sub.17H.sub.16N.sub.5F.sub.3 [M + H].sup.+ 366.1. 170 N-((2-(trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3- d]pyrimidin-4-amine embedded image Synthesised via Route 8 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.18 (t, J = 5.5 Hz, 1H), 9.06 (dd, J = 1.8, 4.4 Hz, 1H), 8.79 (dd, J = 1.8, 8.3 Hz, 1H), 8.64 (d, J = 4.5 Hz, 1H), 8.60 (s, 1H), 7.99 (d, J = 8.0 Hz, 1H), 7.71- 7.57 (m, 2H), 4.99 (d, J = 5.0 Hz, 2H). LCMS (ES) C.sub.14H.sub.11N.sub.5F.sub.3 [M + H].sup.+ 306.1. 171 3-methyl-1-(4-(((2-(trifluoromethyl)pyridin-3- yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)azetidin-3-ol embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, MeOD) δ (ppm) 8.68 (dd, J = 4.64, 1.88 Hz, 1H), 8.57 (d, J = 4.52 Hz, 1H), 8.41 (dd, J = 7.97, 1.82 Hz, 1H), 8.02 (d, J = 8.03 Hz, 1H), 7.60 (dd, J = 7.97, 4.71 Hz, 1H), 7.17 (dd, J = 8.03, 4.64 Hz, 1H), 4.98 (s, 2H), 3.89 (br. s., 4H), 1.47 (s, 3H). LCMS (ES) C.sub.18H.sub.18N.sub.6F.sub.3O [M + H].sup.+ 391.1. 172 2-(2-methylazetidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.90 (br. s., 1H), 8.68 (br. s., 1H), 8.61 (br. s., 1H), 8.49 (d, J = 7.28 Hz, 1H), 7.93 (br. S., 1H), 7.65 (br. s., 1H), 7.13 (br. s., 1H), 4.87 (br. s., 2H), 3.82~4.18 (m, 3H), 2.30 (br. s., 1H), 1.80 (br. s., 1H), 1.15 (m, 3H). LCMS (ES) C.sub.18H.sub.18N.sub.6F.sub.3 [M + H].sup.+ 375.1. 173 2-(2,2-dimethylazetidin-1-yl)-N-((2-(trifluoromethyl)pyridin- 3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.55-8.78 (m, 3H), 8.47 (d, J = 8.03 Hz, 1H), 7.91 (br. s., 1 H), 7.62 (dd, J = 7.97, 4.58 Hz, 1H), 7.08 (dd, J = 7.78, 4.52 Hz, 1H), 4.92 (br. s., 2H), 3.83 (br. s., 2H), 1.98-2.02 (t, J = 7.60 Hz, 2H), 1.27 (br. s., 6H). LCMS (ES) C.sub.19H.sub.20N.sub.6F.sub.3 [M + H].sup.+ 389.1. 174 2-(pyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidin-4-amine 0embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.85 (br. s., 1H), 8.54- 8.74 (m, 2H), 8.47 (br. s., 1H), 7.98 (br. s., 1H), 7.64 (br. s., 1H), 7.07 (br. s., 1H), 4.89 (br. s., 2H), 3.46 (s, 2H), 3.22 (s, 2H), 1.82 (br. s., 4H.). LCMS (ES) C.sub.18H.sub.18N.sub.6F.sub.3 [M + H].sup.+ 375.1. 175 N.sup.2-cyclopropyl-N.sup.2-methyl-N.sup.4-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.86 (br. s., 1H), 8.71 (br. s., 1H), 8.62 (br. s., 1H), 8.50 (d, J = 7.15 Hz, 1H), 7.93 (d, J = 7.28 Hz, 1H), 7.65 (br. s., 1H), 7.15 (br. s., 1H), 4.95 (br. s., 2H), 2.96 (br. s., 3H), 2.64 (br. s., 1H), 0.34-0.62 (m, 4H). LCMS (ES) C.sub.18H.sub.18N.sub.6F.sub.3 [M + H].sup.+ 375.1. 176 N.sup.2-isopropyl-N.sup.2-methyl-N.sup.4-((2-(trifluoromethyl)pyridin-3- yl)methyl)quinazoline-2,4-diamine embedded image Synthesised via Route 4 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.67 (t, J = 5.0 Hz, 1H), 8.58 (d, J = 4.3 Hz, 1H), 8.07 (d, J = 8.0 Hz, 1H), 7.91 (d, J = 8.0 Hz, 1H), 7.62 (dd, J = 8.0, 4.7 Hz, 1H), 7.52 (ddd, J = 8.3, 7.0, 1.4 Hz, 1H), 7.28 (d, J = 8.4 Hz, 1H), 7.06-7.13 (m, 1H), 4.86 (d, J = 4.4 Hz, 2H), 3.30-3.34 (m, 1H), 2.77 (br. s., 3H), 0.88 (br. s., 6 H). LCMS (ES) C.sub.19H.sub.21N.sub.5F.sub.3 [M + H].sup.+ 376.2. 177 2-methyl-N-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 8 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.08-9.11 (t, J = 8.0 Hz, 1H), 8.96-8.97 (dd, J = 4.0 Hz, 1H), 8.71-8.74 (dd, J = 4.0 Hz, J = 8.0 Hz, 1H), 8.62-8.63 (d, J = 8.0 Hz, 1H), 8.01-8.02 (d, J = 4.0 Hz, 1H), 7.65-7.68 (dd, J = 4.0 Hz, J = 8.0 Hz, 1H), 7.50- 7.53 (dd, J = 4.0 Hz, J = 8.0 Hz, 1H), 4.95-4.96 (d, J = 4.0 Hz, 2H), 2.40 (s, 3H). LCMS (ES) C.sub.15H.sub.13N.sub.5F.sub.3 [M + H].sup.+ 320.1. 178 2-(isopropylsulfinyl)-N-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 8 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.71 (br. s., 1H), 9.10 (d, J = 2.89 Hz, 1H), 8.85 (d, J = 8.16 Hz, 1H), 8.64 (d, J = 4.39 Hz, 1H), 8.06 (d, J = 7.91 Hz, 1H), 7.54-7.84 (m, 2H), 4.86-5.06 (m, 2H), 2.87-2.95 (m, 1H), 1.16 (d, J = 7.03 Hz, 3H), 0.81 (d, J = 6.78 Hz, 3H). LCMS (ES) C.sub.17H.sub.17N.sub.5F.sub.3OS [M + H].sup.+ 396.1. 179 2-(isopropylsulfonyl)-N-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 8 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.92 (t, J = 5.40 Hz, 1H), 9.17 (dd, J = 4.39, 1.76 Hz, 1H), 8.90 (dd, J = 8.34, 1.82 Hz, 1H), 8.65 (d, J = 4.39 Hz, 1H), 8.09 (d, J = 7.91 Hz, 1H), 7.79 (dd, J = 8.28, 4.39 Hz, 1H), 7.65 (dd, J = 7.97, 4.71 Hz, 1H), 4.99 (d, J = 4.89 Hz, 2H), 3.63-3.72 (m, 1H), 1.08 (d, J = 6.90 Hz, 6H). LCMS (ES) C.sub.17H.sub.17N.sub.5F.sub.3O.sub.2S [M + H].sup.+ 412.1. 182 4-(((2-(trifluoromethyl)pyridin-3-yl)methyl)amino)pyrido[2,3- d]pyrimldin-2-ol embedded image Synthesised via Route 8 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 11.23 (s, 1H), 9.02- 9.05 (t, J = 8.0 Hz, 1H), 8.64-8.65 (d, J = 4.0 Hz, 1H), 8.57-8.59 (dd, J = 4.0 Hz, 1H), 8.49-8.51 (dd, J = 8.0 Hz, 1H), 7.96-7.98 (d, J = 8.0 Hz, 1H), 7.67-7.70 (dd, J = 8.0 Hz, J = 4.0 Hz, 1H), 7.23- 7.26 (dd, J = 8.0 Hz, J = 4.0 Hz, 1H), 4.88-4.89 (d, J = 4.0 Hz, 2H). LCMS (ES) C.sub.14H.sub.11N.sub.5F.sub.3O [M + H].sup.+ 321.9. 183 N-isopropyl-4-(2-(2-(trifluoromethyl)phenyl)azetidin-1- yl)pyrido[2,3-d]pyrimidin-2-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, MeOD) δ (ppm) 8.62 (d, J = 3.0 Hz, 1H), 8.25 (br. s., 1H), 7.81 (d, J = 7.7 Hz, 1H), 7.75 (d, J = 7.8 Hz, 1H), 7.63 (t, J = 7.6 Hz, 1H), 7.43-7.50 (m, 1H), 7.06 (br. s., 1H), 6.11 (t, J = 7.4 Hz, 1H), 4.68 (br. s., 2H), 3.73 (br. s., 1H), 2.91- 3.06 (m, 1H), 2.33 (br. s., 1H), 0.57-1.20 (m, 6H) LCMS (ES) C.sub.20H.sub.21N.sub.5F.sub.3 [M + H].sup.+ 388.1. 184 N-isopropyl-N-methyl-4-(2-(2- (trifluoromethyl)phenyl)azetidin-1-yl)pyrido[2,3-d]pyrimidin- 2-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, MeOD) δ (ppm) 8.62 (dd, J = 4.6, 1.8 Hz, 1H), 8.28 (d, J = 7.4 Hz, 1H), 7.84 (d, J = 7.8 Hz, 1H), 7.74 (d, J = 7.8 Hz, 1H), 7.62 (t, J = 7.6 Hz, 1H), 7.42-7.50 (m, 1H), 7.07 (dd, J = 8.0, 4.6 Hz, 1H), 6.06 (t, J = 7.7 Hz, 1H), 4.84 (br. s., 1H), 4.62-4.71 (m, 1H), 3.34 (br. s., 3H), 2.87-3.01 (m, 2H), 2.30- 2.46 (m, 1H), 1.05 (d, J = 6.8 Hz, 6H). LCMS (ES) C.sub.21H.sub.23N.sub.5F.sub.3 [M + H].sup.+ 402.2. 185 N-isopropyl-4-(2-(2-(trifluoromethyl)phenyl)piperidin-1- yl)pyrido[2,3-d]pyrimidin-2-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.72 (d, J = 2.51 Hz, 1H), 8.36 (d, J = 7.78 Hz, 1H), 7.64 (m, 2H), 7.37 (t, J = 7.59 Hz, 1H), 7.29 (d, J = 8.00 Hz, 1H), 7.17 (br. s., 1H), 4.81 (d, J = 8.53 Hz, 1H), 3.82 (d, J = 12.42 Hz, 2H), 2.97-3.07 (m, 1H), 2.00 (br. s., 2H), 1.91 (d, J = 11.80 Hz, 1H), 1.79 (d, J = 12.42 Hz, 1H), 1.52-1.71 (m, 2H), 1.11-1.24 (m, 1H), 1.03 (d, J = 6.53 Hz, 3H), 0.52 (br. s., 2H). LCMS (ES) C.sub.22H.sub.25N.sub.5F.sub.3 [M + H].sup.+ 416.3. 186 N-isopropyl-N-methyl-4-(2-(2- (trifluoromethyl)phenyl)piperidin-1-yl)pyrido[2,3- d]pyrimidin-2-amine 0embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.75 (br. s., 1H), 8.37 (br. s., 1H), 7.68 (br. s., 1H), 7.09-7.56 (m, 4H), 4.75 (br. s., 2H), 3.85 (br. s., 1H), 3.03 (br. s., 2H), 2.71-2.83 (m, 2H), 1.57-2.07 (m, 6H), 0.42-1.12 (m, 6H). LCMS (ES) C.sub.23H.sub.27N.sub.5F.sub.7 [M + H].sup.+ 430.2. 187 N-isopropyl-4-(3-(2- (trifluoromethyl)phenyl)morpholino)pyrido[2,3-d]pyrimidin- 2-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.72-8.74 (dd, J = 4.0 Hz, 1H), 8.38-8.39 (d, J = 4.0 Hz, 1H), 7.69-7.71 (d, J = 8.0 Hz, 2H), 7.44-7.48 (t, J = 8.0 Hz, 1H), 7.36-7.39 (t, J = 8.0 Hz, 1H), 7.14-7.17 (dd, J = 8.0 Hz, J = 4.0 Hz, 1H), 5.03 (s, 2H), 3.77-4.06 (m, 6H), 3.17-3.22 (t, J = 8.0 Hz, 1H), 1.04-1.23 (m, 4H), 0.51 (bs, 2H). LCMS (ES) C.sub.21H.sub.23N.sub.5F.sub.3O [M + H].sup.+ 418.2. 188 N-isopropyl-N-methyl-4-(3-(2- (trifluoromethyl)phenyl)morpholino)pyrido[2,3-d]pyrimidin- 2-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.74-8.75 (dd, J = 4.0 Hz, 1H), 8.40-8.42 (d, J = 8.0 Hz, 1H), 7.72-7.74 (d, J = 8.0 Hz, 1H), 7.59-7.61 (d, J = 8.0 Hz, 1H), 7.41-7.45 (t, J = 8.0 Hz, 1H), 7.35-7.39 (t, J = 8.0 Hz, 1H), 7.16-7.19 (dd, J = 4.0 Hz, J = 8.0 Hz, 1H), 4.94 (bs, 1H), 4.64 (bs, 1H), 4.07-4.12 (t, J = 8.0 Hz, 1H), 3.92-3.98 (t, J = 12.0 Hz, 2H), 3.81-3.85 (t, J = 16.0 Hz, 1H), 3.55-3.60 (t, J = 12.0 Hz, 1H), 3.17-3.23 (t, J = 12.0 Hz, 1H), 2.77 (bs, 2H), 2.33 (bs, 1H), 1.02 (bs, 4H), 0.5 (bs, 2H). LCMS (ES) C.sub.22H.sub.25N.sub.5F.sub.3O [M + H].sup.+ 432.2. 189 N-isopropyl-4-(2-(2-(trifluoromethyl)phenyl)pyrazolidin-1- yl)pyrido[2,3-d]pyrimidin-2-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.69-8.72 (dd, J = 4.0 Hz, J = 8.0 Hz, 1H), 8.50-8.51 (dd, J = 4.0 Hz, 1H), 7.78-7.80 (d, J = 8.0 Hz, 1H), 7.53-7.56 (t, J = 8.0 Hz, 1H), 7.27-7.31 (t, J = 8.0 Hz, 1H), 7.22-7.24 (d, J = 8.0 Hz, 1H), 6.89 (bs, 1H), 6.74-6.76 (dd, J = 4.0 Hz, J = 8.0 Hz, 1H), 4.14-4.23 (m, 3H), 3.58 (m, 2 H), 2.07 (bs, 2H), 1.18-1.20 (d,J = 8.0 Hz, 6H). LCMS (ES) C.sub.20H.sub.22N.sub.6F.sub.3 [M + H].sup.+ 403.0. 190 N-isopropyl-N-methyl-4-(2-(2- (trifluoromethyl)phenyl)pyrazolidin-1-yl)pyrido[2,3- d]pyrimidin-2-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.69-8.72 (dd, J = 4.0 Hz, J = 8.0 Hz, 1H), 8.51-8.53 (dd, J = 4.0 Hz, 1H), 7.78-7.80 (d, J = 8.0 Hz, 1H), 7.52-7.55 (t, J = 8.0 Hz, 1H), 7.27-7.31 (t, J = 8.0 Hz, 1H), 7.21-7.23 (d, J = 8.0 Hz, 1H), 6.76-6.79 (dd, J = 4.0 Hz, J = 8.0 Hz, 1H), 5.13-5.16 (m, 1H), 4.16 (bs, 2H), 3.58- 3.61 (t, J = 8.0 Hz, 2 H), 3.02 (s, 3H), 2.07 (bs, 2H), 1.16-1.18 (d, J = 8.0 Hz, 6H). LCMS (ES) C.sub.21H.sub.24N.sub.6F.sub.3 [M + H].sup.+ 417.0. 191 2-((difluoromethyl)thio)-N-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.56 (br. s., 1H), 8.96- 9.02 (m, 1H), 8.76 (dd, J = 8.16, 1.76 Hz, 1H), 8.65 (d, J = 4.27 Hz, 1H), 8.02 (d, J = 7.91 Hz, 1H), 7.71-8.00 (m, 1H), 7.67 (dd, J = 7.91, 4.64 Hz, 1H), 7.59 (dd, J = 8.16, 4.39 Hz, 1H), 4.95 (br. s., 2H). LCMS (ES) C.sub.15H.sub.11N.sub.5F.sub.5S [M + H].sup.+ 388.1. 192 2-morpholino-N-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.97 (t,J = 5.46 Hz, 1H), 8.71 (dd, J = 4.39, 1.76 Hz, 1H), 8.62 (d, J = 4.14 Hz, 1H), 8.50 (dd, J = 8.03, 1.88 Hz, 1H), 7.98 (d, J = 8.03 Hz, 1H), 7.66 (dd, J = 7.91, 4.64 Hz, 1H), 7.15 (dd, J = 8.03, 4.52 Hz, 1H), 4.89 (d, J = 4.89 Hz, 2H), 3.44-3.69 (m, 8H). LCMS (ES) C.sub.18H.sub.18N.sub.6F.sub.3O [M + H].sup.+ 391.2. 193 2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl3) δ (ppm) 8.80 (m, 1H), 8.64 (m, 1H), 7.94 (m, 2H), 7.52-7.38 (m, 1H), 7.05 (dd, J = 7.7, 4.3 Hz, 1H), 6.28 (m, 1H), 5.05 (dd, J = 44.6, 14.7 Hz, 2H), 4.86- 4.67 (m, 1H), 4.51 (d, J = 6.3 Hz, 1H), 3.94 (d, J = 8.4 Hz, 1H), 3.68 (dd, J = 33.8, 11.9 Hz, 2H), 3.48 (t, J = 9.7 Hz, 1H), 3.26 (t, J = 12.0 Hz, 1H), 1.16 (b, 3H). LCMS (ES) C.sub.19H.sub.20N.sub.6F.sub.3O [M + H].sup.+ 405.3. 193_S 2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidin-4-amine methanesulfonate embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, MeOD) δ (ppm) 8.87-8.85 (m, 1H), 8.67- 8.65 (m, 1H), 8.65-8.59 (m, 1H), 8.06-8.04 (m, 1H), 7.64- 7.63 (m, 1H), 7.48-7.45 (m, 1H), 5.05-4.89 (m, 2H), 4.61 (b, 1H), 4.32 (d, 1H), 3.91 (d, 1H), 3.70 (d, 1H), 3.59 (dd, 1H), 3.45 (t, 1H), 3.32-3.30 (m, 1H), 2.70 (s, 3H), 1.14 (b, 3H). LCMS (ES) C.sub.19H.sub.20N.sub.6F.sub.3O [M + H].sup.+ 405.3. 194 2-(3,3-difluoropyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin- 3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, MeOD) δ (ppm) 8.72 (dd, J = 4.6, 1.9 Hz, 1H), 8.58 (d, J = 4.3 Hz, 1H), 8.46 (dd, J = 8.0, 1.9 Hz, 1H), 8.02 (d, J = 8.0 Hz, 1H), 7.60 (dd, J = 8.0, 4.7 Hz, 1H), 7.21 (dd, J = 8.0, 4.6 Hz, 1H), 5.02 (s, 2H), 4.08-3.49 (m, 4H), 2.52- 2.31 (m, 2H). LCMS (ES) C.sub.18H.sub.16N.sub.6F.sub.5 [M + H].sup.+ 411.2. 194_S 2-(3,3-difluoropyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin- 3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine methanesulfonate 0embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, MeOD) δ (ppm) 8.87-8.68 (m, 2H), 8.63 (d, J = 4.5 Hz, 1H). 8.08 (d, J = 7.8 Hz, 1H), 7.65 (dd, J = 7.7, 4.6 Hz, 1H), 7.57-7.45 (m, 1H), 5.11 (b, 2H), 4.16-3.68 (m, 4H), 2.72 (s, 3H), 2.63-2.38 (m, 2H). LCMS (ES) C.sub.18H.sub.16N.sub.6F.sub.5 [M + H].sup.+ 411.1. 195 2-(4-fluoropiperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.97 (t, J = 5.27 Hz, 1H), 8.70 (dd, J = 4.39, 1.88 Hz, 1H), 8.61 (d, J = 3.89 Hz, 1H), 8.49 (dd, J = 7.97, 1.82 Hz, 1H), 7.97 (d, J = 7.91 Hz, 1H), 7.65 (dd, J = 7.97, 4.58 Hz, 1H), 7.14 (dd, J = 7.97, 4.45 Hz, 1H), 4.74- 4.94 (m, 3H), 3.83 (br. s., 2H), 3.56 (br. s., 2H), 1.71 (br. s., 2H), 1.46 (br. s., 2H). LCMS (ES) C.sub.19H.sub.19N.sub.6F.sub.4 [M + H].sup.+ 407.3. 196 2-(4,4-difluoropiperidin-1-yl)-N-(2- (trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.01 (t, J = 5.52 Hz, 1H), 8.72 (dd, J = 4.39, 1.76 Hz, 1H), 8.54 (dd, J = 8.03, 1.63 Hz, 1 H), 7.76 (d, J = 7.78 Hz, 1H), 7.58-7.63 (m, 1H), 7.51-7.56 (m, 1H), 7.43-7.50 (m, 1H), 7.18 (dd, J = 7.97, 4.45 Hz, 1H), 4.88 (d, J = 4.89 Hz, 2H), 3.79 (br. s., 4H), 1.78 (br. s., 4H). LCMS (ES) C.sub.20H.sub.29N.sub.5F.sub.5 [M + H].sup.+ 424.3. 197 2-(4,4-difluoropiperidin-1-yl)-N-((2-(trifluoromethyl)pyridin- 3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.03 (t, J = 5.2 Hz, 1H), 8.78-8.69 (m, 1H), 8.62 (d, J = 4.3 Hz, 1H), 8.57-8.47 (m, 1H), 7.98 (d, J = 8.0 Hz, 1H), 7.65 (dd, J = 7.9, 4.6 Hz, 1H), 7.18 (dd, J = 7.9, 4.4 Hz, 1H), 4.88 (d, J = 4.4 Hz, 2H), 3.91- 3.64 (m, 4H), 1.99-1.61 (m, 4H). LCMS (ES) C.sub.19H.sub.18N.sub.6F.sub.5 [M + H].sup.+ 425.1. 197_S N.sup.2-isopropyl-N.sup.4-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidine-2,4-diamine methanesulfonate embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, MeOD) δ (ppm) 8.88 (d, J = 6.6 Hz, 1H), 8.68 (d, J = 4.2 Hz, 1H), 8.63 (d, J = 4.1 Hz, 1H), 8.07 (d, J = 7.7 Hz, 1H), 7.65 (dd, J = 7.9, 4.7 Hz, 1H), 7.49 (dd, J = 7.9, 5.7 Hz, 1H), 5.07 (s, 2H), 4.16-3.78 (m, 4H), 2.72 (s, 3H), 2.21-1.77 (m, 4H). LCMS (ES) C.sub.19H.sub.18N.sub.6F.sub.5 [M + H].sup.+ 425.0. 198 2-(4-chloropiperidin-1-yl)-N-(2- (trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.96 (br. s., 1H), 8.69 (dd, J = 4.39, 1.76 Hz, 1H), 8.52 (dd, J = 8.03, 1.76 Hz, 1H), 7.75 (d, J = 7.53 Hz, 1H), 7.56-7.64 (m, 1H), 7.50-7.56 (m, 1H), 7.43- 7.50 (m, 1H), 7.14 (dd, J = 7.97, 4.45 Hz, 1H), 4.86 (br. s., 2H), 4.32-4.44 (m, 1H), 4.07 (br. s., 2H), 3.40 (m, 2H), 1.91 (br. s., 2H), 1.51 (br. s., 2H). LCMS (ES) C.sub.20H.sub.20N.sub.5F.sub.3Cl [M + H].sup.+ 422.1. 199 2-(4-chloropiperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.99 (t, J = 5.27 Hz, 1H), 8.70 (br. s., 1H), 8.61 (d, J = 4.39 Hz, 1H), 8.50 (d, J = 7.78 Hz, 1H), 7.97 (d, J = 8.03 Hz, 1H), 7.65 (dd, J = 7.97, 4.58 Hz, 1H), 7.15 (dd, J = 7.65, 4.39 Hz, 1H), 4.86 (d, J = 4.39 Hz, 2H), 4.38 (m, 1H), 4.04 (br. s., 2H), 3.03-3.25 (m, 2H), 1.89 (br. s., 2H), 1.49 (br. s., 2H). LCMS (ES) C.sub.19H.sub.19N.sub.6F.sub.3Cl [M + H].sup.