Variants of Gal2 transporter and their uses

10246495 · 2019-04-02

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to polypeptides which are Gal2 variants comprising at least one amino acid substitution at a position corresponding to T354, and optionally further amino acid substitution(s). The present invention further relates to nucleic acid molecules encoding the polypeptides and to host cells containing said nucleic acid molecules. The present invention further relates to a method for the production of bioethanol and/or other bio-based compounds, comprising the expression of said nucleic acid molecules, preferably in said host cells. The present invention also relates to the use of the polypeptides, nucleic acids molecule or host cells for the production of bioethanol and/or other bio-based compounds, and/or for the recombinant fermentation of biomaterial containing pentose(s), preferably D-xylose and/or L-arabinose.

Claims

1. A polypeptide comprising at least one amino acid substitution at a position corresponding to T354 of the amino acid sequence of SEQ ID NO: 1, wherein the polypeptide has at least 90% sequence identity with the amino acid sequence of SEQ ID NO: 1, and wherein the polypeptide has an in vitro and/or in vivo pentose transport function.

2. The polypeptide according to claim 1, wherein the polypeptide is Gal2 of Saccharomyces cerevisiae.

3. The polypeptide according to claim 1, wherein the amino acid substitution at a position corresponding to T354 of the amino acid sequence of SEQ ID NO: 1 is T354A.

4. The polypeptide according to claim 1, comprising a further amino acid substitution at a position corresponding to V71 of the amino acid sequence of SEQ ID NO: 1.

5. The polypeptide according to claim 1, wherein the amino acid substitution at a position corresponding to T354 increases the activity of the in vitro and/or in vivo pentose transport function compared to a polypeptide without such amino acid substitution.

6. The polypeptide according to claim 1, wherein the amino acid substitution at a position corresponding to T354 increases the affinity of the polypeptide for pentose(s) compared to a polypeptide without such amino acid substitution.

7. The polypeptide according to claim 1, wherein the pentose is D-xylose and/or L-arabinose.

8. A nucleic acid molecule, encoding a polypeptide according to claim 1.

9. The nucleic acid molecule of claim 8, further comprising vector nucleic acid sequences, selected from promoter nucleic acid sequences and terminator nucleic acid sequences.

10. A host cell, containing a nucleic acid molecule according to claim 8 wherein said host cell is a fungus cell.

11. The host cell according to claim 10, which belongs to the species Saccharomyces cerevisiae.

12. The host cell according to claim 10, which has an increased uptake rate for D-xylose and/or L-arabinose compared to a cell not containing said nucleic acid molecule.

13. The host cell according to claim 10, further containing nucleic acid molecules encoding proteins of a xylose metabolic pathway, and/or nucleic acid molecules encoding proteins of an arabinose metabolic pathway.

14. The host cell according to claim 13, which has an increased D-xylose and/or L-arabinose consumption rate and/or a faster growth rate with D-xylose and/or L-arabinose compared to a cell not containing said nucleic acid molecule.

15. A method for the production of bioethanol comprising the expression of a nucleic acid molecule according to claim 8 in a fungal host cell.

16. The method of claim 15, wherein the other bio-based compounds are selected from 1-butanol, isobutanol, 2-butanol, other alcohols, lactic acid, acetic acid, succinic acid, malic acid, other organic acids, amino acids, alkanes, terpenes, isoprenoids, solvents, pharmaceutical compounds, and vitamins.

17. The polypeptide, according to claim 4, wherein the amino acid substitution is V71I.

18. The host cell, according to claim 10, wherein the host cell is a yeast.

19. The host cell, according to claim 13, containing nucleic acid molecules encoding xylose isomerase and xylulokinase and/or arabinose isomerase, ribulokinase, and ribulose-5-P 4-epimerase.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1: Growth test of Gal2_T354A in EBY.VW4000

(2) The transformants were cultivated in 5 ml SCM-ura with 20 g/l maltose at 300, washed with water and adjusted to an OD.sub.600 of 1. Thereof it followed a serial dilution. 5 l were dropped onto the respective media and it was incubated for three days at 30. As a control for the dilution SCM-ura with 20 g/l maltose was taken. The cells of the mutated transporters were dropped onto SCD-ura with 0.2% and 2% glucose, as well as SCG-ura with 0.2% and 2% D-galactose to test their functionality. Furthermore the wild type of CEN.PK2 and Ethanol Red, as well as Gal2_ep3.1 were used for comparison. The galactose transporter with the mutation T354A is from HDY.GUF10.

(3) FIG. 2: Growth test of Gal2_T354A in AFY10

(4) The transformants were cultivated in 5 ml SCE-ura-leu with 2% ethanol at 300, washed with water and adjusted to an OD.sub.600 of 1. Thereof it followed a serial dilution. 5 l were dropped onto the respective media and it was incubated for five days at 30. As a control for the dilution SCE-ura-leu with 2% ethanol was taken. The cells of the mutated transporters were dropped onto SCX-ura-leu with 0.2% and 2% D-xylose, as well as SC-ura-leu with 1% D-xylose with 4% D-glucose and SC-ura-leu with 0.2% D-xylose and 2% D-glucose to test their functionality. Furthermore the wild type of CEN.PK2 and Ethanol Red, as well as Gal2_ep3.1 were used for comparison. The galactose transporter with the mutation T354A is from HDY.GUF10.

(5) FIG. 3: Drop test of Gal2_T354A in combination with V71I and L280R in EBY.VW4000 after four days at 30. Several dilutions were dropped from left to right (undiluted, 1:10, 1:100, 1:1000).

(6) FIG. 4: Drop test of Gal2_T354A in combination with V71I and L280R in AFY10 after six days at 30. Several dilutions were dropped from left to right (undiluted, 1:10, 1:100, 1:1000).

