Method for protecting plants from stress and senescence
10238113 · 2019-03-26
Assignee
- Yeda Research And Development Co. Ltd. At The Weizmann Institute Of Science (Rehovot, IL)
- Ben-Gurion University of the Negev Research and Development Authority (Beer Sheva, IL)
Inventors
Cpc classification
A01N3/00
HUMAN NECESSITIES
C12N15/8243
CHEMISTRY; METALLURGY
A01N47/28
HUMAN NECESSITIES
C12N15/8271
CHEMISTRY; METALLURGY
International classification
A01N3/00
HUMAN NECESSITIES
A01N47/28
HUMAN NECESSITIES
A01N43/90
HUMAN NECESSITIES
C12N15/82
CHEMISTRY; METALLURGY
Abstract
The present invention relates to regulation of ureide levels for optimal plant survival during nutrient remobilization such as occurs during normal growth, dark stress and senescence. Plants can be genetically engineered or selected using a suitable gene marker to have enhanced ureide accumulation. The present invention further provides methods of protecting plants, or extending the shelf life of fresh plant produce by application of exogenous ureides.
Claims
1. A method of extending the post-harvest shelf life of a fresh mature plant produce, the method comprising: (a) harvesting the fresh mature produce, wherein the fresh mature produce is selected from the group consisting of: vegetable, fruit, cut branches, and flower; and (b) applying to the fresh mature produce ready for harvest, either before or after harvest, a composition comprising at least one ureide selected from the group consisting of: allantoin and allantoate, in an amount effective in extending the post-harvest shelf life of the harvested fresh mature produce and protecting the harvested fresh mature produce from post-harvest premature senescence, senescence, or both.
2. The method according to claim 1, wherein the composition comprises 0.001-10 mM of the at least one ureide.
3. The method according to claim 2, wherein the composition comprises 0.01-10 mM of the at least one ureide.
4. The method according to claim 2, wherein the composition comprises 0.1-0.5 mM of the at least one ureide.
5. The method of claim 1, wherein the applying step comprises spraying the fresh mature produce with the composition.
6. The method of claim 1, wherein the applying step comprises at least partially immersing the fresh mature produce in the composition.
7. A method of extending the post-harvest shelf life of a fresh plant produce, the method comprising: (a) harvesting the fresh produce, wherein the fresh produce is selected from the group consisting of: vegetable, fruit, cut branches, and flower; and (b) applying to the fresh produce, either at or after harvest, a composition comprising at least one ureide selected from the group consisting of: allantoin and allantoate, in an amount effective in extending the post-harvest shelf life of the harvested fresh produce and protecting the harvested fresh produce from post-harvest premature senescence, senescence, or both.
8. The method of claim 7, wherein the composition comprises 0.001-10 mM of the at least one ureide.
9. The method of claim 8, wherein the composition comprises 0.01-10 mM of the at least one ureide.
10. The method of claim 8, wherein the composition comprises 0.1-0.5 mM of the at least one ureide.
11. The method of claim 7, wherein the applying step comprises spraying the fresh produce with the composition.
12. The method of claim 7, wherein the applying step comprises at least partially immersing the fresh produce in the composition.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
DETAILED DESCRIPTION OF THE INVENTION
(16) The present invention provides compositions and methods for protecting plants and parts thereof from senescence and stress related processes. The present invention further provides compositions and methods for extending the shelf life of plant fresh produce including, but not limited to, herbs, vegetables, cut branches, fruit and flowers. Without wishing to be bound by any theory or mechanism of action, shelf life extension of the fresh produce according to the teachings of the present invention may be attributed to protection of the harvested material from processes such as senescence, premature senescence and stress related processes.
(17) According to certain embodiments, the present invention relates to regulation of ureide levels for optimal plant survival during nutrient remobilization such as occurs during normal growth, dark stress, senescence and other plant processes.
(18) According to some embodiments, plants can be genetically engineered or selected using a suitable gene marker to achieve enhanced ureide production and/or accumulation.
(19) According to some embodiments the present invention identifies enzymes and enzyme variants that regulate the production of ureides in plants.
