METHODS OF DIAGNOSING CANCER
20190083436 ยท 2019-03-21
Inventors
Cpc classification
A23V2002/00
HUMAN NECESSITIES
A61K31/216
HUMAN NECESSITIES
A61K31/198
HUMAN NECESSITIES
A23V2002/00
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
International classification
Abstract
Disclosed are two methods of treating or preventing a proliferative disease as characterized and/or diagnosed by at least one selected from an accumulation of branched-chain amino acid(s) (BCAA), suppression of activity or transcripts level of BCAA catabolic enzyme(s) and a decrease in acylcarnitine level (C5:1), one comprising the administration of a BCAA catabolism enhancer and/or branched chain alpha-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor and the other comprising administration of a meal replacement with low BCAA levels. In three separate embodiments, methods of diagnosis or prognosis are disclosed, each comprising the measurement of the levels of a different marker, i.e. BCAA, BCAA catabolic enzymes or acylcarnitine (C5:1). In preferred embodiments, the proliferative disease is cancer. Also disclosed is a kit or microarray chip useful for methods thereof.
Claims
1. A method of treating or preventing a proliferative disease in a subject in need thereof, wherein the proliferative disease is characterized and/or diagnosed by at least one selected from the group consisting of: an accumulation of at least one branched-chain amino acid (BCAA); a suppression of enzyme activity involved in the catabolism of at least one branched-chain amino acid (BCAA); a suppression of transcripts-level of enzymes involved in the catabolism of at least one branched-chain amino acid (BCAA); and a decrease in a level of an acylcarnitine (C5:1); wherein said method comprises administering a branched-chain amino acid catabolism enhancer and/or a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor).
2. A method of treating or preventing a proliferative disease in a subject in need thereof, wherein the proliferative disease is characterized and/or diagnosed by at least one selected from the group consisting of: an accumulation of at least one branched-chain amino acid (BCAA); a suppression of enzyme activity involved in the catabolism of at least one branched-chain amino acid (BCAA), a suppression of transcripts involved in the catabolism of at least one branched-chain amino acid (BCAA); and a decrease in a level of an acylcarnitine (C5:1); wherein said method comprises administering a meal replacement comprising low level of branched-chain amino acid (BCAA) into the subject in need thereof.
3. The method of claim any one of claim 1 or 2, wherein the branched-chain amino acids are leucine, isoleucine, and valine.
4. The method of claim 1 or 2, wherein the accumulation of at least one branch chain amino acid is observed in one, or two, or three branched-chain amino acids level.
5. The method of claim 1 or 2, wherein the proliferative disease further comprises the characteristics of an accumulation of at least one amino acid selected from the group consisting of phenylalanine, methionine and asparagine.
6. The method of any one of claims 1 to 5, wherein the method further comprises administering a branched-chain amino acid catabolism enhancer and/or a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor).
7. The method of any one of claims 1 to 6, wherein the branched-chain amino acid catabolism enhancer is a peroxisome proliferator-activated receptor-alpha (PPARa) agonist.
8. The method of claim 7, wherein the PPARa agonist is at least one selected from the group consisting of propan-2-yl 2-[4-(4-chlorobenzoyl)phenoxy]-2-methylpropanoate (fenofibrate), 2-[4-[2-[(4-chlorobenzoyl)amino]ethyl]phenoxy]-2-methylpropanoic acid (bezafibrate), and 2-[4-[2-[4-cyclohexylbutyl(cyclohexylcarbamoyl)amino]ethyl]phenyl]sulfanyl-2-methylpropanoic acid (GW7647).
9. The method of claim 6, wherein the BDK inhibitor is at least one selected from the group consisting of peroxisome proliferator-activated receptor-alpha (PPARa) agonist (such as propan-2-yl 2-[4-(4-chlorobenzoyl)phenoxy]-2-methylpropanoate (fenofibrate), 2-[4-[2-[(4-chlorobenzoyl)amino]ethyl]phenoxy]-2-methylpropanoic acid (bezafibrate)), and 3,6-dichloro-1-benzothiophene-2-carboxylate (BT2).
10. A method of determining or predicting whether a subject is having or likely to have a proliferative disease, the method comprising: a. measuring a level of at least one branched-chain amino acid (BCAA) of the subject; and b. comparing the branched-chain amino acid level of the subject to the branched-chain amino acid level of a control subject or subjects not having said proliferative disease, wherein the branched-chain amino acid level in excess of the branched-chain amino acid level of the control subject indicates the subject is having or is likely to have the proliferative disease.
11. The method of claim 10, wherein the method further comprises measuring a level of acylcarnitine (C5:1) of the subject, wherein a decrease in the level of acylcarnitine (C5:1) as compared to the control further confirms that the subject is having or is likely to have the proliferative disease.
12. A method of predicting the likelihood of a subject surviving proliferative disease comprising: a. measuring a level of branched amino acids (BCAA) of the subject; b. comparing and/or correlating the level measured in (a) to a standard level of branched amino acids, wherein the degree of deviation above the level of the standard indicates the degree of severity of the outcome.
13. A method of determining or predicting whether a subject is having or likely to have a proliferative disease, the method comprising: a. measuring a level of branched amino acids (BCAA) catabolic enzymes of the subject; and b. comparing the level measured in (a) to the level of a branched amino acids (BCAA) catabolic enzymes of a control subject (or subjects) not having said proliferative disease, wherein a decreased branched amino acids (BCAA) catabolic enzymes level as compared to the branched amino acids (BCAA) catabolic enzymes level of the control subject indicates the subject is having or likely to have the proliferative disease.
14. A method of predicting the likelihood of a subject surviving proliferative disease comprising: a. measuring a level of branched amino acids (BCAA) catabolic enzymes of the subject; b. comparing and/or correlating the level measured in (a) to a standard level of branched amino acids catabolic enzymes, wherein the degree of deviation above the level of the standard indicates the degree of severity of the outcome.
15. The method of claim 12 or 14, wherein the standard level is a predetermined level obtained from subjects known to have good prognosis.
16. The method of any one of the preceding claim 12, 14, or 15, wherein the subject with poor outcomes/prognosis are subjects having high-grade cancer, and/or likelihood of disease recurrence or progression, and/or not surviving more than 1, or 2, or 3, or 4, or 5 years.
17. The method of claim 12, 14, 15, or 16, wherein poor outcome/prognosis (negative survival) indicates reduced likelihood of survival over 5 years.
18. The method of any one of claim 12, 14, 15, 16, or 17, wherein good outcome/prognosis indicates a likelihood of survival of more than 5 years, and/or disease remission within 5 years, and/or recurrence free survival.
19. The method of any one of claim 13 or 14 wherein the branched amino acids catabolic enzymes are selected from the group consisting of: ABAT (4-aminobutyrate aminotransferase), ACAA1 (acetyl-CoA acyltransferase 1), ACAA2 (acetyl-CoA acyltransferase 2), ACAD8 (acyl-CoA dehydrogenase family member 8), ACADM (acyl-CoA dehydrogenase, C-4 to C-12 straight chain), ACADS (acyl-CoA dehydrogenase, C-2 to C-3 short chain), ACADSB (acyl-CoA dehydrogenase, short/branched chain), ACAT1 (acetyl-CoA acetyltransferase 1), ACAT2 (acetyl-CoA acetyltransferase 2), ALDH1B1 (aldehyde dehydrogenase 1 family member B1), ALDH2 (aldehyde dehydrogenase 2 family (mitochondrial)), ALDH3A2 (aldehyde dehydrogenase 3 family member A2), ALDH6A1 (aldehyde dehydrogenase 6 family member A1), ALDH9A1 (aldehyde dehydrogenase 9 family member A1), AOX1 (aldehyde oxidase 1), AUH (AU RNA binding protein/enoyl-CoA hydratase), BCKDHA (branched chain keto acid dehydrogenase E1, alpha polypeptide), BCKDHB (branched chain keto acid dehydrogenase E1, beta polypeptide), DBT (dihydrolipoamide branched chain transacylase E2), DLD (dihydrolipoamide dehydrogenase), ECHS1 (enoyl-CoA hydratase, short chain, 1, mitochondrial), EHHADH (enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase), HADH (hydroxyacyl-CoA dehydrogenase), HADHA (hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit), HADHB (hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit), HIBADH (3-hydroxyisobutyrate dehydrogenase), HIBCH (3-hydroxyisobutyryl-CoA hydrolase), HMGCL (3-hydroxymethyl-3-methylglutaryl-CoA lyase), HMGCS2 (3-hydroxy-3-methylglutaryl-CoA synthase 2), HSD17B10 (hydroxysteroid (17-beta) dehydrogenase 10), IVD (isovaleryl-CoA dehydrogenase), MCCC1 (methylcrotonoyl-CoA carboxylase 1), MCCC2 (methylcrotonoyl-CoA carboxylase 2), MCEE (methylmalonyl-CoA epimerase), MUT (methylmalonyl-CoA mutase), OXCT1 (3-oxoacid CoA-transferase 1), PCCA (propionyl-CoA carboxylase alpha subunit), and PCCB (propionyl-CoA carboxylase beta subunit).
20. The method of claim 19, wherein the branched amino acids catabolic enzymes are selected from the group consisting of: ACADS (acyl-CoA dehydrogenase, C-2 to C-3 short chain), ACADSB (acyl-CoA dehydrogenase, short/branched chain), and BCKDHA (branched chain keto acid dehydrogenase E1, alpha polypeptide).
21. The method of any one of claim 13, 14, 15, 19, or 20, wherein the level measured is of branched amino acids (BCAA) catabolic enzyme activity.
22. The method of claim 21, wherein the level of enzyme activity is measured by Magnetic Resonance Spectroscopy.
23. The method of claim 22, wherein the level of enzyme activity is detected by Magnetic Resonance Spectroscopy (MRS) by administering a hyperpolarized .sup.13C compound.
24. The method of claim 23, wherein the level of enzyme activity is detected by Magnetic Resonance Spectroscopy (MRS) by administering a hyperpolarized .sup.13C-alpha-ketoisocaproate.
25. The method of any one of claim 13, 14, 15, 19, or 20, wherein the measured level of branched amino acids (BCAA) catabolic enzymes is at RNA and/or protein level(s).
26. The method of any one of claims 13 to 25, wherein the level of enzyme is measured in a biological sample obtained from the subject.
27. A method of determining or predicting whether a subject is having or likely to have a proliferative disease comprising: a. measuring a level of an acylcarnitine (C5:1) of the subject; and b. comparing the acylcarnitine (C5:1) level of the subject as compared to the acylcarnitine (C5:1) level of a control subject or subjects not having said proliferative disease, wherein a decrease in the acylcarnitine (C5:1) level as compared to the level of the control subject indicates the subject is having or is likely to have the proliferative disease.
28. The method of claim 27, wherein the method further comprises measuring a level of at least one branched-chain amino acid (BCAA) of the subject and wherein an increase in the level of at least one branched-chain amino acid (BCAA) further confirms the subject is having or is likely to have the proliferative disease.
29. The method of claim any one of claim 10, 11, 12, 27, or 28, wherein the branched-chain amino acids are leucine, isoleucine, and valine.
30. The method of claim 29, wherein the method measures the level of one, or two, or three branched-chain amino acids.
31. The methods of any one of claim 10, 11, 27, or 28, wherein the method further comprises measuring the level of the amino acid selected from the group consisting of phenylalanine, methionine and asparagine and wherein an increase in the level of at least one selected from the group consisting of phenylalanine, methionine, and asparagine further confirms the subject is having or is likely to have the proliferative disease.