+ 423.1. 200 2-(3-fluoroazetidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.05 (t, J = 5.14 Hz, 1H), 8.72 (d, J = 3.14 Hz, 1H), 8.62 (d, J = 4.39 Hz, 1H), 8.53 (d, J = 6.65 Hz, 1H), 8.01 (d, J = 7.78 Hz, 1H), 7.67 (dd, J = 7.91, 4.64 Hz, 1H), 7.18 (dd, J = 7.91, 4.52 Hz, 1H), 5.29-5.51 (m, 1H), 4.87 (d, J = 4.77 Hz, 2H), 4.20 (m, 2H), 3.90 (m, 2H). LCMS (ES) C.sub.17H.sub.15N.sub.6F.sub.4 [M + H].sup.+ 379.3. 201 2-(3,3-difluoroazetidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.12-9.13 (t, J = 4.0 Hz, 1H), 8.76-8.77 (dd, J = 4.0 Hz, 1H), 8.62-8.63 (d, J = 4.0 Hz, 1H), 8.55-8.58 (dd, J = 4.0 Hz, J = 8.0 Hz, 1H), 8.01-8.02 (d, J = 4.0 Hz, 1H), 7.65-7.68 (dd, J = 4.0 Hz, J = 8.0 Hz, 1H), 7.23-7.26 (dd, J = 4.0 Hz, J = 8.0 Hz, 1H), 4.88-4.89 (d, J = 4.0 Hz, 2H), 4.25-4.32 (t, J = 12.0 Hz, 4H). LCMS (ES) C.sub.17H.sub.14N.sub.6F.sub.5 [M + H].sup.+ 397.1. 202 2-(3-(trifluoromethyl)azetidin-1-yl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.08 (t, J = 5.08 Hz, 1H), 8.74 (dd, J = 4.27, 1.63 Hz, 1H), 8.62 (d, J = 4.52 Hz, 1H), 8.54 (dd, J = 8.09, 1.69 Hz, 1H), 8.01 (d, J = 7.78 Hz, 1H), 7.66 (dd, J = 7.91, 4.52 Hz, 1H), 7.20 (dd, J = 7.97, 4.45 Hz, 1H), 4.88 (d, J = 4.64 Hz, 2H), 4.10 (br. s., 2H), 3.84 (br. s., 2H), 3.57-3.65 (m, 1H). LCMS (ES) C.sub.18H.sub.15N.sub.6F.sub.6 [M + H].sup.+ 429.0. 203 2-(4-(trifluoromethyl)-1H-pyrazol-1-yl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine 0embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.68 (br. s., 1H), 9.06 (dd, J = 4.39, 1.76 Hz, 1H), 9.00 (s, 1H), 8.83 (dd, J = 8.28, 1.76 Hz, 1H), 8.65 (d, J = 4.14 Hz, 1H), 8.27 (s, 1H), 8.16 (d, J = 7.91 Hz, 1H), 7.65 (ddd, J = 16.94, 8.03, 4.52 Hz, 2H), 5.09 (s, 2H). LCMS (ES) C.sub.18H.sub.12N.sub.7F.sub.6 [M + H].sup.+ 440.0. 204 1-(4-fluorophenyl)-3-(4-(((2-(trifluoromethyl)pyridin-3- yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)urea embedded image Synthesised via Route 10 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 12.61 (s, 1H), 9.78 (s, 1H), 9.24 (s, 1H), 8.92-8.93 (d, J = 4.0 Hz, 1H), 8.64-8.68 (m, 2.H), 8.13-8.15 (d, J = 8.0 Hz, 1H), 7.67-7.70 (dd, J = 4.0 Hz, J = 8.0 Hz, 1H), 7.52-7.55 (dd, J = 4.0 Hz, J = 8.0 Hz, 2H), 7.43-7.47 (dd, J = 4.0 Hz, J = 8.0 Hz, 1H), 7.17-7.21 (t, J = 8.0 Hz, 2H), 4.99 (s, 2H). LCMS (ES) C.sub.21H.sub.16N.sub.7F.sub.4O [M + H].sup.+ 458.0. 205 1-(3-fluorophenyl)-3-(4-(((2-(trifluoromethyl)pyridin-3- yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)urea embedded image Synthesised via Route 10 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 12.84 (s, 1H), 9.91 (s, 1H), 9.36 (s, 1H), 8.93-8.94 (d, J = 4.0 Hz, 1H), 8.64-8.90 (m, 2H), 8.11-8.13 (d, J = 8.0 Hz, 1H), 7.57-7.60 (m, 2H), 7.44-7.46 (dd, J = 4.0 Hz, J = 8.0 Hz, 1H), 7.37-7.39 (d, J = 8.0 Hz, 1H), 7.14- 7.16 (d, J = 8.0 Hz, 1H), 6.88 (m, 1H), 5.00 (s, 2H). LCMS (ES) C.sub.21H.sub.16N.sub.7F.sub.4O [M + H].sup.+ 458.0. 206 1-(2-fluorophenyl)-3-(4-(((2-(trifluoromethyl)pyridin-3- yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)urea embedded image Synthesised via Route 10 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 12.67 (s, 1H), 9.93 (s, 1H), 9.23-9.26 (t, J = 8.0 Hz, 1H), 8.92-8.93 (d, J = 4.0 Hz, 1H), 8.64-8.68 (m, 2H), 8.20-8.24 (d, J = 8.0 Hz, 1H), 8.12-8.14 (d, J = 8.0 Hz, 1H), 7.67-7.70 (dd, J = 4.0 Hz, J = 8.0 Hz, 1H), 7.43- 7.46 (dd, J = 4.0 Hz, J = 8.0 Hz, 1H), 7.26-7.31 (t, J = 8.0 Hz, 1H), 7.15-7.19 (t, J = 8.0 Hz, 1H), 7.07-7.10 (m, 1H), 5.00 (s, 2H). LCMS (ES) C.sub.21H.sub.16N.sub.7F.sub.4O [M + H].sup.+ 458.0. 207 1-ethyl-3-(4-(((2-(trifluoromethyl)pyridin-3- yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)urea embedded image Synthesised via Route 10 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.64 (t, 1H), 9.22 (s, 1H), 9.16 (bs, 1H), 8.85-8.86 (d, J = 4.0 Hz, 1H), 8.61-8.65 (m, 2H), 8.09-8.11 (d, J = 8.0 Hz, 1H), 7.66-7.69 (dd, J = 4.0 Hz, J = 8.0 Hz, 1H), 7.37-7.40 (dd, J = 4.0 Hz, J = 8.0 Hz 1H), 4.95 (bs, 2H), 3.18-3.22 (m, 2H), 1.05-1.08 (t, J = 8.0 Hz, 3H). LCMS (ES) C.sub.17H.sub.17N.sub.7F.sub.3O [M + H].sup.+ 392.0. 208 (S)-2-(3-methylmorpholino)-N-(2- (trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.95 (s, 1H), 8.70 (d, J = 3.0 Hz, 1H), 8.52 (d, J = 7.9 Hz, 1H), 7.74 (d, J = 7.8 Hz, 1H), 7.60 (t, J = 7.5 Hz, 1H), 7.51 (d, J = 7.7 Hz, 1H), 7.45 (t, J = 7.5 Hz, 1H), 7.14 (dd, J = 7.9, 4.4 Hz, 1H), 4.87 (ddd, J = 57.1, 16.1, 4.6 Hz, 2H), 4.51 (b, 1H), 4.25 (d, J = 13.6 Hz, 1H), 3.82 (d, J = 8.9 Hz, 1H), 3.59 (d, J = 11.2 Hz, 1H), 3.45 (d, J = 8.6 Hz, 1H), 3.37-3.24 (m, 1H), 3.01 (td, J = 13.0, 3.2 Hz, 1H), 0.91 (b, 3H). LCMS (ES) C.sub.20H.sub.21N.sub.5F.sub.3O [M + H].sup.+ 404.1. 208_S (S)-2-(3-methylmorpholino)-N-(2- (trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine methanesulfonate embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.98 (s, 1H), 9.01 (d, J = 7.9 Hz, 1H), 8.77 (dd, J = 5.4, 1.2 Hz, 1H), 7.78 (d, J = 7.8 Hz, 1H), 7.70-7.45 (m, 4H), 5.05-4.82 (m, 2H), 4.55 (b, 1H), 4.28 (d, J = 13.1 Hz, 1H), 3.89 (d, J = 10.1 Hz, 1H), 3.66 (d, J = 11.3 Hz, 1H), 3.49 (d, J = 10.9 Hz, 1H), 3.34 (d, J = 11.0 Hz, 1H), 3.30-3.18 (m, 1H), 2.35 (s, 3H), 1.05 (b, 3H). LCMS (ES) C.sub.20H.sub.21N.sub.5F.sub.3O [M + H].sup.+ 403.9. 209 (R)-2-(3-methylmorpholino)-N-(2- (trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.96 (t, J = 4.8 Hz, 1H), 8.68 (dd, J = 4.4, 1.6 Hz, 1H), 8.52 (dd, J = 8.0, 1.6 Hz, 1H), 7.73 (d, J = 7.6 Hz, 1H), 7.59 (t, J = 7.6 Hz, 1H), 7.50 (d, J = 8.0 Hz, 1H), 7.44 (t, J = 7.6 Hz, 1H), 7.13 (dd, J = 7.6, 4.4 Hz, 1H), 4.76-4.96 (m, 2H), 4.50 (br s, 1H), 4.24 (d, J = 13.2 Hz, 1H), 3.81 (d, J = 8.4 Hz, 1H), 3.58 (d, J = 11.2 Hz, 1H), 3.42-3.46 (m, 1H), 3.26- 3.29 (m, 1H), 2.96-3.03 (m, 1H), 0.91 (s, 3H). LCMS (ES) C.sub.20H.sub.21N.sub.5F.sub.3O [M + H].sup.+ 404.1. 210 (S)-2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ (ppm) 8.99 (t, J = 4.9 Hz, 1H), 8.70 (dd, J = 4.4,1.7 Hz, 1H), 8.61 (d, J = 4.2 Hz, 1H), 8.51 (dd, J = 8.0, 1.7 Hz, 1H), 7.95 (d, J = 7.9 Hz, 1H), 7.64 (dd, J = 7.9, 4.7 Hz, 1H), 7.15 (dd, J = 8.0, 4.5 Hz, 1H), 4.87 (ddd, J = 57.3, 16.4, 4.3 Hz, 2H), 4.46 (m, 1H), 4.22 (d, J = 13.1 Hz, 1H), 3.82 (d, J = 8.9 Hz, 1H), 3.58 (d, J = 11.2 Hz, 1H), 3.44 (dd, J = 11.3, 2.7 Hz, 1H), 3.36-3.22 (m, 1H), 3.00 (td, J = 13.2, 3.5 Hz, 1H), 0.88 (b, 3H). LCMS (ES) C.sub.19H.sub.20N.sub.6F.sub.3O [M + H].sup.+ 405.1. 211 (R)-2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO) δ (ppm) 8.99 (t, J = 4.9 Hz, 1H), 8.70 (dd, J = 4.4,1.7 Hz, 1H), 8.61 (d, J = 4.2 Hz, 1H), 8.51 (dd, J = 8.0, 1.7 Hz, 1H), 7.95 (d, J = 7.9 Hz, 1H), 7.64 (dd, J = 7.9, 4.7 Hz, 1H), 7.15 (dd, J = 8.0, 4.5 Hz, 1H), 4.87 (ddd, J = 57.3, 16.4, 4.3 Hz, 2H), 4.46 (m, 1H), 4.22 (d, J = 13.1 Hz, 1H), 3.82 (d, J = 8.9 Hz, 1H), 3.58 (d, J = 11.2 Hz, 1H), 3.44 (dd, J = 11.3, 2.7 Hz, 1H), 3.36-3.22 (m, 1H), 3.00 (td, J = 13.2, 3.5 Hz, 1H), 0.88 (b, 3H). LCMS (ES) C.sub.19H.sub.20N.sub.6F.sub.3O [M + H].sup.+ 405.0. 212 2-(4-chloropiperidin-1-yl)-4-(2-(2- (trifluoromethyl)phenyl)azetidin-1-yl)pyrido[2,3- d]pyrimidine 0embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.67 (d, J = 3.3 Hz, 1 H), 8.33 (s, 1 H), 7.83 (d, J = 7.9 Hz, 1 H), 7.75 (d, J = 7.9 Hz, 1 H), 7.63 (t, J = 7.7 Hz, 1 H), 7.45-7.52 (m, 1 H), 7.15 (s, 1 H), 6.05 (t, J = 7.7 Hz, 1 H), 4.70 (q, J = 8.0 Hz, 1 H), 4.19 (s, 1 H), 3.97 (s, 2 H), 3.37 (s, 1 H), 3.17-3.32 (m, 2 H), 2.90-3.02 (m, 1 H), 2.27-2.44 (m, 1 H), 1.81 (s, 2 H), 1.32-1.61 (m, 2 H) LCMS (ES) C.sub.22H.sub.22N.sub.5F.sub.3Cl [M + H].sup.+ 448.1. 213 2-(4,4-difluoropiperidin-1-yl)-4-(2-(2- (trifluoromethyl)phenyl)azetidin-1-yl)pyrido[2,3- d]pyrimidine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.72 (dd, J = 4.3, 1.6 Hz, 1H), 8.26 (S, 1H), 7.83 (d, J = 7.8 Hz, 1H), 7.77 (d, J = 7.8 Hz, 1H), 7.67 (t, J = 7.5 Hz, 1H), 7.47-7.54 (m, 1H), 7.13 (dd, J = 7.8, 4.4 Hz, 1H), 5.91 (t, J = 7.3 Hz, 1H), 4.88 (d, J = 3.6 Hz, 1H), 4.65 (q, J = 8.2 Hz, 1H), 3.87-3.46 (m, 4H), 2.79- 2.92 (m, 1H), 2.19-2.31 (m, 1H), 1.38-1.91 (m, 4H). LCMS (ES) C.sub.22H.sub.21N.sub.5F.sub.5 [M + H].sup.+ 450.1. 214 3-methyl-4-(4-(2-(2-(trifluoromethyl)phenyl)azetidin-1- yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.68-8.69 (m, 1H), 8.22 (m, 1H), 7.82 (dd, J = 12.0, 8.0 Hz, 1H), 7.74 (d, J = 8.0 Hz, 1H), 7.65 (q, J = 8.0 Hz, 1H), 7.46-7.51 (m, 1H), 7.07-7.11 (m, 1H), 5.89-5.91 (m, 1H), 4.85 (m, 1H), 4.59-4.65 (m, 1H), 4.11 (s, 2H), 3.74 (d, J = 8.0 Hz, 1H), 3.39- 3.51 (m, 2H), 3.22-3.28 (m, 1H), 2.84-2.97 (m, 2H), 2.21-2.27 (m, 1H), 1.07 (d, J = 8.0 Hz, 1.7H), 0.58 (br s, 1.3H). LCMS (ES) C.sub.22H.sub.23N.sub.5F.sub.3O [M + H].sup.+ 430.1. 215 2-(3,3-difluoropyrrolidin-1-yl)-4-(2-(2- (trifluoromethyl)phenyl)azetidin-1-yl)pyrido(2,3- d]pyrimidine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.72 (dd, J = 4.3, 1.6 Hz, 1H), 8.27 (s, 1H), 7.84 (d, J = 7.8 Hz, 1H), 7.77 (d, J = 7.8 Hz, 1H), 7.67 (t, J = 7.6 Hz, 1H), 7.47-7.54 (m, 1H), 7.13 (dd, J = 7.7, 4.3 Hz, 1H), 5.94 (s, 1H), 4.90 (s, 1H), 4.64 (q, J = 8.0 Hz, 1H), 3.38-4.04 (m, 4H), 2.86 (dd, J = 9.3, 4.4 Hz, 1H), 2.30-2.44 (m, 2H), 2.18-2.29 (m, 1H). LCMS (ES) C.sub.21H.sub.19N.sub.5F.sub.5 [M + H].sup.+ 436.1. 216 2-(3-(trifluoromethyl)azetidin-1-yl)-4-(2-(2- (trifluoromethyl)phenyl)azetidin-1-yl)pyrido[2,3- d]pyrimidine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.73 (dd, J = 4.4, 1.6 Hz, 1H), 8.26 (s, 1H), 7.85 (d, J = 7.8 Hz, 1H), 7.76 (d, J = 7.7 Hz, 1H), 7.67 (t, J = 7.6 Hz, 1H), 7.46-7.54 (m, 1H), 7.16 (dd, J = 7.7, 4.3 Hz, 1H), 5.93 (s, 1H), 4.90 (s, 1H), 4.56-4.72 (m, 1H), 4.05 (s, 1H), 3.80 (s, 1H), 3.57 (s, 3H), 2.79-2.93 (m, 1H), 2.16-2.31 (m, 1H). LCMS (ES) C.sub.21H.sub.18N.sub.5F.sub.6 [M + H].sup.+ 454.1. 217 2-(4-chloropiperidin-1-yl)-4-(2-(2-(trifluoromethyl)pyridin-3- yl)azetidin-1-yl)pyrido[2,3-d]pyrimidine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, MeOD) δ (ppm) 8.67 (dd, J = 4.6, 1.8 Hz, 1 H), 8.62 (dd, J = 4.7, 1.2 Hz, 1 H), 8.34 (br d, J = 6.9 Hz, 1 H), 8.27 (d, J = 8.0 Hz, 1 H), 7.68 (dd, J = 8.0, 4.7 Hz, 1 H), 7.15 (dd, J = 8.0, 4.6 Hz, 1 H), 6.05 (br t, J = 7.9 Hz, 1 H), 4.73 (q, J = 8.3 Hz, 1 H), 4.19-4.26 (m, 1 H), 3.99 (br s, 2 H), 3.37 (br s, 1 H), 3.20- 3.32 (m, 2 H), 2.94-3.04 (m, 1 H), 2.45 (ddt, J = 11.2, 9.3, 7.1, 7.1 Hz, 1 H), 1.86 (br s, 2 H), 1.35-1.65 (m, 2 H). I.CMS (ES) C.sub.21H.sub.21N.sub.6F.sub.3Cl [M + H].sup.+ 449.1. 218 2-(4,4-difluoropiperidin-1-yl)-4-(2-(2- (trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3- d]pyrimidine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.73 (dd, J = 4.4, 1.8 Hz, 1H), 8.66 (d, J = 3.6 Hz, 1H), 8.18-8.39 (m, 2H), 7.72 (dd, J = 7.9, 4.6 Hz, 1H), 7.15 (dd, J = 8.0, 4.5 Hz, 1H), 5.91 (t, J = 7.5 Hz, 1H), 4.89 (d, J = 4.0 Hz, 1H), 4.67 (q, J = 8.0 Hz, 1H), 3.56 (s, 4H), 2.79-2.93 (m, 1H), 2.29-2.40 (m, 1H), 1.70 (s, 4H) LCMS (ES) C.sub.21H.sub.20N.sub.6F.sub.5 [M + H].sup.+ 451.1. 219 3-methyl-4-(4-(2-(2-(trifluoromethyl)pyridin-3-yl)azetidin-1- yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.70 (d, J = 4.0 Hz, 1H), 8.64 (s, 1H), 8.24 (t, J = 8.0 Hz, 2H), 7.68-7.72 (m, 1H), 7.09- 7.13 (m, 1H), 5.90 (t, J = 8.0 Hz, 1H), 4.85-4.88 (m, 1H), 4.62- 4.67 (m, 1H), 4.07 (m, 2H), 3.74 (d, J = 12.0 Hz 1H), 3.38-3.51 (m, 2H), 3.21-3.27 (m, 1H), 2.67-2.74 (m, 2H), 2.31-2.36 (m, 1H), 1.06 (d, J = 4.0 Hz, 1.7H), 0.57 (br s, 1.3H) LCMS (ES) C.sub.21H.sub.22N.sub.6F.sub.3O [M + H].sup.+ 431.3. 220 2-(3,3-difluoropyrrolidin-1-yl)-4-(2-(2- (trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3- d]pyrimidine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.73 (dd, J = 4.4, 1.7 Hz, 1H), 8.66 (d, J = 4.2 Hz, 1H), 8.20-8.34 (m, 2H), 7.72 (dd, J = 8.0, 4.6 Hz, 1H), 7.15 (dd, J = 8.0, 4.4 Hz, 1H), 5.94 (t, J = 7.1 Hz, 1H), 4.84-4.99 (m, 1H), 4.66 (q, J = 8.2 Hz, 1H), 3.36-4.06 (m, 4H), 2.88 (dd, J = 10.0, 4.6 Hz, 1H), 2.29-2.44 (m, 3H). LCMS (ES) C.sub.20H.sub.18N.sub.6F.sub.5 [M + H].sup.+ 437.1. 221 2-(3-(trifluoromethyl)azetidin-1-yl)-4-(2-(2- (trifluoromethyl)pyridin-3-yl)azetidin-1-yl)pyrido[2,3- d]pyrimidine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.74 (d, J = 2.8 Hz, 1H), 8.65 (d, J = 4.0 Hz, 1H), 8.27 (d, J = 7.7 Hz, 2H), 7.72 (dd, J = 8.0, 4.6 Hz, 1H), 7.17 (dd, J = 8.0, 4.6 Hz, 1H), 5.92 (s, 1H), 4.91 (d, J = 4.4 Hz, 1H), 4.67 (q, J = 8.2 Hz, 1H), 4.03 (s, 1H), 3.77 (s, 1H), 3.56 (s, 3H), 2.87 (d, J = 5.40 Hz, 1H), 2.28-2.39 (m, 1H) LCMS (ES) C.sub.20H.sub.17N.sub.6F.sub.6 [M + H].sup.+ 455.1. 222 2-((4-chloropiperidin-1-yl)methyl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine 0embedded image Synthesised via Route 11 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 9.05 (dd, J = 4.3, 1.7 Hz, 1H), 8.09 (dd, J = 8.2, 1.7 Hz, 1H), 7.71 (t, J = 7.0 Hz, 2H), 7.52 (t, J = 7.5 Hz, 1H), 7.35-7.46 (m, 2H), 6.22 (br s, 1H), 5.12 (d, J = 4.9 Hz, 2H), 4.00 (br s, 1H), 3.86 (s, 2H), 3.04 (dd, J = 12.6, 6.7 Hz, 2H), 2.47-2.64 (m, 2H), 2.05-2.15 (m, 2H), 1.88-2.00 (m, 2H). LCMS (ES) C.sub.21H.sub.22N.sub.5F.sub.3Cl [M + H].sup.+ 436.1. 223 2-((4,4-difluoropiperidin-1-yl)methyl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 11 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.04-9.05 (dd, J = 4.0, 1.6 Hz 1H), 8.07-8.09 (dd, J = 8.0, 1.6 Hz, 1H), 7.70-7.20 (d, J = 8.0 Hz, 1H), 7.68-7.66 (d, J = 8.0 Hz, 1H), 7.49-7.52 (t, J = 8.0 Hz, 1H), 7.37-7.44 (m, 2H), 6.20 (s, 1H), 5.10-5.11 (d, J = 4.0 Hz, 2H), 3.89 (s, 2H), 2.81-2.83 (t, J = 4.0 Hz, 4H), 1.95- 2.05 (m, 4H). LCMS (ES) C.sub.21H.sub.21N.sub.5F.sub.5 [M + H].sup.+ 438.1. 224 2-((3-methylmorpholino)methyl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 11 .sup.1H NMR (400 MHz, MeOD) δ (ppm) 9.14-9.16 (t, J = 4.0 Hz, 1H), 8.99-9.01 (dd, J = 4.0, 1.6 Hz, 1H), 8.77-8.79 (dd, J = 8.0, 4.0 Hz, 1H), 7.74-7.76 (d, J = 8.0 Hz, 1H), 7.55-7.59 (m, 2H), 7.44-7.51 (m, 2H), 4.95-4.98 (m, 2H), 3.63-5.73 (q, J = 12.0 Hz, 2H), 3.44-3.47 (m, 1H), 3.37-3.40 (m, 1H), 3.25-3.31 (m, 1H), 2.89-2.94 (t, J = 12.0 Hz, 1H), 2.54-2.57 (m, 1H), 2.39-2.46 (m, 2H), 0.82-0.84 (d, J = 8.0 Hz, 3H). LCMS (ES) C.sub.21H.sub.23N.sub.5F.sub.3O [M + H].sup.+ 418.1. 225 2-((3,3-difluoropyrrolidin-1-yl)methyl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 11 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 9.05 (dd, J = 4.3, 1.8 Hz, 1H), 8.09 (dd, J = 8.2, 1.7 Hz, 1H), 7.71 (t, J = 7.9 Hz, 2H), 7.53 (t, J = 7.5 Hz, 1H), 7.29-7.46 (m, 2H), 6.25 (br s, 1H), 5.11 (d, J = 4.5 Hz, 2H), 3.97 (s, 2H), 3.19 (t, J = 13.6 Hz, 2H), 3.03 (t, J = 7.0 Hz, 2.H), 2.29 (m, 2H). LCMS (ES) C.sub.20H.sub.19N.sub.5F.sub.5 [M + H].sup.+ 424.1. 