Production of encoded chemical libraries
10240147 · 2019-03-26
Assignee
Inventors
- Willy Decurtins (Horgen, CH)
- Raphael Franzini (Zürich, CH)
- Dario Neri (Buchs, CH)
- Jörg Scheuermann (Wurenlos, CH)
- Moreno Wichert (Wangen-Nuolen, CH)
Cpc classification
C12N15/1068
CHEMISTRY; METALLURGY
C40B40/06
CHEMISTRY; METALLURGY
International classification
C12N15/10
CHEMISTRY; METALLURGY
C40B40/06
CHEMISTRY; METALLURGY
Abstract
This invention relates to the synthesis of nucleic acid-encoded chemical libraries using common adaptor sequences. Nucleic acid strands coupled to chemical moieties may be contacted with identifier oligonucleotides comprising coding sequences encoding the chemical moieties and an adaptor oligonucleotides, such that the adaptor oligonucleotide hybridizes to both the nucleic acid strands and the identifier oligonucleotides to allow ligation of the identifier oligonucleotides to the nucleic acid strands. The adaptor oligonucleotide is then removed. Nucleic acid-encoded chemical libraries, and methods of producing or screening such libraries are provided.
Claims
1. A method of producing a nucleic acid encoded chemical library comprising; (i) producing a sub-library according to a method comprising; (a) providing a population of first nucleic acid strands, each nucleic acid strand being coupled or couplable to a member of a first diverse population of chemical moieties and comprising a non-hybridisable spacer, (b) contacting the first nucleic acid strands with identifier oligonucleotides comprising a first coding sequence and one or more adaptor oligonucleotides, such that the one or more adaptor oligonucleotides hybridize to the nucleic acid strands and the identifier oligonucleotides to form a partially double-stranded complex, wherein each first nucleic acid strand is contacted with an identifier oligonucleotide comprising a first coding sequence that encodes a chemical moiety that is coupled or couplable to the first nucleic acid strand, and; wherein each of said one or more adaptor oligonucleotides hybridizes to more than one first nucleic acid strand in the population and more than one different identifier oligonucleotide, (c) ligating the first nucleic acid strands to the identifier oligonucleotides in the partially double-stranded complexes, such that the identifier oligonucleotides are incorporated into the first nucleic acid strands, thereby producing a sub-library comprising first nucleic acid strands coupled or couplable to a member of a diverse population of chemical moieties, wherein each first nucleic acid strand comprises a first coding sequence that encodes the chemical moiety that is coupled to the first nucleic acid strand and the non-hybridisable spacer; (ii) hybridizing the first nucleic acid strands to second nucleic acid strands to form double-stranded complexes, wherein the second nucleic acid strands are coupled to a second diverse population of chemical moieties, each second nucleic acid strand comprising a second coding sequence that encodes the chemical moiety that is coupled to it, the position of the second coding sequence in the second nucleic acid strands corresponding in the double-stranded complex to the position of the spacer in the first nucleic acid strands in the double-stranded complexes, such that the second coding sequences do not preferentially hybridise to the first nucleic acid strands, and (iii) extending the second nucleic acid strands along the nucleic acid strands to produce a library comprising members having a double strand nucleic acid molecule comprising the first and second nucleic acid strands; the first diverse population of chemical moieties being coupled to the first nucleic acid strands and the second diverse population of chemical moieties being coupled to the second nucleic acid strands, said chemical moieties form pharmacophores in the library members, wherein each second nucleic acid strand comprises first and second coding sequences that encode the chemical moieties from the first and second diverse populations.
2. A method according to claim 1 wherein the adaptor oligonucleotide is removed after the ligation by cleaving said adaptor oligonucleotide.
3. A method according to claim 2 wherein the adaptor oligonucleotide comprises one or more ribonucleotide bases.
4. A method according to claim 1 wherein the spacer comprises an abasic linker.
5. A method according to claim 4 wherein the abasic linker is an abasic deoxyribose phosphate linker.
6. A method of producing a nucleic acid encoded chemical library comprising; (i) providing a sub-library of first nucleic acid strands coupled to first and second diverse populations of chemical moieties (first and second chemical moieties), wherein each first nucleic acid strand comprises a first coding sequence which encodes the member of the first diverse population of chemical moieties that is coupled to the first nucleic acid strand, (ii) contacting the first nucleic acid strands with an adaptor oligonucleotide and first identifier oligonucleotides comprising coding sequences, such that the adaptor oligonucleotide hybridizes to the first nucleic acid strands and the first identifier oligonucleotides to form partially double-stranded complexes, wherein each first nucleic acid strand is contacted with a first identifier oligonucleotide comprising a coding sequence which encodes the member of the second population of chemical moieties that is coupled to the first nucleic acid strand, and; wherein all the first nucleic acid strands in the sub-library are contacted with the same adaptor oligonucleotide, (iii) ligating the first nucleic acid strands to the first identifier oligonucleotides in the complexes, such that the second coding sequences are incorporated into the first nucleic acid strands; (iv) contacting the first nucleic acid strands with a nucleic acid spacer strand, second identifier oligonucleotides, and a sub-library of second nucleic acid strands coupled to a third diverse population of chemical moieties (third chemical moieties), thereby forming partially double-stranded complexes, wherein each first nucleic acid strand is contacted with a second identifier oligonucleotide comprising a third coding sequence that encodes the member of the third population of chemical moieties that is coupled to the second nucleic acid strand, and; wherein all the nucleic acid strands in the population are contacted with the same nucleic acid spacer strand, (v) ligating the first nucleic acid strand to the second identifier oligonucleotide such that the third coding sequence is incorporated into the nucleic acid strand; and, (vi) optionally ligating the second nucleic acid strand to the nucleic acid spacer strand, wherein the nucleic acid spacer strand comprises; a) a first hybridization portion which hybridizes to the first nucleic acid strand, b) a non-hybridizable spacer at a position that corresponds, when the first nucleic acid strand and the nucleic acid spacer strand are hybridised together, to the position of the second coding sequence in the first nucleic acid strand c) a second hybridization portion which hybridizes to the first nucleic acid strand; and, d) a complementary annealing region which hybridizes to the second identifier oligonucleotide; and wherein the second nucleic acid strand comprises; a) a first hybridization portion which hybridizes to the first nucleic acid strand, b) a non-hybridizable spacer at a position that corresponds, when the first and second strands are hybridised together, to the position of the first coding sequence in the first nucleic acid strand; and c) a second hybridization portion which hybridizes to the first nucleic acid strand thereby producing a library comprising pharmacophores labelled with double-stranded nucleic acid molecules comprising first and second nucleic acid strands.
7. A method according to claim 6 wherein the adaptor oligonucleotide is removed after the ligation by cleaving said adaptor oligonucleotide.
8. A method according to claim 7 wherein the adaptor oligonucleotide comprises one or more ribonucleotide bases.
9. A method according to claim 6 wherein the spacer comprises an abasic linker.
10. A method according to claim 9 wherein the abasic linker is an abasic deoxyribose phosphate linker.
11. A method of producing a nucleic acid encoded chemical library comprising; (i) providing a sub-library of first nucleic acid strands coupled to first and second diverse populations of chemical moieties (first and second chemical moieties), wherein each first nucleic acid strand comprises a first coding sequence which encodes the member of the first diverse population of chemical moieties that is coupled to the first nucleic acid strand, (ii) contacting the first nucleic acid strands with an adaptor oligonucleotide and first identifier oligonucleotides comprising coding sequences, such that the adaptor oligonucleotide hybridizes to the first nucleic acid strands and the first identifier oligonucleotides to form partially double-stranded complexes, wherein each first nucleic acid strand is contacted with a first identifier oligonucleotide comprising a coding sequence which encodes the member of the second population of chemical moieties that is coupled to the first nucleic acid strand, and; wherein all the first nucleic acid strands in the sub-library are contacted with the same adaptor oligonucleotide, (iii) ligating the first nucleic acid strands to the first identifier oligonucleotides in the complexes, such that the second coding sequences are incorporated into the first nucleic acid strands; (iv) contacting the first nucleic acid strands with one or more nucleic acid spacer strands, second identifier oligonucleotides, and a sub-library of second nucleic acid strands coupled to a third diverse population of chemical moieties (third chemical moieties), thereby forming partially double-stranded complexes, wherein each first nucleic acid strand is contacted with a second identifier oligonucleotide comprising a third coding sequence that encodes the member of the third population of chemical moieties that is coupled to the second nucleic acid strand, and wherein the second nucleic acid strands, nucleic spacer strand and second identifier oligonucleotides hybridise to the first nucleic acid strand to form a double-stranded complex having a 5 overhang comprising the third coding sequence; wherein each spacer strand hybridizes to more than one first nucleic acid strand in the population and more than one different second identifier oligonucleotide, (v) extending the first nucleic acid strand along the second identifier oligonucleotide to incorporate the complement of the third coding sequence into the first nucleic acid strand; and, (vi) optionally ligating the second nucleic acid strands to the nucleic acid spacer strands and the second identifier oligonucleotides, thereby producing a library comprising pharmacophores labelled with double-stranded nucleic acid molecules comprising first and second nucleic acid strands, wherein the nucleic acid spacer strand comprises; a) a first hybridization portion which hybridizes to the first nucleic acid strand, b) a non-hybridizable spacer at a position that corresponds, when the first nucleic acid strand and the nucleic acid spacer strand are hybridised together, to the position of the second coding sequence in the first nucleic acid strand c) a second hybridization portion which hybridizes to the first nucleic acid strand; and wherein the second nucleic acid strand comprises; a) a first hybridization portion which hybridizes to the first nucleic acid strand, b) a non-hybridizable spacer at a position that corresponds, when the first and second strands are hybridised together, to the position of the first coding sequence in the first nucleic acid strand; and c) a second hybridization portion which hybridizes to the first nucleic acid strand.