32. The method of any one of claim 10, 11, 12, 27, or 28, wherein the level of acylcarnitine (C5:1) or amino acid is measured in a biological sample obtained from the subject.
33. The method of any one of claims 10 to 32, wherein the biological sample is a tissue biopsy.
34. The method of claim 33, wherein the biological sample is at least one selected from the group consisting of a lung tissue biopsy, a breast tissue biopsy, a colorectal tissue biopsy, an esophageal tissue biopsy, a gastric tissue biopsy, a thyroid tissue biopsy, a head or neck tissue biopsy, a kidney tissue biopsy, and a liver tissue biopsy.
35. The method of any one of claims 10 to 34, further comprising administering into the subject in need thereof at least one selected from the group consisting of: a pharmaceutically effective amount of a branched-chain amino acid catabolism enhancer; a pharmaceutically effective amount of a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor); and an effective amount of meal replacement comprising low level of branched-chain amino acid (BCAA).
36. The method of any one of the preceding claims 10 to 35, wherein the comparing of the level of acylcarnitine (C5:1) and/or amino acid is performed using computer based analysis.
37. The method of any one of the preceding claims, wherein the proliferative disease is cancer.
38. The method of claim 37, wherein the cancer is at least one selected from the group consisting of liver cancer, head and neck squamous cell carcinoma, kidney cancer, colon and rectum adenocarcinoma, breast carcinoma, lung carcinoma, thyroid carcinoma, stomach adenocarcinoma, and esophageal carcinoma.
39. A kit or microarray chip for use in any of the methods as defined above, the kit or microarray chip comprising: a. a reagent or a group of reagents for measuring a level of at least one selected from the group consisting of acylcarnitine (C5:1), branched-chain amino acid (BCAA), and a level of at least one branched-chain amino acid (BCAA) catabolic enzyme in the subject; b. a reagent or a group of reagents comprising a pre-determined level of at least one selected from the group consisting of acylcarnitine (C5:1), branched-chain amino acid (BCAA), and branched-chain amino acid (BCAA) catabolic enzyme, c. optionally instructions for using the reagent in (a) and (b) to determine or predict whether a subject has or likely to have proliferative disease, wherein the pre-determined level is determined by measured level of at least one acylcarnitine (C5:1) and/or branched-chain amino acid and/or branched-chain amino acid (BCAA) catabolic enzyme in a control subject(s) not having the proliferative disease, and/or to determine the prognosis of the subject.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] The invention will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and the accompanying drawings, in which:
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
DETAILED DESCRIPTION OF THE PRESENT INVENTION
[0030] Tumors display profound changes in cellular metabolism, and previous studies have highlighted the importance of these changes in supporting fundamental aspects of anabolism, including anaplerosis and redox balance. However, whether the metabolic reprogramming in tumors is a general aspect of proliferation, an unintended consequence of aberrant signalling pathways, or a central driver of the oncogenic process is unclear. The inventors have found that an accumulation of branched-chain amino acids (BCAAs) may be used to stimulate pro-oncogenic pathways in carcinogenesis. Transcriptomic analyses of human gastrointestinal cancers identified the suppression of BCAA catabolic enzymes as a common and central feature amongst cancers. The degree of suppression strongly correlated with tumor grade and stage, and was an independent predictor of clinical outcome. Using comprehensive multi-omic analyses on a range of liver tumor models, it was shown that a loss of expression lead to a potent suppression of BCAA catabolic enzyme activity. Rather than entering anabolic flux as biosynthetic precursors, the BCAAs accumulated in tumors and stimulated nutrient-sensing pathways. Modulating BCAA accumulation influenced cell proliferation in vitro and the number and size of tumors in vivo. Importantly, this mechanism was unique to cancer cells and was not utilized by proliferating cells of the regenerating liver. In summary, the results reveal that metabolic reprogramming in cancer cells can be used to modulate signalling cascades that support tumor development and growth.
[0031] Thus, in a first aspect the present disclosure refers to a method of determining or predicting whether a subject has or likely to be having a proliferative disease comprising the step of measuring a level of an acylcarnitine (C5:1) of the subject. In some examples, the method may comprise the step of comparing the acylcarnitine (C5:1) level of the subject as compared to the acylcarnitine (C5:1) level of a control subject, or subjects not having said proliferative disease, wherein a decrease in the acylcarnitine (C5:1) level as compared to the level of the control subject indicates the subject is having, or is likely to have, the proliferative disease. As would be appreciated by the person skilled in the art, the final determination of the outcome or diagnosis of a subject having or likely to have a proliferative disease would be determined by a clinician and the result of the method of the present invention cannot and will not replace the role of a clinician.
[0032] The terms decrease, reduced, reduction, decrease, removal or inhibit are all used herein to mean a decrease by an amount, when compared to the control group or control subject. However, for avoidance of doubt, reduced, reduction or decrease, removal, or inhibit means, for example, a decrease by at least about one standard deviation as compared to the control subject, or at least about two standard deviations, or at least about three standard deviations, or by at least 1%, 2%, 3%, 4%, 5%, 8%, or 10% compared to a reference level, for example a decrease by at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% decrease (for example, when a target metabolite is not present at all in the sample, compared to a reference sample wherein the target metabolite is present), or any decrease between 10% to 100%, compared to a reference level, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold decrease, or any decrease between 2-fold and 10-fold or greater compared to a reference level. In one example, a decrease of the level of an acylcarnitine (C5:1) equivalent to a decrease of two standard deviations in a subject (when compared to the level of an acylcarnitine (C5:1) from the control group or control subject) may indicate that the subject may have or has a tumor or one or more proliferative diseases or a cancer.
[0033] As used herein, the reference to a standard deviation (also denoted as sigma, s.d., or ? refers to the statistical difference calculated between a control group (that is a group comprising subject who are known not to suffer from a proliferative disease) and one or more subjects to be analysed, whereby the calculation is performed using known statistical methods, for example, but not limited to, a simple t-test. In calculation, the samples used for calculation may be corrected or may be uncorrected, or may or may not take any predetermined bias into consideration. For example, in the art, the standard deviation is calculated from the mean of a normal distribution (also known as a Gauss distribution or a bell curve), calculated based on the available data. The deviation of data points from this calculated mean of the normal distribution is then termed to be a standard deviation when the data point falls within one sigma range (which is one standard deviation) on either side of the mean of the normal distribution. In the art, a negative standard deviation usually denotes a deviation area to the left of the mean (which is denoted as 0) on the x-axis of the normal distribution graph. Conversely, a positive standard deviation denotes a deviation area to the right of the mean on the x-axis of the normal distribution graph.
[0034] As used herein, the term control subject refers to a subject known not to have one or more diseases, which include, but are not limited to, proliferative diseases, such as cancers, metabolic diseases, fatty liver disease, hyperglycemia, other pre-disease conditions, and the like. As used herein, the term control subject also refers to a subject which is determined to be healthy as defined by clinical standards. The determination whether a subject is healthy or not can be performed, for example, by physical examination, blood tests, and the like. As will be appreciated by a person skilled in the art, a control subject can be within the same age and/or gender group as the subject.
[0035] As used herein, the term subject refers to an animal, mammal, human, including, without limitation, animals classed as bovine, porcine, equine, canine, lupine, feline, murine, ovine, avian, piscine, caprine, corvine, acrine, or delphine. In one example, the subject is a human. In one example, the subject is a human suspected to have, or to likely have, one or more proliferative diseases.
[0036] In one example, the method of present disclosure further comprises measuring a level of at least one branched-chain amino acid (BCAA) of the subject, and wherein an increase in the level of at least one branched-chain amino acid (BCAA) further confirms (or indicates) the subject is having, or is likely to have, the proliferative disease.
[0037] The terms increased, increase or enhance or activate are all used herein to mean an increase by an amount when compared to the control group or control subject. However, for the avoidance of any doubt, the terms increased, increase or enhance or activate means an increase of at least about one standard deviation compared to the control subject, or at least about two standard deviations, or at least about three standard deviations, or by at least 1%, 2%, 3%, 4%, 5%, 8%, or 10% compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10% to 100% compared to a reference level, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater compared to a reference level. In one example, an increase of the level of at least one branched-chain amino acid (BCAA) by two standard deviations in a subject (when compared to the level of at least one branched-chain amino acid (BCAA) from the control group or control subject) indicates that the subject may have or has a tumor, or one or more proliferative diseases, or a cancer.
[0038] As used herein, the term branched-chain amino acid (BCAA) refers to an amino acid having aliphatic side-chains with a branch. As used herein, the term branch may refer to a central carbon atom bound to three or more carbon atoms. In one example, the BCAA is a proteinogenic or a non-proteinogenic amino acid. In one example, the BCAA is proteinogenic. In one example, the proteinogenic BCAA includes, but is not limited to, leucine, isoleucine and valine. In one example, the branched-chain amino acids of the method of the present disclosure includes, but are not limited to, leucine, isoleucine, and valine. In one example, the branched-chain amino acid referred to herein is isoleucine. In another example, the branched-chain amino acid referred to herein is leucine. In one example, the branched-chain amino acid referred to herein is valine. In another example, the branched-chain amino acids referred to herein are isoleucine and leucine. In yet another example, the branched-chain amino acids referred to herein are isoleucine and valine. In a further example, the branched-chain amino acids referred to herein are valine and leucine.
[0039] In one example, the method of the present disclosure measures the level of one branched-chain amino acid as defined herein. In one example, the method of the present disclosure measures the level of two branched-chain amino acids. In one example, the method of the present disclosure measures the level of three branched-chain amino acids.
[0040] In one example, the methods of the present disclosure further comprises measuring the level of a further amino acid, which includes, but is not limited to, phenylalanine, methionine and asparagine and wherein an increase in the level of at least one of phenylalanine, and/or methionine and/or asparagine further confirms (or indicates) that the subject has or is likely to have, the proliferative disease. In one example, the methods may further comprise measuring the level of a further amino acid, which include, but is not limited to, phenylalanine, methionine and asparagine. In another example, an increase in the level of at least one amino acid phenylalanine, and/or methionine and/or asparagine further confirms (or indicates) that the subject has or is likely to have the proliferative disease. In one example, the amino acid is phenylalanine. In another example, the amino acid is methionine. In yet another example, the amino acid is asparagine. In a further example, the amino acids are methionine and phenylalanine. In another example, the amino acids are methionine and asparagine. In yet another example, the amino acids are phenylalanine and asparagine. In one example, the methods of the present disclosure further comprise measuring the level of the amino acid which include, but is not limited to, phenylalanine, methionine and asparagine and wherein an increase in the level of phenylalanine further confirms (or indicates) that the subject has or is likely to have the proliferative disease. In one example, the methods of the present disclosure further comprises measuring the level of the amino acid which includes, but is not limited to, phenylalanine, methionine and asparagine and wherein an increase in the level of methionine further confirms (or indicates) that the subject has or is likely to have the proliferative disease. In one example, the methods of the present disclosure further comprise measuring the level of the amino acid which includes, but is not limited to, phenylalanine, methionine and asparagine and wherein an increase in the level of asparagine further confirms (or indicates) that the subject has or is likely to have the proliferative disease. In one example, the methods of the present disclosure further comprise measuring the level of the amino acid which includes, but is not limited to, phenylalanine, methionine and asparagine and wherein an increase in the level of phenylalanine and methionine further confirms (or indicates) that the subject has or is likely to have the proliferative disease. In one example, the methods of the present disclosure further comprise measuring the level of the amino acid which includes, but is not limited to, phenylalanine, methionine and asparagine and wherein an increase in the level of phenylalanine and asparagine further confirm (or indicate) that the subject has or is likely to have the proliferative disease. In one example, the methods of the present disclosure further comprise measuring the level of the amino acid which include, but is not limited to, phenylalanine, methionine and asparagine and wherein an increase in the level of methionine and asparagine further confirm (or indicate) that the subject has or is likely to have the proliferative disease. In one example, the methods of the present disclosure further comprise measuring the level of the amino acid which include, but is not limited to, phenylalanine, methionine and asparagine and wherein an increase in the level of phenylalanine and methionine and asparagine further confirms (or indicates) that the subject is having or is likely to have the proliferative disease.