(20) The present invention is based in part on the use of experimental models of plant senescence and stress such as extended dark treatment in order to induce metabolite remobilization processes. It is now disclosed for the first time that both dark-induced stress and increased age induce accumulation of ureides, including allantoin and allantoate, in wild-type leaves. In contrast under these conditions, in XDH1-compromised plants, xanthine but no ureides accumulate, and accelerated senescence and mortality rates are observed. Thus, a protective role for AtXDH1 and ureides in senescence is demonstrated.
(21) Unexpectedly, this protection can also be achieved by the exogenous application of ureides. In particular, the present invention provides compositions and methods comprising exogenous ureides for protection of picked or harvested agricultural produce from processes, such as senescence and premature senescence.
(22) According to a first aspect, the present invention provides a method for protecting plants, plant parts or harvested plant produce from aging (for example, senescence or premature senescence). According to one embodiment, the method comprises applying to the plant(s) or plant part(s) a composition comprising an amount of at least one ureide effective to decrease or delay the senescence of the plant or plant parts. According to some embodiments the ureide is selected form allantoin or an allantoate.
(23) According to one embodiment plants or plant parts may be selected from harvested herbs, fruits, vegetables and flowers.
(24) In particular, the present invention provides compositions and methods for protecting harvested agricultural produce from typically stress related processes such as senescence and premature senescence. Picked flowers and leafy crops such as lettuce, spinach, parsley and many others typically begin to undergo senescence immediately after they are picked. This process is typically accelerated during storage of the plant produce. Typically, this means that the green leafy tissue yellows and its nutritional and marketing value may decrease. Embodiments of the present invention thus disclose that the exogenous application of ureides slows this progress and extends plant produce shelf life.
(25) Methods, according to some embodiments of the invention, may comprise applying, such as by applying to the root or cut branches medium or spraying, a composition which includes an appropriate amount of ureides onto the produce or immersing or partially immersing the produce in a suspension or other appropriate form of composition containing ureides or purine metabolites such as uric acid. Any suitable application method, such as, but not limited to, the methods listed here, may be used alone or in combination. According to some embodiments any solution comprising ureides in the range of 1 M-10 mM may be used. Typically a solution in a range of 0.01-10 mM, or 0.1-10 mM is used. Any concentration of ureides in the specified ranges may be used. According to one embodiment 0.1 mM ureide, 0.5 mM ureide or any concentration of ureides in this range may be used. Compositions having other concentrations may also be used with embodiments of the invention.
(26) As exemplified hereinbelow application of exogenous ureides protects plants and plant parts from senescence and stress related processes.
(27) According to another aspect of the invention ureide accumulation may be enhanced in genetically engineered plants. In the alternative, plants may be genetically engineered to achieve enhanced and optimal ureide production. Expression of enzymes specifically required in the pathway of ureide production may be optimized, according to one embodiment of the invention, in order to achieve ureide accumulation. According to further aspects the present invention provides a plant selected for enhanced ureide production. According to one aspect a genetically modified plant can be obtained by enhancing expression levels of enzymes involved in the production pathway of ureides thereby increasing ureide production. According to another aspect a genetically modified plant can be obtained by decreasing expression levels of ureide utilization enzymes by genetic engineering thereby increasing ureide accumulation.
(28) According to another aspect the desired plant can be selected using a probe specific for at least one enzyme related to the production or accumulation of ureides. According to one embodiment the desired plant can be selected using a probe specific for XDH encoding gene or XDH enzyme expression.
(29) According to one embodiment a genetically modified plant is selected for mutations for enhanced purine turnover. A specific controlling element may up and down regulate purine catabolic pathways synchronously, i.e. up regulate the enzymes that make ureides and simultaneously down-regulate the enzymes that can breakdown the ureides. Such selection can be done by various known mutational methods e.g., subjecting plants to mutagenesis as in enhancer trap methods, irradiation, chemical mutagenesis, insertional mutagenesis and other appropriate methods. According to one embodiment an enhancer is inserted randomly in the genome and the resultant lines are screened for changes in ureide levels. According to various embodiments generic lines may be used for screening of ureide production.
(30) According to another aspect identification of transcripts relevant to the ureide metabolism (production or degradation) can be used to perform large scale screening for natural variations in ureide levels in plants in response to stress. According to a particular embodiment the natural variants in ureide levels are screened during or after extended dark periods.
