Method of highly expressing target protein from plant using RbcS fusion protein and method of preparing composition for oral administration of medical protein using target protein expression plant body
10239928 ยท 2019-03-26
Assignee
Inventors
- Inhwan HWANG (Pohang-si, KR)
- Hyang Ju KANG (Pohang-si, KR)
- Eun Ju SOHN (Pohang-si, KR)
- Yong Jik LEE (Pohang-si, KR)
- Per-Olof Berggren (Pohang-si, KR)
- Yun Joo YOO (Pohang-si, KR)
- Jae Yoon KIM (Pohang-si, KR)
Cpc classification
C07K2319/75
CHEMISTRY; METALLURGY
C12N15/8241
CHEMISTRY; METALLURGY
C07K14/5759
CHEMISTRY; METALLURGY
C12N15/8257
CHEMISTRY; METALLURGY
C07K14/635
CHEMISTRY; METALLURGY
International classification
C12N15/82
CHEMISTRY; METALLURGY
Abstract
The present invention provides a plant expressing a target protein, a method of preparing the same and a method of preparing a composition for oral administration of a biopharmaceutical using the same. A target protein expression system using plant cells according to the present invention solves conventional problems in plant cell culture, provides a method of producing a large quantity of target proteins including a biopharmaceutical protein and allowing a target protein to have a resistance to a protease present in a digestive organ, and therefore is very effective to enable commercialization of plant-derived biopharmaceuticals.
Claims
1. A gene construct comprising, (a) an RbcS gene; and (b) a gene encoding a target protein operably linked in order, wherein the RbcS gene is a polynucleotide represented by SEQ ID NO: 1.
2. The gene construct of claim 1, wherein the target protein is any one or more proteins selected from the group consisting of an antigen, an antibody, an antibody fragment, a structural protein, a regulatory protein, a transcription factor, a toxin protein, a hormone, a hormone analogue, a cytokine, an enzyme, an enzyme inhibitor, a transport protein, a receptor, a fragment of a receptor, a defense inducer, a storage protein, a movement protein, and a reporter protein.
3. The gene construct of claim 1, further comprising: a promoter gene at the 5 end of the RbcS gene.
4. The gene construct of claim 3, wherein the promoter is selected from a 35S promoter derived from cauliflower mosaic virus, a 19S RNA promoter derived from cauliflower mosaic virus, a plant actin promoter, and a ubiquitin promoter.
5. The gene construct of claim 1, further comprising: a protein tag gene at the 3 end of the gene encoding the target protein.
6. The gene construct of claim 5, wherein the protein tag is any one selected from the group consisting of an Avi tag, a Calmodulin tag, a polyglutamate tag, an E tag, a FLAG tag, a HA tag, a His tag, an Myc tag, a S tag, a SBP tag, an IgG-Fc tag, a CTB tag, a Softag 1 tag, a Softag 3 tag, a Strep tag, a TC tag, a V5 tag, a VSV tag and an Xpress tag.
7. A recombinant expression vector comprising the gene construct of any one of claims 1, and 2 to 6.
8. A transformed plant body which is transformed with the recombinant expression vector of claim 7.
9. The transformed plant body of claim 8, wherein the plant body is selected from rice, wheat, barley, corn, bean, potato, red bean, oat and sorghum; vegetable crops including Arabidopsis thaliana, Chinese cabbage, white radish, pepper, strawberry, tomato, watermelon, cucumber, cabbage, oriental melon, pumpkin, spring onion, onion, and carrot; industrial crops including ginseng, tobacco, cotton, sesame, sugarcane, sugar beet, perilla, peanut, and rape; fruit crops including apple tree, pear tree, jujube tree, peach, grape, tangerine, persimmon, plum, apricot, and banana; and flower crops including rose, carnation, chrysanthemum, lily, and tulip.
10. A method of preparing a transformed plant body which expresses a target protein, comprising: constructing the recombinant expression vector of claim 7; and introducing the recombinant expression vector into the plant body.
11. The method of claim 10, wherein the introduction of the recombinant expression vector to a plant body is performed by any one or more methods selected from the group consisting of an Agrobacterium sp.-mediated method, particle gun bombardment, silicon carbide whiskers, sonication, electroporation and polyethylene glycol (PEG)-mediated transformation.