EXAMPLES

(7) Methods

(8) Strains and Media

(9) Bacteria

(10) E. coli SURE (Stratagene)

(11) Full medium LB 1% trypton, 0.5% yeast extract, 0.5% NaCl, pH 7.5 (see Sambrook and Russell, 2001)

(12) For selection on a plasmid-coded antibiotic resistance, 40 g/ml ampicillin was added to the medium after autoclaving. Solid culture media additionally contained 1.9% agar. The culture took place at 37 C.

(13) Yeast

(14) CEN.PK2-1C

(15) MATa leu2-3,112 ura3-52 trp1-289 his3-1 MAL2-8.sup.c SUC2 (EUROSCARF, Frankfurt)

(16) Strain EBY.VW4000

(17) EBY.VW4000 (Genotype: MATa leu2-3,112ura3-52 trp1-289 his3-1 MAL2-8c SUC2 hxt1-17dgal2 stl::loxP agt1::loxP mph2::loxP mph3::loxP) (Wieczorke et al., 1999)

(18) Strain Ethanol Red

(19) available from Lesaffre, Lille, France. Described in Demeke et al. (2013).

(20) Strain HDY.GUF10

(21) Xylose and arabinose consuming industrial S. cerevisiae strain derived from Ethanol Red (Dietz 2013).

(22) Strain AFY10

(23) EBY.VW4000 glk1::loxP hxk1::loxP hxk2::loxP ylr446w::loxP pyk2::pPGK1-opt.XKS1-tPGK1 pTPI1-TAL1-tTAL1 pTDH3-TKL1-tTKL1 pPFK1-RPE1-tRPE1 pFBA-RKI1-tRKI1 loxP (Farwick et al., 2014).

(24) Strain AFY10X

(25) AFY10+YEp-kanR_optXI (Farwick et al., 2014).

(26) Synthetic Complete Selective Medium SC

(27) 0.67% yeast nitrogen base w/o amino acids and ammonium sulphate, 0.5% ammonium sulphate, 20 mM potassium dihydrogenphosphate, pH 6.3, amino acid/nucleobase solution without the corresponding amino acids for the auxotrophy markers of the plasmids used, carbon source in the respectively indicated concentration

(28) Concentration of the amino acids and nucleobases in the synthetic complete medium (Zimmermann, 1975): adenine (0.08 mM), arginine (0.22 mM), histidine (0.25 mM), isoleucine (0.44 mM), leucine (0.44 mM), lysin (0.35 mM), methionine (0.26 mM), phenylalanine (0.29 mM), threonine (0.48 mM), tryptophan (0.19 mM), tyrosin (0.34 mM), uracil (0.44 mM) and valine (0.49 mM). As carbon sources, L-arabinose, D-glucose, D-galactose, D-mannose, ethanol and maltose were used, as indicated.

(29) Solid full and selective media contained in addition 1.9% agar. The culture of the yeast cells took place at 30 C.

(30) Plasmids

(31) TABLE-US-00003 Plasmid Referenz p426H7 Becker and Boles, 2003 YEp181_pHXT7-optXI_Clos Subtil and Boles, 2012 p426H7_GAL2_WT p426H7_GAL2_ep3.1 p426H7-GAL2_EtOHred p426H7-GAL2_GUF10 p426H7_GAL2-T354A p426H7_GAL2-V71I
Preparation of DNA

(32) Isolation of Plasmid DNA from E. coli

(33) Small-scale preparations of plasmid DNA from E. coli cultures were done using the GeneJET Plasmid Miniprep Kit (Fisher Scientific) according to manufacturer's instructions. The QUIAGEN Plasmid Maxi Kit was used for large scale preparations.

(34) Isolation of Plasmid and Genomic DNA from S. cerevisiae

(35) For isolation of genomic and plasmid DNA from yeast cells 5-10 ml of stationary phase cultures were harvested by centrifugation (1 min, 2000g) and washed once in 1 ml sterile ddH.sub.2O. The cell pellet was resuspended in 400 l YP-buffer 1 by vortexing and then lysed by addition of 400 l YP-buffer 2, 1/3 to 2/3 Vol glass beads ( 0.25-0.5 mm) and 8 minutes of shaking on a VXR basic Vibrax (IKA) at 2000 rpm. Cell debris was pelleted by centrifugation (30 sec, 16000g) and 650 l of the supernatant transferred to a fresh eppendorf tube. 325 l of cold YP-buffer 3 were added and the sample was vortexed and then incubated on ice for 10 minutes for precipitation of proteins and other contaminants. The sample was centrifuged (10-15 min, 4 C., 16000g), 700 l of the supernatant were transferred to a fresh eppendorf tube and 700 l isopropanol were added. After mixing vigorously, the sample was incubated for 10 minutes at RT to allow precipitation of the DNA, which was then pelleted by centrifugation (30 min, RT, 16000g). The DNA-pellet was washed twice with 500 l of cold (20 C.) 70% (v/v) ethanol, with centrifugation steps of 5 minutes at RT and 16000g, then dried at RT for 10 minutes and dissolved in 15-30 l sterile ddH2O depending on the size of the DNA pellet.

(36) Determining the DNA Concentration

(37) The DNA concentration is measured by spectral photometry in a wavelength range of 240-300 nm. If the purity of the DNA, determined by the quotient E260 nm/E280 nm is 1.8, then the extinction E260 nm=1.0 corresponds to a DNA concentration of 50 g dsDNA/ml (Sambrook and Russell, 2001).

(38) DNA Purification of PCR Products

(39) The purification of the PCR products took place with the QIAquick PCR Purification Kit of the company Qiagen, according to the manufacturer's information.

(40) Digestion of DNA with Restriction Endonucleases (Restriction Digestion)

(41) For the site-specific cleavage of DNA restriction endonucleases from New England Biolabs (NEB) or Fermentas were used with the provided buffers and according to the instructions of the manufacturer. Usually 1-3 units per g DNA were used for the reaction, which was incubated for 2-12 hours. This method was used to prepare vectors for recombinational cloning, to confirm correctly assembled plasmids or to specifically degrade a certain plasmid from a mixture.