(31) It should be understood that composition and/or methods according to embodiments of the invention may be used alone or in combination to achieve results according to the invention. For example, several different concentrations and/or different ureides may be applied to plant, plant parts or crops, according to embodiments of the invention. Genetic engineering and/or screening methods may be used in combination with methods of applying ureides to plants. Any combination of the methods and/or compounds disclosed herein, which achieves protection of plants through the ureide metabolic pathway, is disclosed herein.
(32) The remobilization of metabolites during stress and senescence plays an important role in optimal plant adaptation to the environment. The plant molybdenum-cofactor (MoCo) and flavin containing enzyme, xanthine dehydrogenase (XDH; EC 1.2.1.37) are pivotal for purine remobilization and catalyze the conversion of the purine catabolic products, hypoxanthine and xanthine to uric acid that is subsequently degraded to the ureides, allantoin and allantoate. The present invention now shows that in wild-type plants, conditions of extended darkness or increasing leaf age cause induction of transcripts related to purine catabolism, that in turn result in marked accumulation of the purine catabolic products, allantoin and allantoate. In contrast, Arabidopsis mutants of XDH, Atxdh1, accumulated xanthine and showed premature senescence symptoms as exemplified by enhanced chlorophyll degradation, extensive cell death and up-regulation of senescence-related transcripts. When dark-treated mutant lines were re-exposed to light, they showed elevated levels of reactive oxygen species (ROS) and higher mortality rate compared to wild-type plants. Unexpectedly, the level of ROS and mortality could be attenuated by the addition of allantoin and allantoate suggesting that these metabolites can act as scavengers of reactive oxygen species. The present invention highlights a yet unrecognized need for the controlled maintenance of ureide levels, for example, as mediated by AtXDH1 activity during dark stress and ageing and point to the dual functionality of ureides as efficient stores of nitrogen and as cellular protectants. Thus, regulation of ureide levels by regulating Atxdh1 expression has general implications for optimal plant survival during nutrient remobilization such as occurs during normal growth, dark stress and senescence.
(33) XDH1 Activity Moderates Pre-Mature Senescence Induced by Dark Stress
(34) Extended dark treatment implies complete lack of new photosynthesis that imposes a stress which requires remobilization of leaf resources. In this sense, extended dark initiates molecular events that are reminiscent of leaf senescence. The progression of senescence must be orderly so that the accumulation of deleterious compounds or physiological states of enhanced labile cellular state is avoided. It is shown here that XDH1 activity is required for normal remobilization to succeed, as in its absence, not only will direct purine catabolism be compromised, but the rate of chlorophyll, soluble protein degradation (
(35) The value of extended dark treatments as a signal that stimulates synchronized metabolic remobilization in the plant was discerned by examining transcript induction profiles of genes that are known to be induced during senescence. For example, the WRKY53 transcription factor (which was shown to control early events of senescence and oxidative stress response (Miao Y. et al., 2004 Plant Mol Biol 55, 853-867). The protease regulator, ERD1 encodes caseinolytic protease regulatory subunit, and may be related to posttranslational modification processes, as it was shown to be involved in the degradation of chloroplast proteins subjected to artificial senescence related to ABA, ethylene and SO.sub.2 (Brychkova G. et al., 2007 Plant J 50, 696-709; Weaver L. M. et al., 1998 Plant Mol Biol 37, 455-469). Similarly, chlorophyll degradation (Gepstein S. 2004 Genome Biology 5, 212; Pruzinska A. et al., 2005 Plant Physiol 139, 52-63) and up-regulation of related transcripts such as ACD1 and SGN1 (Park S. Y. et al., 2007 Plant Cell 19, 1649-1664; Tanaka R. et al., 2003 Plant Cell Physiol 44, 1266-1274), during the extended dark period are indicative of leaf senescence. The up-regulation of the chlorophyll-degradation related transcripts and chlorophyll degradation itself is a hallmark of compromised XDH1 activity (
(36) XDH Activity in Response to Dark Stress
(37) XDH possesses a MoCo sulfurated-dependent hypoxanthine/xanthine-O2-generating activity and a FAD dependent NADH-O2.sup.-generated activity (Sagi M. et al., 1999 Plant Physiol 120, 571-578; Sagi M. et al., 2002 Plant J 31, 305-317; Yesbergenova Z. et al., 2005 Plant J 42, 862-876). The xanthine-dependent superoxide generating activity was more enhanced in extended dark than the NADH-dependent activity (
(38) Role of Purine Catabolism in Dark Stress and Recovery
(39) Mutation in AtXDH1 or application of allopurinol to wild type plants led to xanthine accumulation during dark stress (
(40) A coordinated rise in transcripts level involved in ureide production (AMPD, XDH1, UO and TLP) and a concomitant decrease in transcripts level of enzymes that utilize ureides (ALN and AAH) was detected. Thus, dark stress ureides accumulation is at least in part under transcriptional control and is likely to result from the difference in activities involved in ureides formation versus the activities that process them.