[0041] In one example, the method of the present disclosure is used to determine or predict whether a subject has or is likely to have a proliferative disease. In one example, the proliferative disease is cancer. In one example, the cancer predictable or detectable by the method of present disclosure includes, but is not limited to, liver cancer (such as hepatocellular carcinoma, and cholangiocarcinoma), head and neck squamous cell carcinoma, kidney cancer (such as kidney renal clear cell carcinoma, kidney papillary cell carcinoma, and kidney chromophobe renal cell carcinoma), colon and rectum adenocarcinoma, breast carcinoma, lung carcinoma, thyroid carcinoma, stomach adenocarcinoma, esophageal carcinoma and the like.
[0042] In one example, the method of the present disclosure is used to measure a level of an acylcarnitine (C5:1) of the subject, wherein the level of acylcarnitine (C5:1) or amino acid is measured in a biological sample obtained from the subject. In one example, the biological sample for measuring the level of an acylcarnitine (C5:1) of the subject is a tissue biopsy.
[0043] Free BCAAs are typically found in the cytoplasm of a cell. A person skilled in the art would therefore appreciate that in order for a biological sample to be used in accordance with the invention as disclosed herein, it would need to contain cells. However, these cells may or may not contain BCAAs, depending on the type and state of the cell. Having said that, a biological sample obtained from a tumor, that is a tumor sample, is typically understood to comprises cancerous cells. In an example, a tumor sample that comprises too many non-cancerous cells, such as for example blood vessels, immune cells, and the like, may produce erroneous results compared to a tumor sample which comprises cancerous cells. Therefore, in one example, the biological sample is a complete, whole (that is not dissected or resected) tumor. In another example, the biological sample is a representative tumor biopsy, which can be confirmed by examining a slice obtained from a whole tumor by histology. In one example, the biological sample is substantially free of non-cancerous cells. In one example, the method comprises the step of collecting a sample suspected of containing a tumor, part of a tumor, or cancerous cells. In one example, the method comprises the step of analyzing the sample. In one example, the analyzing step comprises preparing a cell extract. As used herein, the term substantially free refers to an object species wherein the predominant species, for example, a particular cell type in a sample, is present. For example, on a molar basis, the predominant species is more abundant than any other individual species in the composition. In regards to biological samples, a substantially pure sample will comprise more than about 80 percent of all individual species present in the sample, or more than about 85%, about 90%, about 95%, and about 99%. Ideally, the object species is purified to essential homogeneity, meaning that any and all contaminant species cannot be detected in the composition by conventional detection methods, wherein the composition consists essentially of a single macromolecular species.
[0044] In one example, the biological sample of the method of present disclosure includes, but is not limited to, a lung tissue biopsy, a breast tissue biopsy, a colorectal tissue biopsy, an esophageal tissue biopsy, a gastric tissue biopsy, a thyroid tissue biopsy, a head or neck tissue biopsy, a kidney tissue biopsy, a liver tissue biopsy, and the like.
[0045] In one example, the level of the acylcarnitine (C5:1) and/or amino acid in a sample used for the method of the present disclosure is measured using methods/devices known in the art. In one example, the level of the acylcarnitine (C5:1) in a sample used for the method of the present disclosure is measured using methods/devices known in the art. In one example, the level of the amino acid in a sample used for the method of the present disclosure is measured using methods/devices known in the art. In one example, the level of the acylcarnitine (C5:1) and amino acid in a sample used for the method of the present disclosure is measured using methods/devices known in the art. In one example, the methods/devices include, but are not limited to, HPLC-MS/MS and Nuclear Magnetic Resonance (NMR). In one example, the comparing of the level of acylcarnitine (C5:1) and/or amino acid for the method of the present disclosure is performed using computer based analysis. In one example, the comparing of the level of acylcarnitine (C5:1) for the method of the present disclosure is performed using computer based analysis. In one example, the comparing of the level of amino acid for the method of the present disclosure is performed using computer based analysis. In one example, the comparing of the level of acylcarnitine (C5:1) and amino acid for the method of the present disclosure is performed using computer based analysis.
[0046] In one example, the method of the present disclosure may further comprising administering a pharmaceutically effective amount of a branched-chain amino acid catabolism enhancer and/or a pharmaceutically effective amount of a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor) and/or an effective amount of meal replacement comprising low level of branched-chain amino acid (BCAA) into the subject in need thereof. In one example, the method of the present disclosure may further comprising administering a pharmaceutically effective amount of a branched-chain amino acid catabolism enhancer into the subject in need thereof. In one example, the method of the present disclosure may further comprising administering a pharmaceutically effective amount of a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor) into the subject in need thereof. In one example, the method of the present disclosure may further comprising administering an effective amount of meal replacement comprising low level of branched-chain amino acid (BCAA) into the subject in need thereof. In one example, the method of the present disclosure may further comprising administering a pharmaceutically effective amount of a branched-chain amino acid catabolism enhancer and a pharmaceutically effective amount of a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor) and an effective amount of meal replacement comprising low level of branched-chain amino acid (BCAA) into the subject in need thereof.
[0047] In one aspect the present disclosure refers to a method of determining or predicting whether a subject has or is likely to have a proliferative disease comprising: a. measuring a level of at least one branched-chain amino acid (BCAA) of the subject. In some examples, the method also comprises b. comparing the branched-chain amino acid level of the subject as compared to the branched-chain amino acid level of a control subject or subjects not having said proliferative disease, wherein the branched-chain amino acid level in excess of the branched-chain amino acid level of the control subject indicates the subject is having or is likely to have the proliferative disease. As would be appreciated by the person skilled in the art, the final determination of the outcome or diagnosis of a subject having or likely to have a proliferative disease would be determined by a clinician and the result of the method of the present invention cannot and will not replace the role of a clinician.
[0048] As used herein, the term control subject refers to a subject known not to have one or more diseases which include, but are not limited to, proliferative diseases, such as cancers, metabolic diseases, fatty liver disease, hyperglycemia, other pre-disease conditions, and the like. As used herein, the term control subject also refers to a subject which is determined to be healthy as defined by clinical standards. The determination whether a subject is healthy or not can be performed for example by, but are not limited to, physical examination, blood tests, and the like. As will be appreciated by a person skilled in the art, a control subject can be within the same age and/or gender group as the subject.
[0049] As used herein, the term level in excess or in excess refers to the observation that a compound, a metabolite, a peptide, a protein, and the like are present at an amount exceeding the amount generally found in a control subject. For the avoidance of any doubt, the compound, the metabolite, the peptide, the protein and the like are present, for example, in an increase of at least about one standard deviation compared to the control subject, or at least about two standard deviations, or at least about three standard deviations, or by at least 1%, 2%, 3%, 4%, 5%, 8%, or 10% compared to a reference level, or at least 20%, or at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 100%, an increase or any increase between 10% to 100% compared to a reference level, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater compared to a reference level. In one example, an increase of the level of at least one branched-chain amino acid (BCAA) by two standard deviations in a subject (when compared to the level of at least one branched-chain amino acid (BCAA) from the control group or control subject) indicates that the subject may have or has a tumor or one or more proliferative diseases or a cancer.
[0050] In one example, the method of present disclosure further comprises measuring a level of acylcarnitine (C5:1) of the subject, wherein a decrease in the level of acylcarnitine (C5:1) compared to the control further confirms (or indicates) that the subject has or is likely to have the proliferative disease.
[0051] In one example, the method of the present disclosure measures the level of one branched-chain amino acid as defined herein. In one example, the method of the present disclosure measures the level of two branched-chain amino acids. In one example, the method of the present disclosure measures the level of three branched-chain amino acids.
[0052] In one example, the methods of the present disclosure further comprises measuring the level of a further amino acid which include, but is not limited to, phenylalanine, methionine and asparagine and wherein an increase in the level of at least one of phenylalanine, and/or methionine and/or asparagine may further confirm (or indicate) the subject has or is likely to have the proliferative disease. In one example, the methods of the present disclosure further comprise measuring the level of the amino acid which include, but is not limited to, phenylalanine, methionine and asparagine and wherein an increase in the level of phenylalanine further confirms (or indicates) that the subject has or is likely to have the proliferative disease. In one example, the methods of the present disclosure further comprise measuring the level of the amino acid which includes, but is not limited to, phenylalanine, methionine and asparagine and wherein an increase in the level of methionine further confirms (or indicates) that the subject has or is likely to have the proliferative disease. In one example, the methods of the present disclosure further comprise measuring the level of the amino acid which includes, but is not limited to, phenylalanine, methionine and asparagine and wherein an increase in the level of asparagine further confirms (or indicates) that the subject is having or is likely to have the proliferative disease. In one example, the methods of the present disclosure further comprises measuring the level of the amino acid which includes, but is not limited to, phenylalanine, methionine and asparagine and wherein an increase in the level of phenylalanine and methionine further confirms (or indicates) that the subject is having or is likely to have the proliferative disease. In one example, the methods of the present disclosure further comprises measuring the level of the amino acid which includes, but is not limited to, phenylalanine, methionine and asparagine and wherein an increase in the levels of phenylalanine and asparagine further confirms (or indicates) that the subject has or is likely to have the proliferative disease. In one example, the methods of the present disclosure further comprises measuring the level of the amino acid which includes, but is not limited to, phenylalanine, methionine and asparagine and wherein an increase in the level of methionine and asparagine further confirms (or indicates) the subject has or is likely to have the proliferative disease. In one example, the methods of the present disclosure further comprises measuring the level of the amino acid which includes, but is not limited to, phenylalanine, methionine and asparagine and wherein an increase in the level of phenylalanine and methionine and asparagine further confirms (or indicates) that the subject has or is likely to have the proliferative disease.
[0053] In one example, the method of the present disclosure is used to determine or predict whether a subject has or likely to have a proliferative disease, wherein the proliferative disease may be cancer. In one example, the cancer predictable or detectable by the method of present disclosure includes but is not limited to, liver cancer (such as hepatocellular carcinoma, and cholangiocarcinoma), head and neck squamous cell carcinoma, kidney cancer (such as kidney renal clear cell carcinoma, kidney papillary cell carcinoma, and kidney chromophobe renal cell carcinoma), colon and rectum adenocarcinoma, breast carcinoma, lung carcinoma, thyroid carcinoma, stomach adenocarcinoma, esophageal carcinoma and the like.