12. A method according to claim 11 wherein the adaptor oligonucleotide is removed after the ligation by cleaving said adaptor oligonucleotide.
13. A method according to claim 12 wherein the adaptor oligonucleotide comprises one or more ribonucleotide bases.
14. A method according to claim 11 wherein the spacer comprises an abasic linker.
15. A method according to claim 14 wherein the abasic linker is an abasic deoxyribose phosphate linker.
16. A method of producing a nucleic acid encoded chemical library comprising; (i) providing a sub-library of first nucleic acid strands coupled to first and second diverse populations of chemical moieties (first and second chemical moieties), wherein each first nucleic acid strand comprises a first coding sequence which encodes the member of the first diverse population of chemical moieties that is coupled to the first nucleic acid strand, (ii) contacting the first nucleic acid strands with an adaptor oligonucleotide and first identifier oligonucleotides comprising coding sequences, such that the adaptor oligonucleotide hybridizes to the first nucleic acid strands and the first identifier oligonucleotides to form partially double-stranded complexes, wherein each first nucleic acid strand is contacted with a first identifier oligonucleotide comprising a coding sequence which encodes the member of the second population of chemical moieties that is coupled to the first nucleic acid strand, and; wherein all the first nucleic acid strands in the sub-library are contacted with the same adaptor oligonucleotide, (iii) ligating the first nucleic acid strands to the first identifier oligonucleotides in the complexes, such that the second coding sequences are incorporated into the first nucleic acid strands; (iv) contacting the first nucleic acid strands with a sub-library of second nucleic acid strands coupled to a third diverse population of chemical moieties (third chemical moieties), thereby forming partially double-stranded complexes, wherein each second nucleic acid strand comprises first and second non-hybridizable spacer regions at positions corresponding to the first and second coding sequences in the first nucleic acid strand and a third coding sequence that encodes the member of the third population of chemical moieties that is coupled to the second nucleic acid strand, and wherein the second nucleic acid strands hybridise to the first nucleic acid strand to form a double-stranded complex having a 5 overhang comprising the third coding sequence; (v) extending the first nucleic acid strand along the second nucleic acid strand to incorporate the complement of the third coding sequence into the first nucleic acid strand; thereby producing a library comprising pharmacophores labelled with double-stranded nucleic acid molecules comprising first and second nucleic acid strands.
17. A method according to claim 16 wherein the sub-library of second nucleic acid strands is produced by a method comprising; (a) providing a second nucleic acid strand having a third chemical moiety coupled thereto, wherein the second nucleic acid strand comprises a first non-hybridizable spacer region at a position corresponding to the first coding sequence in the first nucleic acid strand, (b) contacting the second nucleic acid strand with an adaptor oligonucleotide and a nucleic acid spacer strand comprising a second non-hybridizable spacer region at a position corresponding to the second coding sequence in the first nucleic acid strand, such that the adaptor oligonucleotide hybridizes to the second nucleic acid strand and the nucleic acid spacer strand to form a partially double-stranded complex, (c) ligating the second nucleic acid strand to the nucleic acid spacer strand in the complex, such that the second non-hybridizable spacer region is incorporated into the second nucleic acid strand; (d) contacting the second nucleic acid strand with an adaptor oligonucleotide and a second identifier oligonucleotide comprising a third coding sequence that encodes the third chemical moiety, such that the adaptor oligonucleotide hybridizes to the second nucleic acid strand and the second identifier oligonucleotide to form a partially double-stranded complex, (e) ligating the second nucleic acid strand to the second identifier oligonucleotide in the complex, such that the third coding sequence is incorporated into the second nucleic acid strand; (f) repeating steps (a) to (e) in series or in parallel using different third chemical moieties and third coding sequences and the same adaptor oligonucleotide to produce a diverse population of third chemical moieties coupled to second nucleic acid strands, each third chemical moiety being coupled to a second nucleic acid strand which comprises first and second spacer regions and a third coding sequence encoding the third chemical moiety coupled thereto.
18. A method according to claim 16 wherein the adaptor oligonucleotide is removed after the ligation by cleaving said adaptor oligonucleotide.
19. A method according to claim 18 wherein the adaptor oligonucleotide comprises one or more ribonucleotide bases.
20. A method according to claim 16 wherein the spacer region comprises an abasic linker.
21. A method according to claim 20 wherein the abasic linker is an abasic deoxyribose phosphate linker.
22. A method of producing a nucleic acid encoded chemical library comprising; (i) providing a sub-library of first nucleic acid strands coupled to first and second diverse populations of chemical moieties (first and second chemical moieties), wherein each first nucleic acid strand comprises a first coding sequence which encodes the member of the first diverse population of chemical moieties that is coupled to the first nucleic acid strand, (ii) contacting the first nucleic acid strands with one or more nucleic acid spacer strands and first identifier oligonucleotides comprising coding sequences, such that the first nucleic acid spacer strand hybridizes to the first nucleic acid strands and the first identifier oligonucleotides to form partially double-stranded complexes, wherein each first nucleic acid strand is contacted with a first identifier oligonucleotide comprising a second coding sequence which encodes the member of the second population of chemical moieties that is coupled to the first nucleic acid strand, and; wherein each nucleic acid spacer strand hybridizes to more than one first nucleic acid strand in the population and more than one different first identifier oligonucleotide, (iii) ligating the first nucleic acid strands to the first identifier oligonucleotides in the complexes, such that the second coding sequences are incorporated into the first nucleic acid strands; (iv) contacting the first nucleic acid strands hybridised to the nucleic acid spacer strand with a sub-library of second nucleic acid strands coupled to a third diverse population of chemical moieties (third chemical moieties) and second identifier oligonucleotides, thereby forming double-stranded complexes, wherein each first nucleic acid strand is contacted with a second identifier oligonucleotide that comprises a third coding sequence that encodes the member of the third population of chemical moieties that is coupled to the second nucleic acid strand that is contacted therewith, and; (v) ligating the first nucleic acid strand to the second identifier oligonucleotide such that the third coding sequence is incorporated into the nucleic acid strand; and, (vi) optionally ligating the second nucleic acid strand to the nucleic acid spacer strand, wherein the nucleic acid spacer strand comprises; a) a first hybridization portion which hybridizes to the first nucleic acid strand, b) a first non-hybridizable spacer at a position that corresponds, when the first nucleic acid strand and the nucleic acid spacer strand are hybridised together, to the position of the second coding sequence in the first nucleic acid strand, c) a second hybridization portion which hybridizes to the first nucleic acid strand; d) a first annealing region which hybridizes to the second identifier oligonucleotide, e) a second non-hybridizable spacer at a position that corresponds, when the second identifier oligonucleotide and the nucleic acid spacer strand are hybridised together, to the position of the third coding sequence in the second identifier oligonucleotide and; f) a second annealing region which hybridizes to the second identifier oligonucleotide; and wherein the second nucleic acid strand comprises; a) a first hybridization portion which hybridizes to the first nucleic acid strand, b) a non-hybridizable spacer at a position that corresponds, when the first and second strands are hybridised together, to the position of the first coding sequence in the first nucleic acid strand; and c) a second hybridization portion which hybridizes to the first nucleic acid strand thereby producing a library comprising pharmacophores labelled with double-stranded nucleic acid molecules comprising first and second nucleic acid strands.