(42) Polymerase Chain Reaction (PCR)

(43) Different polymerases were used for different PCR experiments in this work. For confirmation of genomic gene deletion or integration the Crimson Taq polymerase (NEB) was used. For amplification of ORFs (for sequencing), genes for recombinational cloning or amplification of integrative cassettes for genomic gene deletion or integration the Phusion or Q5 polymerases (NEB) were used. Composition of PCR reactions and the corresponding PCR program are displayed in the Tables below. Annealing temperatures of primer pairs were calculated with the T.sub.m calculator tool on the NEB homepage. All PCRs were performed in a Mastercycler gradient (Eppendorf), Piko Thermo Cycler (Finnzymes) or Progene PCR cycler (Techne).

(44) Composition of PCR Reactions with Crimson Taq Polymerase

(45) TABLE-US-00004 15 l 25 l component reaction reaction final concentration 5x Crimson Taq 3 l .sup.5 l 1x reaction buffer 2 mM dNTP mix 1.5 l 2.5 l 200 M each 10 M 0.3 0.5 l 0.2 M each primer (each) template DNA variable variable variable Crimson Taq DNA 0.15 l 0.25 l 0.025 U/l polymerase nuclease-free water to 15 l to 25 l.sup.
PCR Program for Reactions with Crimson Taq Polymerase

(46) TABLE-US-00005 step temperature ( C.) time initial denaturation 95 1 min 30-35 cycles 95 22 sec 45-68 35 sec 68 1 min/kb final extension 68 5 min hold 4-10
Composition of PCR Reactions with Phusion or Q5 Polymerase

(47) TABLE-US-00006 25 l 50 l component reaction reaction final conc. 5x Phusion HF/Q5 .sup.5 l 10 l 1x reaction buffer 2 mM dNTPs mix 2.5 l 5 l 200 M each 10 M primer (each) 0.5 l 1 l 200 M each template DNA variable variable variable Phusion/Q5 High-Fidelity 0.25 l 0.5 l.sup. 0.02 U/l DNA polymerase nuclease-free water to 25 l.sup. to 50 l
PCR Program for Reactions with Phusion or Q5 Polymerase

(48) TABLE-US-00007 step temperature ( C.) time initial denaturation 98 C. 1 min 15-35 cycles 98 C. 10 sec 50-72 C..sup. 20 sec 72 C. 15 sec/kb (for plasmids) 30 sec/kb (for gDNA) final extension 72 C. 5 min hold 4-10 C..sup.
Fusion PCR

(49) A fusion PCR was used for construction the ORF of HXT7-N370F for recombinational cloning. In the first step two overlapping fragments of HXT7 were amplified in two separate Q5 PCR reactions with p426H7_HXT7 as a template. The PCR reactions were separated in a 1.5% agarose gel and the correct fragments purified from the corresponding gel pieces. Equal molar amount of both fragments (20 ng minimum) were used in a Q5 PCR reaction without primers. This PCR reaction was run for 6 cycles, before 1 l of forward and reverse primer (from 10 M stocks) were added. The reaction was then run for another 20 cycles.

(50) Error-Prone PCR (epPCR)

(51) For generation of random mutagenized ORFs of GAL2 the GeneMorph II Random Mutagenesis Kit (Agilent Technologies) was applied. The manufacturer's protocol has been followed. The PCR reaction has been run for 33 cycles. The amount of template DNA has been varied to achieve different mutation rates (see Table below) The analysis of epPCR-products revealed that the desired amplification specifications have been met. The PCR fragments were purified and used as templates for a Phusion PCR reaction to extend the fragments' ends with homologous overhangs.

(52) Amount of Template DNA Used in Different epPCRs and

(53) TABLE-US-00008 amount of template amplification mutation rate (acceptable range) desired found medium 205 ng (100-500 ng) 10-100 45 (4.5-9 mut/kb) high 23 ng (0.1-100 ng) 100-10000 250 (9-16 mut/kb)
Agarose Gel-Electrophoresis for DNA or RNA Separation

(54) Fragments in DNA or RNA samples were separated by size using agarose gels with concentrations ranging from 0.7 to 2.0% (w/v) agarose (Sambrook and Russell, 2001). 1TAE-buffer was used for preparation of gels and as running buffer. The GeneRuler 1 kb DNA Ladder (Fisher Scientific) was used for sizing of the DNA fragments. DNA samples were mixed with 1/5 Vol of 6DNA loading dye before loading onto the gel. RNA samples were mixed with the same volume 2RNA loading dye, incubated at 96 C. for 10 min and stored on ice prior to loading. Gels were run at up to 6-10 V/cm for 30 to 45 minutes depending on current, gel percentage and expected fragment sizes. DNA and RNA were visualized by UV-light (254 nm) after incubation of the gel in an ethidium bromide bath.

(55) DNA-Purification and DNA-Extraction from Agarose Gels

(56) To purify DNA (e.g. from PCR reactions or after restriction digestions) and to extract DNA from agarose gels the NucleoSpin Extract II-Kit (Macherey-Nagel) was used according to manufacturer's instructions.

(57) DNA Sequencing

(58) Sequencing of DNA samples was done by GATC Biotech AG (Konstanz, Germany). The samples contained 30-100 ng/l (plasmids) or 10-50 ng/l (PCR products) of DNA. Suitable primers (10 M) were sent to GATC Biotech together with the DNA sample.