[0054] In one example, the method of the present disclosure is used to measure a level of at least one branched-chain amino acid (BCAA) of the subject, wherein the level of acylcarnitine (C5:1) or amino acid is measured in a biological sample obtained from the subject. In one example, the biological sample for measuring the level of an acylcarnitine (C5:1) of the subject may be a tissue biopsy. In one example, the biological sample is substantially free of non-cancerous cells. In one example, the method comprises the step of collecting a sample suspected of containing a tumor, part of a tumour or cancerous cells.
[0055] In one example, the biological sample of the method of present disclosure includes but is not limited to a lung tissue biopsy, a breast tissue biopsy, a colorectal tissue biopsy, an esophageal tissue biopsy, a gastric tissue biopsy, a thyroid tissue biopsy, a head or neck tissue biopsy, a kidney tissue biopsy, a liver tissue biopsy, and the like.
[0056] In one example, the level of the acylcarnitine (C5:1) and/or amino acid in a sample used for the method of the present disclosure is measured using methods/devices known in the art. In one example, the level of the acylcarnitine (C5:1) in a sample used for the method of the present disclosure is measured using methods/devices known in the art. In one example, the level of the amino acid in a sample used for the method of the present disclosure is measured using methods/devices known in the art. In one example, the level of the acylcarnitine (C5:1) and amino acid in a sample used for the method of the present disclosure is measured using methods/devices known in the art. In one example, the methods/devices include, but are not limited to, HPLC-MS/MS and Nuclear Magnetic Resonance (NMR).
[0057] In one example, the comparing of the level of acylcarnitine (C5:1) and/or amino acid for the method of the present disclosure is performed using computer based analysis. In one example, the comparing of the level of acylcarnitine (C5:1) for the method of the present disclosure is performed using computer based analysis. In one example, the comparing of the level of amino acid for the method of the present disclosure is performed using computer based analysis. In one example, the comparing of the level of acylcarnitine (C5:1) and amino acid for the method of the present disclosure is performed using computer based analysis.
[0058] In one example, the method of the present disclosure further comprises administering a pharmaceutically effective amount of a branched-chain amino acid catabolism enhancer and/or a pharmaceutically effective amount of a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor) and/or an effective amount of meal replacement comprising low levels of branched-chain amino acid (BCAA) to the subject in need thereof. In one example, the method of the present disclosure further comprises administering a pharmaceutically effective amount of a branched-chain amino acid catabolism enhancer to the subject in need thereof. In one example, the method of the present disclosure further comprises administering a pharmaceutically effective amount of a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor) to the subject in need thereof. In one example, the method of the present disclosure further comprises administering an effective amount of meal replacement comprising low level of branched-chain amino acid (BCAA) to the subject in need thereof. In one example, the method of the present disclosure further comprises administering a pharmaceutically effective amount of a branched-chain amino acid catabolism enhancer and a pharmaceutically effective amount of a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor) and an effective amount of meal replacement comprising low levels of branched-chain amino acid (BCAA) to the subject in need thereof.
[0059] In one aspect, the present disclosure refers to a method of predicting the likelihood of a subject surviving cancer (prognosis of a subject) comprising: a. measuring a level of branched amino acids (BCAA) of the subject. In some examples, the method also comprises b. comparing and/or correlating the level measured in (a) to a standard level of branched amino acids, wherein the degree of deviation above the level of the standard indicates the degree of severity of the outcome.
[0060] As used herein, the term standard level or level of the standard may refer to the average level of at least one branched amino acids (BCAA) in a healthy group of subjects. Standard level or level of the standard of at least one branched amino acid (BCAA) can be determined for example by (1) collecting samples from a clinically healthy groups of people based on age and gender, (2) quantifying the BCAA levels from the healthy groups, (3) establishing a confidence interval of 95% and 99% for the average level of branched amino acids (BCAA) in a healthy group of subjects, and (4) defining abnormality for those measurements outside of the range of the confidence interval. As appreciated by a person skilled in the art, the determination of standard level or level of the standard can also be similar to previously established practices of determining liver functions using liver enzymes (which may include but are not limited to SGOT, SGPT, and the like).
[0061] As used herein, the term degree of deviation refers to the amount of variation present within a data population. In one example, the degree of deviation refers to the differences between the level of at least one branched amino acid (BCAA) measured from the subject and the level of at least one branched amino acid (BCAA) measured from the control subject. Thus the deviation referred to in this example is the (positive or negative) difference in value measured for a branched-chain amino acid in the subject compared to the value obtained for the same branched-chain amino acid in the control subject. The degree of deviation or a particular target molecule or marker, for example, a particular amino acid or, in one example, a branched-chain amino acid, can be established by collecting and accumulating data from both healthy and different cancer patient groups in order to establish a diagnosis window (which may have confidence interval of 95% or 99%). In this case, a higher or high degree of deviation refers to a degree of deviation of equal to or higher than three standard deviations. A lower or low degree of deviation refers to a degree of deviation between two to three standard deviations.
[0062] In one example, higher degree of deviation from the level of the standard is observed in (b). In an example wherein higher degree of deviation from the level of the standard is observed in (b), the outcome is poorer (which means a poor outcome, or negative, or unfavorable survival). In contrast, in another example, lower degree of deviation from the level of the standard is observed in (b). In an example wherein lower degree of deviation from the level of the standard is observed in (b), the outcome is better (which means a good prognosis, positive, or favorable survival).
[0063] In one example, the standard level of the method of the present disclosure is a predetermined level obtained from subjects known to have a good prognosis. The standard level can be determined by creating an average value based on a particular characteristic present in a group of healthy subjects. Such an average value can be generated by collecting and analyzing data from healthy patients and patients of relevant diseases (which can be further divided into groups based on diseases, gender, race, age, etc.). In one example, the average value or normal range is determined based on a group of healthy subjects based on age and gender. In another example, the average value or normal range is determined based on a group of healthy subjects based on age, gender and race). This average value or normal range can be a 95% confidence interval or a 99% confidence interval, depending on the stringency required of the diagnosis: for example, a confidence interval of 95% is used so as not to under-diagnose. A confidence interval of 99% is used, for example, to reduce potential false positive results, which are results that appear to be positive, but at actually negative for the characteristic in questions and only appear to be a positive result due to handling errors and the like. In one example, it is possible to use standard deviations as described above as a way to define low and high degree of deviations. It is of note that the terms average and mean are used interchangeably in the art. In the art of statistics, it is noted that while average and mean may refer to the same concept, the determination of the two is different. An average in statistics refers to a grouping of data points that fall around the centre of the normal distribution curve, for example. A mean is the mathematical (arithmetic) calculation of the sum of all values (for example, n) taken into consideration and divided by the total number of values (which would also be n). In other words, an average and an arithmetic mean are synonymous. However, a statistical mean can also be defined using geometric or harmonic means, and would then vary from the average as discussed above.
[0064] In one example, the method of the present disclosure measures the level of one branched-chain amino acid. In one example, the method of the present disclosure measures the level of two branched-chain amino acid. In one example, the method of the present disclosure measures the level of three branched-chain amino acids.
[0065] In one example, the method of the present disclosure is used to predict the likelihood of a subject surviving proliferative disease, wherein the proliferative disease is cancer. In one example, the cancer predictable or detectable by the method of present disclosure includes, but is not limited to, liver cancer (such as hepatocellular carcinoma, and cholangiocarcinoma), head and neck squamous cell carcinoma, kidney cancer (such as kidney renal clear cell carcinoma, kidney papillary cell carcinoma, and kidney chromophobe renal cell carcinoma), colon and rectum adenocarcinoma, breast carcinoma, lung carcinoma, thyroid carcinoma, stomach adenocarcinoma, esophageal carcinoma, and the like.
[0066] In one example, the method of the present disclosure is used to measure a level of at least one branched-chain amino acid (BCAA) of the subject, wherein the level of acylcarnitine (C5:1) or amino acid is measured in a biological sample obtained from the subject. In one example, the biological sample for measuring the level of an acylcarnitine (C5:1) of the subject is a tissue biopsy.
[0067] In one example, the biological sample of the method of present disclosure includes but is not limited to a lung tissue biopsy, a breast tissue biopsy, a colorectal tissue biopsy, an esophageal tissue biopsy, a gastric tissue biopsy, a thyroid tissue biopsy, a head or neck tissue biopsy, a kidney tissue biopsy, a liver tissue biopsy, and the like.
[0068] In one example the level of the amino acid in a sample used for the method of the present disclosure is measured using methods/devices known in the art. In one example, the methods/devices may include but are not limited to HPLC-MS/MS and Nuclear Magnetic Resonance (NMR).
[0069] In one example, the comparing of the level of amino acid for the method of the present disclosure is performed using computer based analysis.
[0070] In one example, the prognosis of a subject using the method of the present disclosure is poor or negative. In one example, the subject with poor outcomes/prognosis (negative survival) are subjects having high-grade cancer (such as having a tumor with a grade of 3 and/or 4), and/or likelihood of disease recurrence or progression, and/or not surviving more than 1, or 2, or 3, or 4, or 5 years. In one example, the subject with poor outcomes/prognosis (negative survival) are subjects having high-grade cancer (such as having a tumor with a grade of 3 and/or 4). In one example, the subjects with poor outcomes/prognosis (negative survival) are subjects in whom the likelihood of disease recurrence or progression is present. In one example, the subject with poor outcomes/prognosis (negative survival) are subjects who do not survive more than 1, or 2, or 3, or 4, or 5 years. In one example, the subject with poor outcomes/prognosis (negative survival) are subjects having high-grade cancer (such as having a tumor with a grade of 3 and/or 4), and likelihood of disease recurrence or progression. In one example, the subject with poor outcomes/prognosis (negative survival) are subjects having high-grade cancer (such as having a tumor with a grade of 3 and/or 4) and not surviving for more than 1, or 2, or 3, or 4, or 5 years. In one example, the subject with poor outcomes/prognosis (negative survival) are subjects having the likelihood of disease recurrence or progression and not surviving for more than 1, or 2, or 3, or 4, or 5 years. In one example, the subject with poor outcomes/prognosis (negative survival) are subjects having high-grade cancer (such as having a tumor with a grade of 3 and/or 4), and likelihood of disease recurrence or progression, and not surviving for more than 1, or 2, or 3, or 4, or 5 years.
[0071] As would be appreciated by a person skilled in the art, tumor grading or tumor grade or grade of tumor refers to the description of a tumor based on how abnormal the cells from tumor samples and the tumor tissue appear under a microscope, for example under histological analysis. The tumor grade or tumor grading or grade of tumor may also be an indicator of how quickly a tumor is likely to grow or spread. It is generally understood that cells from tumor samples and the organization of tumor tissue that are close (or appear similar) to normal cells and tissues are considered to be well-differentiated, and may grow or spread at a slower rate compared to abnormal looking cells from the tumor and tumor tissues (i.e. undifferentiated or poorly differentiated). The grading system for tumor grade or tumor grading or grade of tumor generally comprises five different grades, which are GX (which means the grade cannot be assessed or undetermined grade), G1 (which means grade 1, well differentiated cells and/or tissues, low grade), G2 (which means grade 2, moderately differentiated cells and/or tissues, intermediate grade), G3 (which means. grade 3, poorly differentiated cells and/or tissues, high grade), and G4 (which means grade 4, undifferentiated cells and/or tissues, high grade).