23. A method according to claim 22 wherein the spacer comprises an abasic linker.
24. A method according to claim 23 wherein the abasic linker is an abasic deoxyribose phosphate linker.
25. A method of producing a nucleic acid encoded chemical library according comprising; (i) providing a sub-library of first nucleic acid strands coupled to first and second diverse populations of chemical moieties (first and second chemical moieties), wherein each first nucleic acid strand comprises a first coding sequence which encodes the member of the first diverse population of chemical moieties that is coupled to the first nucleic acid strand, (ii) contacting the first nucleic acid strands with one or more nucleic acid spacer strands and first identifier oligonucleotides comprising coding sequences, such that the first nucleic acid spacer strand hybridizes to the first nucleic acid strands and the first identifier oligonucleotides to form partially double-stranded complexes, wherein each first nucleic acid strand is contacted with a first identifier oligonucleotide comprising a second coding sequence which encodes the member of the second population of chemical moieties that is coupled to the first nucleic acid strand, and; wherein each nucleic acid spacer strand hybridizes to more than one first nucleic acid strand in the population and more than one different first identifier oligonucleotide, (iii) ligating the first nucleic acid strands to the first identifier oligonucleotides in the complexes, such that the second coding sequences are incorporated into the first nucleic acid strands; (iv) contacting the first nucleic acid strands with a sub-library of second nucleic acid strands coupled to a third diverse population of chemical moieties (third chemical moieties), thereby forming double-stranded complexes, wherein each first nucleic acid strand is contacted with a second nucleic acid strand comprising a third coding sequence that encodes the member of the third population of chemical moieties that is coupled to the second nucleic acid strand, and the double-stranded complexes have a 5 overhang comprising the third coding sequence, (v) extending the first nucleic acid strand along the second nucleic acid strand to incorporate the complement of the third coding sequence into the first nucleic acid strand; and, wherein the second nucleic acid strand comprises; a) a first hybridization portion which hybridizes to the first nucleic acid strand, b) non-hybridizable spacers at positions that correspond, when the first and second strands are hybridised together, to the position of the first and second coding sequences in the first nucleic acid strand; and c) a second hybridization portion which hybridizes to the first nucleic acid strand; thereby producing a library comprising pharmacophores labelled with double-stranded nucleic acid molecules comprising first and second nucleic acid strands.
26. A method according to claim 25 wherein the spacer comprises an abasic linker.
27. A method according to claim 26 wherein the abasic linker is an abasic deoxyribose phosphate linker.
Description
(1) Certain aspects and embodiments of the invention will now be illustrated by way of example and with reference to the figures described below.
(2)
(3) The encoded chemical library member, which contains a pharmacophore comprising two chemical moieties, can then be used for selection experiments on a target of interest. Following selection, candidate chemical library members are decoded by PCR amplification of the partner nucleic acid strand, which contains the coding sequences of both chemical moieties. The spacer region located in the nucleic acid strand prevents amplification of this strand.
(4)
(5)
(6)
(7) Here, a nucleic acid strand is first coupled to first and second chemical moieties (building blocks). The nucleic acid strand contains a first coding sequence (codeA) encoding a first chemical moiety. The nucleic acid strand is then contacted with a nucleic acid spacer strand and a first identifier oligonucleotide to form a complex. The first identifier oligonucleotide contains a second coding sequence encoding the identity of the second chemical moiety. The nucleic acid spacer strand contains first and second non-hybridizable spacer regions at a position in the nucleic acid spacer strand corresponding to the position of the second coding sequence in and a further, third coding sequence in the nucleic acid strand. The nucleic acid spacer strand hybridizes to the nucleic acid strand and first identifier oligonucleotide through complementary regions. The nucleic acid strand is then ligated to the first identifier oligonucleotide. The complex comprising the nucleic acid spacer strand and nucleic acid strand is then contacted with a second identifier oligonucleotide and partner nucleic acid strand, which hybridize through complementary regions to form a complex. In the complex each coding region is located in a position corresponding to a non-hybridizable spacer region. The partner nucleic acid strand is coupled to a third chemical moiety and contains a spacer region at a position in the nucleic acid partner strand corresponding to the position of the first coding sequence in the nucleic acid strand. The second identifier oligonucleotide contains a third coding sequence encoding the identity of the third chemical moiety.
(8) The partner nucleic acid strand may be ligated to the nucleic acid spacer strand and the second identifier oligonucleotide is ligated to the nucleic acid strand.
(9)
(10) A nucleic acid strand is first coupled to first and second chemical moieties (building blocks). The nucleic acid strand contains coding sequence (codeA) encoding the first chemical moiety. A cleavable chimeric adaptor is used to couple an identifier oligonucleotide to the distal end of the nucleic acid strand with respect to the moieties. The identifier oligonucleotide contains a coding sequence (codeB) which encodes the identity of the second chemical moiety attached to the nucleic acid strand. The adaptor hybridizes to complementary bases on the distal end of the nucleic acid strand and proximal end of the identifier oligonucleotide forming a complex between identifier oligonucleotide, nucleic acid strand and adaptor. This brings an end of the identifier oligonucleotide into proximity to an end of the nucleic acid strand, such that ligation can occur under suitable conditions. The ends of the identifier oligonucleotide and nucleic acid strand are then ligated and the adaptor is removed. The nucleic acid strand is then contacted with a partner nucleic acid strand, a nucleic acid spacer strand and a second identifier oligonucleotide to form a complex. The partner nucleic acid strand is coupled to a third chemical moiety. The partner nucleic acid strand hybridizes to the nucleic acid strand through complementary regions and includes a spacer region which does not hybridize to a coding region (codeA) of the nucleic acid strand. The nucleic acid spacer strand also hybridises to the nucleic acid strand and includes a spacer region which does not hybridize to the further coding region (codeB) of the nucleic acid strand. The second identifier oligonucleotide contains a coding sequence (codeC) encoding the identity of the third chemical moiety. The proximal end of the second identifier oligonucleotide hybridises to complementary regions at the distal end of the nucleic acid strand to produce a 5 overhang that contains the coding sequence (codeC). The nucleic acid strand is then extended along the second identifier oligonucleotide using a polymerase. The second identifier oligonucleotide may be ligated to the nucleic acid strand and the nucleic acid spacer strand. Coding information for all three chemical moieties in the pharmacophore is now encoded on the nucleic acid strand.
(11)
(12) A nucleic acid strand is first coupled to first and second chemical moieties (building blocks). The nucleic acid strand contains a first coding sequence (codeA) encoding the first chemical moiety. A cleavable chimeric adaptor is used to couple an identifier oligonucleotide to the distal end of the nucleic acid strand with respect to the moieties. The identifier oligonucleotide contains a second coding sequence (codeB) which encodes the identity of the second chemical moiety attached to the nucleic acid strand. The adaptor hybridizes to complementary bases on the distal end of the nucleic acid strand and proximal end of the identifier oligonucleotide forming a complex between identifier oligonucleotide, nucleic acid strand and adaptor. This brings an end of the identifier oligonucleotide into proximity to an end of the nucleic acid strand, such that ligation can occur under suitable conditions. The ends of the identifier oligonucleotide and nucleic acid strand are then ligated and the adaptor is removed.
(13) A partner nucleic acid strand is coupled to a third chemical moiety. The partner nucleic acid strand contains a first spacer region (d-spacer) at a position corresponding to the first coding sequence (codeA) of the nucleic acid strand. The first spacer region does not hybridize to the first coding sequence (codeA).
(14) A first cleavable chimeric adaptor is used to couple a nucleic acid spacer strand to the distal end of the partner nucleic acid strand with respect to the third chemical moiety. The nucleic acid spacer strand is capable of hybridizing to the nucleic acid strand and contains a second spacer region (d-spacer II) at a position corresponding to the second coding sequence (codeB) of the nucleic acid strand. The second spacer region does not hybridize to the coding sequence (codeB).
(15) A second cleavable chimeric adaptor is used to couple a second identifier oligonucleotide to the distal end of the partner nucleic acid strand with respect to the third chemical moiety (i.e. the second identifier oligonucleotide is coupled to the 5 end of the nucleic acid spacer strand). The second identifier oligonucleotide contains a third coding sequence (codeC) encoding the identity of the third chemical moiety. The first and second cleavable chimeric adaptors are then removed by purification, RNAse or pH to leave a partner nucleic acid strand comprising a third coding sequence and first and second spacer regions at positions corresponding to the first and second coding sequences of the nucleic acid strand.