(59) Transformation of E. coli

(60) E. coli cells were transformed by electroporation according to the protocol of Dower (Dower et al., 1988) and Wirth (Wirth, 1989) using a Bio-Rad Gene Pulser. DNA (from E. coli or yeast DNA preparations) was added to the frozen competent E. coli cells and the sample was incubated and thawed for 10 min on ice. The cell suspension was then transferred to electroporation cuvettes and directly pulsed. The Bio-Rad Gene Pulser was set to a voltage of 2.5 kV per cm, a resistance of 200 and a capacity of 25 F. Immediately after the pulse the cells were mixed with 1 ml of pre-warmed SOC medium and transferred to an eppendorf tube. The cells were incubated at 37 C. for 45 min at 600-800 rpm in a Thermomixer (Eppendorf) before plating on selective LB agar plates containing kanamycin or ampicillin. In case the cells were transformed with a HXT7-coding plasmid, the incubation was performed at room temperature for 4 hours without shaking or at 20-25 C. with shaking for 2 hours.

(61) Transformation of S. cerevisiae

(62) For transformation of S. cerevisiae, two different protocols of the LiAc/SS carrier DNA/PEG method from Gietz et al. (Gietz and Schiestl, 2007a, Gietz and Schiestl, 2007b) were used with small deviations. Liquid cultures were grown in suitable medium to an OD of 0.6-1.0. Centrifugation of the culture and for the washing steps were shortened to 2 minutes at 3000g. The single-stranded carrier DNA was used as a 10 mg/ml solution, allowing a volume of 54 l or 74 l of DNA in the transformation mix, respectively. The duration of the heat-shock was 35 minutes. After transformation the whole cell suspension was directly plated on the selection medium or, in case of transformations with a dominant selection marker, transferred to 5 ml of appropriate liquid medium for regeneration. After regeneration cells were pelleted, resuspended in 50-100 l medium and plated out.

(63) DNA amounts for transformations were approx. 500 ng for single plasmids, 1000 ng each for co-transformations with multiple plasmids and 2000 ng and more for integrative DNA-cassettes (e.g. for gene deletions).

(64) Codon Optimization of Genes

(65) The ORF of some genes has been codon-optimized. The codons have been adapted to the codon-usage of S. cerevisiae as determined by the preferred codons of the glycolytic genes. Described in Wiedemann et al. (Wiedemann and Boles, 2008).

(66) Plasmid Construction by Homologous Recombination (Recombinational Cloning)

(67) Plasmids were constructed in vivo by homologous recombination of suitable DNA fragments (vector backbone and insert(s)) in S. cerevisiae. For this purpose the respective vector was linearized at the site of insertion by restriction digestion. Optionally, the resulting vector backbone was purified by agarose gel-electrophoresis and subsequent gel extraction. The inserts were designed to have flanking sequences (>30 bp) homologous to the region targeted for insertion or, in case of multiple insert fragments, to each other. Inserts were amplified by PCR and could be provided with homologous sequences by using primers with corresponding 5 ends (homologous overhangs). S. cerevisiae was transformed with the DNA fragments and transformants were plated out on selective medium. Colonies were picked to inoculate selective liquid medium. DNA was isolated from these cultures and used for transformation of E. coli for plasmid separation and proliferation. Plasmids containing the gyrase inhibitor gene ccdB are toxic to most E. coli strains so ccdB-resistant strain E. coli DB3.1 was used for these plasmids. Plasmids were isolated from E. coli single-colony cultures and verified by analytic restriction digestion and DNA sequencing. Glycerol stock cultures were set up for correct clones.

(68) Genomic Gene Deletion or Insertion by Homologous Recombination

(69) For gene deletions in the genome of S. cerevisiae, marker cassettes were integrated into the respective gene by homologous recombination (Carter and Delneri, 2010, Gldener et al., 1996, Sauer, 1987). The marker cassettes were amplified by PCR using primers with 5 ends homologous to the target gene to enable site-directed insertion. The cassettes are composed of a dominant marker gene (kanMX4/G418, hphNT1/Hygromycin B, natNT2/clonNAT), flanked by a promoter (pTEF) and a terminator (tTEF, tCYC1 and tADH1, respectively) and loxP sites. These sites allow excision of the genome-integrated marker cassettes by the cre recombinase, which clears the marker for another round of gene deletion. After transformation of S. cerevisiae with a deletion cassette, cells were plated out on selective medium and replica plated on the same medium once. Single colonies were streaked out again to obtain single clones, which were then picked and grown in selective medium. The DNA was isolated from these cultures and the correct integration was confirmed by PCR with different primer combinations. Primers for confirmation are termed as seen in the Table below. Glycerol stock cultures were set up for correct clones.

(70) Nomenclature of Primers Used for Confirmation of Genomic Integration by PCR

(71) TABLE-US-00009 name position direction A1 upstream of the integration site downstream A2 within the region that gets replaced by upstream the integration A3 within the region that gets replaced by downstream the integration A4 downstream of the integration site upstream K2 within the deletion cassette/gene that upstream is integrated K3 within the deletion cassette/gene that downstream is integrated

(72) For recycling of the marker, cells were transformed with a plasmid encoding the cre recombinase under control of the galactose-inducible GALJ-promotor (pSH47 or pNatCre). After brief induction of the recombinase, cells were selected for loss of the dominant marker by replica plating. Since full expression of the recombinase is lethal in hxt.sup.0 strains, basal expression of the recombinase under non-inducing conditions was used for these strains. Removal of the cassette was again controlled by PCR (see above). The integration of gene cassettes for overexpression of genes was done accordingly. Within these cassettes only the dominant marker is flanked by loxP sites and is excised, the rest of the cassette remains in the genome.