(41) The data presented in the present invention have highlighted a complete and functional purine remobilization pathway that occurs in the extended absence of light but the implications are not restricted to conditions of environmental stress. Rapid XDH1 up-regulation (
(42) Senescence and dark-induced senescence are associated with modulation of ROS production (Guo F. Q. and Crawford N. M. 2005 Plant Cell 17, 3436-3450; Pastori G. M. and Del Rio L. A. 1997 Plant Physiol 113, 411-418). Thus, without wishing to be bound by any particular theory opr mechanism of action, ureides may serve a dual function in senescence as transportable metabolites for further biosynthetic pathways and at the same time as cellular protectants from ROS. The results herein show that purine catabolism, ageing and extended dark induce similar senescence programs. In both cases, the transition from nutrient assimilation to metabolite turnover occurs due to the acceleration of purine catabolic recycling activities in which AtXDH1 plays a pivotal role.
(43) Examples of specific experiments carried out on specific plants are presented herein in order to more fully illustrate certain embodiments of the invention. They should in no way, however, be construed as limiting the broad scope of the invention. One skilled in the art can readily devise many variations and modifications of the principles disclosed herein without departing from the scope of the invention.
EXAMPLES
Experimental Procedures
(44) Plant Materials, Growth Conditions and Dark Treatment
(45) Arabidopsis thaliana (ecotype Columbia) and its isogenic Atxdh1 compromised plants were grown in a growth room under 16 h light/8 h dark, 22 C., 75-85% relative humidity, light intensity of 100 mol m.sup.2 s.sup.1 as described before (Brychkova G. et al., 2007, ibid). Atxdh1 compromised plants included homozygous T-DNA inserted line [SALK_148364 (obtained from the Arabidopsis Biological Research Center, Columbus, Ohio, USA)] and 3 independent homozygous xdh RNA interference lines described before (Yesbergenova et al., 2005, ibid). For dark treatment, four-week-old plants grown in peat were transferred from the growth room to a dark room. Samples were collected every day during 15 min, under dim light (40 l, mol m2 s1), as a mix of fully expanded rosette leaves taken from 5 plants. After 6 days in the dark, plants were transferred to the growth room and survival rate of plants were determined 9 days later. Average and S.E. of survival rate was calculated from 12 independent experiments with at least 30 plants for each treatment. For aging measurements plants were grown in a growth room as described above and samples were collected from 30, 45, 60 and 75 day old plants as a mix of fully expanded rosette leaves taken from 5 plants.
(46) Cell Death Measurements, Determination of Chlorophyll and Leaf Damage Level
(47) Cell death was visualized in leaves sampled from dark stressed and control unstressed plants, by lactophenol-trypan blue staining followed by destaining in saturated chloral hydrate (Koch E. and Slusarenko A. 1990 Plant Cell 2, 437-445). Total chlorophyll content was measured in extracts of the fully expanded leaves as described before (Brychkova et al., 2007, ibid). The values for remaining chlorophyll content in leaf discs were determined as the amount of chlorophyll per disc divided by the amount of chlorophyll per untreated control and expressed as a percentage. The severity of leaf damage after dark stress was as follows: 1, no damage; 2, <30%; 3, 30-50%; 4, >50% of the leaf area damaged. The average leaf damage was then multiplied by the total number of damaged leaves to determine the damage level. MeansSEM for each treatment are presented.
(48) Preparation of RNA and Quantitative Real-Time RT-PCR
(49) For quantitative analysis of transcripts expression, total RNA, RT reaction and quantitative RT-PCR reactions with specific primers (see Table 1 hereinbelow) were performed as describes in Brychkova et al. (2007, ibid). Reactions normalized with UBQ10 (At4g05320) and Elongation factor 1- (At5g60390) as housekeeping genes revealed similar results and thus only results based on the later housekeeping gene are presented.