226 2-((3-(trifluoromethyl)azetidin-1-yl)methyl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 11 .sup.1H NMR (400 MHz, MeOD) δ (ppm) 9.01-9.04 (dd, J = 4.0, 1.6 Hz, 1H), 8.09-8.12 (dd, J = 8.0, 1.6 Hz, 1H), 7.69-7.71 (d, J = 8.0 Hz, 1H), 7.62-7.64 (d, J = 8.0 Hz, 1H), 7.49-7.53 (t, J = 8.0 Hz, 1H), 7.40-7.43 (t, J = 8.0 Hz, 1H), 7.35-7.38 (dd, J = 8.0, 4.0 Hz, 1H), 6.31 (m, 1H), 5.08-5.10 (d, J = 8.0 Hz, 2H), 3.87 (s, 2H), 3.69-3.73 (t, J = 8.0 Hz, 2H), 3.44-3.48 (t, J = 8.0 Hz, 2H), 3.16- 3.22 (m, 1H). LCMS (ES) C.sub.20H.sub.18N.sub.5F.sub.6 [M + H].sup.+ 442.1. 227 2-((4-chloropiperidin-1-yl)methyl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 11 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.32 (br s, 1H), 9.03 (br d, J = 3.1 Hz, 1H), 8.80 (br d, J = 8.2 Hz, 1H), 8.63 (d, J = 4.3 Hz, 1H), 8.01 (br d, J = 7.8 Hz, 1H), 7.65 (br dd, J = 4.6, 8.0 Hz, 2H), 4.98 (br d, J = 3.8 Hz, 2H), 4.05 (br s, 1H), 3.67 (br s, 2H), 2.79 (br s, 2H), 2.48-2.35 (m, 2H), 2.09-1.56 (m, 4H). LCMS (ES) C.sub.20H.sub.21N.sub.6F.sub.3Cl [M + H].sup.+ 437.0. 228 2-((4,4-difluoropiperidin-1-yl)methyl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 11 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.34 (br s, 1H), 9.02 (dd, J = 1.6, 4.4 Hz, 1H), 8.78 (dd, J = 1.6, 8.2 Hz, 1H), 8.62 (d, J = 4.1 Hz, 1H), 8.00 (br d, J = 7.9 Hz, 1H), 7.69-7.56 (m, 2H), 4.97 (br d, J = 4.8 Hz, 2H), 3.66 (br s, 2H), 2.57 (m, 4H), 1.84 (br s, 4H). LCMS (ES) C.sub.20H.sub.20N.sub.6F.sub.5 [M + H].sup.+ 439.2. 229 2-((3-methylmorpholino)methyl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 11 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.28 (br s, 1H), 9.02 (dd, J = 1.6, 4.3 Hz, 1H), 8.78 (dd, J = 1.6, 8.2 Hz, 1H), 8.62 (d, J = 4.3 Hz, 1H), 7.98 (br d, J = 7.9 Hz, 1H), 7.62 (dt, J = 4.5, 8.8 Hz, 2H), 4.97 (br s, 2H), 3.75-3.46 (m, 4H), 2.99 (br s, 1H), 2.66- 2.55 (m, 2H), 2.44 (m, 2H), 0.82 (d, J = 6.2 Hz, 3H). LCMS (ES) C.sub.20H.sub.22N.sub.6F.sub.3O [M + H].sup.+ 419.1. 230 2-((3,3-difluoropyrrolidin-1-yl)methyl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 11 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 9.04 (dd, J = 1.6, 4.4 Hz, 1H), 8.63 (d, J = 4.3 Hz, 1H), 8.24 (d, J = 8.5 Hz, 1H), 8.17 (d, J = 7.8 Hz, 1H), 7.47 (dd, J = 4.7, 7.8 Hz, 1H), 7.42 (dd, J = 4.4, 8.3 Hz, 1H), 6.74 (br s, 1H), 5.14 (br d, J = 5.5 Hz, 2H), 3.92 (s, 2H), 3.13 (t, J = 13.4 Hz, 2H), 2.98 (t, J = 7.0 Hz, 2H), 2.28 (tt, J = 7.1, 14.6 Hz, 2H). LCMS (ES) C.sub.19H.sub.18N.sub.5F.sub.6 [M + H].sup.+ 425.1. 231 2-((3-(trifluoromethyl)azetidin-1-yl)methyl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 11 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.32 (br s, 1H), 9.01 (dd, J = 1.9, 4.4 Hz, 1H), 8.81 (dd, J = 1.7, 8.2 Hz, 1H), 8.61 (d, J = 4.3 Hz, 1H), 7.97 (d, J = 7.9 Hz, 1H), 7.66-7.62 (m, 1H), 7.59- 7.56 (m, 1H), 4.96 (br d, J = 5.0 Hz, 2H), 3.56 (s, 2H), 3.39 (m, 3H), 3.22 (br d, J = 5.9 Hz, 2H). LCMS (ES) C.sub.19H.sub.17N.sub.6F.sub.6 [M + H].sup.+ 443.0. 232 2-(4-(methylsulfonyl)piperidin-1-yl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine 0embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.78 (dd, J = 1.7, 4.5 Hz, 1H), 8.63 (d, J = 4.3 Hz, 1H), 8.07 (d, J = 6.8 Hz, 1H), 7.93 (d, J = 7.8 Hz, 1H), 7.46 (dd, J = 4.7, 8.0 Hz, 1H), 7.06 (dd, J = 4.5, 7.9 Hz, 1H), 6.70 (s, 1H), 5.03 (d, J = 5.4 Hz, 4H), 3.15-3.04 (m, 1H), 2.90-2.84 (m, 5H), 2.11 (d, J = 12.3 Hz, 2H), 1.69 (s, 2H). LCMS (ES) C.sub.20H.sub.22N.sub.6F.sub.3O.sub.2S [M + H].sup.+ 467.1. 233 2-(4,4-dimethyipiperidin-1-yl)-N-((2-(trifluoromethyl)pyridin- 3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.73 (dd, J = 4.4, 1.6 Hz, 1H), 8.60 (d, J = 4.4 Hz, 1H) 7.94 (d, J = 8.0 Hz, 1H), 7.89 (dd, J = 8.0, 1.6 Hz, 1H), 7.43 (dd, J = 8.0, 4.8 Hz, 1H), 6.95 (dd, J = 7.6, 4.4 Hz, 1H), 6.23 (br s, 1H), 5.02 (d, J = 4.8 Hz, 2H), 3.82 (br s, 4H), 1.31 (br s, 4H), 0.96 (s, 6H). LCMS (ES) C.sub.21H.sub.24N.sub.6F.sub.3 [M + H].sup.+ 417.1. 234 1-(4-(((2-(trifluoromethyl)pyridin-3- yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)piperidine-4- carbonitrile embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.78 (dd, J = 4.0, 2.0 Hz, 1H), 8.62 (d, J = 4.0 Hz, 1H), 7.94 (dd, J = 8.0, 2.0 Hz, 1H), 7.90 (d, J = 8.0 Hz, 1H), 7.46 (dd, J = 8.0, 4.0 Hz, 1H), 7.04 (dd, J = 8.0, 4.0 Hz, 1H), 6.28 (t, J = 8.0 Hz, 1H), 5.02 (d, J = 4.0 Hz, 2H), 4.16 (br s, 2H), 3.72 (br s, 2H), 2.82-2.88 (m, 1H) 1.78-1.86 (m, 4H). LCMS (ES) C.sub.20H.sub.19N.sub.7F.sub.3 [M + H].sup.+ 414.0. 235 2-(4-(trifluoromethyl)piperidin-1-yl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d] pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.80 (dd, J = 4.5, 1.8 Hz, 1H), 8.63 (d, J = 4.4 Hz, 1H), 7.84-8.00 (m, 2H), 7.46 (dd, J = 7.9, 4.7 Hz, 1H), 7.04 (dd, J = 7.9, 4.5 Hz, 1H), 6.19 (t, J = 5.3 Hz, 1H), 5.04 (d, J = 5.7 Hz, 4H), 2.82 (t, J = 12.1 Hz, 2H), 2.19-2.36 (m, 1H), 1.87 (d, J = 12.8 Hz, 2H), 1.46 (m, 2H). LCMS (ES) C.sub.20H.sub.19N.sub.6F.sub.6 [M + H].sup.+ 457.1. 236 N-((2-(trifluoromethyl)pyridin-3-yl)methyl)-2-(3- (trifluoromethyl)pyrrolidin-1-yl)pyrido[2,3-d]pyrimidin-4- amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.72-8.84 (m, 1H), 8.58- 8.67 (m, 1H), 7.96 (t, J = 8.2 Hz, 2H), 7.45 (dd, J = 7.4, 4.7 Hz, 1H), 7.02 (dd, J = 7.7, 4.4 Hz, 1H), 6.34 (s, 1H), 5.05 (d, J = 5.3 Hz, 2H), 3.53-4.04 (m, 4H), 2.99 (dd, J = 15.0, 7.5 Hz, 1H), 2.01-2.27 (m, 2H). LCMS (ES) C.sub.19H.sub.17N.sub.6F.sub.6 [M + H].sup.+ 443.0. 237 1-(4-(((2-(trifluoromethyl)pyridin-3- yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)azetidine-3- carbonitrile embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.84 (dd, J = 4.4, 1.8 Hz, 1H), 8.65 (d, J = 4.0 Hz, 1H), 7.95 (m, J = 5.3, 2.4 Hz, 2H), 7.43- 7.55 (m, 1H), 7.11 (dd, J = 8.1, 4.5 Hz, 1H), 6.29 (t, J = 5.4 Hz, 1H), 5.03 (d, J = 6.0 Hz, 2H), 4.25-4.53 (m, 4H), 3.45-3.58 (m, 1H). LCMS (ES) C.sub.18H.sub.15N.sub.7F.sub.3 [M + H].sup.+ 386.0. 238 1-(4-(((2-(trifluoromethyl)pyridin-3- yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)pyrrolidine-2- carbonitrile embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.79 (dd, J = 1.9, 4.5 Hz, 1H), 8.63 (d, J = 4.3 Hz, 1H), 8.05 (dd, J = 1.9, 8.0 Hz, 1H), 7.97 (d, J = 7.9 Hz, 1H), 7.47 (dd, J = 4.8, 7.9 Hz, 1H), 7.06 (dd, J = 4.5, 8.0 Hz, 1H), 6.65 (t, J = 5.4 Hz, 1H), 5.06 (d, J = 5.3 Hz, 2H), 4.05- 3.58 (m, 4H), 3.20 (m, 1H), 2.39-2.26 (m, 2H). LCMS (ES) C.sub.19H.sub.17N.sub.7F.sub.3 [M + H].sup.+ 400.2. 239 2-(2,2-dimethylmorpholino)-N-((2-(trifluororoethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.79 (dd, J = 4.5, 1.8 Hz, 1H), 8.63 (br d, J = 4.3 Hz, 1H), 7.84-7.97 (m, 2H), 7.45 (dd, J = 7.5, 5.0 Hz, 1H), 7.03 (dd, J = 7.9, 4.5 Hz, 1H), 6.20 (br s, 1H), 5.03 (d, J = 4.8 Hz, 2H), 3.51-4.00 (m, 6H), 0.85-1.27 (m, 6H). LCMS (ES) C.sub.20H.sub.22N.sub.6F.sub.3O [M + H].sup.+ 419.2. 240 2-(3,3-dimethylmorpholino)-N-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.88 (s, 1H), 8.74 (d, J = 4.0 Hz, 1H), 8.61 (d, J = 4.0 Hz, 1H), 8.52 (d, J = 4.0 Hz, 1H), 7.90 (d, J = 8.0 Hz, 1H), 7.64 (dd, J = 8.0, 4.0 Hz, 1H), 7.19 (dd, J = 8.0, 4.0 Hz, 1H), 4.90 (s, 2H), 3.68 (s, 4H), 3.30 (s, 2H), 1.23 (s, 6H). LCMS (ES) C.sub.20H.sub.22N.sub.6F.sub.3O [M + H].sup.+ 419.1. 241 2-(2-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.77 (dd, J = 4.0, 1.2 Hz, 1H), 8.62 (d, J = 4.0 Hz, 1H), 7.90-7.96 (m, 2H), 7.44 (dd, J = 8.0, 4.0 Hz, 1H), 7.03 (dd, J = 8.0, 4.0 Hz, 1H), 6.33 (br s, 1H), 5.02 (d, J = 4.0 Hz, 2H), 4.58 (br s, 2H), 3.89 (dd, J = 12.0, 4.0 Hz, 1H), 3.49-3.54 (m, 2H), 3.00 (t, J = 12.0 Hz, 1H), 2.63 (t, J = 12.0 Hz, 1H), 1.16 (d, J = 8.0 Hz, 3H). LCMS (ES) C.sub.19H.sub.20N.sub.6F.sub.3O [M + H].sup.+ 405.1. 242 2-(3-fluoropyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-a]pyrimidin-4-amine 00embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.73 (dd, J = 1.8, 4.4 Hz, 1H), 8.59 (d, J = 4.3 Hz, 1H), 8.15 (d, J = 7.8 Hz, 1H), 7.99 (s, 1H), 7.43 (dd, J = 4.7, 7.8 Hz, 1H), 6.99 (dd, J = 4.5, 7.9 Hz, 2H), 5.42- 5.17 (m, 1H), 5.04 (d, J = 5.0 Hz, 2H), 4.14-3.54 (m, 4H), 2.35- 2.30 (m, 1H), 2.27-2.25 (m, 1H). LCMS (ES) C.sub.18H.sub.17N.sub.6F.sub.4 [M + H].sup.+ 393.1. 243 2-(4-(methylsulfonyl)piperidin-1-yl)-N-(2- (trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 01embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.77 (dd, J = 1.8, 4.5 Hz, 1H), 8.00 (dd, J = 1.8, 8.0 Hz, 1H), 7.71 (d, J = 7.7 Hz, 1H), 7.57 (d, J = 7.3 Hz, 1H), 7.50 (t, J = 7.6 Hz, 1H), 7.38-7.45 (m, 1H), 7.03 (dd, J = 4.5, 8.0 Hz, 1H), 6.47 (t, J = 5.6 Hz, 1H), 5.15 (s, 2H), 5.01 (d, J = 5.5 Hz, 2H), 3.06-3.10 (m, 1H), 2.84-2.92 (m, 2H), 2.82 (s, 3H), 2.13 (d, J = 12.3 Hz, 2H), 1.71 (s, 2H). LCMS (ES) C.sub.21H.sub.23N.sub.5F.sub.3O.sub.2S [M + H].sup.+ 466.1. 244 2-(4,4-dimethylpiperidin-1-yl)-N-(2- (trifluoromethyl)benzyl)pyndo[2,3-d]pyrimidin-4-amine 02embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.71 (dd, J = 4.4, 2.8 Hz, 1H), 7.83 (dd, J = 8.0, 1.6 Hz, 1H), 7.68 (d, J = 8.0 Hz, 1H), 7.59 (d, J = 7.6 Hz, 1H), 7.48 (t, J = 7.2 Hz, 1H), 7.38 (t, J = 7.2 Hz, 1H), 6.92 (dd, J = 7.6, 4.4 Hz, 1H), 6.07 (t, J = 5.2 Hz, 1H), 4.99 (d, J = 5.6 Hz, 2.H), 3.88 (s, 4H), 1.35 (s, 4H), 0.97 (s, 6H). LCMS (ES) C.sub.22H.sub.25N.sub.5F.sub.3 [M + H].sup.+ 416.2. 245 1-(4-((2-(trifluoromethyl)benzyl)amino)pyrido[2,3- d]pyrimidin-2-yl)azetidine-3-carbonitrile 03embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.82 (dd, J = 4.5, 1.8 Hz, 1H), 7.89 (dd, J = 8.0,1.7 Hz, 1H), 7.72 (d, J = 7.8 Hz, 1H), 7.57- 7.63 (m, 1H), 7.50-7.56 (m, 1H), 7.39-7.48 (m, 1H), 7.09 (dd, J = 8.1, 4.4 Hz, 1H), 6.11 (s, 1H), 5.01 (d, J = 5.9 Hz, 2H), 4.35- 4.59 (m, 4H), 3.48-3.60 (m, 1H). LCMS (ES) C.sub.19H.sub.16N.sub.6F.sub.3 [M + H].sup.+ 385.1. 246 2-(3,3-dimethylmorpholino)-N-(2- (trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 04embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.84 (t, J = 5.5 Hz, 1H), 8.74 (dd, J = 4.4, 1.7 Hz, 1H), 8.54 (dd, J = 8.1,1.7 Hz, 1H), 7.75 (d, J = 7.7 Hz, 1H), 7.56-7.64 (m, 1H), 7.42-7.51 (m, 2H), 7.19 (dd, J = 8.0, 4.5 Hz, 1H), 4.91 (d, J = 5.0 Hz, 2H), 3.71 (s, 4H), 3.31 (s, 2H), 1.26 (s, 6H). LCMS (ES) C.sub.21H.sub.23N.sub.5F.sub.3O [M + H].sup.+ 418.1. 247 2-(2,2-dimethylmorpholino)-N-(2- (trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 05embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.76 (dd, J = 4.4, 1.7 Hz, 1H), 7.89 (d, J = 7.2 Hz, 1H), 7.71 (d, J = 7.7 Hz, 1H), 7.45-7.59 (m, 2H), 7.36-7.44 (m, 1H), 7.00 (dd, J = 8.0, 4.5 Hz, 1H), 6.16 (br s, 1H), 5.00 (d, J = 5.4 Hz, 2H), 3.56-4.02 (m, 6H), 1.11 (br s, 6H). LCMS (ES) C.sub.21H.sub.23N.sub.5F.sub.3O [M + H].sup.+ 418.1. 248 2-(2-methylmorpholino)-N-(2- (trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 06embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.75 (d, J = 3.2 Hz, 1H), 7.89 (d, J = 7.2 Hz, 1H), 7.69 (d, J = 7.6 Hz, 1H), 7.55 (d, J = 7.6 Hz, 1H), 7.49 (t, J = 8.0Hz, 1H), 7.40 (t, J = 7.6 Hz, 1H), 6.90-6.94 (dd, J = 8.0, 4.4 Hz, 1H), 6.17 (s, 1H), 4.99 (d, J = 4.8 Hz, 2H), 4.68 (br s, 2H), 3.91 (dd, J = 11.2, 2.4 Hz, 1H), 3.56 (m, 2H), 3.03 (m, 1H), 2.67 (t, J = 12.0 Hz, 1H), 1.18 (d, J = 6.0 Hz, 3H). LCMS (ES) C.sub.20H.sub.21N.sub.5F.sub.3O [M + H].sup.+ 404.1. 249 2-(3-(trifluoromethyl)piperidin-1-yl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine 07embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.00 (t, J = 8.0 Hz, 1H), 8.70 (dd, J = 4.0, 2.0 Hz, 1H), 8.59 (d, J = 4.0 Hz, 1H), 8.50 (dd, J = 8.0, 2.0 Hz, 1H), 7.92 (d, J = 8.0 Hz, 1H), 7.63 (d, J = 8.0, 4.0 Hz, 1H), 7.16 (dd, J = 8.0, 4.0 Hz, 1H), 4.88 (d, J = 4.0 Hz, 2H), 4.49-4.71 (m, 2H), 2.81-2.87 (m, 2H), 2.22 (br s, 1H), 1.88 (d, J = 8.0 Hz, 1H), 1.45-1.60 (m, 2H), 1.27 (br s, 1H). LCMS (ES) C.sub.20H.sub.19N.sub.6F.sub.6 [M + H].sup.+ 457.1. 250 4-methyl-1-(4-(((2-(trifluoromethyl)pyridin-3- yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)piperidine-4- carbonitrile 08embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.77 (dd, J = 4.0, 2.0 Hz, 1H), 8.61 (d, J = 4.0 Hz, 1H),7.94 (dd, J = 8.0, 4.0 Hz, 1H), 7.91 (d, J = 8.0 Hz, 1H), 7.45 (dd, J = 8.0, 4.0 Hz, 1H), 7.02 (dd, J = 8.0, 4.0 Hz, 1H), 6.34 (t, J = 4.0 Hz, 1H), 5.01-5.02 (m, 4H), 3.16 (t, J = 12.0 Hz, 2H), 1.91 (d, J = 16.0 Hz, 2H), 1.37 (m, 5H). LCMS (ES) C.sub.21H.sub.21N.sub.7F.sub.3 [M + H].sup.+ 427.9. 251 09embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.71-8.76 (m, 2H), 8.61 (d, J = 4.0 Hz, 1H), 8.49 (dd, J = 8.0, 2.0 Hz, 1H), 7.98 (d, J = 8.0 Hz, 1H), 7.62 (dd, J = 8.0, 4.0 Hz, 1H), 7.13 (dd, J = 8.0, 4.0 Hz, 1H), 4.92 (s, 2H), 3.92 (d, J = 4.0 Hz, 2H), 3.63-3.73 (m, 2H), 2.84-2.89 (m, 1H), 1.90-1.96 (m, 1H), 1.78-1.85 (m, 1H), 1.53- 1.59 (m, 1H), 1.44-1.47 (m, 1H). LCMS (ES) C.sub.20H.sub.19N.sub.7F.sub.3 [M + H].sup.+ 413.9. 252 2-(2,2-difluoro-7-azaspiro[3.5]nonan-7-yl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine 0embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.95 (s, 1H), 8.68 (d, J = 2.7 Hz, 1H), 8.61 (d, J = 4.2 Hz, 1H), 8.47 (d, J = 6.4 Hz, 1H), 7.95 (d, J = 8.0 Hz, 1H), 7.64 (dd, J = 7.8, 4.6 Hz, 1H), 7.12 (dd, J = 7.9, 4.4 Hz, 1H), 4.86 (d, J = 3.8 Hz, 2H), 3.75-3.51 (m, 4H), 2.41-2.26 (m, 4H), 1.57-1.25 (m, 4H). LCMS (ES) C.sub.22H.sub.22N.sub.6F.sub.5 [M + H].sup.+ 465.1. 252_S 2-(2,2-difluoro-7-azaspiro[3.5]nonan-7-yl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine methanesulfonate embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.88 (s, 1H), 8.86 (d, J = 8.0 Hz, 1H), 8.75 (d, J = 4.9 Hz, 1H), 8.66 (d, J = 4.3 Hz, 1H), 8.04 (d, J = 8.1 Hz, 1H), 7.69 (dd, J = 8.0, 4.6 Hz, 1H), 7.54- 7.41 (m, 1H), 4.94 (d, J = 5.2 Hz, 2H), 3.86-3.53 (m, 4H), 2.41 (t, J = 13.0 Hz, 4H), 2.31 (s, 3H), 1.75-1.34 (m, 4H). LCMS (ES) C.sub.22H.sub.22N.sub.6F.sub.5 [M + H].sup.+ 465.3. 253 2-(3-cyclopropylmorpholino)-N-((2-(trifluoromethyl)pyridin- 3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.71 (d, J = 4.0 Hz, 1H), 8.61 (d, J = 4.0 Hz, 1H), 8.04 (d, J = 8.0 Hz, 1H), 7.86 (d, J = 8.0 Hz, 1H), 7.44 (dd, J = 8.0, 4.0 Hz, 1H), 6.97 (dd, J = 8.0, 4.0 Hz, 1H), 6.71 (s, 1H), 4.88-5.07 (m, 2H), 4.63 (s, 1H), 3.87-3.97 (m, 3H), 3.37-3.57 (m, 3H), 1.48-1.51 (m, 1H), 0.43-0.7 (m, 1H), 0.06- 0.25 (m, 3H). LCMS (ES) C.sub.21H.sub.22N.sub.6F.sub.3O [M + H].sup.+ 431.1. 254 2-((6S)-2,6-dimethylmorpholino)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.78 (d, J = 2.6 Hz, 1H), 8.62 (d, J = 3.9 Hz, 1H), 7.92 (t, J = 9.0 Hz, 2H), 7.45 (dd, J = 7.7, 4.6 Hz, 1H), 7.03 (dd, J = 8.0, 4.5 Hz, 1H), 6.27 (s, 1H), 4.48-5.14 (m, 3H), 3.41-4.40 (m, 3H), 2.37-2.81 (m, 2H), 1.18-1.19 (m, J = 5.8 Hz, 6H). LCMS (ES) C.sub.20H.sub.22N.sub.6F.sub.3O [M + H].sup.+ 419.1. 