(73) List of Primers

(74) TABLE-US-00010 Primername Sequence(5-3)[SEQIDNO.] Description GAL2_for AACACAAAAACAAAAAGTTTTTTTAATTTTA forwardprimerfor ATCAAAAAATGGCAGTTGAGGAGAACAA GAL2amplification [SEQIDNO.2] GAL2_rev GAATGTAAGCGTGACATAACTAATTACATG reverseprimerfor ACTCGAGTTATTCTAGCATGGCCTTGTACC GAL2amplification [SEQIDNO.3] GAL2T354A TTATTTTTTCTACTACGGTGCCGTTATTTTCA forwardprimerfor fw AGTCAG mutagenesisofT354 [SEQIDNO.4] toAinGAL2 GAL2T354A GACTTGAAAATAACGGCACCGTAGTAGAAA reverseprimerfor rv AAATAATTG mutagenesisofT354 [SEQIDNO.5] toAinGAL2 GAL2V71I GTCTGAATATGTTACCATTTCCTTGCTTTGTT forwardprimerfor fw TGTG mutagenesisofV7Ito [SEQIDNO.6] IinGAL2 GAL2V71I AAACAAAGCAAGGAAATGGTAACATATTCA reverseprimerfor rv GACATG mutagenesisofV7Ito [SEQIDNO.7] IinGAL2
Methods for Cell Cultivation and Fermentation Experiments
Spectrophotometrical Determination of Cell Density

(75) The cell concentration in a liquid culture was quantified spectrophotometrically by measuring the optical density at 600 nm (OD.sub.600). Samples of the cell culture or dilutions thereof were placed in a polystyrene (PS) cuvette and analysed in a Ultrospec 2100 pro spectrophotometer (GE Healthcare, USA) at 600 nm.

(76) Glycerol Stock Cultures

(77) For long time storage of specific strains and plasmid-containing E. coli glycerol stock cultures were prepared. For this purpose stationary cultures of S. cerevisiae or growing cultures of E. coli were mixed 1:1 with 50% (v/v) glycerol and stored at 80 C.

(78) Semi-Solid Agar Cultivation

(79) The Semi-solid agar method of cultivation was chosen to expand the plasmid cDNA library (in E. coli). By this method representational biases that can occur during growth in liquid culture can be minimized. Incubation is done at 30 C. helping to stabilize unstable clones (Hanahan et al., 1991, Sassone-Corsi, 1991). The protocol can be found at Life technologies website. In brief, 2 concentrated LB medium is mixed with 3 g/l SeaPrep agarose while stirring, autoclaved and cooled down to 37 C. The antibiotic and 4.Math.10.sup.5 to 6.Math.10.sup.5 (per 450 ml medium) are added to the medium and mixed for 2 minutes. The bottles are then incubated in an ice-bath at 0 C. for 1 hour and then gently transferred to 30 C. for 40-45 h of incubation (without disturbance). After growth the cells can be pelleted from the semi-solid agar by centrifugation at 10400g.

(80) Serial Dilution Spot Assays (Drop Tests)

(81) For easy comparison of growth of different S. cerevisiae strains under various growth conditions a serial dilution spot assay was performed. Cells were grown in liquid culture to exponential phase in appropriate medium, collected by centrifugation (2000g, 2 min), washed twice with sterile water and then resuspended to an OD.sub.600 of 1.0 in selective medium without carbon source. From this cell suspension a ten-fold serial dilution was prepared in selective medium (four dilution steps). 6 l of each cell suspension were spotted on plates of the media to be examined and allowed to dry. Plates were incubated at 30 C.

(82) Aerobic Batch Fermentations

(83) Aerobic batch fermentations were done in shake flasks of varying sizes (volume 5-10 of the culture volume) on rotary shakers (150-180 rpm) usually at 30 C. The evolutionary engineering was done as a serial aerobic batch fermentation (details see below)

(84) Anaerobic Batch Fermentations

(85) For anaerobic batch fermentations, shake flasks were sealed with a rubber plug and a fermentation lock. The volume of the flasks was matching the culture volume of 100 ml. The cultures were stirred continuously with 120 rpm on a magnetic stirrer at 30 C. In this work the fermentations were done at OD.sub.600=10. For this purpose grown cells were harvested and set to an OD.sub.600 of 20 in 50 ml fermentation medium without carbon source. To start the experiment this cell suspension was added to the prepared flasks containing 50 ml fermentation medium supplemented with 2 concentrated carbon source. Samples for determination of cell concentration and for HPLC analysis were taken through an inserted, sterile needle and syringe.

(86) Anaerobic Fermentations in a Fermenter

(87) Some fermentations with industrial S. cerevisiae strains were conducted in an Infors Multifors fermenter (21.4l) with a working volume of 800 ml and equipped with temperature, pH, O2 and CO2 sensors. The fermenter was filled with 530 ml of concentrated fermentation medium (without carbon source and supplements) and then autoclaved. Prior to the start of the fermentation, 250 ml concentrated carbon source solution, 100 l/1 Antifoam 204 and the other supplements (vitamins, trace elements and antibiotics) were added to the concentrated medium. The fermenter was purged with nitrogen gas to initially create anaerobic conditions. A feed of nitrogen gas to the head space (0.4 l/min) was applied during the experiment to maintain anaerobic conditions. The gas outlet was cooled to condense and return vapor and then piped through a gas washing bottle. The culture was stirred with 300 rpm, temperature kept at 35 C. and pH kept at 5.0 by automated addition of 2M KOH or 2M H.sub.2PO.sub.4. The inoculum of cells (in 20 ml fermentation medium) was added when all set parameters were reached and constant. During the fermentations samples were taken for cell dry weight determination and HPLC analysis. Iris 5.2 Software (Infors) was used to operate the fermenter and monitor the experiment.

(88) Determination of Cell Dry Mass

(89) To determine cell dry mass 5-10 ml of a liquid culture were vacuum filtered through a pre-washed and dried (as described below) filter (nitrocellulose, pore size 0.45 m) and subsequently washed twice with ddH2O. The filters were dried in a microwave oven at 120-150 W for 15 min and left to cool and dry further in a desiccator for another 15 min. The filters were weighted prior to filtering and after drying to measure the cell dry weight. The method described has been adapted from Ask et al. (Ask et al., 2013).