[0072] In one example, poor outcome/prognosis (negative survival) indicates a reduced likelihood of survival over 7 years. In one example, poor outcome/prognosis (negative survival) indicates a reduced likelihood of survival over 6 years. In one example, poor outcome/prognosis (negative survival) indicates a reduced likelihood of survival over 5 years. In one example, poor outcome/prognosis (negative survival) indicates a reduced likelihood of survival over 4 years. In one example, poor outcome/prognosis (negative survival) indicates a reduced likelihood of survival over 3 years. In one example, poor outcome/prognosis (negative survival) indicates a reduced likelihood of survival over 2 years. In one example, poor outcome/prognosis (negative survival) indicates a reduced likelihood of survival over 1 year.
[0073] In one example, good outcome/prognosis indicates a likelihood of survival of more than 7 years, and/or recurrence-free survival (of more than 7 years). In one example, good outcome/prognosis indicates a likelihood of survival of more than 6 years, and/or recurrence-free survival (of more than 6 years). In one example, good outcome/prognosis indicates a likelihood of survival of more than 5 years, and/or recurrence-free survival (of more than 5 years). In one example, good outcome/prognosis indicates a likelihood of survival of more than 4 years, and/or recurrence-free survival (of more than 4 years). In one example, good outcome/prognosis indicates a likelihood of survival of more than 3 years, and/or recurrence-free survival (of more than 3 years). In one example, good outcome/prognosis indicates a likelihood of survival of more than 2 years, and/or recurrence-free survival (of more than 2 years). In one example, good outcome/prognosis indicates a likelihood of survival of more than 1 year, and/or recurrence-free survival (of more than 1 year).
[0074] As would be appreciated by the person skilled in the art, the final determination of the outcome or diagnosis of a cancer patient is determined by a clinician and the result of the method of the present invention cannot or will not replace the role of a clinician. In general, it would be understood that the outcome also depends on traditional variables, such as, but not limited to underlying diseases and risk factors, time of diagnosis, tumor grade, tumor stage, quality of care, approved and available treatment options and the like.
[0075] In one example, for hepatocellular carcinoma patients, it is understood that the outcome or diagnosis depends on various variables such as, for example, the geographical location of the patient, which in turn reflects underlying factors such as those factors driven by, for example, HVB/HCV, alcohol, alfatoxin, NASH/NAFLD, and the like, quality care, approved and available treatment options, and the like.
[0076] In one example, the method of the present disclosure further comprises administering a pharmaceutically effective amount of a branched-chain amino acid catabolism enhancer and/or a pharmaceutically effective amount of a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor) and/or an effective amount of meal replacement comprising low level of branched-chain amino acid (BCAA) to the subject in need thereof. In one example, the method of the present disclosure further comprises administering a pharmaceutically effective amount of a branched-chain amino acid catabolism enhancer to the subject in need thereof. In one example, the method of the present disclosure further comprises administering a pharmaceutically effective amount of a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor) to the subject in need thereof. In one example, the method of the present disclosure further comprises administering an effective amount of meal replacement comprising low level of branched-chain amino acid (BCAA) to the subject in need thereof. In one example, the method of the present disclosure further comprises administering a pharmaceutically effective amount of a branched-chain amino acid catabolism enhancer and a pharmaceutically effective amount of a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor) and an effective amount of meal replacement comprising low level of branched-chain amino acid (BCAA) to the subject in need thereof.
[0077] In one aspect, the present disclosure refers to a method of determining or predicting whether a subject is having or likely to have a proliferative disease comprising: a. measuring a level of branched amino acids (BCAA) catabolic enzymes of the subject. In some examples, the method comprises b. comparing the level measured in (a) to the level of a branched amino acids (BCAA) catabolic enzymes of a control subject (or subjects) not having said proliferative disease, wherein a decreased branched amino acids (BCAA) catabolic enzymes level as compared to the branched amino acids (BCAA) catabolic enzymes level of the control subject indicates the subject has or is likely to have the proliferative disease. As would be appreciated by the person skilled in the art, the final determination of the outcome or diagnosis of a subject having or likely to have a proliferative disease would be determined by a clinician and the result of the method of the present invention cannot and will not replace the role of a clinician.
[0078] The terms decrease, reduced, reduction, decrease, removal or inhibit are all used herein to mean a decrease by an amount when compared to the control group or control subject. However, for avoidance of doubt, reduced, reduction or decrease, removal, or inhibit means a decrease by at least about one standard deviation compared to the control subject, or at least about two standard deviations, or at least about three standard deviations, or by at least 1%, 2%, 3%, 4%, 5%, 8%, or 10% as compared to a reference level, for example a decrease by at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% decrease (e.g. absent level as compared to a reference sample), or any decrease between 10% to 100% as compared to a reference level. In one example, a decrease of the level of at least one branched amino acids (BCAA) catabolic enzyme by two standard deviations in a subject (when compared to the level of at least one branched amino acids (BCAA) catabolic enzyme from the control group or control subject) may indicate that the subject may have or has a tumor or one or more proliferative diseases or a cancer.
[0079] As used herein, the term control subject refers to a subject known not to have one or more diseases which include, but are not limited to, proliferative diseases, such as cancers, metabolic diseases, fatty liver disease, hyperglycemia, other pre-disease conditions, and the like. As used herein, the term control subject also refers to a subject who is determined to be healthy, as defined by clinical standards. The determination whether a subject as healthy or not can be performed, for example, by physical examination, blood tests, and the like. As will be appreciated by a person skilled in the art, a control subject can be within the same age and/or gender group as the subject.
[0080] As used herein, the term subject refers to an animal, mammal, human, including, without limitation, animals classed as bovine, porcine, equine, canine, lupine, feline, murine, ovine, avian, piscine, caprine, corvine, acrine, or delphine. In one example, the subject is a human. In one example, the subject is a human having, or suspected to have or to likely have, one or more proliferative diseases.
[0081] As used herein, the term catabolic enzyme refers to enzymes that play a role in destructive metabolism or the breakdown of complex molecules in living organisms to form simpler ones, together with the release of energy. As such, the term branched-chain amino acids (BCAA) catabolic enzymes refers to enzymes that play a role in destructive metabolism or the breakdown of branched-chain amino acid (BCAA).
[0082] In one example, the branched-chain amino acids catabolic enzymes of the method of the present disclosure include, but are not limited to, ABAT (4-aminobutyrate aminotransferase), ACAA1 (acetyl-CoA acyltransferase 1), ACAA2 (acetyl-CoA acyltransferase 2), ACAD8 (acyl-CoA dehydrogenase family member 8), ACADM (acyl-CoA dehydrogenase, C-4 to C-12 straight chain), ACADS (acyl-CoA dehydrogenase, C-2 to C-3 short chain), ACADSB (acyl-CoA dehydrogenase, short/branched chain), ACAT1 (acetyl-CoA acetyltransferase 1), ACAT2 (acetyl-CoA acetyltransferase 2), ALDH1B1 (aldehyde dehydrogenase 1 family member B1), ALDH2 (aldehyde dehydrogenase 2 family (mitochondrial)), ALDH3A2 (aldehyde dehydrogenase 3 family member A2), ALDH6A1 (aldehyde dehydrogenase 6 family member A1), ALDH9A1 (aldehyde dehydrogenase 9 family member A1), AOX1 (aldehyde oxidase 1), AUH (AU RNA binding protein/enoyl-CoA hydratase), BCKDHA (branched chain keto acid dehydrogenase E1, alpha polypeptide), BCKDHB (branched chain keto acid dehydrogenase E1, beta polypeptide), DBT (dihydrolipoamide branched chain transacylase E2), DLD (dihydrolipoamide dehydrogenase), ECHS1 (enoyl-CoA hydratase, short chain, 1, mitochondrial), EHHADH (enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase), HADH (hydroxyacyl-CoA dehydrogenase), HADHA (hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit), HADHB (hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit), HIBADH (3-hydroxyisobutyrate dehydrogenase), HIBCH (3-hydroxyisobutyryl-CoA hydrolase), HMGCL (3-hydroxymethyl-3-methylglutaryl-CoA lyase), HMGCS2 (3-hydroxy-3-methylglutaryl-CoA synthase 2), HSD17B10 (hydroxysteroid (17-beta) dehydrogenase 10), IVD (isovaleryl-CoA dehydrogenase), MCCC1 (methylcrotonoyl-CoA carboxylase 1), MCCC2 (methylcrotonoyl-CoA carboxylase 2), MCEE (methylmalonyl-CoA epimerase), MUT (methylmalonyl-CoA mutase), OXCT1 (3-oxoacid CoA-transferase 1), PCCA (propionyl-CoA carboxylase alpha subunit), PCCB (propionyl-CoA carboxylase beta subunit), and the like.
[0083] The branched-chain amino acids catabolic enzymes of the method of the present disclosure may also be referred to using the following Gene ID:
TABLE-US-00001 Official Gene Symbol ID Official Full Name ABAT 18 4-aminobutyrate aminotransferase ACAA1 30 acetyl-CoA acyltransferase 1 ACAA2 10449 acetyl-CoA acyltransferase 2 ACAD8 27034 acyl-CoA dehydrogenase family member 8 ACADM 34 acyl-CoA dehydrogenase, C-4 to C-12 straight chain ACADS 35 acyl-CoA dehydrogenase, C-2 to C-3 short chain ACADSB 36 acyl-CoA dehydrogenase, short/branched chain ACAT1 38 acetyl-CoA acetyltransferase 1 ACAT2 39 acetyl-CoA acetyltransferase 2 ALDH1B1 219 aldehyde dehydrogenase 1 family member B1 ALDH2 217 aldehyde dehydrogenase 2 family (mitochondrial) ALDH3A2 224 aldehyde dehydrogenase 3 family member A2 ALDH6A1 4329 aldehyde dehydrogenase 6 family member A1 ALDH9A1 223 aldehyde dehydrogenase 9 family member A1 AOX1 316 aldehyde oxidase 1 AUH 549 AU RNA binding protein/enoyl-CoA hydratase BCKDHA 593 branched chain keto acid dehydrogenase E1, alpha polypeptide BCKDHB 594 branched chain keto acid dehydrogenase E1, beta polypeptide DBT 1629 dihydrolipoamide branched chain transacylase E2 DLD 1738 dihydrolipoamide dehydrogenase ECHS1 1892 enoyl-CoA hydratase, short chain, 1, mitochondrial EHHADH 1962 enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase HADH 3033 hydroxyacyl-CoA dehydrogenase HADHA 3030 hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit HADHB 3032 hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit HIBADH 11112 3-hydroxyisobutyrate dehydrogenase HIBCH 26275 3-hydroxyisobutyryl-CoA hydrolase HMGCL 3155 3-hydroxymethyl-3-methylglutaryl-CoA lyase HMGCS2 3158 3-hydroxy-3-methylglutaryl-CoA synthase 2 HSD17B10 3028 hydroxysteroid (17-beta) dehydrogenase 10 IVD 3712 isovaleryl-CoA dehydrogenase MCCC1 56922 methylcrotonoyl-CoA carboxylase 1 MCCC2 64087 methylcrotonoyl-CoA carboxylase 2 MCEE 84693 methylmalonyl-CoA epimerase MUT 4594 methylmalonyl-CoA mutase OXCT1 5019 3-oxoacid CoA-transferase 1 PCCA 5095 propionyl-CoA carboxylase alpha subunit; and PCCB 5096 propionyl-CoA carboxylase beta subunit.