(50) TABLE-US-00001 TABLE1 Listofprimersusedforquantitativereal-timePCR withArabidopsisthaliana Lengthof PCR PCRproduct Primer Transcript SGN1 Forward 189 (StayGreen1; GATTGTTCCCGTTGCAAGGTTGTTT At4g22920) (SEQIDNO:1) Reverse TGCAACTGAGAGTTGTTTATGGATTGAG (SEQIDNO:2) SRG1 forward 191 (senescence- AAGAGTGGGGATTTTTCCAGCTTGT related (SEQIDNO:3) gene1; reverse At1g17020) TGCCCAATCTAGTTTCTGATCTTCTGA (SEQIDNO:4) UBQ10 forward 192 (Ubiquitine10; TTTGTTAAGACTCTCACCGGAAAGACA At4g05320) (SEQIDNO:5) reverse GAGGGTGGATTCCTTCTGGATATTGTA (SEQIDNO:6) UO(Urate forward 187 oxidase; CACTGTTTATGTGAAAGCCAAGGAATG At2g26230) (SEQIDNO:7) reverse CCCAAGCTTAAAACCATGTAAATGTGG (SEQIDNO:8) TLP forward 185 (transthyretin- CCATGCGTTAAAGGAAAGGTATGAAAA likeprotein; (SEQIDNO:9) AT5g58220) reverse TGATTCTCAGACGATCTTGAGGTTTTG (SEQIDNO:10) WRKY53 forward 158 (WRKYDNA- TCAAAGAAAAGAAAGATGTTACCAAAGTGG bindingprotein (SEQIDNO:11) 53;At4g23810), reverse GTGCATCTGTAATAACTCCTTGGGAAT (SEQIDNO:12) XDH1(xanthine forward 200 dehydrogenase1; TGATGTTGGACAAATAGAAGGAGCGTTT At4g34890) (SEQIDNO:13) reverse TATTCGGATTCCCCTTGAGAAGCGAAACA (SEQIDNO:14) XDH2(xanthine Forward 202 dehydrogenase2; TGATATTGGACAAATAGAAGGAGCGTTT At4g34900) (SEQIDNO:15) reverse TGCATTTGGATTACCCTTGAGAAGAGAAA (SEQIDNO:16) XERO1/TAS14 forward 165 (dehydrin; AGACTCACCAACAGCTTGACCAATTT At3g50980) (SEQIDNO:17) reverse CACCTAGTCCATCATCCGAGCTAGAG (SEQIDNO:18) SGN1 Forward 189 (StayGreen1; GATTGTTCCCGTTGCAAGGTTGTTT At4g22920) (SEQIDNO:19) Reverse TGCAACTGAGAGTTGTTTATGGATTGAG (SEQIDNO:20) SRG1 forward 191 (senescence- AAGAGTGGGGATTTTTCCAGCTTGT relatedgene1; (SEQIDNO:21) At1g17020) reverse TGCCCAATCTAGTTTCTGATCTTCTGA (SEQIDNO:22) UBQ10 forward 192 (Ubiquitine10; TTTGTTAAGACTCTCACCGGAAAGACA At4g05320) (SEQIDNO:23) reverse GAGGGTGGATTCCTTCTGGATATTGTA (SEQIDNO:24) UO(Urate forward 187 oxidase; CACTGTTTATGTGAAAGCCAAGGAATG At2g26230) (SEQIDNO:25) reverse CCCAAGCTTAAAACCATGTAAATGTGG (SEQIDNO:26) TLP forward 185 (transthyretin- CCATGCGTTAAAGGAAAGGTATGAAAA likeprotein; (SEQIDNO:27) AT5g58220) reverse TGATTCTCAGACGATCTTGAGGTTTTG (SEQIDNO:28) WRKY53(WRKY forward 158 DNA-binding TCAAAGAAAAGAAAGATGTTACCAAAGTGG protein53; (SEQIDNO:29) At4g23810), reverse GTGCATCTGTAATAACTCCTTGGGAAT (SEQIDNO:30) XDH1(xanthine forward 200 dehydrogenase TGATGTTGGACAAATAGAAGGAGCGTTT 1;At4g34890) (SEQIDNO:31) reverse TATTCGGATTCCCCTTGAGAAGCGAAACA (SEQIDNO:32) XDH2(xanthine Forward 202 dehydrogenase TGATATTGGACAAATAGAAGGAGCGTTT 2;At4g34900) (SEQIDNO:33) reverse TGCATTTGGATTACCCTTGAGAAGAGAAA (SEQIDNO:34) XERO1/TAS14 forward 165 (dehydrin; AGACTCACCAACAGCTTGACCAATTT At3g50980) (SEQIDNO:35) reverse CACCTAGTCCATCATCCGAGCTAGAG (SEQIDNO:36)
Histochemical Staining for O.sub.2.sup. and H.sub.2O.sub.2 Detection