(90) Evolutionary Engineering

(91) The evolutionary engineering was done as an serial aerobic batch fermentation. Transformants were first inoculated in selective SCE.sub.2 to obtain biomass and then grown in selective SC and SM medium with 20 g/l xylose to adapt the strain to xylose utilization. After these initial cultures the cells were switched to medium with 10 g/l xylose and increasing concentrations of glucose to apply an evolutionary pressure. When they were reaching late exponential to early stationary phase cells were harvested by centrifugation (2000g, 2 min) and transferred to fresh medium to an OD.sub.600 of 0.2. Glucose concentrations were increased every time an adaptation could be seen or growth was not negatively influenced by the current glucose concentration. To all media, liquid and solid, G418 was added to select for the AFY10 strain background. Liquid media additionally contained 0.5 g/l 2-deoxy-D-glucose (2-DOG) to suppress formation of suppressor mutants of the hxk.sup.0 phenotype. hxk.sup.0 strains, but not wild type strains, are resistant to 2-DOG (Subtil and Boles, 2012). Lack of glucose-consumption has been confirmed by streaking out culture samples on glucose-media-plates and also by HPLC analysis.

(92) Metabolite Analysis by HPLC

(93) For analysis of metabolites cell-free samples (5-10 min, 4 C., 16000g) were mixed with 1/9 volumes of 50% (w/v) 5-sulfosalicylic acid and centrifuged (5-10 min, 4 C., 16000g). The supernatant was analyzed in an UHPLC+ system by Thermo Scientific (Dionex UltiMate 3000) equipped with a HyperREZ XP Carbohydrate H.sup.+ 8 m column and a refractive index detector (Thermo Shodex RI-101). Separation was carried out at column temperature of 65 C. with 5 mM sulfuric acid as mobiles phase with a flow rate of 0.6 ml/min. Chromeleon 6.80 software was used to control the system and to analyze the data. Five standards (mixtures of D-glucose, D-xylose, xylitol, acetate, glycerol and ethanol with concentrations of 0.01-3% (w/v)) were analyzed for quantification of the different compounds.

(94) Sugar Uptake Assays

(95) Sugar uptake assays were done as described by Bisson et al. (Bisson and Fraenkel, 1983) with modifications according to Walsh et al. (Walsh et al., 1994).

(96) Transformants of strain EBY.VW4000 were grown in selective YEPE to an OD of 1.1-1.6, harvested by centrifugation and washed twice in ice-cold uptake-buffer (RT, 3 min, 3000g). Cells were kept on ice from here on. The cell pellet was resuspended in ice-cold uptake-buffer to a concentration of 60 mg.sub.ww/ml and aliquoted to 110 l. One cell suspension aliquot and one sugar solution were incubated in a water bath at 30 C. for 4-5 min. 100 l of the cell suspension were pipetted to the sugar solution (50 l), mixed briefly by pipetting and incubated for 5 (D-[U-.sup.14C]-glucose) or 20 sec (D-[1-.sup.14C]-xylose). The uptake reaction was stopped by transferring 100 l of the mixture into 10 ml ice-cold quenching-buffer, which was immediately filtered through a Durapore membrane filter (0.22 m pore size, Millipore). The filter was washed twice with 10 ml ice-cold quenching-buffer, transferred to a scintillation vial containing 4 ml scintillation cocktail (Rotiszint eco plus, Roth) and shaken thoroughly. Additionally to this filter sample (cpm.sub.filter), 10 l of each reaction were transferred directly to a scintillation vial with 4 ml scintillation cocktail for determination of the total counts in the reaction (cpm.sub.total). To determine a value for sugar that is bound unspecifically to the cell surface or the filter (cpmblank) a few samples of 33.3 l sugar solution and 66.6 l cell suspension were mixed in 10 ml ice-cold quenching buffer and treated as described above. Radioactivity of all vials was analysed in an Wallac 1409 liquid scintillation counter.

(97) Stocksolutions of 2M, 500 mM or 20 mM glucose or xylose (in H.sub.2O) were used to prepare the sugar solutions for the assays (threefold of the desired concentration in the uptake reaction (S, substrate concentration), 50 l aliquots). Uptake was measured at sugar concentrations 0.2, 1, 5, 25 and 100 mM for glucose and 1, 5, 25, 66, 100, 200 and 500 mM for xylose. Inhibition of xylose uptake by glucose was measured at 25, 66 and 100 mM xylose with additional 25 and 100 mM unlabelled glucose. Sugar solutions contained 0.135 to 0.608 Ci of D-[U-.sup.14C]-glucose (290-300 mCi/mmol) or D-[1-.sup.14C]-xylose (55 mCi/mmol) (American Radiolabeled Chemicals Inc., St. Louis, Mo., USA).

(98) Data of the uptake assays were used for following calculations:

(99) The amount of sugar (A.sub.sugar, in nmol) taken up during the incubation time (t, in seconds) at a certain sugar concentration (S, in mM):
A.sub.sugar=((cpm.sub.samplecpm.sub.blank)/cpm.sub.total.Math.10)).Math.S.Math.100 l

(100) Transport velocity (in nmol.Math.min.sup.1.Math.mg.sub.ww.sup.1) calculated per milligrams of cell (m, in mg.sub.ww):
V=(A.sub.sugar.Math.60 s)/(t.Math.m)

(101) Calculation of K.sub.m (Michaelis constant), V.sub.max (maximal initial uptake velocity) and Ki (inhibitor constant for competitive inhibition) was done by nonlinear regression analysis and global curve fitting in Prism 5 (GraphPad Software, Inc.) with values of three independent measurements.

(102) Bioinformatic Methods

(103) DNA sequences were obtained from the Saccharomyces Genome Database (SGD, (Cherry et al., 2012)). Sequence alignments for transporter proteins were conducted using the PRALINE multiple alignment server ((Simossis and Heringa, 2005)) with standard settings plus PHOBIUS transmembrane structure prediction (Kll et al., 2004). Phylogenetic trees were calculated from PRALINE alignments with ClustalW2 phylogeny (Larkin et al., 2007) and visualized with Phylodendron software (http://iubio.bio.indiana.edu/soft/molbio/java/apps/trees/). Similarities and identities between protein sequences were calculated from PRALINE alignments using SIAS (http://imed.med.ucm.es/Tools/sias.html). Figures for sequence alignments were created with ALINE software (Bond and Schuttelkopf, 2009).