12. A method of producing a target protein, comprising: (a) constructing the recombinant expression vector of claim 7; (b) introducing the recombinant expression vector into a plant to prepare a transformed plant body; (c) culturing the transformed plant body; and (d) isolating and purifying the target protein from the transformed plant body or a culture solution.
13. The method of claim 12, wherein the plant is a plant from which an RbcS gene present in its genome is deleted.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The above and other objects, features and advantages of the present invention will become more apparent to those of ordinary skill in the art by describing exemplary embodiments thereof in detail with reference to the accompanying drawings, in which:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
DETAILED DESCRIPTION OF EXEMPLARY EMBODIMENTS
(12) Hereinafter, the present invention will be described in detail.
(13) As described above, to design a method capable of producing a large quantity of target proteins in plant cells, the inventors focused on protein domain fusion capable of stabilizing target proteins in cells, isolated an RbcS gene known to be stably present in the form of a protein complex in the chloroplast of Arabidopsis thaliana, and confirmed the fact that when the RbcS gene is fused, expression of target proteins in plant cells is increased (refer to Example 2).
(14) Therefore, the present invention provides an RbcS gene fragment which is characterized by improving the expression level of target proteins located downstream in plant cells.
(15) The RbcS gene may consist of an amino acid sequence of SEQ ID NO: 1. In addition, a variant of the base sequence is included in the scope of the present invention. Specifically, the gene may include a base sequence having 70% or more, preferably 80% or more, more preferably 90% or more, and most preferably 95% or more sequence homology with respect to the base sequence of SEQ ID NO: 1. The % sequence homology with respect to a polynucleotide is determined by comparing two optimally-arranged sequences with a comparative region, and a part of the polynucleotide sequence in the comparative region may include addition or deletion (that is, a gap) compared to a reference sequence (without addition or deletion) with respect to the optimal arrangement of two sequences.
(16) In addition, the present invention provides a gene construct for high expression of a target protein, in which (a) an RbcS gene; and (b) a target protein-encoding gene are operably linked in order.
(17) The gene construct of the present invention may further include a promoter gene at the 5 end of the RbcS gene.
(18) The gene construct of the present invention may further include a protein tag gene at the 3 end of a gene encoding a target protein.
(19) In the gene construct of the present invention, (a) a promoter gene; (b) an RbcS gene; (c) a gene encoding a target protein; and (d) a protein tag gene are operably linked in order.
(20) In this case, a promoter may be any one that can express a gene inserted in a plant body without a particular limitation, and is preferably selected from a 35S promoter derived from cauliflower mosaic virus, a 19S RNA promoter derived from cauliflower mosaic virus, a plant actin promoter and a ubiquitin promoter.
(21) The RbcS gene may be a gene encoding RbcS, and most preferably an RbcS gene represented by SEQ ID NO: 1, derived from Arabidopsis thaliana.
(22) Here, the target protein is a term referring to a protein to be produced, and is not limited to a specific protein. Specifically, the target protein may be any one or more selected from the group consisting of an antigen, an antibody, an antibody fragment, a structural protein, a regulatory protein, a transcription factor, a toxin protein, a hormone, a hormone analogue, a cytokine, an enzyme, an enzyme inhibitor, a transport protein, a receptor, a fragment of a receptor, a defense inducer, a storage protein, a movement protein, an exploitive protein and a reporter protein.
(23) In one exemplary embodiment of the present invention, as the target protein, parathyroid hormone (PTH) or leptin was used. However, the target protein of the present invention is not limited to leptin or PTH. The present invention may also be used in mass expression of various small peptide-like hormones such as human growth hormone, GLP1, Exendin-4, etc. The expressed protein may be isolated and purified from RbcS by introducing a specific protein degradation site into a fusion part with RbcS.