(16) The nucleic acid strand and the partner nucleic acid strand are then hybridized together through complementary regions in the strands to form a complex (
(17)
(18)
(19)
(20)
EXPERIMENTS
Example 1: Construction of a Sub-Library of Oligonucleotide-Compound Conjugates Using 3-Aminomodified, 5-Phosphorylated Oligonucleotides
(21) Synthetic oligonucleotides were purchased from various commercial suppliers. They were stored as 1 mM and 100 M stock solutions in at 20 C. Chemical compounds were purchased from various commercial suppliers. Enzymes were purchased from various commercial suppliers.
(22) 1.1 Agarose and Polyacrylamide Gel Electrophoresis
(23) DNA consisting of 10 to 300 nucleotides was analyzed on native polyacrylamide 20% TBE gels (1.0 mm, 12 well, Invitrogen) or on denaturing polyacrylamide 15% TBE-Urea gels (1.0 mm, 12 well, Invitrogen). A current of 60 mA with a voltage of 180 V was applied for 75 minutes on the electrophoresis box (Novex). The gels were stained with SYBR Green I. Preparative gel electrophoresis was performed on 2.0% agarose/TBE gels (stained with ethidium bromide) using 60 mA and 100 V for 25 minutes. SYBR Green I and ethidium bromide were detected by UV excitation.
(24) 1.2 Synthesis of Fmoc-Protected Amino Acid and Carboxylic Acid Oligonucleotide Conjugates
(25) 12.5 l 100 mM Fmoc-protected amino acids or carboxylic acids (1.25 mol in dry dimethyl sulfoxide [DMSO]) were activated for 30 min at 30 C. with 12 l 100 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, 1.2 mol) and 10 l 333 mM N-hydroxysulfosuccinimide (S-NHS, 3.3 mol, in DMSO/H2O, 2:1) in 215 l dry DMSO and subsequently reacted overnight at 30 C. with 5 l of amino-modified oligonucleotide (5 nmol) dissolved in 50 l 500 mM triethylamine/hydrogen chloride (TEA/HCl, 25 mol, pH=10.0). Carboxylic acids were quenched with 20 l 500 mM Tris/HCl (pH=8.1) at 30 C. for 1 h. Fmoc-protected amino acids were quenched and concurrently deprotected with 5 l 1 M tris(hydroxymethyl)aminomethane (Tris) and 5 l pure TEA at 30 C. for 1 h. After quenching and deprotection, the DNA-compound conjugate was precipitated with ethanol (see protocol for ethanol precipitation for compound-conjugates) before purifying by HPLC. The separated and collected compound conjugates were vacuum-dried overnight, redissolved in 100 l H.sub.2O, and analyzed by ESI-MS.
(26) 1.3 Synthesis of Sulfonamide Oligonucleotide Conjugates
(27) 25 l 100 mM sulfonyl chloride (2.5 mol in dry acetonitrile [MeCN]) were mixed with 25 l 1 M sodium hydrogen carbonate in H2O (pH=9.0), 100 l MeCN, 95 l H2O and subsequently reacted with 5 l of the amino-modified oligonucleotide (5 nmol) overnight at 30 C. The reaction was quenched with 20 l 500 mM Tris/HCl (pH=8.1) at 30 C. for 1 h. After quenching the DNA-compound conjugate was precipitated with ethanol (see protocol for ethanol precipitation for compound-conjugates) before purification by HPLC. The separated and collected compound conjugates were vacuum-dried overnight, redissolved in 100 l H2O, and analyzed by ESI-MS.
(28) 1.4 Synthesis of Oligonucleotide Conjugates from Carboxylic Acid Anhydrides
(29) 5.2 l 100 mM carboxylic acid anhydrides (25 l, 2.5 mol in dry DMSO) were mixed together with 25 l 500 mM sodium hydrogen phosphate in H2O (pH=7.1), 195 l DMSO, 35 l H2O and subsequently reacted with 5 l of the amino-modified oligonucleotide (5 nmol) overnight at 30 C. The reaction was quenched with 20 l 500 mM Tris/HCl (pH=8.1) at 30 C. for 1 h. After quenching, the DNA-compound conjugate was precipitated with ethanol (see protocol for ethanol precipitation for compound-conjugates) before purifying by HPLC. The separated and collected compound conjugates were vacuum-dried overnight, redissolved in 100 l of H2O, and analyzed by ESI-MS.
(30) 1.5 Ethanol Precipitation of Compound-Oligonucleotide Conjugates
(31) Before HPLC purification, the compound-olignucleotide conjugates were precipitated with ethanol. In this procedure, 100 l 3 M sodium acetate (pH=4.7) and 30 l 5 M acetic acid were added to the reactions. After vortexing, 1100 l pure (100%) ethanol was added and the reactions were allowed to stand for 30 min at 22 C. and 30 min at 20 C. before centrifugation (30 min, 13200 rpm, 4 C.). Immediately after centrifugation, the supernatant was carefully discarded and the pellet was dissolved in 500 l 100 mM triethylammonium acetate (TEAA) buffer (pH=7.0) and subjected to HPLC purification.
(32) 1.6 High-Performance Liquid Chromatography (HPLC) of Oligonucleotide-Compound Conjugates
(33) Oligonucleotide-conjugated compounds for the library were separated from the unreacted amino-modified Elib4.aT oligo by HPLC. A reverse-phased C18-XTerra column (5 m, 10150 mm, Waters) with organic/inorganic particle (silica and polymeric supports) was used as stationary phase. As a mobile phase, an aqueous, 100 mM triethylammonium acetate (TEAA) buffer C (pH=7.0) was used together with an acetonitrile gradient (buffer D: 100 mM TEAA in 80% MeCN/20% H2O. Depending on the retention time for a class of compounds, either a short (16 min, for more hydrophilic compounds) or a long (30 min, for more hydrophobic compounds a gradient program was run (T=30 C., p=0-300 bar).
(34) In order to distinguish oligonucleotides and oligonucleotide-conjugates from starting compounds and side-products, absorption was monitored at 260 nm and 280 nm. The oligonucleotide absorption ratio 260 nm/280 nm is typically 1.8/1. The collection of fractions was started after 4 min with a minimum intensity threshold of 30000 (106:=Abs=1 for the observed channel [260 nm]). The minimum fraction collecting frame was 5 s, the maximum 300 s.
(35) 1.7 Liquid Chromatography-Mass Spectrometry (LC-MS)
(36) Mass-analysis of the oligo-coupled compounds was performed by the combination of liquid chromatography with electrospray ionization mass spectrometry (LC-ESI-MS). A reverse-phased C18-XBridge column (2.5 m, 2.150 mm, Waters) with organic/inorganic particle (silica and polymeric supports) was used as stationary phase. As a mobile phase, 400 mM 1,1,1,3,3,3-hexafluoroisopropanol (HFIP), 2 mM triethylamin (TEA) buffer C was applied with a methanol gradient (buffer D: 400 mM HFIP, 2 mM TEA in 50% H2O/50% methanol (T=30 C., p=0-200 bar). A tandem-quadrupole mass spectrometer (Quattro micro API, Waters, Milford, Conn.) with electrospray ionization (ESI) source was used for mass detection and analysis. Mass spectrometric analyses were performed in negative ion-mode. ESI interface parameters were set as follows: disolvation temperature: 200 C., source temperature: 110 C.; capillary voltage: 3.0 kV; cone voltage: 40 V; scan time: 0.5 s; inter-scan delay time: 0.1 s.
(37) 1.8 Encoding by Ligation
(38) 50 l 2 M compound-oligonucleotide conjugate (100 mol), 10 l 15 M coding oligonucleotide (150 pmol), 10 l 30 M chimeric RNA/DNA adapter oligonucleotide, 10 l NEB 10 ligase buffer and 19.5 l H2O were mixed and heated up to 90 C. for 2 min. Then the mixture was passively cooled down to 22 C. (hybridization). Afterwards, 0.5 l NEB ligase was added. Ligation was performed at 16 C. for 10 hours. The ligase was inactivated for 15 min at 70 C.