255 2-(2-oxa-5-azabicyclo[2.2.1]heptan-5-yl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.72 (s, 1H), 8.58 (d, J = 4.0 Hz, 1H), 7.89-8.06 (m, 2H), 7.40-7.45 (m, 1H), 6.98 (dd, J = 8.0, 4.0 Hz, 1H), 6.56-6.76 (m, 1H), 5.22 (br s, 0.5H), 4.93-5.09 (m, 2H), 4.79 (s, 0.5H), 4.63 (s, 1H), 3.81-3.94 (m, 1H), 3.41-3.69 (m, 3H) 1.86-1.69 (m, 2H). LCMS (ES) C.sub.19H.sub.18N.sub.6F.sub.3O [M + H].sup.+ 402.9. 256 2-(4-oxa-7-azaspiro[2.5]octan-7-yl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.01 (s, 1H), 8.69 (dd, J = 4.0, 2.0 Hz, 1H), 8.60 (d, J = 4.0 Hz, 1H), 8.50 (dd, J = 8.0, 2.0 Hz, 1H), 7.94 (d, J = 8.0 Hz, 1H), 7.64 (dd, J = 8.0, 4.0 Hz, 1H), 7.14 (dd, J = 8.0, 4.0 Hz, 1H), 4.81 (s, 2H), 3.56-3.64 (m, 6H), 0.01-0.55 (m, 4H). LCMS (ES) C.sub.20H.sub.20N.sub.6F.sub.3O [M + H].sup.+ 416.9. 257 4-(4-(((2-(trifluoromethyl)pyridin-3- yl)methyl)amino)pyrido[2,3-d]pyrimidin-2-yl)morpholine-2- carbonitrile embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.81 (d, J = 2.8 Hz, 1H), 8.62 (d, J = 4.4 Hz, 1H), 8.02 (d, J = 7.9 Hz, 1H), 7.93 (d, J = 7.9 Hz, 1H), 7.48? (dd, J = 4.7, 7.8 Hz, 1H), 7.10 (dd, J = 4.5, 7.9 Hz, 1H), 6.62- 6.52 (m, 1H), 5.11-4.96 (m, 2H), 4.62-4.56 (m, 3H), 3.94-3.92 (m, 1H), 3.81-3.78 (m, 2H), 3.47-3.42 (m, 1H). LCMS (ES) C.sub.19H.sub.17N.sub.7F.sub.3O [M + H].sup.+ 416.1. 258 2-(3-(fluoromethyl)piperidin-1-yl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d] pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.76 (dd, J = 4.5, 1.8 Hz, 1H), 8.62 (d, J = 4.2 Hz, 1H), 7.98 (d, J = 7.8 Hz, 1H), 7.89 (dd, J = 7.9, 1.7 Hz, 1H), 7.45 (dd, J = 7.9, 4.7 Hz, 1H), 6.99 (dd, J = 7.9, 4.5 Hz, 1H), 6.20 (t, J = 5.6 Hz, 1H), 4.96-5.11 (m, 2H), 4.65-4.90 (m, 2H), 4.20-4.42 (m, 2H), 2.86-3.19 (m, 2H), 1.84 (d, J = 10.6 Hz, 2H), 1.66-1.76 (m, 1H), 1.31-1.53 (m, 2H). LCMS (ES) C.sub.20H.sub.21N.sub.6F.sub.4 [M + H].sup.+ 421.1. 259 2-(2-(trifluoromethyl)piperidin-1-yl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.82 (dd, J = 4.3, 1.7 Hz, 1H), 8.62 (d, J = 4.3 Hz, 1H), 7.94 (d, J = 8.1 Hz, 2H), 7.45 (s, 1H), 7.08 (dd, J = 7.9, 4.4 Hz, 1H), 6.25 (s, 1H), 4.79-5.45 (m, 3H), 3.04 (t, J = 13.1 Hz, 1H), 2.00-2.11 (m, 1H), 1.64-1.86 (m, 4H), 1.30-1.54 (m, 2H). LCMS (ES) C.sub.20H.sub.19N.sub.6F.sub.6 [M + H].sup.+ 457.1. 260 2-(2,2-difluoro-7-azaspiro[3.5]nonan-7-yl)-N-(2- (trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.89 (t, J = 5.6 Hz, 1H), 8.66 (dd, J = 4.4, 1.9 Hz, 1H), 8.48 (dd, J = 8.0,1.9 Hz, 1H), 7.74 (d, J = 7.7 Hz, 1H), 7.55-7.64 (m, 1H), 7.49-7.54 (m, 1H), 7.41- 7.48? (m, 1H), 7.10 (dd, J = 8.0, 4.5 Hz, 1H), 4.85 (d, J = 5.1 Hz, 2H), 3.41-3.77 (m, 4H), 2.35 (t, J = 13.1 Hz, 4H), 1.42 (s, 4H). LCMS (ES) C.sub.23H.sub.23N.sub.5F.sub.5 [M + H].sup.+ 464.2. 261 (2-(trifluoromethyl)pyridin-3-yl)metha 4-methyl-1-(4-((2- (trifluoromethyl)benzyl)amino)pyrido[2,3-d]pyrimidin-2- yl)piperidine-4-carbonitrile 0embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.94 (s, 1H), 8.69 (dd, J = 4.4 Hz, 1H), 8.52 (d, J = 8.0 Hz, 1H), 7.75 (d, J = 7.6 Hz, 1H), 7.56-7.63 (m, 1H), 7.50-7.55 (m, 1H), 7.42-7.49 (m, 1H), 7.14 (dd, J = 7.8, 4.6 Hz, 1H), 4.86 (d, J = 4.8 Hz, 2H), 4.58 (s, 2H), 2.94 (t, J = 12.0 Hz, 2H), 1.77 (d, J = 12.0 Hz, 2H), 1.29 (s, 5H). LCMS (ES) C.sub.22H.sub.22N.sub.6F.sub.3 [M + H].sup.+ 427.1. 262 1-(4-((2-(trifluoromethyl)benzyl)amino)pyrido[2,3- d]pyrimidin-2-yl)piperidine-3-carbonitrile embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.76 (d, J = 4.4 Hz, 1H), 7.88 (d, J = 7.6 Hz, 1H), 7.70 (d, J = 8.0Hz, 1H), 7.57 (d, J = 7.6 Hz, 1H), 7.51 (t, J = 8.0Hz, 1H), 7.41 (t, J = 7.2 Hz, 1H), 7.02 (dd, J = 8.0, 4.4 Hz, 1H), 6.17 (s, 1H), 5.00 (d, J = 5.6 Hz, 2H), 4.28 (s, 1H), 4.22-4.26 (m, 1H), 3.74-3.80 (m, 1H), 3.59 (s, 1H), 2.64 (s, 1H), 2.05 (m, 1H), 1.86-1.95 (m, 1H), 1.77-1.80 (m, 1H), 1.54 (m, 1H). LCMS (ES) C.sub.21H.sub.20N.sub.6F.sub.3 [M + H].sup.+ 413.0. 263 2-(3-(methylsulfonyl)pyrrolidin-1-yl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.79 (dd, J = 4.5, 1.8 Hz, 1H), 8.62 (d, J = 4.4 Hz, 1H), 7.91-8.01 (m, 2H), 7.47 (dd, J = 7.8, 4.7 Hz, 1H), 7.05 (dd, J = 8.0, 4.5 Hz, 1H), 6.33 (s, 1H), 5.03 (d, J = 5.7 Hz, 2H), 3.96-4.29 (m, 2H), 3.73 (m, 2H), 2.91 (s, 3H), 2.32-2.68 (m, 2H). LCMS (ES) C.sub.19H.sub.20N.sub.6F.sub.3O.sub.2S [M + H].sup.+ 453.1. 264 N-((2-(trifluoromethyl)pyridin-3-yl)methyl)-2-(2- (trifluoromethyl)pyrrolidin-1-yl)pyrido[2,3-d]pyrimidin-4- amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.83 (dd, J = 1.8, 4.4 Hz, 1H), 8.63 (d, J = 4.3 Hz, 1H), 8.04 (dd, J = 1.7, 8.1 Hz, 1H), 7.93 (d, J = 7.6 Hz, 1H), 7.46 (dd, J = 4.7, 7.9 Hz, 1H), 7.09 (dd, J = 4.5, 7.9 Hz, 1H), 6.48 (t, J = 5.7 Hz, 1H), 5.20-4.77 (m, 3H), 4.06- 3.64 (m, 2.H), 2.24-2.13 (m, 2H), 2.08-1.97 (m, 2H) I.CMS (ES) C.sub.19H.sub.17N.sub.6F.sub.6 [M + H].sup.+ 443.1. 265 2-(3-chloropyrrolidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.96 (t, J = 5.1 Hz, 1H), 8.69 (dd, J = 1.8, 4.5 Hz, 1H), 8.61 (d, J = 4.1 Hz, 1H), 8.50 (dd, J = 1.9, 8.0 Hz, 1H), 7.99 (s, 1H), 7.65 (dd, J = 4.8, 7.4 Hz, 1H), 7.13 (dd, J = 4.5, 8.0 Hz, 1H), 4.90-4.77 (m, 3H), 3.82-3.43 (m, 4H), 2.34-2.33 (m, 1H), 2.11 (s, 1H). LCMS (ES) C.sub.18H.sub.17N.sub.6F.sub.3Cl [M + H].sup.+ 409.0. 266 N-(2-(trifluoromethyl)benzyl)-2-(3- (trifluoromethyl)pyrrolidin-1-yl)pyrido[2,3-d]pyrimidin-4- amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.73-8.82 (m, 1H), 7.86 (dd, J = 8.0, 1.5 Hz, 1H), 7.71 (d, J = 7.7 Hz, 1H), 7.62 (d, J = 7.6 Hz, 1H), 7.51 (t, J = 7.5 Hz, 1H), 7.38-7.45 (m, 1H), 7.00 (dd, J = 7.9, 4.4 Hz, 1H), 6.05 (s, 1H), 5.03 (br d, J = 5.7 Hz, 2H), 3.58- 4.14 (m, 4H), 3.01 (dd, J = 16.6, 7.9 Hz, 1H), 2.10-2.29 (m, 2H). LCMS (ES) C.sub.22H.sub.18N.sub.5F.sub.6 [M + H].sup.+ 442.0. 267 2-(2-oxa-5-azabicyclo[2.2.1]heptan-5-yl)-N-(2- (trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.74 (dd, J = 4.0, 1.6 Hz, 1H), 7.70-7.88 (m, 1H), 7.68 (d, J = 7.6 Hz, 1H), 7.48-7.62 (m, 2H), 7.37 (t, J = 5.2 Hz, 1H), 6.97-6.98 (m, 1H), 6.08-6.18 (m, 1H), 5.30 (s, 0.5H), 4.92-5.08 (m, 2.5H), 4.66 (s, 1H), 3.85- 3.99 (m, 1H), 3.52-3.77 (m, 3H), 1.90-1.93 (d, J = 11.2 Hz, 2H). LCMS (ES) C.sub.20H.sub.19N.sub.5F.sub.3O [M + H].sup.+ 401.9. 268 2-((6S)-2,6-dimethylmorpholino)-N-(2- (trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.76 (dd, J = 4.5, 1.8 Hz, 1H), 7.88 (dd, J = 8.1, 1.7 Hz, 1H), 7.71 (d, J = 7.8 Hz, 1H), 7.46- 7.60 (m, 2H), 7.37-7.45 (m, 1H), 7.00 (dd, J = 7.9, 4.5 Hz, 1H), 6.11 (t, J = 5.6 Hz, 1H), 4.22-5.18 (m, 4H), 3.96-4.08 (m, 1H), 3.27-3.86 (m, 2H), 2.58 (t, J = 11.9 Hz, 2H), 1.08-1.24 (m, 6H). LCMS (ES) C.sub.21H.sub.23N.sub.5F.sub.3O [M + H].sup.+ 418.1. 269 2-(3-isopropylmorpholino)-N-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.68 (dd, J = 4.0, 2.0 Hz, 1H), 8.59 (d, J = 4.0 Hz, 1H), 8.46 (dd, J = 8.0, 2.0 Hz, 1H), 7.93 (d, J = 8.0 Hz, 1H), 7.62 (dd, J = 8.0, 4.0 Hz, 1H), 7.08 (dd, J = 8.0, 4.0 Hz, 1H), 4.97 (d, J = 16.0 Hz, 1H), 4.82 (d, J = 16.0 Hz, 1H), 4.52 (d, J = 16.0 Hz, 1H), 4.15 (d, J = 12.0 Hz, 1H), 3.84 (d, J = 12.0 Hz, 1H), 3.76 (dd, J = 12.0, 8.0 Hz, 1H), 3.25-3.31 (m, 2H), 2.98- 2.99 (m, 3H), 2.21-2.27 (m, 1H), 0.81-0.83 (d, J = 8.0 Hz, 3H), 0.51-0.53 (d, J = 8.0 Hz, 3H). LCMS (ES) C.sub.21H.sub.24N.sub.6F.sub.3O [M + H].sup.+ 433.1. 270 2-((2R,3R)-2,3-dimethylmorpholino)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.03 (t, J = 4.0 Hz, 1H), 8.68 (d, J = 4.0 Hz, 1H), 8.59 (d, J = 4.0 Hz, 1H), 8.49-8.51 (m, 1H), 7.93 (d, J = 8.0 Hz, 1H), 7.63 (dd, J = 8.0, 4.0 Hz, 1H), 7.12 (dd, J = 8.0, 4.0 Hz, 1H), 4.84 (d, J = 3.55 Hz, 2H), 4.24-4.29 (m, 2H), 3.56-3.62 (m, 1H), 3.50-3.53 (m, 1H), 3.00-3.09 (m, 2H), 0.98 (d, J = 4.0 Hz, 3H), 0.91 (d, J = 4.0 Hz, 3H). LCMS (ES) C.sub.20H.sub.22N.sub.6F.sub.3O [M + H].sup.+ 419.0. 271 2-((2S,5R)-2,5-dimethylmorpholino)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine 0embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.77 (dd, J = 4.0, 2.0 Hz, 1H), 8.60 (d, J = 4.0 Hz, 1H), 7.93 (dd, J = 8.0, 2.0 Hz, 1H), 7.89 (d, J = 8.0 Hz, 1H), 7.43 (dd, J = 8.0, 4.0 Hz, 1H), 7.02 (dd, J = 8.0, 4.0 Hz, 1H), 6.27 (t, J = 4.0 Hz, 1H), 5.11 (dd, J = 16.0, 8.0 Hz, 1H), 4.91-4.95 (m, 1H), 4.74 (d, J = 4.0 Hz, 1H), 4.23 (dd, J = 12.0, 2.0 Hz, 1H), 4.07-4.10 (m, 1H), 3.97 (dd, J = 12.0, 4.0 Hz, 1H), 3.48 (dd, J = 12.0, 4.0 Hz, 1H), 3.41 (dd, J = 12.0, 2.0 Hz, 1H), 1.15 (dd, J = 8.0, 4.0 Hz, 6H). LCMS (ES) C.sub.20H.sub.22N.sub.6F.sub.3O [M + H].sup.+ 419.0. 272 2-(6-oxa-9-azaspiro[4.5]decan-9-yl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.00 (s, 1H), 8.68 (d, J = 4.0 Hz, 1H), 8.60 (d, J = 4.0 Hz, 1H), 8.49 (d, J = 4.0 Hz, 1H), 7.92 (d, J = 8.0 Hz, 1H), 7.63 (dd, J = 8.0, 4.0 Hz, 1H), 7.13 (dd, J = 8.0, 4.0 Hz, 1H), 4.85 (d, J = 4.0 Hz, 2H), 3.51-3.66 (m, 6H), 1.15-1.50 (m, 8H). LCMS (ES) C.sub.22H.sub.24N.sub.6F.sub.3O [M + H].sup.+ 445.1. 273 2-(4-(trifluoromethoxy)piperidin-1-yl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.77 (dd, J = 4.5, 1.8 Hz, 1H), 8.63 (d, J = 3.9 Hz, 1H), 8.02 (dd, J = 8.0, 1.8 Hz, 1H), 7.93 (d, J = 7.8 Hz, 1H), 7.46 (dd, J = 7.9, 4.7 Hz, 1H), 7.03 (dd, J = 8.0, 4.5 Hz, 1H), 6.57 (t, J = 5.8 Hz, 1H), 5.04 (d, J = 5.6 Hz, 2H), 4.47 (tt, J = 7.7, 3.8 Hz, 1H), 4.35-4.04 (m, 2H), 3.79- 3.48 (m, 2H), 1.99-1.77 (m, 2H), 1.80-1.58 (m, 2H). LCMS (ES) C.sub.20H.sub.19N.sub.6F.sub.6O [M + H].sup.+ 473.1. 273_S 2-(4-(trifluoromethoxy)piperidin-1-yl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine methanesulfonate embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.95 (s, 1H), 8.94 (d, J = 7.2 Hz, 1H), 8.78 (d, J = 4.3 Hz, 1H), 8.67 (d, J = 4.3 Hz, 1H), 8.07 (d, J = 7.9 Hz, 1H), 7.70 (dd, J = 8.0, 4.6 Hz, 1H), 7.54 (dd, J = 7.9, 5.5 Hz, 1H), 4.95 (d, J = 4.5 Hz, 2H), 4.72 (dd, J = 8.3, 4.0 Hz, 1H), 4.28-3.88 (m, 2H), 3.74-3.44 (m, 2H), 2.31 (s, 3H), 2.12-1.32 (m,4H). LCMS (ES) C.sub.20H.sub.19N.sub.6F.sub.6O [M + H].sup.+ 473.1. 274 2-(3-(difluoromethyl)azetidin-1-yl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.74-8.86 (m, 1H), 8.62 (br d, J = 4.6 Hz, 1H), 7.99 (t, J = 7.3 Hz, 2H), 7.46 (dd, J = 7.8, 4.7 Hz, 1H), 7.05 (dd, J = 8.0, 4.5 Hz, 1H), 6.40-6.55 (m, 1H), 5.79-6.19 (m, 1H), 5.02 (d, J = 5.8 Hz, 2H), 4.04-4.28 (m, 4H), 2.92-3.16 (m, 1H). LCMS (ES) C.sub.18H.sub.16N.sub.6F.sub.5 [M + H].sup.+ 411.1. 275 2-((3R)-3,5-dimethylmorpholino)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.99-9.02 (m, 1H), 8.67-8.71 (m, 1H), 8.59 (d, J = 4.0 Hz, 1 H), 8.49-8.54 (m, 1H), 7.92 (d, J = 8.0 Hz, 1H), 7.63 (dd, J = 8.0, 4.0 Hz, 1H), 7.11-7.18 (m, 1H), 4.97-5.02 (m, 1H), 4.74-4.78 (m, 1H), 4.45-4.47 (m, 0.47H), 4.12-4.15 (m, 1.6H), 3.99 (dd, J = 12.0, 4.0 Hz, 2H), 3.76-3.78 (m, 0.33H), 3.44-3.56 (m, 1.6H), 3.00-3.05 (m, 1.6H), 1.08 (d, J = 4.0 Hz, 4.3H), 0.94 (t, J = 4.0 Hz, 1.6H). LCMS (ES) C.sub.20H.sub.22N.sub.6F.sub.3O [M + H].sup.+ 419.1. 276 2-(3-(difluoromethyl)azetidin-1-yl)-N-(2- (trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.77 (dd, J = 4.4, 1.6 Hz, 1H), 7.89 (dd, J = 8.0, 1.8 Hz, 1H), 7.70 (d, J = 7.8 Hz, 1H), 7.63 (d, J = 7.8 Hz, 1H), 7.52 (t, J = 7.4 Hz, 1H), 7.36-7.46 (m, 1H), 7.02 (dd, J = 8.0, 4.5 Hz, 1H), 5.86-6.22 (m, 2H), 5.01 (d, J = 5.8 Hz, 2H), 4.11-4.35 (m, 4H), 3.00-3.15 (m, 1H). LCMS (ES) C.sub.19H.sub.17N.sub.5F.sub.5 [M + H].sup.+ 410.1. 277 2-((3R)-3,5-dimethylmorpholino)-N-(2- (trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.95 (s, 1H), 8.67-8.71 (m, 1H), 8.53-8.55 (m, 1H), 7.74 (d, J = 8.0 Hz, 1H), 7.58 (t, J = 8.0 Hz, 1H), 7.42-7.49 (m, 2H), 7.11-7.17 (m, 1H), 5.00 (t, J = 16.0 Hz 1H), 4.75 (d, J = 16.0 Hz, 1H), 4.51 (m, 0.32H), 4.17- 4.18 (m, 1.7H), 3.98-4.04 (m, 2H), 3.78 (dd, J = 12.0, 4.0 Hz, 0.25H), 3.55 (dd, J = 12.0, 2.0 Hz, 1.57H), 3.02 (d, J = 16.0 Hz, 1H), 1.07 (d, J = 4.0 Hz, 4.8H), 0.95 (dd, J = 16.0, 4.0 Hz, 1.6H). LCMS (ES) C.sub.21H.sub.23N.sub.5F.sub.3O [M + H].sup.+ 418.1. 278 2-(2-cyclopropylmorpholino)-N-((2-(trifluoromethyl)pyridin- 3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.77 (dd, J = 4.0, 2.0 Hz, 1H), 8.61 (d, J = 4.0 Hz, 1H), 7.96 (d, J = 8.0, 4.0 Hz, 1H), 7.90 (d, J = 8.0 Hz, 1H), 7.45 (dd, J = 8.0, 4.0 Hz, 1H), 7.02 (dd, J = 8.0, 4.0 Hz, 1H), 6.35 (br s, 1H), 5.00-5.09 (m, 2H), 4.58 (br s, 2H), 3.94 (dd, J = 12.0, 2.4 Hz, 1H), 3.47 (t, J = 12.0 Hz, 1H), 2.81- 3.01 (m, 2H), 2.65 (br s, 1H), 0.85-0.88 (m, 1H), 0.47-0.60 (m, 2H), 0.35-0.39 (m, 1H), 0.19 (br s, 1H). LCMS (ES) C.sub.21H.sub.22N.sub.6F.sub.3O [M + H].sup.+ 430.9. 279 2-((2S,5S)-2,5-dimethylmorpholino)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.74 (dd, J = 4.0, 2.0 Hz, 1H), 8.58 (d, J = 4.0 Hz, 1H), 8.02 (d, J = 8.0 Hz, 1H), 7.89 (d, J = 8.0 Hz, 1H), 7.42 (d, J = 4.0 Hz, 1H), 7.01 (dd, J = 8.0, 4.0 Hz, 1H), 6.60-6.66 (m, 1H), 4.89-5.12 (m, 2.6H), 4.65 (d, 0.6H), 4.49 (d, 0.6H), 4.21 (d, 0.3H), 3.63-3.71 (m, 2H), 3.35-3.36 (m, 1H), 2.70-2.81 (m, 1H), 1.10-1.29 (m, 4H), 0.97 (d, J = 8.0 Hz, 2H). LCMS (ES) C.sub.20H.sub.22N.sub.6F.sub.3O [M + H].sup.+ 419.0. 280 (R)-2-(3-(difluoromethoxy)pyrrolidin-1-yl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine 0embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.77 (dd, J = 4.5, 1.8 Hz, 1H), 8.62 (d, J = 3.9 Hz, 1H), 8.00 (dd, J = 7.9, 2.0 Hz, 2H), 7.46 (dd, J = 7.8, 4.7 Hz, 1H), 7.02 (dd, J = 8.0, 4.5 Hz, 1H), 6.49 (s, 1H), 6.06-6.44 (m, 1H), 5.06 (s, 2H), 4.91 (s, 1H), 3.56-4.00 (m, 4H), 2.20 (m, 2H). LCMS (ES) C.sub.19H.sub.18N.sub.6F.sub.5O [M + H].sup.+ 441.1 281 (S)-2-(3-(difluoromethoxy)pyrrolidin-1-yl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.93 (t, J = 4.0 Hz, 1H), 8.68 (dd, J = 4.0, 2.0 Hz, 1H), 8.59 (d, J = 4.0 Hz, 1H), 8.49 (dd, J = 8.0, 2.0 Hz, 1H), 7.98 (d, J = 8.0 Hz, 1H), 7.62-7.65 (m, 1H), 7.12 (dd, J = 8.0, 4.0 Hz, 1H), 6.51-6.94 (m, 1H), 4.82-4.90 (m, 3H), 3.39-3.70 (m, 3H), 3.20-3.29 (m, 1H), 1.99-2.16 (m, 2H). LCMS (ES) C.sub.19H.sub.18N.sub.6F.sub.5O [M + H].sup.+ 441.1. 282 2-(2-(difluoromethyl)morpholino)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.81 (dd, J = 1.9, 4.5 Hz, 1H), 8.64 (d, J = 3.9 Hz, 1H), 8.04 (dd, J = 1.8, 8.0 Hz, 1H), 7.94 (d, J = 7.9 Hz, 1H), 7.47 (dd, J = 4.8, 7.9 Hz, 1H), 7.08 (dd, J = 4.5, 8.0 Hz, 1H), 6.59 (t, J = 5.3 Hz, 1H), 5.89-5.61 (m, 1H), 5.13- 4.53 (m, 4H), 4.00 (dd, J = 2.1, 11.6 Hz, 1H), 3.74-3.51 (m, 2H), 3.12 (t, J = 11.5 Hz, 1H), 3.02 (dd, J = 10.7, 13.4 Hz, 1H). LCMS (ES) C.sub.19H.sub.18N.sub.6F.sub.5O [M + H].sup.+ 441.1. 283 4-(4-((2-(trifluoromethyl)benzyl)amino)pyrido[2,3- d]pyrimidin-2-yl)morpholine-2-carbonitrile embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.81 (dd, J = 4.5, 1.8 Hz, 1H), 7.98 (dd, J = 8.0, 1.7 Hz, 1H), 7.73 (d, J = 7.8 Hz, 1H), 7.51- 7.61 (m, 2H), 7.39-7.47 (m, 1H), 7.09 (dd, J = 7.9, 4.0 Hz, 1H), 6.38 (t, J = 5.4 Hz, 1H), 4.95-5.09 (m, 2H), 4.61 (t, J = 3.7 Hz, 1H), 4.53 (dd, J = 13.8, 3.9 Hz, 1H), 4.37 (br s, 1H),3.93-3.99 (m, 1H), 3.75-3.93 (m, 2H), 3.56-3.63 (m, 1H). LCMS (ES) C.sub.20H.sub.18N.sub.6F.sub.3O [M + H].sup.