(24) In addition, the protein tag gene of the present invention may be any distinguishable tag without limitation in order to isolate and purify a protein. Specifically, the protein tag may be any one or more selected from the group consisting of an Avi tag, a Calmodulin tag, a polyglutamate tag, an E tag, a FLAG tag, a HA tag, a His tag, a Myc tag, a S tag, a SBP tag, an IgG-Fc tag, a CTB tag, a Softag 1 tag, a Softag 3 tag, a Strep tag, a TC tag, a V5 tag, a VSV tag and an Xpress tag.
(25) The present invention also provides a recombinant expression vector including the gene construct.
(26) The term recombinant is used to refer to cells that replicate heterologous nucleic acids, express the nucleic acids, or express a protein encoded by peptides, heterologous peptides or heterologous nucleic acids. Such recombinant cells may express one of sense and antisense genes or gene fragments, which have not been found in natural cells. In addition, while the recombinant cells may express a gene that is found in natural cells, the gene is modified, and reintroduced to cells by an artificial means.
(27) In the present invention, the RbcS gene sequence may be inserted into a recombinant expression vector. The term recombinant expression vector refers to a bacterial plasmid, a phage, a yeast plasmid, a plant cell virus, a mammalian cell virus or a different vector. Generally, any plasmid and vector may be used as long as they can be replicated and stabilized in hosts. The key feature of the expression vector is having a replication origin, a promoter, a marker gene and a translation control element.
(28) An expression vector including the RbcS gene sequence and suitable transcription/translation control signals may be constructed by a method known in the art. The method includes an in vitro recombinant DNA technique, a DNA synthesis technique and an in vivo recombination technique.
(29) The DNA sequence may be effectively linked to a suitable promoter in the expression vector to elicit mRNA synthesis. A vector suitable for expressing the DNA fragment according to the present invention and a gene encoding a target protein in plant cells is a pUC19-based plasmid or Ti plasmid vector.
(30) Exemplary examples of the recombinant vector of the present invention include a part of the vector when the vector is present in suitable hosts such as Agrobacterium tumefaciens, and a Ti-plasmid vector which can transfer the so-called T region to plant cells. A different type of Ti-plasmid vector is a protoplast capable of producing a new plant which suitably inserts current plant cells or hybrid DNA into a plant genome to transfer a hybrid DNA sequence. A particularly exemplary form of the Ti-plasmid vector is a so-called binary vector, which has been disclosed in European Patent (EP) No. 0120 516 B1 and U.S. Pat. No. 4,940,838. Another suitable vector that can be used to introduce the DNA according to the present invention into a plant host may be selected from viral vectors derived from a double-stranded plant virus (e.g., CaMV) and a single-stranded virus, for example, a non-competent plant virus vector. The use of such a vector may be particularly advantageous when it is difficult to properly transform a plant host.
(31) Examples of the suitable vectors may include, but are not limited to, a binary vector such as a 326 GFP or pCAMBIA-derived vector, and thus one of ordinary skill in the art can select any vector capable of expressing the DNA fragment according to the present invention and a gene encoding a target protein in plant cells.
(32) More specifically, the recombinant vector is a recombinant expression vector in which a promoter, the DNA fragment according to the present invention to improve an expression level of a target protein, and a gene encoding a target protein are operably linked in order to a conventional vector used in protein expression as a basic backbone.
(33) In addition, the expression vector may include a ribosome-binding site as a translation initiation site and a transcription terminator.
(34) The expression vector may include one or more selectable markers. The marker is a nucleic acid sequence conventionally having a characteristic selected by a conventional chemical method, and includes any gene capable of discriminating transformed cells from untransformed cells. Examples of such genes include, but are not limited to, genes having a resistance to herbicides such as glyphosate and phosphinothricin, genes having a resistance to antibiotics such as kanamycin, G418, bleomycin, hygromycin, and chloramphenicol, and aadA gene.
(35) In the recombinant vector of the present invention, the promoter may be a CaMV 35S, actin, ubiquitin, pEMU, MAS, histone promoter, or Clp promoter, but the present invention is not limited thereto. The promoter refers to a DNA region upstream from a structural gene, and a DNA molecule to which an RNA polymerase is bound to initiate transcription. The plant promoter is a promoter capable of initiating transcription in plant cells. The constitutive promoter is a promoter that is active under most of environmental conditions and developing stage or cell differentiation. Since the selection of transformants can be achieved by various types of tissue in various stages, in the present invention, a constitutive promoter is preferably used. Therefore, a constitutive promoter is not limited in selectability.