(39) 1.9 Degradation of the Chimeric DNA/RNA Adapter
(40) Hydrolysis of the RNA was achieved when an equivalent volume (13 l) of 200 mM sodium hydroxide and the ligation solution was mixed and incubated for 5 h at 22 C. The solution was then neutralized to pH=7.9. Alternatively, enzymatic cleavage was effectively carried out by adding 5.3 l of 10 RNase H reaction buffer, 33.7 H2O and 1.5 l RNase H. RNase H was inactivated by heat denaturation (15 min, 70 C.). Optionally, the ligated oligonucleotide-compound conjugates could be purified again by ethanol precipitation as described above. Equimolar amounts of encoded compounds were then mixed together to generate the desired sub-library
Example 2: Construction of a Sub-Library of Oligonucleotide-Compound Conjugates Using 3-Aminomodified, 5-Phosphorylated Oligonucleotides
(41) 2.1 Preparation of Amino-Modified Encoding Oligonucleotides
(42) Amino-modified encoding oligonucleotides necessary were either purchased from a commercial supplier or obtained by encoding by ligation: 50 l 2 M amino-modified oligonucleotide (100 pmol), 10 l 15 M coding oligonucleotide (150 pmol), 10 l 30 M chimeric RNA/DNA adapter oligonucleotide, 10 l NEB 10 ligase buffer and 19.5 l H2O were mixed and heated up to 90 C. for 2 min. Then the mixture was passively cooled down to 22 C. (hybridization). Afterwards, 0.5 l NEB ligase was added. Ligation was performed at 16 C. for 10 hours. The ligase was inactivated for 15 min at 70 C.
(43) 2.2 Degradation of the Chimeric DNA/RNA Adapter
(44) Hydrolysis of the RNA was achieved when an equivalent volume (13 l) of 200 mM sodium hydroxide and the ligation solution was mixed and incubated for 5 h at 22 C. The solution was then neutralized to pH=7.9 Alternatively, enzymatic cleavage was effectively carried out by adding 5.3 l of 10 RNase H reaction buffer, 33.7 H2O and 1.5 l RNase H. RNase H was inactivated by heat denaturation (15 min, 70 C.). Optionally, the ligated oligonucleotide-compound conjugates could be purified again by Ethanol precipitation as described above.
(45) The sub-library of compound-oligonucleotide conjugates was then obtained by chemically modifying the individual amino-modified encoded oligonuclotides, followed by Ethanol precipitation, HPLC purification, and MS-based analytics, as described in Example 1. Equimolar amounts of encoded compounds were then mixed together to the desired sub-library.
Example 3: Construction of a Sub-Library of Oligonucleotide-Compound Conjugates Using 5-Aminomodified Oligonucleotides
(46) Commercially purchased oligonucleotides carrying a 5 primary amino group and an individual encoding sequence were coupled to carboxylic acids, acyl chlorides, cyclic anhydrides, or isothiocyanates. Some of the carboxylic acids contained an Fmoc-protected amino group. Typically, for acyl chlorides, 200 L of a 25 M solution of oligonucleotide in 100 mM NaHCO3, pH 9, was added to 200 L of a 4 mM solution of acyl chloride in MeCN.
(47) In the case of isothiocyanates, 100 L of a 50 M solution of oligonucleotide in 100 mM KHPO4, pH 7.1, was added to 200 L of a 2.6 mM solution of isothiocyanate in DMSO. For cyclic anhydrides, 100 L of a 50 M solution of oligonucleotide in 100 mM KHPO.sub.4, pH 7.1, was added to 200 L of a 2.6 mM solution of anhydride in DMSO. To activate the carboxylic acids, 22 L of a solution containing 45 mM EDC and 180 mM sulfo-NHS in 15% H2O/85% DMSO was added to 230 L of a 5.5 mM solution of the carboxylic acid in DMSO. After 30 min at 30 C., 60 L of a solution of 83 M oligonucleotide in 420 mM TEA/HCl, pH 10, was added. All reactions were stirred for 12 h at 30 C. The reactions were quenched by adding 20 L of 500 mM Tris/HCl, pH 8, and stirred for an additional 1 h at 30 C. In the case of Fmoc-protected compounds, the quenching and removal of the Fmoc group was performed by addition of 5 L of 1 M Tris and 5 L of triethylamine and stirring for 1 h at 30 C.
(48) For HPLC purification, 400 L of 100 mM TEAA, pH 7, was added to the reaction mixture. In the case of the Fmoc samples, 20 L of 1 M HCl was additionally added. Purifications were performed by HPLC on an XTerra Prep RP18 column (5 M, 10150 mm) using a linear gradient from 10 to 40% MeCN in 100 mM TEAA. The desired samples were redissolved in 100 L of H2O. An amount of 5 L was analyzed by LC-ESI-MS on an XTerra RP18 column (5 M, 4.620 mm) using a linear gradient from 0 to 50% MeOH over 1 min in 400 mM HFIP/5 mM TEA. The mass spectrum was measured from 900 to 2000 m/z by a Waters Quattro Micro instrument. The mass spectra of oligonucleotides before and after conjugation were analyzed. The samples containing the oligonucleotide-compound conjugates of the expected size were pooled and precipitated by adding 10% v/v of 3 M NaAc, pH4.7, and 250% v/v of EtOH. The pellets were collected by centrifugation and washed by addition of ice cold 85% EtOH, followed by drying under vacuum. The oligonucleotide-compound conjugates were then redissolved in 100 L of H2O, and the OD260 was determined by a ND-1000 (Nanodrop). Equimolar amounts of encoded compounds were then mixed together to generate the desired sub-library.
Example 4: Construction of a Sub-Library Displaying Two Chemical Building Blocks (2BB) Using 5-Aminomodified Oligonucleotides
(49) 4.1 DNA-Conjugation of Carboxylic Acids as First Building Block (BB1)
(50) Protected DNA 45-mers with a terminal 5-amino modifier C12 attached to the solid support (controlled pore glass) were distributed into synthesis cartridges (approx. 50 nmol). The supports were washed with MeCN and DCM (2). A solution of 3% trichloroacetic in DCM (1-2 mL) was dropwise eluted from the cartridge followed by washing with DCM (2 mL) and these two steps were repeated 5 times. The solid support was washed with DCM (11 mL) and MeCN (21 mL). The solid support was treated with a solution of Fmoc-L-DAP(Mtt)-OH (50 mM), HATU (50 mM) and DIEA (150 mM) in DMF (0.5 mL) and let react for 2 h at room temperature. The solution was removed and the solid support rinsed with DMF (21 mL), MeCN (11 mL) and DCM (21 mL). The Mtt-group was removed as described above for the Mmt-group. The solid support was then treated with a solution of the corresponding carboxylic acid (50 mM), HATU (50 mM) and DIEA (150 mM) in DMF (0.5 mL) and let react overnight. The solution was removed and the support rinsed with DMF (21 mL), MeCN (21 mL) and dried under a stream of air. The DNA was cleaved from the solid support and deprotected by 2 h incubation in conc. aq. NH.sub.3/MeNH.sub.2 (AMA) (1 mL) at room temperature. The AMA solution was evaporated, the residue dissolved in water (0.2 mL) and the DNA conjugates purified by reverse-phase HPLC. Product-containing fractions were combined, evaporated and analyzed by LC-MS measurement.
(51) 4.2 DNA-Conjugation of Carboxylic Acids as Second Building Block (BB2)
(52) Equimolar amounts of the DNA-conjugates obtained as described above were combined and further derivatized: The combined conjugates (0.75 nmol) were immobilized on DEAE sepharose (0.1 mL of slurry). The resin was washed with 10 mM aq. AcOH (20.5 mL), water (20.5 mL) and DMSO (20.5 mL). To the resin-immobilized DNA was added a solution of the corresponding carboxylic acid (50 mM), EDC (50 mM) and HOAt (5 mM) in DMSO (0.5 mL). The slurry was agitated for 2 h at room temperature. The solution was removed and the resin washed with DMSO (10.5 mL) and treated with freshly activated reaction solution. These steps were repeated to reach three coupling steps of 2 h each. The reaction solution was removed and the resin washed with DMSO (20.5 mL) and 10 mM aq. AcOH (30.5 mL). The DNA was eluted from the resin by incubation with 3 M AcOH buffer (pH 4.75) for 5 min. The DNA-conjugates were isolated by ethanol-precipitation and the pellets redissolved in deionized water (50 L). To ensure a high degree of conversion for chemical BB2, all used carboxylic acids were tested for coupling efficiency and only carboxylic acids with high conversion yields in test reactions (typically >80%) were used for library synthesis. The individual DNA-chemical conjugates constitute a (not pooled) sub-library which is encoded for BB1 but not yet for BB2 and can be used as starting material for the library construction described in Examples 6-8.
Example 5: Preparation of a DNA-Encoded Library [1+1 Library (FIG. 1A+1B)]
(53) 20 l 0.5 M of pooled 3-compound oligonucleotide conjugates (e.g. sub-library of Example 1 or 2), 1 l 10 M of pooled 5-compound oligonucleotide conjugates (e.g. sub-library of Example 3), 10 l 10NEB2 reaction buffer, 57 l H.sub.2O and 8 l 500 M dNTPs were mixed and heated up to 90 C. for 2 min, then cooled to 22 C. for hybridization. 2 l NEB Klenow polymerase was added and the sample was incubated at 25 C. for 90 min, optionally followed by a purification step. The obtained encoded self-assembling chemical library could optionally be stored or directly used for target-based selections.