[0084] As shown in, for example in
[0085] In one example, the level measured in the method of the present disclosure is of branched amino acids (BCAA) catabolic enzymes activity.
[0086] In one example, the level of enzyme activity in the method of the present disclosure is be measured by Magnetic Resonance Spectroscopy (MRS). In one example, the level of enzyme activity in the method of the present disclosure is detected by Magnetic Resonance Spectroscopy (MRS) by administering a hyperpolarized .sup.13C compound. In one example, the level of enzyme activity in the method of the present disclosure is detected by Magnetic Resonance Spectroscopy (MRS) by administering .sup.13C-alpha-ketoisocaproate. In one non-limiting example, the steps involved in MRS approach include, but are not limited to: (1) preparation of a solution comprising hyperpolarized sodium [1-.sup.13C]2-ketoisocaproate; (2) injection of solution in point (1) to the tail end of a mouse; (3) detection of metabolite peaks corresponding to [1-.sup.13C]2-ketoisocaproate (i.e. the starting material), [1-.sup.13C]leucine (i.e. the product of BCAT enzyme activity), and [1-.sup.13C]bicarbonate (i.e. the byproduct of BCKDH enzyme activity); (4) quantification of the metabolite peaks of point (3) by calculating the ratio of [1-.sup.13C]leucine peak and [1-.sup.13C]bicarbonate peak to the sum of all three metabolite peaks (i.e. tCarbon); and (5) inferring the enzyme activity level of BCKDH based on the result of point (4). The Magnetic Resonance Spectroscopy of the present disclosure may differ from Magnetic Resonance Imaging (MRI) method known in the art, as MRS provides molecular information on the enzyme activities, whereas MRI gives an image or statistical map of the region of observation. The MRS approach provided herein is used to infer the level of acylcarnitine (C5:1); the level of accumulated BCAA; and the transcript level of enzymes involved in catabolism of at least one BCAA. The MRS approach may provide the enzyme activity of BCKDH, which is the first rate-limiting step of BCAA degradation. If the enzyme activity of BCKDH is lower, the BCAA degradation may be impaired/reduced which may indicate BCAA accumulation and reduced level of C5:1 acylcarnitine.
[0087] In one example, the level of enzyme measured by the method of the present disclosure is measured in a biological sample obtained from the subject. In one example, the biological sample to be measured by the method of the present disclosure is a tissue biopsy. In one example, the biological sample of the method of present disclosure includes, but is not limited to, a lung tissue biopsy, a breast tissue biopsy, a colorectal tissue biopsy, an esophageal tissue biopsy, a gastric tissue biopsy, a thyroid tissue biopsy, a head or neck tissue biopsy, a kidney tissue biopsy, a liver tissue biopsy, and the like.
[0088] In one example, the biological sample is a complete tumor. In another example, the biological sample is a representative tumor biopsy, which can be confirmed by examining a slice of the tumor by histology. In one example, the biological sample is substantially free of non-carcinoma cells.
[0089] In one example, the method comprises the step of collecting a sample suspected of containing a tumor, part of a tumor, or cancerous cells.
[0090] In one example, the measured level of branched amino acids (BCAA) catabolic enzymes of the method of present disclosure is at RNA and/or protein level(s). In one example, the measured level of branched amino acids (BCAA) catabolic enzymes of the method of present disclosure is at RNA level(s). In one example, the measured level of branched amino acids (BCAA) catabolic enzymes of the method of present disclosure may be at protein level(s). In one example, the measured level of branched amino acids (BCAA) catabolic enzymes of the method of present disclosure is at RNA and protein level(s).
[0091] In one example, the RNA level of branched amino acids (BCAA) catabolic enzymes of the method of present disclosure is measured by methods or devices which include, but is not limited to, RT-PCR, microarray, sequencing, and the like. In one example, the protein level of branched amino acids (BCAA) catabolic enzymes of the method of present disclosure is measured using methods/devices which include but is not limited to immunohistochemistry, protein array, mass spectrometry, and the like.
[0092] In one example, the comparing of the RNA and/or protein level of branched amino acids (BCAA) catabolic enzymes of the method of present disclosure is performed using computer based analysis. In one example, the comparing of the RNA level of branched amino acids (BCAA) catabolic enzymes of the method of present disclosure may be performed using computer based analysis. In one example, the comparing of the protein level of branched amino acids (BCAA) catabolic enzymes of the method of present disclosure is performed using computer based analysis. In one example, the comparing of the RNA and protein level of branched amino acids (BCAA) catabolic enzymes of the method of present disclosure may be performed using computer based analysis.
[0093] In one example, the method of the present disclosure is used to determine or predict whether a subject is having or likely to have a proliferative disease, wherein the proliferative disease is cancer. In one example, the cancer which is predictable or detectable by the method of present disclosure includes but is not limited to liver cancer (such as hepatocellular carcinoma, and cholangiocarcinoma), head and neck squamous cell carcinoma, kidney cancer (such as kidney renal clear cell carcinoma, kidney papillary cell carcinoma, and kidney chromophobe renal cell carcinoma), colon and rectum adenocarcinoma, breast carcinoma, lung carcinoma, thyroid carcinoma, stomach adenocarcinoma, esophageal carcinoma, and the like.
[0094] In one aspect, the present disclosure refers to a method of predicting the likelihood of a subject surviving cancer (prognosis of a subject) comprising: a. measuring a level of branched amino acids (BCAA) catabolic enzymes of the subject. In some examples, the method also comprises b. comparing and/or correlating the level measured in (a) to a standard level of branched amino acids catabolic enzymes, wherein the degree of deviation above the level of the standard indicates the degree of severity of the outcome.
[0095] As used herein, the term standard level or level of the standard refers to the average level of at least one branched amino acids (BCAA) catabolic enzyme in a healthy group of subjects. Standard level or level of the standard of at least one branched amino acids (BCAA) catabolic enzyme can be determined for example by (1) collecting samples from a clinically healthy groups of people based on age and gender, (2) quantifying the BCAA levels from the healthy groups, (3) establishing a confidence interval of 95% and 99% for the average level of branched amino acids (BCAA) in a healthy group of subjects, and (4) defining abnormality for those measurements outside of the range of the confidence interval. As appreciated by a person skilled in the art, the determination of standard level or level of the standard can also be similar to previously established practices of determining liver functions using liver enzymes (which may include but are not limited to SGOT, SGPT, and the like).
[0096] As used herein, the term degree of deviation refers to the amount of variation present within a data population. In one example, the degree of deviation refers to the differences between the level of at least one branched amino acids (BCAA) catabolic enzyme measured from the subject and the level of at least one branched amino acids (BCAA) catabolic enzyme measured from the control subject. Thus the deviation referred to in this example is the (positive or negative) difference in value measured for a branched-chain amino acid in the subject compared to the value obtained for the same branched-chain amino acid in the control subject. The degree of deviation or a particular target molecule or marker, for example, a particular amino acid or, in one example, a branched-chain amino acid, can be established by collecting and accumulating data from both healthy and different cancer patient groups in order to establish a diagnosis window (which may have confidence interval of 95% or 99%). In this case, a higher or high degree of deviation refers to a degree of deviation of equal to or higher than three standard deviations. A lower or low degree of deviation refers to a degree of deviation between two to three standard deviations.
[0097] In one example, higher degree of deviation from the level of the standard is observed in (b). In an example wherein higher degree of deviation from the level of the standard is observed in (b), the outcome is poorer (which means a poor outcome, negative, or unfavorable survival). In contrast, in another example, lower degree of deviation from the level of the standard may be observed in (b). In an example wherein lower degree of deviation from the level of the standard is observed in (b), the outcome may be better (which means a good prognosis, positive, or favorable survival).
[0098] As used herein, the term catabolic enzyme refers to enzymes that play a role in destructive metabolism or the breakdown of complex molecules in living organisms to form simpler ones, together with the release of energy. As such, the term branched-chain amino acids (BCAA) catabolic enzymes refers to enzymes that play a role in destructive metabolism or the breakdown of branched amino acid (BCAA).
[0099] In one example, the standard level of the method of the present disclosure may is a predetermined level obtained from subjects known to have good prognosis.
[0100] In one example, the branched amino acids catabolic enzymes of the method of the present disclosure include, but are not limited to, ABAT (4-aminobutyrate aminotransferase), ACAA1 (acetyl-CoA acyltransferase 1), ACAA2 (acetyl-CoA acyltransferase 2), ACAD8 (acyl-CoA dehydrogenase family member 8), ACADM (acyl-CoA dehydrogenase, C-4 to C-12 straight chain), ACADS (acyl-CoA dehydrogenase, C-2 to C-3 short chain), ACADSB (acyl-CoA dehydrogenase, short/branched chain), ACAT1 (acetyl-CoA acetyltransferase 1), ACAT2 (acetyl-CoA acetyltransferase 2), ALDH1B1 (aldehyde dehydrogenase 1 family member B1), ALDH2 (aldehyde dehydrogenase 2 family (mitochondrial)), ALDH3A2 (aldehyde dehydrogenase 3 family member A2), ALDH6A1 (aldehyde dehydrogenase 6 family member A1), ALDH9A1 (aldehyde dehydrogenase 9 family member A1), AOX1 (aldehyde oxidase 1), AUH (AU RNA binding protein/enoyl-CoA hydratase), BCKDHA (branched chain keto acid dehydrogenase E1, alpha polypeptide), BCKDHB (branched chain keto acid dehydrogenase E1, beta polypeptide), DBT (dihydrolipoamide branched chain transacylase E2), DLD (dihydrolipoamide dehydrogenase), ECHS1 (enoyl-CoA hydratase, short chain, 1, mitochondrial), EHHADH (enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase), HADH (hydroxyacyl-CoA dehydrogenase), HADHA (hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit), HADHB (hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit), HIBADH (3-hydroxyisobutyrate dehydrogenase), HIBCH (3-hydroxyisobutyryl-CoA hydrolase), HMGCL (3-hydroxymethyl-3-methylglutaryl-CoA lyase), HMGCS2 (3-hydroxy-3-methylglutaryl-CoA synthase 2), HSD17B10 (hydroxysteroid (17-beta) dehydrogenase 10), IVD (isovaleryl-CoA dehydrogenase), MCCC1 (methylcrotonoyl-CoA carboxylase 1), MCCC2 (methylcrotonoyl-CoA carboxylase 2), MCEE (methylmalonyl-CoA epimerase), MUT (methylmalonyl-CoA mutase), OXCT1 (3-oxoacid CoA-transferase 1), PCCA (propionyl-CoA carboxylase alpha subunit), PCCB (propionyl-CoA carboxylase beta subunit) and the like.