(36) In the recombinant vector of the present invention, a conventional terminator may be used, and may be, for example, nopaline synthase (NOS), rice amylase RAmy1 A terminator, phaseolin terminator, Octopine gene terminator of Agrobacterium tumefaciens, or E. coli rrnB1/B2 terminator, but the present invention is not limited thereto. In terms of the necessity of a terminator, such a region is generally known to increase certainty and efficiency of transcription in plant cells. Therefore, the use of a terminator is very preferable for the scope of the present invention.
(37) Host cells which can stably and sequentially clone and express the vector of the present invention in prokaryotic cells may be any host cells known in the art, and include, for example, E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus strains such as Bacillus subtilis and Bacillus thuringiensis, and Enterobacteriaceae strains such as Salmonella typhimurium, Serratia marcescens and various Pseudomonas sp.
(38) In addition, when the vector of the present invention is transformed in eukaryotic cells, as host cells, yeast cells (Saccharomyce cerevisiae), insect cells, human cells (e.g., a Chinese hamster ovary (CHO) cell line, W138, BHK, COS-7, 293, HepG2, 3T3, RIN and MDCK cell lines) or plant cells may be used. The host cells are preferably plant cells, and the plant may be selected from rice, wheat, barley, corn, bean, potato, red bean, oat and sorghum; vegetable crops including Arabidopsis thaliana, Chinese cabbage, white radish, pepper, strawberry, tomato, watermelon, cucumber, cabbage, oriental melon, pumpkin, spring onion, onion, and carrot; industrial crops including ginseng, tobacco, cotton, sesame, sugarcane, sugar beet, perilla, peanut, and rape; fruit crops including apple tree, pear tree, jujube tree, peach, grape, tangerine, persimmon, plum, apricot, and banana; and flower crops including rose, carnation, chrysanthemum, lily, and tulip.
(39) A method of delivering the vector of the present invention into host cells may be performed by, when host cells are prokaryotic cells, a CaCl.sub.2 method, a Hanahan method (Hanahan, D., J. Mol. Biol., 166:557-580(1983)) or electroporation. In addition, when host cells are eukaryotic cells, the vector may be injected into the host cells by microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, DEAE-dextran treatment, or gene bombardment.
(40) The present invention also provides a transformed plant body which is transformed with the recombinant expression vector and highly expresses a target protein.
(41) According to another exemplary embodiment of the present invention, the plant may be selected from rice, wheat, barley, corn, bean, potato, red bean, oat and sorghum; vegetable crops including Arabidopsis thaliana, Chinese cabbage, white radish, pepper, strawberry, tomato, watermelon, cucumber, cabbage, oriental melon, pumpkin, spring onion, onion, and carrot; industrial crops including ginseng, tobacco, cotton, sesame, sugarcane, sugar beet, perilla, peanut, and rape; fruit crops including apple tree, pear tree, jujube tree, peach, grape, tangerine, persimmon, plum, apricot, and banana; and flower crops including rose, carnation, chrysanthemum, lily, and tulip.
(42) The present invention also provides a method of preparing a transformed plant body for highly expressing a target protein, which includes constructing a recombinant expression vector; and introducing the recombinant expression vector into a plant body.
(43) For the introduction of the plant expression vector into plant cells or a plant body, any one method selected from the group consisting of an Agrobacterium sp.-mediated method, particle gun bombardment, sonication, electroporation and polyethylene glycol (PEG)-mediated transformation may be used. In one exemplary embodiment of the present invention, for transformation of an Arabidopsis thaliana protoplast, PEG-mediated transformation, and for construction of an Arabidopsis thaliana transformant, an Agrobacterium sp.-mediated method were used.
(44) The present invention also provides a method of producing a large quantity of target proteins using a plant transformed with the recombinant vector of the present invention.
(45) Specifically, the method of producing a target protein of the present invention includes (a) constructing the recombinant expression vector; (b) preparing a transformed plant body by introducing the recombinant expression vector into a plant; (c) culturing the transformed plant body; and (d) isolating and purifying a target protein from the transformed plant body or a culture solution.