Example 6: Preparation of a DNA-Encoded Library [2+1 Library (FIG. 2A)]
(54) The individual sub-library members of Example 3, which carry the chemical building blocks BB1 and BB2 and which are encoded for BB1 (but not yet for BB2) were encoded for BB2 according to the following procedure:
(55) 6.1 Encoding by Ligation
(56) 50 l of 2 M compound-oligonucleotide conjugate (100 pmol), 10 l 15 M coding oligonucleotide (150 pmol), 10 l 30 M chimeric RNA/DNA adapter oligonucleotide, 10 l NEB 10 ligase buffer and 19.5 l H.sub.2O were mixed and heated up to 90 C. for 2 min. Then the mixture was passively cooled down to 22 C. (hybridization). Afterwards, 0.5 l NEB ligase was added. Ligation was performed at 16 C. for 10 hours. The ligase was inactivated for 15 min at 70 C.
(57) 6.2 Degradation of the Chimeric DNA/RNA Adapter
(58) Hydrolysis of the RNA was achieved when an equivalent volume (13 l) of 200 mM sodium hydroxide and the ligation solution was mixed and incubated for 5 h at 22 C. The solution was then neutralized to pH-7.9. Alternatively, enzymatic cleavage was effectively carried out by adding 5.3 l of 10 RNase H reaction buffer, 33.7 H2O and 1.5 l RNase H. RNase H was inactivated by heat denaturation (15 min, 70 C.). Optionally, the ligated oligonucleotide-compound conjugates could be purified again by Ethanol precipitation as described above.
(59) Equimolar amounts of encoded compounds were then mixed together to the desired sub-library A. A portion of sub-library A was then split into 200 vials (10 l of 20 nM compound-oligonucleotide conjugates) and each vial contained: 10 l of 20 nM individual sub-library B member, 10 l of 20 nM DNA/RNA adaptor oligonucleotide (d-spacerII) and 10 l of 20 nM individual coding oligonucleotide (code C), 10 l NEB 10 ligase buffer and 10 l H2O. The solutions were mixed and heated up to 90 C. for 2 min. Then the mixture was cooled down to 22 C. (hybridization). Afterwards, 0.5 l NEB ligase was added. Ligation was performed at 16 C. for 10 hours. Equimolar amounts of the 200 vials were mixed together, optionally followed by a purification step. The obtained DNA-encoded chemical library could optionally be stored or directly used for target-based selections.
Example 7: Preparation of a DNA-Encoded Library [2+1 Library (FIG. 2B)]
(60) The individual sub-library members of Example 3, which carry the chemical building blocks BB1 and BB2 and which are encoded for BB1 (but not yet for BB2) were encoded for BB2 according to the following procedure:
(61) 7.1 Encoding by Ligation
(62) 50 l of 2 M compound-oligonucleotide conjugate (100 pmol), 10 l 15 M coding oligonucleotide (150 pmol), 10 l 30 M adapter oligonucleotide containing 2 abasic sites, 10 l NEB 10 ligase buffer and 19.5 l H2O were mixed and heated up to 90 C. for 2 min. Then the mixture was passively cooled down to 22 C. (hybridization). Afterwards, 0.5 l NEB ligase was added. Ligation was performed at 16 C. for 10 hours. The ligase was inactivated for 15 min at 70 C. Optionally, the ligated oligonucleotide-compound conjugates could be purified as described above.
(63) Equimolar amounts of encoded compounds were then mixed together to the desired sub-library A. A portion of sub-library A was then split into 200 vials (10 l of 20 nM compound-oligonucleotide conjugates) and each vial contained: 10 l of 20 nM individual sub-library B member, 10 l of 20 nM adapter oligonucleotide containing 2 abasic sites and 10 l of 20 nM individual coding oligonucleotide (code C), 10 l NEB 10 ligase buffer and 10 l H.sub.2O. The solutions were mixed and heated up to 90 C. for 2 min. Then the mixture was cooled down to 22 C. (hybridization). Afterwards, 0.5 l NEB ligase was added. Ligation was performed at 16 C. for 10 hours. Equimolar amounts of the 200 vials were mixed together, optionally followed by a purification step. The obtained DNA-encoded chemical library could optionally be stored or directly used for target-based selections.
Example 8: Preparation of a DNA-Encoded Library [2+1 Library (FIG. 2C)]
(64) The individual sub-library members of Example 3, which carry the chemical building blocks BB1 and BB2 and which are encoded for BB1 (but not yet for BB2) were encoded for BB2 according to the following procedure.
(65) 8.1 Encoding by Ligation
(66) 50 l of 2 M compound-oligonucleotide conjugate (100 pmol), 10 l 15 M coding oligonucleotide (150 pmol), 10 l 30 M chimeric RNA/DNA adapter oligonucleotide, 10 l NEB 10 ligase buffer and 19.5 l H.sub.2O were mixed and heated up to 90 C. for 2 min. Then the mixture was passively cooled down to 22 C. (hybridization). Afterwards, 0.5 l NEB ligase was added. Ligation was performed at 16 C. for 10 hours. The ligase was inactivated for 15 min at 70 C.
(67) 8.2 Degradation of the Chimeric DNA/RNA Adapter
(68) Hydrolysis of the RNA was achieved when an equivalent volume (13 l) of 200 mM sodium hydroxide and the ligation solution was mixed and incubated for 5 h at 22 C. The solution was then neutralized to pH=7.9. Alternatively, enzymatic cleavage was effectively carried out by adding 5.3 l of 10 RNase H reaction buffer, 33.7 H.sub.2O and 1.5 l RNase H. RNase H was inactivated by heat denaturation (15 min, 70 C.). Optionally, the ligated oligonucleotide-compound conjugates could be purified again by Ethanol precipitation as described above.
(69) Equimolar amounts of encoded compounds were then mixed together to the desired sub-library A. A portion of sub-library A was then split into 200 vials (10 l of 20 nM compound-oligonucleotide conjugates) and each vial contained: 10 l of 20 nM individual sub-library B member, 10 l of 20 nM DNA/RNA adaptor oligonucleotide (d-spacerII) and 10 l of 20 nM individual coding oligonucleotide (code C), 10 l 10NEB2 reaction buffer, 52 l H2O and 8 l 500 M dNTPs were mixed and heated up to 90 C. for 2 min, then cooled to 22 C. for hybridization. 2 l Klenow polymerase was added and the sample was incubated at 25 C. for 90 min, optionally followed by a purification step. Equimolar amounts of the 200 vials were mixed together, optionally followed by a purification step. The obtained DNA-encoded chemical library could optionally be stored or directly used for target-based selections.
Example 9: Chimeric Adaptors
(70) Chimeric adapters were used to facilitate the ligation mediated by T4 DNA ligase, as this enzyme only seals nicks in double stranded DNA. Chimeric adapters were required for the enzymatic reaction but needed to be disposed of afterwards. The Chimeric adapters were DNA oligonucleotides with intermittent RNA nucleotides. The adapter-specific disintegration was achieved by NaOH-treatment of the ligation products, which cleaves the chimeric adapters at the RNA sites. An alternative disintegration strategy is the cleavage using RNase H. For the 2+1 library of Example 10, the three Chimeric Adapters shown in Table 1 were employed.
(71) 9.1 Degradation Tests
(72) The Chimeric Adapters shown in Table 2 were tested for degradation by means of NaOH treatment (high pH) or RNase H treatment.
(73) 9.3 Ligation
(74) The ligation of nucleic acid strands carrying compounds at their 5 end using chimeric adapters was assessed. TBE and TBE-Urea gels (life technologies, Novex TBE Gels, 20%, 15 well, Cat. No. EC63155BOX; life technologies, Novex TBE-Urea Gels, 15%, 15 well, Cat. No. EC68855BOX), were loaded as shown in Table 3 and subjected to electrophoresis. The results are shown in
(75) The ligation of nucleic acid strands carrying compounds at their 3 end using chimeric adapters was assessed. TBE and TBE-Urea gels (life technologies, Novex TBE Gels, 20%, 15 well, Cat. No. EC63155BOX; life technologies, Novex TBE-Urea Gels, 15%, 15 well, Cat. No. EC68855BOX), were loaded as shown in Table 4 and subjected to electrophoresis. The results are shown in
Example 10: Preparation of a DNA-Encoded Library [2+1 Library (FIGS. 2D and 2E)]
(76) The ESAC 2+1 library consists of two sub-libraries. The 5-sub-library carries two compounds at the 5-end of a single-stranded oligonucleotide while the 3-sub-library consists of one compound, coupled to the 3-end of a complementary single-stranded oligonucleotide. Both sub-library are mixed in equimolar amounts and hybridized by heating. Klenow fill-in is used to transfer coding information from the 3-strand to the 5-strand.