+ 415.1. 284 2-(2-(difluoromethyl)morpholino)-N-(2- (trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.80 (dd, J = 1.7, 4.5 Hz, 1H), 7.96 (dd, J = 1.7, 8.1 Hz, 1H), 7.72 (d, J = 7.8 Hz, 1H), 7.61- 7.56 (m, 1H), 7.55-7.48 (m, 1H), 7.46-7.38 (m, 1H), 7.06 (dd, J = 4.5, 8.0 Hz, 1H), 6.31 (t, J = 5.5 Hz, 1H), 5.92-5.61 (m, 1H), 5.07-4.96 (m, 2H), 4.96-4.59 (m, 2H), 4.02 (dd, J = 2.1, 11.4 Hz, 1H), 3.75-3.57 (m, 2H), 3.20-3.10 (m, 1H), 3.09-2.99 (m, 1H), 3.04 (dd, J = 10.7, 13.3 Hz, 1H). LCMS (ES) C.sub.20H.sub.19N.sub.5F.sub.5O [M + H].sup.+ 440.1. 285 2-(8-oxa-5-azaspiro[3.5]nonan-5-yl)-N-(2- (trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.83 (t, J = 5.6 Hz, 1H), 8.70 (d, J = 4.0 Hz, 1H), 8.50 (d, J = 8.0 Hz, 1H), 7.73 (d, J = 8.0 Hz, 1H), 7.61 (t, J = 8.0 Hz, 1H), 7.45 (dd, J = 16.0, 8.0 Hz 2H), 7.16 (dd, J = 8.0, 4.0Hz, 1H), 4.84 (d, J = 4.0Hz, 2H), 3.67 (s, 2H), 3.50 (s, 2H), 3.26-3.29 (m 2H), 2.26-2.32 (m, 2H), 2.08 (d, J = 4.0 Hz, 2H), 1.53-1.58 (m, 2H). LCMS (ES) C.sub.22H.sub.23N.sub.5F.sub.3O [M + H].sup.+ 430.0. 286 2-(9-oxa-6-azaspiro[4.5]decan-6-yl)-N-(2- (trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.82 (s, 1H), 8.73 (d, J = 2.4 Hz, 1H), 8.53 (d, J = 8.0 Hz, 1H), 7.74 (d, J = 8.0 Hz, 1H), 7.60 (t, J = 8.0 Hz, 1H), 7.48 (m, 2H), 7.18 (dd, J = 8.0, 4.0 Hz, 1H), 4.88 (d, J = 4.0 Hz, 2H), 3.66 (s, 4H), 3.32 (s, 2H), 2.27- 2.28 (m, 2H), 1.97 (s, 2H), 1.42-1.47 (m, 4H). LCMS (ES) C.sub.23H.sub.25N.sub.5F.sub.3O [M + H].sup.+ 444.1. 287 2-((2R,3S)-2,3-dimethylmorpholino)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 9.10 (s, 1H), 8.51-8.70 (m, 3H), 7.91 (s, 1H), 7.62 ( s, 1H), 7.14 (s, 1H), 4.72-4.92 (m, 2H), 3.48-4.30 (m, 4H), 3.13-3.16 (m, 1H), 2.89-3.06 (m, 1H), 0.84-1.14 (m, 4H), 0.50 (br s, 2H) LCMS (ES) C.sub.20H.sub.22N.sub.6F.sub.3O [M + H].sup.+ 419.0. 288 (3R)-3-methyl-4-(4-(2-(2-(trifluoromethyl)pyridin-3- yl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.78-8.67 (m, 1H), 8.56 (t, J = 3.3 Hz, 1H), 7.90-8.10 (m, 2H), 7.43 (m, 1H), 6.92 (m, 1H), 5.98 t, J = 8.1 Hz, 1H), 3.82-5.01 (m, 4H), 3.74-3.76 (m, 1H), 3.16-3.51 (m, 3H), 3.06 (m, 1H), 2.90 (d, J = 7.5 Hz, 1H), 2.29- 2.43 (m, 1H), 1.13 (m, 3H). LCMS (ES) C.sub.23H.sub.22N.sub.6F.sub.3O [M + H].sup.+ 431.1. 289 (3S)-3-methyl-4-(4-(2-(2-(trifluoromethyl)pyridin-3- yl)azetidin-1-yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.64-8.70 (m, 2H), 8.24 (t, J = 8.0 Hz, 2H), 7.69-7.73 (m, 1 H), 7.11 (s, 1H), 5.90 (s, 1H), 4.87 (s, 1H), 4.62-4.69 (m, 1H), 4.08 (s, 2H), 3.73 (d, J = 12.0 Hz, 1H), 3.39-3.51 (m, 2H), 3.21-3.24 (m, 1H), 2.84- 2.97 (m, 2H), 2.33 (m, 1H), 1.06 (d, J = 6.4 Hz, 1.7H), 0.56 (br s, 1.3H). LCMS (ES) C.sub.21H.sub.22N.sub.6F.sub.3O [M + H].sup.+ 431.1. 290 (3R)-3-methyl-4-(4-(2-(2-(trifluoromethyl)phenyl)azetidin-1- yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine 0embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.73-8.81 (m, 1H), 8.01 (t, J = 9.0 Hz, 1H), 7.68-7.81 (m, 2H), 7.55 (q, J = 7.7 Hz, 1H), 7.37- 7.44? (m, 1H), 6.91-7.00 (m, 1H), 6.07 (t, J = 7.8 Hz, 1H), 4.23- 4.80 (m, 4H), 3.85 (d, J = 8.3 Hz, 1H), 3.33-3.64 (m, 3H), 3.16 (m, 1H), 2.96 (d, J = 4.4 Hz, 1H), 2.33-2.46 (m, 1H), 1.23 (d, J = 6.8 Hz, 3H). LCMS (ES) C.sub.22H.sub.23N.sub.5F.sub.3O [M + H].sup.+ 430.2. 291 (3S)-3-methyl-4-(4-(2-(2-(trifluoromethyl)phenyl)azetidin-1- yl)pyrido[2,3-d]pyrimidin-2-yl)morpholine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.75 (s, 1H), 8.00 (t, J = 9.7 Hz, 1H), 7.67-7.79 (m, 2H), 7.54 (q, J = 7.6 Hz, 1H), 7.36-7.44 (m, 1H), 6.90-6.99 (m, 1H), 6.06 (t, J = 7.9 Hz, 1H), 4.12-4.86 (m, 4H), 3.84 (d, J = 8.2 Hz, 1H), 3.27-3.65 (m, 3H), 3.14-3.58 (m, 1H), 2.94 (d, J = 4.9 Hz, 1H), 2.31-2.44 (m, 1H), 1.22 (d, J = 6.8 Hz, 3H). LCMS (ES) C.sub.22H.sub.23N.sub.5F.sub.3O [M + H].sup.+ 430.1. 292 2-(3-(difluoromethoxy)piperidin-1-yl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.77 (dd, J = 1.8, 4.5 Hz, 1H), 8.62 (d, J = 3.8 Hz, 1H), 8.01-7.93 (m, 2H), 7.46 (dd, J = 4.6, 7.9 Hz, 1H), 7.02 (dd, J = 4.5, 7.9 Hz, 1H), 6.60-5.97 (m, 2H), 5.05 (d, J = 5.6 Hz, 2H), 4.57-4.11 (m, 3H), 3.59-3.35 (m, 2H), 2.10-1.97 (m, 1H), 1.85-1.73 (m, 2H), 1.54 (br s, 1H). LCMS (ES) C.sub.20H.sub.19N.sub.6F.sub.5O [M + H].sup.+ 455.1. 293 2-(6-oxa-3-azabicyclo[3.1.1]heptan-3-yl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.77 (dd, J = 4.0, 2.0 Hz, 1H), 8.59 (d, J = 2.0 Hz, 1H), 8.03 (dd, J = 8.0, 2.0 Hz, 1H), 7.96 (d, J = 8.0 Hz, 1H), 7.43 (dd, J = 8.0, 4.0 Hz, 1H), 7.03 (dd, J = 8.0, 4.0 Hz, 1H), 6.56 (t, J = 6.0 Hz, 1H), 4.97-5.16 (m, 2H), 4.66 (dd, J = 12.0, 4.0 Hz, 2H), 4.11 (d, J = 12.0 Hz, 1H), 3.90 (d, J = 12.0 Hz, 1H), 3.82 (d, J = 12.0 Hz, 1H), 3.67 (d, J = 12.0 Hz, 1H), 3.23 (q, J = 8.0 Hz, 1H), 1.87 (d, J = 8.0 Hz, 1H). LCMS (ES) C.sub.19H.sub.18N.sub.6F.sub.3O [M + H].sup.+ 403.0. 294 2-(2-oxa-5-azabicyclo[4.1.0]heptan-5-yl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.78 (d, J = 3.1 Hz, 1H), 8.60 (d, J = 3.5 Hz, 1H), 7.87-8.14 (m, 2H), 7.39-7.49 (m, 1H), 7.04 (dd, J = 7.3, 4.3 Hz, 1H), 6.61 (s, 1H), 4.95-5.22 (m, 2H), 2.88- 3.80 (m, 6H), 0.36-1.09 (m, 2H). LCMS (ES) C.sub.19H.sub.18N.sub.6F.sub.3O [M + H].sup.+ 403.1. 295 2-(2,2,6,6-tetrafluoromorpholino)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.89 (dd, J = 4.5, 1.8 Hz, 1H), 8.66 (d, J = 4.4 Hz, 1H), 7.99 (dd, J = 8.2, 1.8 Hz, 1H), 7.92 (d, J = 7.8 Hz, 1H), 7.48 (dd, J = 7.8, 4.6 Hz, 1H), 7.19 (dd, J = 8.1, 4.5 Hz, 1H), 6.33 (t, J = 5.7 Hz, 1H), 5.07 (d, J = 5.7 Hz, 2H), 4.39 (br s, 4H). LCMS (ES) C.sub.18H.sub.14N.sub.6F.sub.7O [M + H].sup.+ 463.1. 296 2-(4-azaspiro[2.5]octan-4-yl)-N-((2-(trifluoromethyl)pyridin- 3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.79 (dd, J = 4.4, 1.7 Hz, 1H), 8.61 (d, J = 4.3 Hz, 1H), 7.96 (d, J = 7.8 Hz, 2H), 7.44 (dd, J = 7.9, 4.6 Hz, 1H), 7.00-7.11 (m, 1H), 6.23 (br s, 1H), 5.09 (s, 2H), 3.59-4.20 (m, 2H), 1.70-1.75 (m, 2H), 1.31-1.53 (m, 4H), 0.48-0.97 (m, 4H). LCMS (ES) C.sub.21H.sub.22N.sub.6F.sub.3 [M + H].sup.+ 415.1. 297 2-(3-(trifluoromethoxy)pyrrolidin-1-yl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.78 (dd, J = 4.5, 1.8 Hz, 1H), 8.62 (d, J = 4.0 Hz, 1H), 7.91-8.02 (m, 2H), 7.46 (dd, J = 7.5, 4.8 Hz, 1H), 7.03 (dd, J = 8.0, 4.5 Hz, 1H), 6.30 (t, J = 5.5 Hz, 1H), 4.86-5.11 (m, 3H), 3.50-4.16 (m, 4H), 2.11-2.37 (m, 2H). LCMS (ES) C.sub.19H.sub.17N.sub.6F.sub.6O [M + H].sup.+ 459.1. 298 2-(5-azaspiro[3.4]octan-5-yl)-N-((2-(trifluororoethyl)pyridin- 3-yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.70 (dd, J = 4.4, 2.0 Hz, 1H), 8.62 (d, J = 3.9 Hz, 1H), 8.51 (t, J = 5.3 Hz, 1H), 8.46 (dd, J = 8.0,1.9 Hz, 1H), 7.95 (d, J = 7.4 Hz, 1H), 7.64 (dd, J = 8.0, 4.6 Hz, 1H), 7.09 (dd, J = 8.0, 4.5 Hz, 1H), 5.02 (d, J = 5.0 Hz, 2H), 3.53 (t, J = 6.6 Hz, 2H), 3.27 (d, J = 8.9 Hz, 2H), 2.10-2.14 (m, 2H), 1.47-1.73 (m, 6H). LCMS (ES) C.sub.21H.sub.22N.sub.6F.sub.3O [M + H].sup.+ 415.1. 299 2-(2-((trifluoromethoxy)methyl)pyrrolidin-1-yl)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.79 (dd, J = 4.5, 1.8 Hz, 1H), 8.63 (d, J = 4.0 Hz, 1H), 7.92 (t, J = 6.9 Hz, 2H), 7.45 (dd, J = 7.9, 4.6 Hz, 1H), 7.04 (dd, J = 8.0, 4.5 Hz, 1H), 6.19 (s, 1H), 4.99-5.15 (m, 2H), 4.12-4.55 (m, 3H), 3.46-3.79 (m, 2H), 2.06 (d, J = 4.0 Hz, 1H), 1.76-1.93 (m, 2H), 1.50-1.57 (m, 1H). LCMS (ES) C.sub.20H.sub.19N.sub.6F.sub.6O [M + H].sup.+ 473.1. 300 2-(6-oxa-3-azabicyelo[3.1.1]heptan-3-yl)-N-(2- (trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine 0embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.79 (d, J = 3.2 Hz, 1H), 7.96 (d, J = 7.8 Hz, 1H), 7.71 (d, J = 7.7 Hz, 1H), 7.63 (d, J = 7.6 Hz, 1H), 7.51 (t, J = 7.5 Hz, 1H), 7.41 (t, J = 7.6 Hz, 1H), 7.02 (dd, J = 7.8, 4.4 Hz, 1H), 6.26 (b, 1H), 5.07 (dt, J = 15.7, 10.4 Hz, 2H), 4.72 (b, 2H), 4.20 (d, J = 13.6 Hz, 1H), 3.97 (t, J = 13.2 Hz, 2H), 3.81 (d, J = 13.2 Hz, 1H), 3.25 (dd, J = 14.4, 6.8 Hz, 1H), 1.94 (d, J = 8.7 Hz, 1H). LCMS (ES) C.sub.20H.sub.19N.sub.5F.sub.3O [M + H].sup.+ 402.1. 301 2-(2-oxa-5-azabicyclo[4.1.0]heptan-5-yl)-N-(2- (trifluoromethyl)benzyl)pyrido[2,3-d)pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.79 (d, J = 2.9 Hz, 1H), 7.87-7.96 (m, 1H), 7.56-7.74 (m, 2H), 7.50 (t, J = 7.5 Hz, 1H), 7.36-7.44 (m, 1H), 7.03 (dd, J = 7.9, 4.4 Hz, 1H), 6.12 (s, 1H), 4.98-5.25 (m, 2H), 3.52-3.89 (m, 5H), 3.01-3.38 (m, 1H), 0.50- 1.17 (m, 2H), LCMS (ES) C.sub.20H.sub.19N.sub.5F.sub.3O [M + H].sup.+ 402.1. 302 2-((3R)-3,5-dimethylmorpholino)-N-(2- (trifluoromethyl)benzyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.98-9.03 (m, 1H), 8.67-8.68 (m, 1H), 8.49-8.56 (m, 1.4H), 7.73 (d, J = 8.0 Hz, 1H), 7.58 (t, J = 8.0 Hz, 1H), 7.42-7.49 (m, 2H), 7.11-7.17 (m, 1H), 4.86 (s 2H), 4.41 (s, 1.4H), 4.17-4.18 (m, 0.4H), 3.98-4.04 (m, 0.4H), 3.53-3.66 (m, 1.3H), 3.43-3.62 (m, 2.OH), 3.01 (s, 0.5H), 0.93-1.23 (m, 6.0H). LCMS (ES) C.sub.21H.sub.23N.sub.5F.sub.3O [M + H].sup.+ 418.1. 303 6-fluoro-2-(3-methylmorpholino)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.97 (s, 1H), 8.75-8.74 (d, J = 2.8 Hz, 1H), 8.61-8.60 (d, J = 4.4 Hz, 2H), 8.45-8.42 (dd, J = 8.8, 3.2 Hz 1H), 7.98-7.96 (d, J = 7.6 Hz, 1H), 7.66-7.63 (dd, J = 8.0, 4.4 Hz 1H), 4.95-4.91 (d, J = 16.4 Hz, 1H), 4.82-4.78 (d, J = 16.4 Hz, 1H), 4.43 (br s, 1H), 4.20-4.17 (d, J = 13.2 Hz, 1H), 3.83-3.80 (d, J = 11.2 Hz, 1H), 3.59-3.56 (d, J = 11.2 Hz, 1H), 3.29-3.26 (m, 1H), 2.99-2.95 (m, 1H), 0.87 (s, 3H). LCMS (ES) C.sub.19H.sub.19N.sub.6F.sub.4O [M + H].sup.+ 423.0. 304 6-methoxy-2-(3-methylmorpholino)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-dipyrimidin- 4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.63 (d, J = 3.1 Hz, 2H), 7.93 (d, J = 7.9 Hz, 1H), 7.46 (d, J = 7.9 Hz, 1H), 7.31 (d, J = 3.1 Hz, 1H), 6.21-6.18 (m, 1H), 5.14-4.96 (m, 2H), 4.70 (s, 1H), 4.43 (d, J = 13.1 Hz, 1H), 4.56-4.41 (m, 1H), 3.95-3.90 (m, 4H), 3.73- 3.70 (m, 1H), 3.52-3.45 (m, 1H), 3.27-3.20 (m, 1H), 1.13 (d, J = 6.7 Hz, 3H). LCMS (ES) C.sub.20H.sub.22N.sub.6F.sub.3O [M + H].sup.+ 435.2. 305 7-methoxy-2-(3-methylmorpholino)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.61 (d, J = 4.3 Hz, 1H), 7.90 (d, J = 8.0 Hz, 1H), 7.76 (d, J = 8.8 Hz, 1H), 7.44 (dd, J = 7.9, 4.6 Hz, 1H), 6.53 (d, J = 8.7 Hz, 1H), 5.89 (t, J = 5.6 Hz, 1H), 5.03- 5.12 (m, 1H), 4.87-4.97 (m, 1H), 4.69 (s, 1H), 4.49 (d, J = 13.1 Hz, 1H), 4.08 (s, 3H), 3.92 (dd, J = 11.1, 3.3 Hz, 1H), 3.58-3.74 (m, 2H), 3.47 (m, 1H), 3.25 (m, 1H), 1.10 (d, J = 6.5 Hz, 3H). LCMS (ES) C.sub.20H.sub.22N.sub.6F.sub.3O [M + H].sup.+ 435.1. 306 2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrimido[4,5-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 9.05 (s, 1H), 9.00 (s, 1H), 8.64 (d, J = 4.5 Hz, 1H), 7.90 (d, J = 7.9 Hz, 1H), 7.43-7.54 (m, 1H), 6.55-6.89 (m, 1H), 4.29-5.21 (m, 4H), 3.92 (d, J = 10.3 Hz, 1H), 3.65-3.76 (m, 1H), 3.36-3.63 (m, 2H), 3.18-3.32 (m, 1H), 1.01-1.35 (m, 3H). LCMS (ES) C.sub.18H.sub.19N.sub.7F.sub.3O [M + H].sup.+ 406.1. 307 2-(3-methylmorpholino)-N-(2- (trifluoromethyl)benzyl)pyrimido[4,5-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 9.04 (s, 1H), 8.92 (s, 1H), 7.73 (d, J = 7.7 Hz, 1H), 7.49-7.58 (m, 2H), 7.40-7.48 (m, 1H), 6.33-6.57 (m, 1H), 4.42-5.18 (m, 4H), 3.95 (dd, J = 11.2, 3.2 Hz, 1H), 3.59-3.77 (m, 2H), 3.41-3.55 (m, 1H), 3.30 (t, J = 13.1 Hz, 1H), 1.13-1.38 (m, 3H). LCMS (ES) C.sub.19H.sub.20N.sub.6F.sub.3O [M + H].sup.+ 405.2. 5-methoxy-2-(3-methylmorpholino)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.52-8.67 (m, 2H), 7.85- 8.03 (m, 2.H), 7.44 (dd, J = 7.8, 4.7 Hz, 1H), 6.49 (d, J = 5.5 Hz, 1H), 4.89-5.11 (m, 2H), 4.37-4.86 (m, 2H), 4.06 (s, 3H), 3.91 (br dd, J = 11.4, 3.2 Hz, 1H), 3.58-3.72 (m, 2H), 3.46 (m, 1H), 3.15-3.30 (m, 1H), 1.12 (br s, 3H). LCMS (ES) C.sub.20H.sub.22N.sub.6F.sub.3O.sub.2 [M + H].sup.+ 435.1. 308 6,7-dimethoxy-2-(3-methylmorphoIino)-N-((2- (trifluoromethyl)pyridin-3-yl)methyl)pyrido[2,3-d]pyrimidin- 4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.59 (d, J = 4.14 Hz, 1H), 8.55 (t, J = 5.33 Hz, 1H), 7.92 (d, J = 7.91 Hz, 1H), 7.89 (s, 1H), 7.64 (dd, J = 7.97, 4.71 Hz, 1H), 4.88-4.98 (m, 1H), 4.71- 4.82 (m, 1H), 4.38 (s, 1 H), 4.11 (d, J = 12.42 Hz, 1H), 3.93 (s, 3H), 3.84 (s, 3H), 3.78 (dd, J = 11.11, 2.95 Hz, 1H) 3.52-3.58 (m, 1 H), 3.42 (dd, J = 11.36, 2.95 Hz, 1H), 3.27 (m, 1H), 2.94 (m, 1H), 0.82 (d, J = 6.15 Hz, 3H). LCMS (ES) C.sub.21H.sub.24N.sub.6F.sub.3O.sub.3 [M + H].sup.+ 465.2. 309 2-(3-methylmorpholino)-N-((2-(trifluoromethyl)pyridin-3- yl)methyl)pteridin-4-amine 0embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.73 (d, J = 2.0 Hz, 1H), 8.64 (d, J = 4.0 Hz, 1H), 8.23 (d, J = 2.1 Hz, 1H), 7.94 (d, J = 7.8 Hz, 1H), 7.47 (dd, J = 8.0, 4.7 Hz, 1H), 7.36 (s, 1H), 4.93-5.16 (m, 2H), 4.34-4.93 (m, 2H), 3.96 (dd, J = 11.2, 3.3 Hz, 1H), 3.71-3.79 (m, 1H), 3.61-3.69 (m, 1H), 3.50 (, J = 11.9 Hz, 1H), 3.29 (t, J = 13.1 Hz, 1H), 1.24 (d, J = 16.7 Hz, 3H). LCMS (ES) C.sub.18H.sub.19N.sub.7F.sub.3O [M + H].sup.+ 406.1. 310 2-(3-methylmorpholino)-N-(2- (trifluoromethyl)benzyl)pteridin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, CDCl.sub.3) δ (ppm) 8.70 (d, J = 2.1 Hz, 1H), 8.20 (d, J = 2.0 Hz, 1H), 7.71 (d, J = 7.7 Hz, 1H), 7.56-7.61 (m, 1H), 7.52 (t, J = 7.4 Hz, 1H), 7.38-7.44 (m, 1H), 7.29 (s, 1H), 4.83- 5.11 (m, 3H), 4.62 (d, J = 13.6 Hz, 1H), 3.97 (dd, J = 11.3, 3.5 Hz. 1H), 3.73-3.79 (m, 1H), 3.65-3.71 (m, 1H), 3.53 (t, J = 11.8 Hz. 1H), 3.32 (t, J = 13.1 Hz, 1H), 1.26 (s, 3H). LCMS (ES) C.sub.19H.sub.20N.sub.6F.sub.3O [M + H].sup.+ 405.1. 311 2-(3-methylpiperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) δ 8.92 (t, J = 5.3 Hz, 1H), 8.66 (dd, J = 4.4, 1.8 Hz, 1H), 8.60 (d, J = 4.3 Hz, 1H), 8.47 (dd, J = 8.0,1.9 Hz, 1H), 7.93 (d, J = 7.9 Hz, 1H), 7.63 (dd, J = 8.0, 4.6 Hz, 1H), 7.10 (dd, J = 7.9, 4.5 Hz, 1H), 4.86 (s, 2H), 4.46 (br. s, 2H), 2.70 (br. s, 1H), 2.36 (t, J = 11.3 Hz, 1H), 1.67 (d, J = 10.0 Hz, 1H), 1.49 (br. s, 1H), 1.23 (br. s, 2H), 1.12- 0.96 (m, 1H), 0.71 (s, 3H). HRMS (ES) C.sub.20H.sub.22F.sub.3N.sub.6 [M + H].sup.+ 403.1844. 312 2-(4-methylpiperidin-1-yl)-N-((2-(trifluoromethyl)pyridin-3- yl)methyl)pyrido[2,3-d]pyrimidin-4-amine embedded image Synthesised via Route 6 .sup.1H NMR (400 MHz, DMSO-d6) δ (ppm) 8.92 (t, J = 5.4 Hz, 1H), 8.66 (dd, J = 4.4,1.6 Hz, 1H), 8.60 (d, J = 4.4 Hz, 1H), 8.47 (dd, J = 8.0, 1.7 Hz, 1H), 7.95 (d, J = 7.9 Hz, 1H), 7.64 (dd, J = 8.0, 4.6 Hz, 1H), 7.10 (dd, J = 7.9, 4.5 Hz, 1H), 4.86 (d, J = 4.5 Hz, 2H), 4.52 (br. s, 2H), 2.69 (t, J = 12.1 Hz, 2H), 1.70-1.37 (m, 3H), 0.83 (m, 5H). HRMS (ES) C.sub.20H.sub.22F.sub.3N.sub.6 [M + H].sup.+ 403.1853.
Biology
In Vitro Insect Cell Line Assay