(46) In the method of producing a target protein of the present invention, the plant may be a plant from which an RbcS gene present in the genome is deficient.
(47) The method of producing a target protein from the transformed plant cells may obtain a target protein from transformed cells after plant cells are transformed with the recombinant vector according to the present invention and culturing the cells for a suitable time to express the target protein. Here, a method of expressing the target protein is any method known in the art.
(48) In this method, a transformant was constructed with Arabidopsis thaliana, but the present invention is not limited thereto, and the method of the present invention can employ all of protoplasts isolated from dicotyledones or monocotyledones.
(49) The present invention provides a fusion protein including a target protein and an RbcS peptide fragment binding at the 5 end of the target protein.
(50) The fusion protein of the present invention forms a 500 to 800-kD large complex to have a resistance to a protease in a digestive organ.
(51) The present invention also provides a pharmaceutical composition for oral administration, which includes a fusion protein in which an RbcS peptide fragment is bound at the 5 end of a target protein as an active ingredient.
(52) The present invention also provides a pharmaceutical composition for oral administration, which includes a transformed plant body expressing a fusion protein in which an RbcS peptide fragment is bound at the 5 end of a target protein as an active ingredient.
(53) According to an exemplary embodiment of the present invention, the RbcS peptide fragment may be an amino acid sequence represented by SEQ ID NO: 2.
(54) Hereinafter, the present invention will be described in further detail with reference to examples. These examples are merely provided to exemplify the present invention, and it would be obvious to those of ordinary skill in the art as long as the scope of the present invention is not limited by these examples.
Example 1. Construction of Recombinant Expression Vector
(55) The inventors used a gene construct to which [35S promoter]-[RbcS gene]-[target protein gene]-[HA tag] was operably linked as an expression vector (
(56) In one example of the present invention, parathyroid hormone (PTH) was used as a target protein, and a method of constructing an expression vector is as follows. PCR was performed with the genomic DNA of Arabidopsis thaliana as a template using a forward primer consisting of a XbaI-RbcS N-terminal sequence (SEQ ID NO: 6) and a reverse primer consisting of a BamHI-RbcS C-terminal sequence (SEQ ID NO: 7) to amplify an RbcS gene. In addition, PCR was performed with PTH-contained plasmid DNA as a template using a forward primer consisting of a BamHI-PTH N-terminal sequence (SEQ ID NO: 8) and a reverse primer consisting of a XhoI-stop codon-HA C-terminal sequence (SEQ ID NO: 9) to amplify a HA-tag-fused PTH gene. The amplified PCR products were cleaved with XbaI/BamHI (the first PCR product) and BamHI/XhoI (the second PCR product) and purified, respectively. These two PCR products were cloned between a 35S promoter of cauliflower mosaic virus (SEQ ID NO: 3) and a NOS terminator in a 326 GFP (Arabidopsis Biological Resource Center, Ohio State University, Ohio, USA) plasmid cleaved with XbaI/XhoI, thereby constructing an expression vector RbcS:PTH:HA.
Example 2. Comparison of Protein Expression Effects of RbcS Fusion Vectors
(57) A transformant was prepared by introducing the expression vector prepared in Example 1 into the protoplast separated from a leaf of Arabidopsis thaliana, and amounts of RbcS-fusion proteins expressed from the transformant were compared by western blotting analysis.
(58) Specifically, 30 g of a cell lysate was mixed with an SDS sample buffer, heated, and then subjected to electrophoresis using a 10% SDS-PAGE gel. A separated protein was transferred to a PVDF membrane, and the reaction was blocked with 5% skim milk. Subsequently, the resulting product was reacted with anti-HA antibodies (1:1,000 dilution), and then reacted with horseradish peroxidase (HRP)-labeled secondary antibodies. Afterward, an ECL solution was treated according to a manufacturer's instruction manual.