(77) 10.1 5-Sublibrary (2 Building Blocks)
(78) The 5-Sublibrary was generated in split-and-pool fashion. Building block 1 was coupled to an oligonucleotide that contains Code 1. Compound-oligonucleotide conjugates were pooled, split to equimolar amounts and coupled to building block 2. These intermediate library members were encoded via ligation: conjugates were incubated with an equimolar amount of an oligonucleotide that contained code two and an excess of a chimeric adapter oligonucleotide (DNA/RNA hybrid) (see Table 5). The Code 1 and Code 2 oligonucleotides were ligated using T4 DNA Ligase. The chimeric adapter was disintegrated using 250 mM NaOH. Finally, the ligation product was purified using the Qiagen QIAquick gel extraction kit and library members were pooled again in equimolar amounts in order to yield the final 5-sublibrary.
(79) 10.2 3-Sub-Library
(80) The 3-sub-library carries building block 3 at the 3-end of a single-stranded oligonucleotide. The 3-oligonucleotide, named Elib4.aT, contains a d-spacer (abasic nucleotide backbone) in order to allow hybridization to Code 1. Elib4.aT was ligated (as described above) to a second d spacer that allowed hybridization to Code 2, and purified as described above (see Table 6). The oligonucleotide containing Code 2 was added in a second ligation step. The final product was purified and pooled in equimolar amounts in order to yield the final 3-sublibrary.
(81) 10.2. Hybridization and Klenow Fill-In
(82) The 3- and 5-sublibraries were mixed in equimolar amounts. Heating and subsequent cooling down to room temperature leads to the hybridization (=combinatorial assembly) of the two sub-libraries. Klenow polymerase was used to fill in the Code 3 information of the 3-strand to the 5-strand as shown in Table 7, which was amplified by PCR.
Example 11: Preparation of a DNA-Encoded Library of Three or More Building Blocks [(FIG. 3A)]
(83) 5-Amino-modified oligonucleotides were modified with a first chemical building block as described in Examples 1-3 (i.e. in liquid or on solid phase). The compound-oligonucleotide conjugates were then purified and individually ligated with an encoding oligonucleotide, by the help of a RNA/DNA adaptor oligonucleotide, as described in Examples 1-3. The adaptor molecules were then removed by either pH-based cleavage or RNAse H addition, optionally followed by a purification step, described in Examples 1-3. The obtained encoded compound-oligonucleotide conjugates were pooled in equimolar amounts and then split into a set of b vials, for the modification with b building block 2 (BB2) compounds.
(84) The couplings were performed either in solution or while the DNA was attached to a solid support, as described in Examples 1-3. The b pools of compound-oligonucleotide conjugates were then individually ligated with an encoding oligonucleotide, by the help of a RNA/DNA adaptor oligonucleotide, as described in Examples 1-3. The adaptor molecules were then removed by either pH-based cleavage or RNAse H addition, optionally followed by a purification step, described in Examples 1-3. The obtained set of encoded compound-oligonucleotide conjugates were pooled in equimolar amounts and then split into a set of c vials, for the modification with c building block 3 (BB3) compounds. The couplings were performed either in solution or while the DNA was attached to a solid support, as described in Examples 1-3. The b pools of compound-oligonucleotide conjugates were then individually ligated with an encoding oligonucleotide, by the help of a RNA/DNA adaptor oligonucleotide, as described in Examples 1-3. The adaptor molecules were then removed by either pH-based cleavage or RNAse H addition, optionally followed by a purification step, described in Examples 1-3. The obtained set of encoded compound-oligonucleotide conjugates carrying sets of 3 encoded building blocks were either submitted to further rounds of for the modification with further sets of building blocks followed by encoding or mixed together to the desired sub-library. Optionally, using a suitable DNA polymerase the sub-library was converted into a double stranded DNA-encoded chemical library, which could optionally be stored or directly used for target-based selections.
Example 12: Preparation of a DNA-Encoded Library [(FIG. 3B)]
(85) 5-Amino-modified oligonucleotides were modified with a first chemical building block as described in Examples 1-3 (i.e. in liquid or on solid phase). The compound-oligonucleotide conjugates were then purified and individually ligated with an encoding oligonucleotide, by the help of a RNA/DNA adaptor oligonucleotide, as described in Examples 1-3. The adaptor molecules were then removed by either pH-based cleavage or RNAse H addition, optionally followed by a purification step, described in Examples 1-3. The obtained encoded compound-oligonucleotide conjugates were pooled in equimolar amounts and then split into a set of b vials, for the modification with b building block 2 (BB2) compounds. The couplings were performed either in solution or while the DNA was attached to a solid support, as described in Examples 1-3. The b pools of compound-oligonucleotide conjugates were then individually ligated with an encoding oligonucleotide, by the help of a RNA/DNA adaptor oligonucleotide, as described in Examples 1-3. The adaptor molecules were then removed either by pH-based cleavage or RNAse H cleavage, optionally followed by a purification step, described in Examples 1-3. The obtained sets of encoded compound-oligonucleotide conjugates were pooled in equimolar amounts and conjugation with further n sets of building blocks (n>1) was performed as described before. The ultimate encoding step was not performed by ligation but by polymerase-mediated fill-in. In this case, a fill-in reaction with an encoding oligonucleotide complementary to a sequence between the (n1).sup.th code and the 3 terminus of the compound-oligonucleotide conjugate strand was performed, as described in Examples 5 and 6, leading to a double-stranded DNA-encoded chemical library, which could optionally be stored or directly used for target-based selections.
Example 13: Affinity Screening of a DNA-Encoded Chemical Library Against a Target Protein of Interest
(86) Affinity selections were performed using a Thermo Scientific KingFisher magnetic particle processor. Streptavidin-coated magnetic beads (0.1 mg) were resuspended in 100 l PBS (50 mM NaPi, 100 mM NaCl, pH 7.4) and subsequently incubated with 100 l biotinylated target protein of interest (0.1 M/1.0 M concentration) for 30 min with continuous gentle mixing. target protein-coated beads were washed three times with 200 l PBST (50 mM NaPi, 100 mM NaCl, 0.05% (v/v) Tween-20, pH 7.4) that was supplemented with 100 M biotin in order to block remaining binding sites on Streptavidin, and subsequently incubated with 100 l of the DNA-encoded chemical library (100 nM total concentration, in PBST) for 1 h with continuous gentle mixing. After removing unbound library members by washing with 200 l PBST for five times, beads carrying bound library members were resuspended in 100 l buffer EB (QIAGEN) and the DNA compound conjugates were separated from the beads by heat denaturation of Streptavidin and target protein (95 C. for 5 min).