(436) A C6/36 Aedes albopictus cell line infected with Wolbachia pipientis (Wolbachia strain wAlbB) derived from Aa23 A. albopictus cell line (O'Neill et al., 1997; Insect Mol Biol; Turner et al., (2006) J. Immunol. 7:1240-1249) was used to screen compounds. Cells were cultured in Leibovitz's L15+L-glutamine supplemented with heat-inactivated Foetal Calf Serum (HI-FCS), non-essential amino acids and tryptose phosphate broth. Culture medium was filter-sterilized through a 0.2 μm filter and stored at 4° C. Compounds were provided as 10 mM stocks in DMSO, diluted to 50 μM working stock to give final concentration of 5 μM on the test plate. Concentrated stocks were frozen at −20° C.

(437) Prior to use in the screening assay, cell cultures were sub-passaged (6 days prior) to provide ˜90% confluent cells on Day 0 of screening assay. On Day 0 (assay set-up), the medium was removed from the stock culture flask and replaced with fresh medium. The cells were detached by scraping and cell density was calculated using an automated cell counter. The cells were then diluted at working density and aliquoted at 90 μl to each well of a Cell Carrier 384 well plate (Perkin Elmer). Cell plates were incubated at 26° C.

(438) Control solution (DMSO-medium) was dispensed at 10 μl per well for “untreated” wells. Test solution (Drug-DMSO) was also dispensed at 10 μl (from working plate) per well for “treated” wells. The plates were incubated at 26° C., inside plastic wallet in incubator, for 7 days.