(51) Nitroblue tetrazolium (NBT) O.sub.2.sup. staining of leaves was performed essentially according to Jabs T. et al. (1996 Science 273, 1853-1856) and Fryer M. J. et al. (2002 J Exp Bot 53, 1249-1254). Leaves were incubated for 10 h in the dark overnight and then placed in 96% ethanol, boiled for 10 min and photographed. Application of allantoin and allantoate and O.sub.2.sup. and H.sub.2O.sub.2 measurement was carried out on 7 mm leaf discs removed from 4-week-old Col wild-type and Atxdh1 mutant plants. Discs were placed in the dark for 24 h on moistened filter papers. Thereafter, 0.1 mM allantoin or allantoate in pH 7.5 solution was added to the filter papers for additional 2 h. For NBT-O.sub.2.sup. staining, leaf discs were washed twice and immersed in 0.8 mM NBT solution added to the filter papers for 2 h in the light and then boiled in 96% ethanol for 10 min and photographed. For DAB-H.sub.2O.sub.2 staining leaf discs subjected to the procedure described above for NBT were immersed in solution containing 1 mg ml.sup.1 3,3-diaminobenzidine (DAB) in pH 5.0, for 2 h in the light as described before (Sagi M. et al., 2004 Plant Cell 16, 616-628). Leaf discs were photographed after boiling in 96% ethanol for 10 min. NBT and DAB stained leaves and leaf discs were quantified using NIH Image Software (Version 1.6).
(52) Protein Extraction, Fractionation and Total Soluble Protein Determination in-Gel and Kinetic Assay of ROS-Generating Activities of XDH
(53) Extracts of XDH for assay by native gel electrophoresis (PAGE) were prepared as described by Sagi M. et al. (1998 Plant Science 135, 125-135) and Yesbergenova et al. (2005, ibid). Kinetic O.sub.2.sup. generating activities of XDH were assayed spectrophotometrically by measuring the oxidation of epinephrine to adrenochrome at 480 nm as described previously in Sagi M. and Fluhr R. (2001 Plant Physiol 126, 1281-1290). The reaction medium contained 6.2 g of protein extract, 1 mM epinephrine in 50 mM Tris-HCl buffer (pH 8.5) and 1 mM hypoxanthine/xanthine. Reaction medium without hypoxanthine/xanthine was used as control. Six samples were analyzed and averaged for each data points. MeansSEM for each treatment are presented.
(54) Ureides, Hypoxanthine and Xanthine Determination
(55) Ureides were extracted from leaves with 80% ethanol and determined according to Vogels G. D. and Van Der Drift C. (1970 Anal Biochem 33, 143-157) using allantoic acid and allantoin as references. Six samples were analyzed and averaged for each data points. For hypoxanthine and xanthine determination, leaves were extracted with 40 mM NaOH and diluted four times by Tris-HCl 0.1 M, pH 7.5. Hypoxanthine/xanthine were determined by high performance liquid chromatography (HPLC) using a 1002.1 mm ID, ODS-Hypersil (5 m) column. The mobile phase was a 10 mM NaOH/0.1 mM Tris-HCl, pH 5.0, similar to that used by Corpas F. J. et al., (1997 J Plant Physiol 151, 246-250). The hypoxanthine and xanthine were detected using standards retention time and UV absorption spectra ratio at 249 nm and 267 nm. A modified protocol to detect xanthine via the xanthine oxidase assay was used (Mohanty J. G. et al., 1997 Journal of Immunological Methods 202, 133-141). The reaction mixture modified from Yesbergenova et al., (2005 ibid), contained 0.4 U ml.sup.1 HRP, 40 mU ml.sup.1 buttermilk xanthine oxidase (Fluka), 3.4 mM 3,5-dichloro-2-hydroxobenzene sulphonate and 0.85 mM 4-aminoantipyrine in Tris-HCl 0.1 M, pH 7.5.