Example 1 T354A

(104) 1.1 Investigation of Gal2_T354A

(105) Ethanol Red is an industrial strain, which is a promising candidate for fermentations of lignocellulosic hydrolysates. Genes encoding enzymes for the xylose and arabinose metabolic pathway could be integrated into the genome, resulting in strain HDY.GUF5 (Demeke et al., 2013). HDY.GUF5 was further evolved on xylose and engineered by genetic engineering, finally resulting in strain HDY.GUF9 (Dietz 2013). HDY.GUF9 was further evolved by evolutionary engineering on arabinose, resulting in strain HDY.GUF10. This strain also had an improved growth behavior on xylose. The xylose consumption rate was improved by about 80%, the arabinose consumption rate by about 25%. Determination of the xylose uptake rate with radioactive sugar uptake assays revealed that HDY.GUF10 had a xylose uptake rate 35% higher than HDY.GUF9. As Gal2 is the only transporter in S. cerevisiae which can transport xylose and arabinose in significant amounts, the GAL2 gene was isolated from both strains and sequenced. One amino acid substitution was found in Gal2_HDY.GUF10 compared to Gal2_HDY.GUF9, which is T354A, probably located within the transport channel in transmembrane helix 7 at the extracellular side. This position might play a role for the alteration of conformation of the transporter. The desired sequence was amplified from chromosomal DNA of HDY.GUF10 and cloned into p426 in order to investigate the modified Gal2p. As a control Gal2p of Ethanol Red was used. The received vectors were transformed into the screening strains to test the growth on several media.

(106) 1.2 Test for Functionality of Gal2_T354A

(107) First a growth test was performed with the vectors in VW4000 on glucose and maltose media. The galactose transporter of the wild type CEN.PK2, as well as Gal2_ep3.1 were used as controls and as a comparison. The Gal2p wild type of the industrial strain Ethanol Red showed the same growth like the wild type of CEN.PK2, as expected. The growth of Gal2_GUF10 was like the growth of both wild types on galactose, whereas the growth on glucose looked like the growth of the error prone mutant (FIG. 1).

(108) Furthermore this was also done with AFY10 in order to investigate the xylose specificity and the glucose affinity of the transformants. The wild type Gal2_EtOH Red was not able to grow on a low xylose concentration, like 0.2%. However growth of Gal2_GUF10 was observed on this media. Nevertheless the growth of Gal2_GUF10 was inferior to Gal2_ep3.1 on 2% xylose. Therefore Gal2_GUF10 seems to have a higher xylose affinity. On the media with additional glucose only the error prone mutant showed growth (FIG. 2).

Example 2 T354A/V71I

(109) 2.1 Effect of T354A in Combination with Other Mutations

(110) The amino acid exchange T354A in Gal2 was found in strain Ethanol Red HDY.GUF10 which was evolved on arabinose originating from strain HDY.GUF9. This indicates that the transport properties of Gal2 for arabinose were improved. It was also shown that the T354A mutation in Gal2 of HDY.GUF10 could restore growth on low xylose concentrations. The sequence of Ethanol Red Gal2 and Gal2 HDY.GUF9 differs in two amino acids from Gal2 of strain CEN.PK (L280R and V71I). To determine the effects of these two differences, plasmid expression constructs were made with Gal2 of CEN.PK which have V71I and L280R alone or in combination with T354A. To determine their properties, growth drop tests were performed after transformation of the constructs with the screening strains EBY.VW4000 und AFY10. As controls CEN.PK Gal2 wild type, p426_empty vector and T354A alone in CEN.PK Gal2 were used.

(111) 2.2 Growth of Cells with Gal2 T354A in Combination with L280R and V71I on Hexoses

(112) The following variants of Gal2 were constructed in expression vectors: T354A, T354A+V71I, T354A+L280R, L280R and I71V. They were transformed into competent EBY.VW4000 cells. Then drop tests were performed on different carbon sources.

(113) As can be seen (FIG. 3) V71I and L280R alone have no effect on uptake of glucose or galactose. T354A alone strongly impairs growth on glucose. The combination of V71I and T354A does not mediate growth on glucose. The combination of T354A and L280R however can mediate growth on glucose. Growth is however slower than with Gal2 wild type.

(114) 2.3 Growth of Cells with Gal2_T354A in Combination with L280R and V71I on Xylose and Sugar Mixtures

(115) The various constructs were transformed into AFY10 cells together with vector YEp181_pHXT7-optXI_Clos, and serial dilution growth drop tests were performed.

(116) No variant can mediate growth on xylose-glucose mixture plates indicating that the mutant transporters are all inhibited by glucose. Growth with high xylose concentrations (20 g/l) is not much different between the various constructs. Growth on low xylose concentrations (2 g/l) however shows significant differences: L280R mediates growth like Gal2 wild type; growth of the combination of L280R and T354A looks like T354A alone or the empty vector control. V71I mediates very slow growth on 2 g/l xylose. The combination of V71I and T354A however mediates growth like the Gal2 wild type (FIG. 4) whereas, in contrast, T354A and V71I alone mediate poor growth on low xylose concentrations. This demonstrates that amino acid exchange V71I in Gal2 of Ethanol Red is responsible for the low xylose uptake activity especially at low xylose concentrations. This defect is suppressed by the additional exchange of T354A. This explains the improved growth behavior of GUF-10 compared to GUF-9. As GUF-10 was evolved on arabinose medium it can be concluded that also uptake of arabinose of Gal2 from Ethanol Red is improved by the T354A mutation by suppressing the V71I exchange.