(439) On Day 7, 25 μl of staining medium/dye (SYTO 11, Life Technologies) was added to each sample well and allowed to stain for 15 minutes in the dark. All the medium was removed from each sample well without disturbing the cells and replaced with 100 μl of fresh medium. Plates were imaged on the Operetta High Content Imaging system (Perkin Elmer) and analyzed using texture analysis through Harmony software (Perkin Elmer). The cell-based screen and analysis are described in detail in Clare et al. (2014) J Biomol Screen.

(440) Anti-Wolbachia activity is catagorised in Table 2 as follows +: 1,000 nM<EC.sub.50≤100,000 nM; ++: 100 nM<EC.sub.50≤1,000 nM; +++: 10 nM<EC.sub.50≤100 nM; ++++: 1 nM<EC.sub.50≤10 nM; +++++: 0.01 nM<EC.sub.50≤1 nM; ++++++: EC.sub.50≤0.01 nM.

(441) TABLE-US-00002 TABLE 2 In vitro anti- Wolbachia Entry Structure activity 1 embedded image + 2 embedded image + 3 embedded image + 4 embedded image ++ 5 embedded image ++++ 6 embedded image + 7 0embedded image ++ 8 embedded image ++ 9 embedded image ++ 10 embedded image + 11 embedded image ++ 12 embedded image + 13 embedded image + 14 embedded image ++ 15 embedded image ++ 16 embedded image + 17 0embedded image +++ 18 embedded image + 19 embedded image + 20 embedded image + 21 embedded image +++ 22 embedded image + 23 embedded image +++ 24 embedded image ++ 25 embedded image ++ 26 embedded image ++ 27 00embedded image + 28 01embedded image +++ 29 02embedded image ++ 30 03embedded image ++ 31 04embedded image + 32 05embedded image + 33 06embedded image ++ 34 07embedded image + 35 08embedded image ++ 36 09embedded image + 37 0embedded image + 38 embedded image + 39 embedded image + 40 embedded image + 41 embedded image +++ 42 embedded image ++ 43 embedded image ++ 44 embedded image +++ 45 embedded image ++ 46 embedded image +++ 47 0embedded image + 48 embedded image ++ 49 embedded image ++++ 50 embedded image +++ 51 embedded image +++ 52 embedded image +++ 53 embedded image ++++ 54 embedded image ++++ 55 embedded image +++ 56 embedded image +++ 57 0embedded image +++ 58 embedded image ++ 59 embedded image ++ 60 embedded image +++ 61 embedded image + 62 embedded image +++ 63 embedded image +++ 64 embedded image ++ 65 embedded image +++ 66 embedded image ++++ 67 0embedded image ++ 68 embedded image +++ 69 embedded image + 70 embedded image + 71 embedded image +++ 72 embedded image +++ 73 embedded image ++ 74 embedded image + 75 embedded image ++ 76 embedded image + 77 0embedded image ++ 78 embedded image + 79 embedded image ++ 80 embedded image +++ 81 embedded image + 82 embedded image + 83 embedded image + 84 embedded image + 85 embedded image ++ 86 embedded image + 87 0embedded image ++ 88 embedded image + 89 embedded image + 90 embedded image + 91 embedded image + 92 embedded image + 93 embedded image ++ 94 embedded image + 95 embedded image + 96 embedded image + 97 0embedded image ++ 98 embedded image + 99 embedded image + 101 embedded image + 102 embedded image + 103 embedded image +++ 104 embedded image ++ 105 embedded image + 106 embedded image + 108 embedded image + 109 0embedded image + 110 embedded image + 111 embedded image + 112 embedded image ++ 113 embedded image + 114 embedded image ++ 115 embedded image + 116 embedded image ++ 117 embedded image ++ 118 embedded image + 119 0embedded image ++ 120 embedded image ++ 121 embedded image + 122 embedded image + 123 embedded image + 124 embedded image + 125 embedded image + 126 embedded image ++ 127 embedded image ++ 128 embedded image ++ 129 00embedded image ++ 130 01embedded image + 131 02embedded image + 132 03embedded image + 133 04embedded image + 134 05embedded image + 135 06embedded image + 136 07embedded image + 137 08embedded image + 138 09embedded image + 139 0embedded image ++ 140 embedded image ++ 141 embedded image ++ 142 embedded image + 143 embedded image +++ 144 embedded image +++ 145 embedded image + 146 embedded image + 147 embedded image + 148 embedded image + 149 0embedded image ++ 150 embedded image +++ 151 embedded image ++ 152 embedded image ++ 153 embedded image +++ 154 embedded image + 155 embedded image + 156 embedded image ++++ 157 embedded image + 158 embedded image ++ 159 0embedded image ++++ 160 embedded image +++ 161 embedded image ++++ 162 embedded image +++++ 163 embedded image +++ 164 embedded image ++++ 165 embedded image +++ 166 embedded image ++ 167 embedded image + 168 embedded image ++++ 169 0embedded image ++ 170 embedded image + 171 embedded image ++ 172 embedded image +++++ 173 embedded image ++++ 174 embedded image +++++ 175 embedded image ++++ 176 embedded image ++ 177 embedded image + 178 embedded image + 179 0embedded image +++ 180 embedded image + 181 embedded image + 182 embedded image + 183 embedded image ++++ 184 embedded image +++++ 185 embedded image + 186 embedded image + 187 embedded image + 188 embedded image + 189 0embedded image + 190 embedded image ++ 191 embedded image ++ 192 embedded image +++ 193 embedded image ++++ 194 embedded image ++++ 195 embedded image ++++ 196 embedded image +++++ 197 embedded image ++++ 198 embedded image ++++ 199 0embedded image ++++ 200 embedded image +++ 201 embedded image +++ 202 embedded image ++++ 203 embedded image ++ 204 embedded image +++ 205 embedded image +++ 206 embedded image ++ 207 embedded image ++ 208 embedded image ++++++ 209 0embedded image +++ 210 embedded image ++++ 211 embedded image +++ 212 embedded image ++ 213 embedded image +++ 214 embedded image +++++ 215 embedded image +++ 216 embedded image ++ 217 embedded image ++++++ 218 embedded image +++++ 219 0embedded image ++++ 220 embedded image +++++ 221 embedded image ++++ 222 embedded image + 223 embedded image ++ 224 embedded image + 225 embedded image + 226 embedded image ++ 227 embedded image ++ 228 embedded image ++ 229 00embedded image + 230 01embedded image + 231 02embedded image ++ 232 03embedded image ++ 233 04embedded image +++ 234 05embedded image ++++ 235 06embedded image +++++ 236 07embedded image ++++++ 237 08embedded image ++ 238 09embedded image +++ 239 0embedded image +++++ 240 embedded image +++++ 241 embedded image +++++ 242 embedded image ++++ 243 embedded image ++ 244 embedded image ++++ 245 embedded image ++++ 246 embedded image ++ 247 embedded image ++++++ 248 embedded image +++++ 249 0embedded image ++++++ 250 embedded image +++++ 251 embedded image ++++ 252 embedded image +++++ 253 embedded image ++++ 254 embedded image +++++ 255 embedded image ++++ 256 embedded image ++++++ 257 embedded image +++ 258 embedded image ++++++ 259 0embedded image +++++ 260 embedded image ++++ 261 embedded image ++++++ 262 embedded image +++++ 263 embedded image ++ 264 embedded image ++++++ 265 embedded image ++++++ 266 embedded image ++++ 267 embedded image ++++++ 268 embedded image +++ 269 0embedded image ++++ 270 embedded image ++++ 271 embedded image +++++ 272 embedded image +++++ 273 embedded image ++++++ 274 embedded image ++++ 275 embedded image +++++ 276 embedded image ++++++ 277 embedded image +++ 278 embedded image +++++ 279 0embedded image +++++ 280 embedded image +++++ 281 embedded image +++++ 282 embedded image +++++ 283 embedded image +++++ 284 embedded image ++++++ 285 embedded image +++ 286 embedded image ++ 287 embedded image +++++ 288 embedded image ++++ 289 0embedded image +++++ 290 embedded image +++++ 291 embedded image +++++ 292 embedded image ++++++ 293 embedded image ++++ 294 embedded image +++++ 295 embedded image +++ 296 embedded image ++++++ 297 embedded image ++++++ 298 embedded image ++++++ 299 0embedded image ++++++ 300 embedded image ++++++ 301 embedded image +++++ 302 embedded image ++++++ 303 embedded image ++ 304 embedded image + 305 embedded image + 306 embedded image + 307 embedded image + 308 embedded image + 309 0embedded image ++ 310 embedded image ++ 311 embedded image +++++ 312 embedded image +++++
In Vitro Microfilariae (Mf) Brugia malayi Screen