[0101] The branched amino acids catabolic enzymes of the method of the present disclosure may also be referred to using the following Gene ID:
TABLE-US-00002 Official Gene Symbol ID Official Full Name ABAT 18 4-aminobutyrate aminotransferase ACAA1 30 acetyl-CoA acyltransferase 1 ACAA2 10449 acetyl-CoA acyltransferase 2 ACAD8 27034 acyl-CoA dehydrogenase family member 8 ACADM 34 acyl-CoA dehydrogenase, C-4 to C-12 straight chain ACADS 35 acyl-CoA dehydrogenase, C-2 to C-3 short chain ACADSB 36 acyl-CoA dehydrogenase, short/branched chain ACAT1 38 acetyl-CoA acetyltransferase 1 ACAT2 39 acetyl-CoA acetyltransferase 2 ALDH1B1 219 aldehyde dehydrogenase 1 family member B1 ALDH2 217 aldehyde dehydrogenase 2 family (mitochondrial) ALDH3A2 224 aldehyde dehydrogenase 3 family member A2 ALDH6A1 4329 aldehyde dehydrogenase 6 family member A1 ALDH9A1 223 aldehyde dehydrogenase 9 family member A1 AOX1 316 aldehyde oxidase 1 AUH 549 AU RNA binding protein/enoyl-CoA hydratase BCKDHA 593 branched chain keto acid dehydrogenase E1, alpha polypeptide BCKDHB 594 branched chain keto acid dehydrogenase E1, beta polypeptide DBT 1629 dihydrolipoamide branched chain transacylase E2 DLD 1738 dihydrolipoamide dehydrogenase ECHS1 1892 enoyl-CoA hydratase, short chain, 1, mitochondrial EHHADH 1962 enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase HADH 3033 hydroxyacyl-CoA dehydrogenase HADHA 3030 hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit HADHB 3032 hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit HIBADH 11112 3-hydroxyisobutyrate dehydrogenase HIBCH 26275 3-hydroxyisobutyryl-CoA hydrolase HMGCL 3155 3-hydroxymethyl-3-methylglutaryl-CoA lyase HMGCS2 3158 3-hydroxy-3-methylglutaryl-CoA synthase 2 HSD17B10 3028 hydroxysteroid (17-beta) dehydrogenase 10 IVD 3712 isovaleryl-CoA dehydrogenase MCCC1 56922 methylcrotonoyl-CoA carboxylase 1 MCCC2 64087 methylcrotonoyl-CoA carboxylase 2 MCEE 84693 methylmalonyl-CoA epimerase MUT 4594 methylmalonyl-CoA mutase OXCT1 5019 3-oxoacid CoA-transferase 1 PCCA 5095 propionyl-CoA carboxylase alpha subunit; and PCCB 5096 propionyl-CoA carboxylase beta subunit.
[0102] As shown for example in
[0103] In one example, the level measured in the method of the present disclosure are of branched amino acids (BCAA) catabolic enzymes activity.
[0104] In one example, the level of enzyme activity in the method of the present disclosure is measured by Magnetic Resonance Spectroscopy (MRS). In one example, the level of enzyme activity in the method of the present disclosure is detected by Magnetic Resonance Spectroscopy (MRS) by administering a hyperpolarized .sup.13C compound. In one example, the level of enzyme activity in the method of the present disclosure is detected by Magnetic Resonance Spectroscopy (MRS) by administering .sup.13C-alpha-ketoisocaproate. In one non-limiting example, the steps involved in MRS approach include but are not limited to: (1) preparation of a solution comprising hyperpolarized sodium [1-.sup.13C]2-ketoisocaproate; (2) injection of solution in point (1) to the tail end of a mouse; (3) detection of metabolite peaks corresponding to [1-.sup.13C]2-ketoisocaproate (i.e. the starting material), [1-.sup.13C]leucine (i.e. the product of BCAT enzyme activity), and [1-.sup.13C]bicarbonate (i.e. the byproduct of BCKDH enzyme activity); (4) quantification of the metabolite peaks of point (3) by calculating the ratio of [1-.sup.13C]leucine peak and [1-.sup.13C]bicarbonate peak to the sum of all three metabolite peaks (i.e. tCarbon); and (5) inferring the enzyme activity level of BCKDH based on the result of point (4). The Magnetic Resonance Spectroscopy of the present disclosure may differ from Magnetic Resonance Imaging (MRI) method known in the art, as MRS provides molecular information on the enzyme activities whereas MRI gives an image or statistical map of the region of observation. The MRS approach provided herein may be used to infer the level of acylcarnitine (C5:1); the level of accumulated BCAA; and the transcript level of enzymes involved in catabolism of at least one BCAA. The MRS approach may provide the enzyme activity of BCKDH, which is the first rate-limiting step of BCAA degradation. If the enzyme activity of BCKDH is lower, the BCAA degradation may be impaired/reduced which may indicate BCAA accumulation and reduced level of C5:1 acylcarnitine.
[0105] In one example, the level of enzyme measured by the method of the present disclosure is measured in a biological sample obtained from the subject. In one example, the biological sample to be measured by the method of the present disclosure is a tissue biopsy.
[0106] In one example, the biological sample of the method of present disclosure includes, but is not limited to a lung tissue biopsy, a breast tissue biopsy, a colorectal tissue biopsy, an esophageal tissue biopsy, a gastric tissue biopsy, a thyroid tissue biopsy, a head or neck tissue biopsy, a kidney tissue biopsy, a liver tissue biopsy and the like.
[0107] In one example, the biological sample is substantially free of non-carcinoma cells.
[0108] In one example, the method comprises the step of collecting a sample suspected of containing a tumor, part of a tumor, or cancerous cells.
[0109] As used herein, the term substantially free refers to an object species wherein the predominant species, for example, a particular cell type in a sample, is present. For example, on a molar basis, the predominant species is more abundant than any other individual species in the composition. In regards to biological samples, a substantially pure sample will comprise more than about 80 percent of all individual species present in the sample, or more than about 85%, about 90%, about 95%, and about 99%. Ideally, the object species is purified to essential homogeneity, meaning that any and all contaminant species cannot be detected in the composition by conventional detection methods, wherein the composition consists essentially of a single macromolecular species.
[0110] In one example, the measured level of branched amino acids (BCAA) catabolic enzymes of the method of present disclosure is at RNA and/or protein level(s). In one example, the measured level of branched amino acids (BCAA) catabolic enzymes of the method of present disclosure is at RNA level(s). In one example, the measured level of branched amino acids (BCAA) catabolic enzymes of the method of present disclosure is at protein level(s). In one example, the measured level of branched amino acids (BCAA) catabolic enzymes of the method of present disclosure is at RNA and protein level(s).
[0111] In one example, the RNA level of branched amino acids (BCAA) catabolic enzymes of the method of present disclosure is measured by methods or devices which include, but are not limited to, RT-PCR, microarray, sequencing and the like.
[0112] In one example, the protein level of branched amino acids (BCAA) catabolic enzymes of the method of present disclosure is measured using methods/devices which include, but are not limited to immunohistochemistry, protein array, mass spectrometry, and the like.
[0113] In one example, the comparing of the RNA and/or protein level of branched amino acids (BCAA) catabolic enzymes of the method of present disclosure is performed using computer based analysis. In one example, the comparing of the RNA level of branched amino acids (BCAA) catabolic enzymes of the method of present disclosure is performed using computer based analysis. In one example, the comparing of the protein level of branched amino acids (BCAA) catabolic enzymes of the method of present disclosure is performed using computer based analysis. In one example, the comparing of the RNA and protein level of branched amino acids (BCAA) catabolic enzymes of the method of present disclosure is performed using computer based analysis.
[0114] In one example, the prognosis of a subject using the method of the present disclosure is poor or negative. In one example, the subject with poor outcomes/prognosis (negative survival) are subjects having high-grade cancer (such as having a tumor with a grade of 3 and/or 4), and/or likelihood of disease recurrence or progression, and/or not surviving for more than 1, or 2, or 3, or 4, or 5 years. In one example, the subject with poor outcomes/prognosis (negative survival) are subjects having high-grade cancer (such as having a tumor with a grade of 3 and/or 4). In one example, the subject with poor outcomes/prognosis (negative survival) are subjects having the likelihood of disease recurrence or progression. In one example, the subject with poor outcomes/prognosis (negative survival) are subjects who do not surviving for more than 1, or 2, or 3, or 4, or 5 years. In one example, the subject with poor outcomes/prognosis (negative survival) are subjects having high-grade cancer (such as having a tumor with a grade of 3 and/or 4), and likelihood of disease recurrence or progression. In one example, the subject with poor outcomes/prognosis (negative survival) are subjects having high-grade cancer (such as having a tumor with a grade of 3 and/or 4) and not surviving for more than 1, or 2, or 3, or 4, or 5 years. In one example, the subject with poor outcomes/prognosis (negative survival) are subjects having the likelihood of disease recurrence or progression and not surviving for more than 1, or 2, or 3, or 4, or 5 years. In one example, the subject with poor outcomes/prognosis (negative survival) are subjects having high-grade cancer (such as having a tumor with a grade of 3 and/or 4), and likelihood of disease recurrence or progression, and not surviving for more than 1, or 2, or 3, or 4, or 5 years.
[0115] As would be appreciated by a person skilled in the art, tumor grading or tumor grade or grade of tumor refers to the description of a tumor based on how abnormal the cells from the tumor and the tumor tissue appear under a microscope. Tumor grade or tumor grading or grade of tumor may also be an indicator of how quickly a tumor is likely to grow or spread. It is generally understood that cells from the tumor and organization of tumor tissue that are close to normal cells and tissues may be considered well-differentiated and may grow or spread at a slower rate when compared to abnormal looking cells from the tumor and tumor tissues (i.e. undifferentiated or poorly differentiated). The grading system for tumor grade or tumor grading or grade of tumor may generally comprise of five different grades, which are GX (i.e. grade cannot be assessed or undetermined grade), G1 (i.e. grade 1, well differentiated cells and/or tissues, low grade), G2 (i.e. grade 2, moderately differentiated cells and/or tissues, intermediate grade), G3 (i.e. grade 3, poorly differentiated cells and/or tissues, high grade), and G4 (i.e. grade 4, undifferentiated cells and/or tissues, high grade).
[0116] In one example, poor outcome/prognosis (negative survival) indicates a reduced likelihood of survival over 7 years. In one example, poor outcome/prognosis (negative survival) indicates a reduced likelihood of survival over 6 years. In one example, poor outcome/prognosis (negative survival) indicates a reduced likelihood of survival over 5 years. In one example, poor outcome/prognosis (negative survival) indicates a reduced likelihood of survival over 4 years. In one example, poor outcome/prognosis (negative survival) indicates a reduced likelihood of survival over 3 years. In one example, poor outcome/prognosis (negative survival) indicates a reduced likelihood of survival over 2 years. In one example, poor outcome/prognosis (negative survival) indicates a reduced likelihood of survival over 1 year.
[0117] In one example, good outcome/prognosis indicates a likelihood of survival of more than 7 years, and/or disease remission within 7 years. In one example, good outcome/prognosis indicates a likelihood of survival of more than 6 years, and/or disease remission within 6 years. In one example, good outcome/prognosis indicates a likelihood of survival of more than 5 years, and/or disease remission within 5 years. In one example, good outcome/prognosis indicates a likelihood of survival of more than 4 years, and/or disease remission within 4 years. In one example, good outcome/prognosis indicates a likelihood of survival of more than 3 years, and/or disease remission within 3 years. In one example, good outcome/prognosis indicates a likelihood of survival of more than 2 years, and/or disease remission within 2 years. In one example, good outcome/prognosis indicates a likelihood of survival of more than 1 year, and/or disease remission within 1 year.
[0118] As would be appreciated by the person skilled in the art, the final determination of the outcome or diagnosis of a cancer patient would be determined by a clinician and the result of the method of the present invention cannot or will not replace the role of a clinician. In general, it would be understood that the outcome would also depend on traditional variables such as underlying diseases and risk factors, time of diagnosis, tumor grade, tumor stage, quality of care, approved and available treatment options and the like.