Example 3. Analysis of Protein Expression Levels Due to RbcS Fusion in Plant Cells
(59) To confirm protein expression levels due to RbcS fusion, a plasmid gene in which an RbcS full length gene (SEQ ID NO: 1) was installed upstream PTH:HA, and as a control, a plasmid gene in which an RbcS transit peptide (SEQ ID NO: 10), instead of the RbcS full length gene, was installed upstream PTH:HA was used. These genes were introduced to protoplasts separated from leaves of Arabidopsis thaliana by PEG-mediated transformation and cultured for 24 hours, the protoplasts were collected, lysed and quantified, followed by western blotting analysis.
(60) Consequently, referring to
Example 4. Comparative Analysis of Protein Expression Levels Due to RbcS Fusion in Wild-Type Plants and RbcS Gene-Deleted Plants
(61) To analyze the expression level of the RbcS-fusion protein in RbcS gene-deficient plants, RbcS gene-deficient mutants of Arabidopsis thaliana were used as host cells.
(62) Specifically, after protoplasts were separated from leaves of wild-type Arabidopsis thaliana and RbcS gene-deficient mutant of Arabidopsis thaliana, respectively, the PTH:HA gene fused with the RbcS full length gene (SEQ ID NO: 1) was introduced to each protoplast by PEG-mediated transformation, and cultured for 24 hours to collect, lyse and quantify protoplasts, followed by western blotting analysis.
(63) As a result, referring to
Example 5. Construction of Transformed Plant Body Expressing RbcS Fusion Protein
(64) A transformed plant body which is improved in target protein expression due to RbcS fusion was constructed. A plasmid for transforming a plant body was constructed as follows. First, PCR was performed with plasmid DNA containing leptin as a template using a forward primer consisting of BamHI-leptin N-terminal sequence (SEQ ID NO: 12 GGATCCATGTGCTGGAGACCCCTG) and a reverse primer consisting of XhoI-stop codon-HA C-terminal sequence (SEQ ID NO: 13 ctcgagtcaggaagcgtaatctggaacatcgtatgggtaagcccgggggcattcagggctaacatccaac) to amplify a HA-tag-fused leptin gene. The amplified PCR product was cleaved with BamHI/XhoI, purified and then cloned in RbcS:PTH:HA plasmid DNA cleaved with BamHI/XhoI, thereby constructing RbcS:leptin:HA.
(65) A recombinant transformation vector was prepared by cloning a 35S promoter-RbcS:leptin:HA:NOS terminator-formed gene construct in a multi-cloning site of a pCAMBIA1300 vector by cleaving an RbcS:leptin:HA-contained region in the prepared recombinant vector using XbaI and EcoRI restriction enzymes. Subsequently, a transformed plant body was manufactured by Agrobacterium sp.-mediated transformation using the prepared recombinant transformation vector. Here, the plant body transformed with pCABIA1300, which is a basic vector of the prepared transformation vector was selected by the method of the present invention through a hygromycin resistance test. In addition, the plant body selected by the resistance test was subjected to western blotting to identify a line highly expressing a protein, thereby ensuring first generation transformants (
Example 6. Pepsin-Resistant Effect of RbcS-Fused Protein
(66) A transformed plant body of the RbcS-FL:leptin:HA as shown in Example 5 was manufactured and then a resistance against pepsin was investigated in vitro using the plant body.
(67) Specifically, after the corresponding transformed plant body was grown for approximately 4 weeks in a green house, leaves were harvested, freeze-dried and then grinded to manufacture a fine powder. A 10 mg aliquot of such a powder-type transformed plant body was mixed with a buffer with pH 2.0, and treated with 0, 200 or 400 ng/L of pepsin to perform a reaction at 37 C. for 30 minutes. Afterward, the sample was cooled on ice for approximately 10 minutes to reduce the activity of pepsin, and treated with a 1.5 M Tris buffer with pH 8.8 to raise pH and then reduce the activity of pepsin again. Subsequently, cells were disrupted by sonication, mixed with a buffer and boiled for 10 minutes to remove a debris by centrifugation at 14,000 rpm. After then, the sample corresponding to 100 g was quantified and subjected to SDS-PAGE and then western blotting. As controls to compare a resistance of the fusion protein according to pepsin treatment, an ER protein, which was a chaperone-binding protein (BiP), and a chloroplast protein for forming a complex protein, which was a chlorophyll a-b binding protein (Lhcb4), were used. As a result, referring to
(68) Here, it was confirmed that the RbcS-fusion protein exhibited a degradation resistance according to pepsin treatment per concentration, and subsequently, the degradation was examined with a reaction time variation of 30 minutes, 1 hour and 2 hours with respect to 400 ng/L pepsin. Consequently, referring to
Example 7. Confirmation of Stability of RbcS-Leptin in Digestive Tract
(69) To measure the stability of RbcS-FL:leptin:HA protein in a digestive tract, the protein was given to a mouse by a forced diet, and food was obtained from the stomach and the small intestine, followed by western blotting.