(442) An in vitro microfilariae (Mf) assay was used to screen against Wolbachia of the target parasite, Brugia malayi. The Mf were obtained by peritoneal lavage of gerbils (Meriones unguiculatus) harbouring a patent infection of Brugia malayi as described previously (Griffiths et al., 2010, Lab Animal).

(443) Mf were purified using a PD-10 desalting column (Fisher) followed by centrifugation (1200 rpm for 5 minutes at room temperature) then re-suspended in filter-sterilised culture medium consisting of RPMI supplemented with heat-inactivated Foetal Calf Serum (HI-FCS), 1% Penicillin-Streptomycin and 1% Amphotericin B.

(444) After determining the concentration of Mf, the stock solution was diluted in culture medium to ensure a final concentration of 8000 Mf/well of a 96 well plate (100 μl per well). Compounds to be tested (10 mM stock in 100% DMSO) were diluted to appropriate working concentrations in culture medium and 100 μl was added to the appropriate wells of the 96 well plate containing the Mf. Five replicates were used for each compound and each plate contained doxycycline (5 μM) and vehicle (DMSO) controls. The plates were incubated at 37° C., 5% CO.sub.2, for 6 days.

(445) On day 6, a visual assessment of motility was performed and wells scored from 0 to 4 (where 0=no movement and 4=highly motile) in order to assess whether there were any direct effects against the Mf. To perform the anti-Wolbachia readout, DNA was extracted from each individual well using the QIAmp DNA Mini Kit (Qiagen) ‘DNA Purification from Tissues’ protocol.

(446) The number of Wolbachia present in Mf was assessed by quantification of the Wolbachia surface protein (wsp) gene copy number and normalised to the nematode glutathione S-transferase (gst) gene by qPCR based on methods described by McGarry et al., 2004, Mol Biochem Parasitol. DNA samples were amplified in duplicate in the following 20 μl reactions containing 1× QuantiTect SYBR Green PCR master mix (Qiagen): for wsp, 0.3 μM each of forward (CCCTGCAAAGGCACAAGTTATTG) and reverse (CGAGCTCCAGCAAAGAGTTTAATTT) primer, 3 mM MgCl.sub.2 and 2 μl of DNA. For gst, 0.35 μM of forward (GAGACATCTTGCTCGCAAAC) and reverse primer (ATCACGGACGCCTTCACAG), 3.5 mM MgCl.sub.2 and 1 μl of DNA. qPCR was performed using the Bio-Rad CFX384 C1000 thermal cycler (Bio-Rad laboratories LTD) with a denaturation step of 95° C. for 15 min then 40 cycles at 95° C. for 15 s, 57° C. (gst) or 60° C. (wsp) for 30 s, and 72° C. for 30 s. Quantification was determined by Bio-Rad CFX manager software by comparing the DNA samples to that of a standard curve generated from serial dilution of plasmid DNA of the appropriate gene. Data in Table 3 are expressed as a reduction in Wolbachia load in comparison to the vehicle control group and normalized by positive control (doxycycline at 5 μM).

(447) TABLE-US-00003 TABLE 3 % Reduction % Wolbachia level reduction cf. normalised to Compound (Conc.) DMSO DOX (5 μm) embedded image 89.4 99.8 embedded image 87.3 97.4 embedded image 88.0 98.2 embedded image 83.3 92.9 DOX (500 nM) 80.0 92.9 DOX (5 μM) 89.6 100.0 DMSO 0 0 DOX = doxycycline
Larval Brugia malayi Mouse Model

(448) In a larval Brugia malayi mouse model treatment groups (BALB/c IL4Rα−/− mice, 6-8 week old) received compounds by oral delivery for 7 to 14 days commencing on the day of intraperitoneal infection with Brugia malayi third-stage larvae. At 14 days post-infection, larvae were recovered from the peritoneal cavity, counted, and length measured. Genomic DNA was extracted from individual worms (10/group) and quantification of the Wolbachia surface protein (wBm-wsp) gene copy numbers performed by quantitative PCR.

(449) Table 4 shows Wolbachia reductions in Brugia malayi larval infection mouse model (% compared to median vehicle control) following treatment with Compound X orally. Treatment dosage unit is mg/kg (MK) and duration stated in days (d). Abbreviations: DOX (doxycycline), bid (twice daily), Ms (mesylate). Data in Table 4 are expressed as a reduction in Wolbachia load in comparison to the vehicle control group.

(450) TABLE-US-00004 TABLE 4 Drug % Wolbachia Dose/duration reduction* DOX 99.05 25 MK bid + 14 d embedded image 99.99 embedded image 99.91 0embedded image 99.84 *cf median Vehicle
Adult Brugia malayi Mouse Model

(451) In an adult Brugia malayi mouse model treatment groups (BALB/c CCR3−/− mice, 6-8 week old) received compounds by oral delivery for 7-28 days beginning at 6-10 weeks post-infection intraperitoneal with Brugia malayi third-stage larvae. Following treatment, at 12 weeks past-infection, adult worms and released microfilariae were recovered from the peritoneal cavity, counted and staged for sex. Genomic DNA was extracted from individual adult worms (10/group) and quantification of the Wolbachia surface protein (wBm-wsp) performed by quantitative PCR.

(452) Table 5A shows Wolbachia reductions in Brugia malayi adult infection mouse model (% compared to median vehicle control) following treatment with Compound X orally. Treatment dosage unit is mg/kg (MK) and duration stated in days (d). Abbreviations: MIN (minocycline), bid (twice daily), Ms (mesylate). Data in Table 5A are expressed as a reduction in Wolbachia load in comparison to the vehicle control group.

(453) TABLE-US-00005 TABLE 5A Drug % Wolbachia Dose/duration reduction* MIN 83.6 25 MK bid + 28 d embedded image 99.4 embedded image 97.8 embedded image 98.8 embedded image 98.5 *cf median Vehicle

(454) Table 5B provides a comparison of two stereoisomers in the adult Brugia malayi mouse model above at a range of doses and durations of treatment. Data in Table 5B are expressed as a reduction in Wolbachia load in comparison to the vehicle control group.

(455) TABLE-US-00006 % Microfilaria Drug % Wolbachia (Mf) production Dose/duration reduction* reduction* Min 98.2 100 25 MK bid + 28 d treatment + 14 d wash-out embedded image 99.7 100 embedded image 99.9 100 embedded image 97.8 100 embedded image 99.7 100 embedded image 99.6 100 00embedded image 86.8 100 01embedded image 82.2 91.4 *cf median Vehicle
Adult Onchocerca ochengi Mouse Model

(456) Viable male Onchocerca ochengi were aseptically isolated from naturally parasitized cattle. Between 10-11 male Onchocerca were surgically implanted into the peritoneal cavity of CB.17(BALB/c) SCID mice under anaesthesia. 3 days post O. ochengi surgical implantation, SCID mice received compounds by oral delivery for 14 days. 38 Days after O. ochengi surgical implantation, mice were necropsied to recover the live worms. Genomic DNA was extracted from individual adult worms (10/group) and quantification of the O. ochengi-specific Wolbachia surface protein (wsp) performed by quantitative PCR. Data in Table 6 is expressed as a reduction in Wolbachia load in comparison to the vehicle control group.

(457) TABLE-US-00007 Drug % Wolbachia Dose/duration Reduction* DOX 98.7 25 MK bid + 28 d 02embedded image 96.2 *cf median Vehicle

(458) All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference in their entirety and to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein (to the maximum extent permitted by law).

(459) All headings and sub-headings are used herein for convenience only and should not be construed as limiting the invention in any way.

(460) The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise paragraphed. No language in the specification should be construed as indicating any non-paragraphed element as essential to the practice of the invention.

(461) The citation and incorporation of patent documents herein is done for convenience only and does not reflect any view of the validity, patentability, and/or enforceability of such patent documents.

(462) This invention includes all modifications and equivalents of the subject matter recited in the paragraphs appended hereto as permitted by applicable law.