Example 1: XDH Expression During Dark-Induced Stress and its Subsequent Recovery
(56) XDH1 expression was examined under extended dark treatment that imposes major remobilization of cellular components. To this end, wild type Col plants and Atxdh1-compromised plants (RNA interference lines Ri5, Ri7 and Ri10; T-DNA insertion line, KO) impaired in XDH1 activity (Yesbergenova et al., 2005, ibid), were exposed to 6 days continuous dark followed by a recovery period of 9 days under normal diurnal light regime (16 h light/8 h dark). The level of XDH1 transcript was found to increase continuously in the dark reaching a peak (>20 fold induction) in 24 h (
Example 2: XDH Superoxide Activity Parallels XDH Expression
(57) To ascertain whether potential enzymatic performance parallels the measured transcript changes, the in-gel activities of superoxide generation by XDH were tested using NADH and hypoxanthine/xanthine substrates (Yesbergenova et al., 2005, ibid). NADH-dependent activity exhibited at most a 1.5-fold enhancement in O.sub.2.sup. production during the dark period (
Example 3: Mutation in XDH1 Accelerates Premature Senescence in Dark-Induced Stressed Plants
(58) Reference is now made to
(59) Wild type Col and XDH1-compromised lines were examined more closely during the dark treatment. Rosette leaves of the mutant plants impaired in XDH1 expression were distinctly more yellow than wild type leaves (
Example 4: Senescence and Chlorophyll Degradation-Associated Gene Expression in Atxdh1 Down-Regulated Plants
(60) Reference is now made to
(61) Enhanced dark-induced leaf yellowing in the mutant lines (such as that described in
(62) The chlorophyll-degradation gene ACD1 (accelerated cell death1) is involved in senescence-associated chlorophyll breakdown (Tanaka et al., 2003, ibid) while SGN1 (stay-green protein1) is involved in chlorophyll catabolism during development (Park et al., 2007, ibid). The transcript levels of these genes were rapidly induced already after 1 day in darkness and were maintained at higher levels in Atxdh1 mutants in comparison to those of Col plants (
Example 5: XDH and Non-XDH Superoxide Generating Activities
(63) Reference is now made to
Example 6: Dark Treatment Modifies Accumulation of Purine Metabolites
(64) Reference is now made to
(65) XDH activity produces urate which is rapidly converted to the ureides, allantoin and allantoate (Nguyen, 1986, ibid; Sagi et al., 1998 ibid). Unexpectedly, their levels were found to be significantly enhanced in wild type Col leaves upon exposing plants to dark treatment (5-fold;
Example 7: Dark-Induced Stress Modifies Transcript Levels of Genes Involved in Purine Catabolism Up-Stream and Down-Stream to XDH
(66) Reference is now made to
Example 8: Purine Remobilization is Also Reflected in Leaf Age
(67) Reference is made to
(68) Dark treatment stimulates remobilization of metabolites which should in part mimic processes that occur during ageing. To examine this, transcripts related to ureides synthesis were examined in wild type and XDH1 mutant plants over the entire plant life. With increasing age, rosette leaves of XDH mutant plants yellowed earlier than wild-type Col plants and exhibited a significantly higher fold level of the SAG12 transcript (
Example 9: Role of Xanthine and Ureides in Cellular Protection During Dark-Induced Stress
(69) Reference is made to
(70) Reference is also made to
(71) Reference is further made to
(72) These results show that application of 0.1-10 mM allantoin protects leaves from chlorophyll degradation and yellowing. According to one embodiment 0.1 mM of allantoin, 0.5 mM of allantoin or any concentration of allantoin in this range are sufficient to prevent yellowing.
Example 10: A Role for Ureides as Cellular Scavengers
(73) Reference is made to
(74) The concomitant accumulation of internal ROS as H.sub.2O.sub.2 was examined by application of 3,3-diaminobenzidine (DAB). Mutant Ri lines showed 50% more DAB staining after 24 h dark treatment (