(70) Subsequently, leaves of an RbcS-FL:leptin:HA-transformed plant body were freeze-dried under liquid nitrogen, and grinded to manufacture a fine powder. The powder was suspended in PBS, and to exactly control a time in the digestive tract, 80 mg (based on leaf dry weight) of the suspension per individual was directly administered to the stomach of each C57BL/6 mouse (n=5) using zoned. 30 minutes after the administration, food was obtained from the stomach and the small intestine, added to an RIPA lysis buffer, and disrupted by sonication. Cell debris was removed by centrifugation (14,000g). Following Bradford protein quantification, 20 g of a protein was loaded in an SDS-PAGE gel to perform western blotting. HA antibodies were used to identify the presence of the RbcS-FL:leptin:HA.
(71) Consequently, referring to
Example 8. Confirmation of Rubisco Complex of RbcS-Fused Protein
(72) To confirm whether the RbcS-FL:leptin:HA prepared in the above-described example still forms a rubisco complex regardless of the fusion of a leptin gene, Blue-Native polyacrylamide gel electrophoresis (PAGE) was performed.
(73) The Blue-Native PAGE analysis is a method of confirming a polymer-form protein, and specifically included the following process. After the transformed plant body was grown in a green house for approximately 4 weeks, leaves were collected therefrom, freeze-dried, and grinded to manufacture a fine powder. 10 mg aliquot of the powder-type transformed plant body was mixed with a Bis-Tris buffer, the cells were disrupted by sonication, quantified and then lysed with a non-ionic detergent, which was n-dodecyl -D-maltoside. Afterward, following mixing with Coomassie brilliant blue-G250 (CBB-G), electrophoresis was performed in a Blue-Native gel in a 4 to 16% concentration gradient, and then western blotting was performed by the same method as described in the above-described example.
(74) Consequently, referring to
Example 9. Confirmation of Formation of Rubisco Complex of RbcS-Fused Protein with Different Target Protein
(75) As confirmed in Example 8, to further clarify that an RbcS-fusion target protein forms a rubisco complex, an experiment was performed on a different target protein, except leptin.
(76) Specifically, the leptin:HA part was removed from the RbcS-leptin:HA recombinant vector, and a DNA fragment in which exendin-4 (SEQ ID NO: 14) and a GM1-binding peptide (G15) (SEQ ID NO: 16) were fused was recombined with the resulting vector (RFeEx4fG15). The prepared recombinant vector was introduced to a protoplast separated from a leaf of Arabidopsis thaliana by PEG-mediated transformation, and an amount of the RbcS-fusion protein expressed after 24 hours was detected by western blotting analysis. Consequently, referring to
(77) In addition, to confirm whether the target fusion protein (RFeEx4fG15) forms a rubisco complex, a recombinant vector was introduced to a protoplast by the above-described method, and Blue native-PAGE was performed. As a result, referring to
(78) Therefore, the present invention provides a plant for expressing a target protein, a method of preparing the same, and a method of producing a target protein using the same. According to the present invention, a target protein can be highly expressed at high efficiency from a plant body and thus can be applied to mass production of an industrial or medical protein using a plant body. Particularly, the plant can be applied to produce a protein drug for oral administration and prepare a pharmaceutical composition for oral administration without isolation and purification of the produced protein.
(79) Above, the present invention has been described with reference to exemplary examples, but it can be understood by those of ordinary skill in the art that the present invention may be changed and modified in various forms without departing from the spirit and scope of the present invention which are described in the accompanying claims.