REFERENCES
(87) 1 Mannocci, L. et al. PNAS USA 105(46):17670-17675 2 Brenner, S. and Lerner, R. A. PNAS USA 89 (1992), 5381-5383 3 Nielsen, J., et al., J. Am. Chem. Soc. 115 (1993) 4 Needels et al., M. C., PNAS USA 90 (1993), 10700-10704 5 Gartner, Z. J., et al., Science 305 (2004), 1601-1605 6 Melkko, S., et al., Nat. Biotechnol. 22 568-574 (2004) 7 Sprinz, K. I., et al., Bioorg. Med. Chem. Lett. 15 (2005), pp. 3908-3911 8 Leimbacher et al Chemistry. 2012 Jun. 18; 18(25):7729-37 9 Clark et al Nat Chem Biol. 2009 September; 5(9):647-54
(88) TABLE-US-00001 TABLE1 Adapter 5-CGTC ATCCG
CGCCAT
GGACTCG-3 AdapterG1 5-CGA
TCCCAT
GCGCCG
ATCGACG-3 AdapterG2 5-GCCTC
AGGCGT
ATCCTAC-3
RNAnucleotides
(89) TABLE-US-00002 TABLE2 TestAdapter 5-CGA CATGGC
CTGC-3
RNAnucleotide TestLigationProduct 5-CCTGCATCGAATGGATCCGTGXXXXXXXXGCAGCTGCGCCATGG GACTCGddddddCAGCACACAGAATTCAGAAGCTCC-3
(90) TABLE-US-00003 TABLE3 lane1 Code1(45nt) 5-GGAGCTTCTGAATTCTGTGTGCTGXXXXXXCGAGTCCCATGGCGC-3 lane2 Code25P(27nt) 5-CGGATCGACGYYYYYYYGCCTCGAGGC-3 lane3 Adapter(25nt) 3-GCTCAGGGTACCGCGGCCTAGCTGC-5 lane4hybridization Code1(45nt) 5-GGAGCTTCTGAATTCTGTGTGCTGXXXXXXCGAGT NICK:Code25P(27nt) CCCATGGCGCCGGATCGACGYYYYYYYGCCTCGAGGC-3 3-GCTCAGGGTACCGCGGCCTAGCTGC-5 Adapter(25nt) lane5ligation Code1+ Code2(72nt) 5-GGAGCTTCTGAATTCTGTGTGCTGXXXXXXCGAGTCCCATGGCG CCGGATCGACGYYYYYYYGCCTCGAGGC-3 3-GCTCAGGGTACCGCGGCCTAGCTGC-5 Adapter(25nt) lanes6-9purifiedligation Code1+ Code2(72nt) 5-GGAGCTTCTGAATTCTGTGTGCTGXXXXXXCGAGTCCCATGGCG CCGGATCGACGYYYYYYYGCCTCGAGGC-3 lane6 QIAnucleotideremovalkit NaOH- lane7 QIAnucleotideremovalkit NaOH+ lane8 QIAgelextractionkit NaOh- lane9 QIAgelextractionkit NaOH+
(91) TABLE-US-00004 TABLE4 lane1 Code3 (31nt) 3-CACTAGGATGzzzzzzCGCGGTACCCTGAGC-5 lane2 d-spacer2(31nt) 3-CGCGGCCTAGCTGCdddddddCGGAGCTCCG-5 lane3 AdapterG2(20nt) 5-GCCTCGAGGCGTGATCCTAC-3 lane4hybridication AdapterG2(20nt) 5-GCCTCGAGGCGTGATCCTAC-3 3-CGCGGCCTAGCTGCddddddd d-spacer2(31nt) CGGAGCTCCGCACTAGGATGzzzzzzCGCGGTACCCTGAGC-5 NICK:Code3 (31nt) lane5ligation AdapterG2(20nt) 5-GCCTCGAGGCGTGATCCTAC-3 3-CGCGGCCTAGCTGCddddddd d-spacer2+ Code3 (62nt) CGGAGCTCCGCACTAGGATGzzzzzzCGCGGTACCCTGAGC-5 lanes6-11purifiedligation d-spacer2+ Code3 (62nt) 3-CGCGGCCTAGCTGCddddddd CGGAGCTCCGCACTAGGATGzzzzzzCGCGGTACCCTGAGC-5 lane6 QIAPCRpurificationkit NaOH- lane7 QIAnucleotideremovalkit NaOH- lane8 QIAgelextrkitwithisopropanol NaOH- lane9 QIAgelextrkitnoisopropanol NaOH- lane10 MNNTI NaOH- lane11 MNNTC NaOH-
(92) TABLE-US-00005 TABLE5 Step1:LigateCode1+ Code2(T4DNALigase) Code1(45nt) 5-GGAGCTTCTGAATTCTGTGTGCTGXXXXXXCGAGTCCCATGGCGC-3 Code25P(27nt) 5-CGGATCGACGYYYYYYYGCCTCGAGGC-3 3-GCTCAGGGTACCGCGGCCTAGCTGC-5 Adapter(25nt) Code1+ Code2(72nt) 5-GGAGCTTCTGAATTCTGTGTGCTGXXXXXXCGAGTCCCATGGCGCCGG ATCGACGYYYYYYYGCCTCGAGGC-3 3-GCTCAGGGTACCGCGGCCTAGCTGC-5 Adapter(25nt) Step2:DisintegrationofchimericAdapterby NaOHtreatment Step3:Purificationusingspincolumns Code1+ Code2(72nt) 5-GGAGCTTCTGAATTCTGTGTGCTGXXXXXXCGAGTCCCATGGCGCCGG ATCGACGYYYYYYYGCCTCGAGGC-3 XXXXXX 6variablenucleotidesofCode1 YYYYYYY 7variablenucleotidesofCode2 zzzzzz 6complementaryvariable nucleotidesofCode3 ZZZZZZ 6variablenucleotidesofCode3 dddddd abasicnucleotidebackbone P phophate nt nucleotides
(93) TABLE-US-00006 TABLE6 Step1:LigateElib4.aT+ d-spacer2(T4DNALigase) AdapterG1(25nt) 5-CGAGTCCCATGGCGCCGGATCGACG-3 3-CCTCGAAGACTTAAGACACACGACddddddGCTCAGGGTAC-5 Elib4.aT(41nt) 3-CGCGGCCTAGCTGCdddddddCGGAGCTCCG-5 d-spacer2(31nt) AdapterG1(25nt) 5-CGAGTCCCATGGCGCCGGATCGACG-3 3-CCTCGAAGACTTAAGACACACGACddddddGCTCAGGGTACCGCGGCC Elib4.aT+ d-spacer2(72nt) TAGCTGCdddddddCGGAGCTCCG-5 Step2:DisintegrationofchimericAdapterby NaOHtreatment Step3:Purificationusingspincolumns 3-CCTCGAAGACTTAAGACACACGACddddddGCTCAGGGTACCGCGGCC Elib4.aT+ d-spacer2(72nt) TAGCTGCdddddddCGGAGCTCCG-5 Step4:LigateElib4.aT/d-spacer2+ Code3 (T4DNALigase) AdapterG2(20nt) 5-GCCTCGAGGCGTGATCCTAC-3 3-CCTCGAAGACTTAAGACACACGACddddddGCTCAGGGTACCGCGGCC Elib4.aT+ d-spacer2(72nt) TAGCTGCdddddddCGGAGCTCCG-5 3-CACTAGGATGzzzzzzCGCGGTACCCTGAGC-5 Code3 (31nt) AdapterG2(20nt) 5-GCCTCGAGGCGTGATCCTAC-3 3-CCTCGAAGACTTAAGACACACGACddddddGCTCAGGGTACCGCGGCC Elib4.at+ d-spacer2+ Code3 (103nt) TAGCTGCdddddddCGGAGCTCCGCACTAGGATGzzzzzzCGCGGTACCCT GAGC-5 Step5:DisintegrationofchimericAdapterby NaOHtreatment Step6:Purificationusingspincolumns 3-CCTCGAAGACTTAAGACACACGACddddddGCTCAGGGTACCGCGGCC Elib4intermediatelibrary+ d-spacer2+ Code3 (103nt) TAGCTGCdddddddCGGAGCTCCGCACTAGGATGzzzzzzCGCGGTACCCT GAGC-5
(94) TABLE-US-00007 TABLE7 Step1:HybridizationofSub-Libraries Code1+ Code2(72nt) 5-GGAGCTTCTGAATTCTGTGTGCTGXXXXXXCGAGTCCCATGGCG CCGGATCGACGYYYYYYYGCCTCGAGGC-3 3-CCTCGAAGACTTAAGACACACGACddddddGCTCAGGGTACCGC Elib4.aT+ d-spacer2+ Code3 (103nt) GGCCTAGCTGCdddddddCGGAGCTCCGCACTAGGATGzzzzzzCGC GGTACCCTGAGC-5 step2:KlenowPolymerasefill-in Code1+ Code2(72nt) 5-GGAGCTTCTGAATTCTGTGTGCTGXXXXXXCGAGTCCCATGGCG CCGGATCGACGYYYYYYYGCCTCGAGGC-3 ---> 3-CCTCGAAGACTTAAGACACACGACddddddGCTCAGGGTACCGC Elib4.aT+ d-spacer2+ Code3 (103nt) GGCCTAGCTGCdddddddCGGAGCTCCGCACTAGGATGzzzzzzCGC GGTACCCTGAGC-5 Code1+ Code2+ Code3(103nt) 5-GGAGCTTCTGAATTCTGTGTGCTGXXXXXXCGAGTCCCATGGCG CCGGATCGACGYYYYYYYGCCTCGAGGCGTGATCCTACZZZZZZGCG CCATGGGACTCG-3 3-CCTCGAAGACTTAAGACACACGACddddddGCTCAGGGTACCGC Elib4.aT+ d-spacer2+ Code3 (103nt) GGCCTAGCTGCdddddddCGGAGCTCCGCACTAGGATGzzzzzzCGC GGTACCCTGAGC-5 Finallibrary.Readytouse.