(117) The features disclosed in the foregoing description, in the claims and/or in the accompanying drawings may, both separately and in any combination thereof, be material for realizing the invention in diverse forms thereof.

REFERENCES

(118) Becker, J. and Boles, E. (2003) A modified Saccharomyces cerevisiae strain that consumes L-Arabinose and produces ethanol. Appl Environ Microbiol 69(7), 4144-50. Brat D, Boles E, Wiedemann B (2009) Functional expression of a bacterial xylose isomerase in Saccharomyces cerevisiae. Appl Environ Microbiol. 75:2304-11. Bruder S (2011) Analyse eines unbekannten Glukose Transporters in Saccharomyces cerevisiae und Entwicklung eines Xylose-Transporter Screening Systems. Diploma thesis (Goethe Universitt Frankfurt). Demeke M M, Dietz H, Li Y, Foulqui-Moreno M R, Mutturi S, Deprez S, Den Abt T, Bonini B M, Liden G, Dumortier F, Verplaetse A, Boles E, Thevelein J M (2013) Development of a D-xylose fermenting and inhibitor tolerant industrial Saccharomyces cerevisiae strain with high performance in lignocellulose hydrolysates using metabolic and evolutionary engineering. Biotechnol Biofuels. 6:89. Dien, B. S., Kurtzman, C. P., Saha, B. C. and Bothast, R. J. (1996) Screening for L-arabinose fermenting yeasts. Appl Biochem Biotechnol 57-58, 233-42. Dietz H (2013) Konstruktion und Charakterisierung von pentosefermentierenden Industriehefestmmen. PhD thesis. Goethe University Frankfurt, Germany Farwick A, Bruder S, Schadeweg V, Oreb M, Boles E. Engineering of yeast hexose transporters to transport D-xylose without inhibition by D-glucose. Proc Natl Acad Sci USA. 2014 Apr. 8; 111(14):5159-64. Hahn-Hagerdal, B., Wahlbom, C. F., Gardonyi, M., van Zyl, W. H., Cordero Otero, R. R. and Jonsson, L. J. (2001) Metabolic engineering of Saccharomyces cerevisiae for xylose utilization. Adv Biochem Eng Biotechnol 73, 53-84. Horak J and Wolf D H (1997) Catabolite inactivation of the galactose transporter in the yeast Saccharomyces cerevisiae: ubiquitination, endocytosis, and degradation in the vacuole. J Bacteriol 179(5):1541-1549. Jeppson M, Bengtsson O, Franke K, Lee H, Hahn-Hagerdal B, Gorwa-Grauslund M F. (2006) The expression of a Pichia stipitis xylose reductase mutant with higher K(M) for NADPH increases ethanol production from xylose in recombinant Saccharomyces cerevisiae. Biotechnol Bioeng. 93(4):665-73. Jin Y S, Jeffries T W. (2004) Stoichiometric network constraints on xylose metabolism by recombinant Saccharomyces cerevisiae. Metab Eng. 6(3):229-38. Katahira S, Mizuike A, Fukuda H, Kondo A. (2006) Ethanol fermentation from lignocellulosic hydrolysate by a recombinant xylose- and cellooligosaccharide-assimiliating yeast strain. Appl Microbiol Biotechnol. 72(6):1136-43. Kotter, P. and Ciriacy, M. (1993) Xylose fermentation by Saccharomyces cerevisiae. Appl Microbiol Biotechnol 38, 776-783. Kou, S. C., Christensen, M. S. and Cirillo, V. P. (1970) Galactose transport in Saccharomyces cerevisiae. II. Characteristics of galactose uptake and exchange in galactokinaseless cells. J Bacteriol 103(3), 671-8. Kuyper, M., Toirkens, M. J., Diderich, J. A., Winkler, A. A., van Dijken, J. P. and Pronk, J. T. (2005b) Evolutionary engineering of mixed-sugar utilization by a xylose-fermenting Saccharomyces cerevisiae strain. FEMS Yeast Res 5(10), 925-34. Kuyper, M., Winkler, A. A., van Dijken, J. P. and Pronk, J. T. (2004) Minimal metabolic engineering of Saccharomyces cerevisiae for efficient anaerobic xylose fermentation: a proof of principle. FEMS Yeast Res 4(6), 655-64. Lucas, C. and Uden, N. v. (1986) Transport of hemicellulose monomers in the xylose-fermenting yeast Candida shehatae. Appl Microbiol Biotechnol 23, 491-495. Pitkanen J P, Rintala E, Aristidou A, Ruohonen L, Penttila M. (2005) Xylose chemostat isolates of Saccharomyces cerevisiae show altered metabolite and enzyme levels compared with xylose, glucose, and ethanol metabolism of the original strain. Appl Microbiol Biotechnol. 67(6):827-37. Reifenberger E, Boles E and Ciriacy M (1997) Kinetic characterization of individual hexose transporters of Saccharomyces cerevisiae and their relation to the triggering mechanisms of glucose repression. Eur J Biochem 245(2):324-333. Richard, P., Putkonen, M., Vaananen, R., Londesborough, J. and Penttila, M. (2002) The missing link in the fungal L-arabinose catabolic pathway, identification of the L-xylulose reductase gene. Biochemistry 41(20), 6432-7. Sambrook J. and Russell D. W. (2001) Molecular cloning. A laboratory manual. New York: Cold Spring Harbor. Subtil T and Boles E (2012) Competition between pentoses and glucose during uptake and catabolism in recombinant Saccharomyces cerevisiae. Biotechnol Biofuels 5(1):14. Wieczorke, R., Krampe, S., Weierstall, T., Freidel, K., Hollenberg, C. P. and Boles, E. (1999) Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae. FEBS Lett 464(3), 123-8. Wiedemann B., Boles E. (2008) Codon-optimized bacterial genes improve L-Arabinose fermentation in recombinant Saccharomyces cerevisiae. Appl Environ Microbiol. 74 (7):2043-50.