[0119] In one example, for hepatocellular carcinoma patients, it is understood that the outcome or diagnosis depends on various variables such as location, which in turn reflects underlying factors (driven by HVB/HCV, alcohol, alfatoxin, NASH/NAFLD, and the like), quality care, approved and available treatment options, and the like.
[0120] In one example, the method of the present disclosure is used to predict the likelihood of a subject surviving proliferative disease, wherein the proliferative disease is cancer. In one example, the cancer which is predictable by the method of present disclosure includes, but is not limited to, liver cancer (such as hepatocellular carcinoma, and cholangiocarcinoma), head and neck squamous cell carcinoma, kidney cancer (such as kidney renal clear cell carcinoma, kidney papillary cell carcinoma, and kidney chromophobe renal cell carcinoma), colon and rectum adenocarcinoma, breast carcinoma, lung carcinoma, thyroid carcinoma, stomach adenocarcinoma, esophageal carcinoma and the like.
[0121] In one example, the method of the present disclosure further comprises administering a pharmaceutically effective amount of a branched-chain amino acid catabolism enhancer and/or a pharmaceutically effective amount of a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor) and/or an effective amount of meal replacement comprising low level of branched-chain amino acid (BCAA) to the subject in need thereof. In one example, the method of the present disclosure further comprises administering a pharmaceutically effective amount of a branched-chain amino acid catabolism enhancer to the subject in need thereof. In one example, the method of the present disclosure further comprises administering a pharmaceutically effective amount of a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor) to the subject in need thereof. In one example, the method of the present disclosure further comprises administering an effective amount of meal replacement comprising low level of branched-chain amino acid (BCAA) to the subject in need thereof. In one example, the method of the present disclosure further comprises administering a pharmaceutically effective amount of a branched-chain amino acid catabolism enhancer and a pharmaceutically effective amount of a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor) and an effective amount of meal replacement comprising low level of branched-chain amino acid (BCAA) to the subject in need thereof.
[0122] In one aspect, the present disclosure refers to a kit or microarray chip for use in any of the methods as defined herein. In one example, the kit or microarray chip comprises: a. a reagent or a group of reagents for measuring a level of at least one acylcarnitine (C5:1) and/or branched-chain amino acid (BCAA) and/or a level of at least one branched-chain amino acid (BCAA) catabolic enzyme in the subject. In one example, the kit or microarray chip comprises b. a reagent or a group of reagents comprising a pre-determined level of acylcarnitine (C5:1) and/or branched-chain amino acid (BCAA) and/or branched-chain amino acid (BCAA) catabolic enzyme. In one example, the kit or microarray chip comprises c. optionally instructions for using the reagent or group of reagents in (a) and (b) to determine or predict whether a subject has or likely to have proliferative disease, wherein the pre-determined level may be determined by measured level of at least one acylcarnitine (C5:1) and/or branched-chain amino acid and/or branched-chain amino acid (BCAA) catabolic enzyme in a control subject (or subjects) not having the proliferative disease, and/or to determine the prognosis of the subject.
[0123] In one aspect, the present disclosure refers to a kit or microarray chip for use in any of the methods as defined herein. In one example, the kit or microarray chip comprises: a. a reagent or a group of reagents for measuring a level of at least one acylcarnitine (C5:1) in the subject. In one example, the kit or microarray chip comprises b. a reagent comprising a pre-determined level of acylcarnitine (C5:1). In one example, the kit or microarray chip comprises c. optionally instructions for using the reagent or group of reagents in (a) and (b) to determine or predict whether a subject has or likely to have proliferative disease, wherein the pre-determined level may be determined by measured level of at least one acylcarnitine (C5:1) in a control subject (or subjects) not having the proliferative disease, and/or to determine the prognosis of the subject.
[0124] In one aspect, the present disclosure refers to a kit or microarray chip for use in any of the methods as defined herein. In one example, the kit or microarray chip comprises: a. a reagent or a group of reagents for measuring a level of at least one branched-chain amino acid (BCAA) in the subject. In one example, the kit or microarray chip comprises b. a reagent or a group of reagents comprising a pre-determined level of at least one branched-chain amino acid (BCAA). In one example, the kit or microarray chip comprises c. optionally instructions for using the reagent or a group of reagents in (a) and (b) to determine or predict whether a subject has or likely to have proliferative disease, wherein the pre-determined level may be determined by measured level of at least one branched-chain amino acid in a control subject (or subjects) not having the proliferative disease, and/or to determine the prognosis of the subject.
[0125] In one aspect, the present disclosure refers to a kit or microarray chip for use in any of the methods as defined herein. In one example, the kit or microarray chip comprises: a. a reagent or a group of reagents for measuring a level of at least one branched-chain amino acid (BCAA) catabolic enzyme in the subject. In one example, the kit or microarray chip comprises b. a reagent or a group of reagents comprising a pre-determined level of branched-chain amino acid (BCAA) catabolic enzyme. In one example, the kit or microarray chip comprises c. optionally instructions for using the reagent or group of reagents in (a) and (b) to determine or predict whether a subject has or likely to have proliferative disease, wherein the pre-determined level may be determined by measured level of at least one branched-chain amino acid (BCAA) catabolic enzyme in a control subject (or subjects) not having the proliferative disease, and/or to determine the prognosis of the subject.
[0126] In one aspect, the present disclosure refers to a kit or microarray chip for use in any of the methods as defined herein. In one example, the kit or microarray chip comprises: a. a reagent or a group of reagents for measuring a level of at least one acylcarnitine (C5:1) and branched-chain amino acid (BCAA) and a level of at least one branched-chain amino acid (BCAA) catabolic enzyme in the subject. In one example, the kit or microarray chip comprises b. a reagent or a group of reagents comprising a pre-determined level of acylcarnitine (C5:1) and branched-chain amino acid (BCAA) and branched-chain amino acid (BCAA) catabolic enzyme. In one example, the kit or microarray chip comprises c. optionally instructions for using the reagent or group of reagents in (a) and (b) to determine or predict whether a subject has or likely to have proliferative disease, wherein the pre-determined level are determined by measured level of at least one acylcarnitine (C5:1) and branched-chain amino acid and branched-chain amino acid (BCAA) catabolic enzyme in a control subject (or subjects) not having the proliferative disease, and/or to determine the prognosis of the subject.
[0127] In one example, the kit or microarray kit or microarray chip as defined herein contains an array of one or more samples from one or more diseased tissues. The molecules on the array are, but is not limited to, polynucleotides, polypeptides or antibody molecules as described herein. The kit optionally also includes a detectable label or a labelled compound or agent capable of detecting expression of a gene product in a biological sample, and the necessary reagents for labelling the sample and affecting hybridization to complementary sequences on the array. The kit optionally also includes means for determining the amount of transcript in the sample, such as a colorimetric chart or device.
[0128] More than one array may be included in the kit, wherein each array corresponds to a tissue afflicted with different diseases and wherein each array contains a plurality of samples corresponding to a tissue afflicted with a disease. The compound or agent can be packaged in a suitable container. The kit can further include instructions for using the kit to detect protein or nucleic acid.
[0129] In one aspect, the present disclosure refers to a method for manufacturing a microarray chip or protein array chip for determining or predicting whether a subject is having or likely to have a proliferative disease. In one example, the method comprises a. immobilizing reagents on the chip that allow the measurement of the level of at least one acylcarnitine (C5:1) and/or branched-chain amino acid (BCAA) and/or branched-chain amino acid (BCAA) catabolic enzyme in the subject. In one example, the method comprises b. optionally instructions on determining or predicting whether a subject has or likely to have proliferative disease.
[0130] In one aspect, the present disclosure refers to a method for manufacturing a microarray chip or protein array chip for determining or predicting whether a subject is having or likely to have a proliferative disease. In one example, the method comprises a. immobilizing reagents on the chip that allow the measurement of the level of at least one acylcarnitine (C5:1) in the subject. In one example, the method comprises b. optionally instructions on determining or predicting whether a subject has or likely to have proliferative disease.
[0131] In one aspect, the present disclosure refers to a method for manufacturing a microarray chip or protein array chip for determining or predicting whether a subject is having or likely to have a proliferative disease. In one example, the method comprises a. immobilizing reagents on the chip that allow the measurement of the level of at least one branched-chain amino acid (BCAA) in the subject. In one example, the method comprises b. optionally instructions on determining or predicting whether a subject has or likely to have proliferative disease.
[0132] In one aspect, the present disclosure refers to a method for manufacturing a microarray chip or protein array chip for determining or predicting whether a subject is having or likely to have a proliferative disease. In one example, the method comprises a. immobilizing reagents on the chip that allow the measurement of the level of at least one branched-chain amino acid (BCAA) catabolic enzyme in the subject. In one example, the method comprises b. optionally instructions on determining or predicting whether a subject has or likely to have proliferative disease.
[0133] In one aspect, the present disclosure refers to a method for manufacturing a microarray chip or protein array chip for determining or predicting whether a subject is having or likely to have a proliferative disease. In one example, the method comprises a. immobilizing reagents on the chip that allow the measurement of the level of at least one acylcarnitine (C5:1) and branched-chain amino acid (BCAA) and branched-chain amino acid (BCAA) catabolic enzyme in the subject. In one example, the method comprises b. optionally instructions on determining or predicting whether a subject has or likely to have proliferative disease.
[0134] In one aspect, the present disclosure refers to a method for manufacturing a microarray chip or protein array chip for determining the outcome of a proliferative disease in a subject. In one example, the method comprises a. immobilizing reagents on the chip that allow the measurement of the level of at least one acylcarnitine (C5:1) and/or branched-chain amino acid (BCAA) and/or branched-chain amino acid (BCAA) catabolic enzyme in the subject. In one example, the method comprises b. optionally instructions on determining what outcome a subject has.
[0135] In one aspect, the present disclosure refers to a method for manufacturing a microarray chip or protein array chip for determining the outcome of a proliferative disease in a subject. In one example, the method comprises a. immobilizing reagents on the chip that allow the measurement of the level of at least one acylcarnitine (C5:1). In one example, the method comprises b. optionally instructions on determining what outcome a subject has.
[0136] In one aspect, the present disclosure refers to a method for manufacturing a microarray chip or protein array chip for determining the outcome of a proliferative disease in a subject. In one example, the method comprises a. immobilizing reagents on the chip that allow the measurement of the level of at least one branched-chain amino acid (BCAA) in the subject. In one example, the method comprises b. optionally instructions on determining what outcome a subject has.
[0137] In one aspect, the present disclosure refers to a method for manufacturing a microarray chip or protein array chip for determining the outcome of a proliferative disease in a subject. In one example, the method comprises a. immobilizing reagents on the chip that allow the measurement of the level of at least one branched-chain amino acid (BCAA) catabolic enzyme in the subject. In one example, the method comprises b. optionally instructions on determining what outcome a subject has.
[0138] In one aspect, the present disclosure refers to a method for manufacturing a microarray chip or protein array chip for determining the outcome of a proliferative disease in a subject. In one example, the method comprises a. immobilizing reagents on the chip that allow the measurement of the level of at least one acylcarnitine (C5:1) and branched-chain amino acid (BCAA) and branched-chain amino acid (BCAA) catabolic enzyme in the subject. In one example, the method comprises b. optionally instructions on determining what outcome a subject has.
[0139] A person skilled in the art would appreciate that the kit or microarray kit or microarray chip of the present disclosure can be manufactured with any method or technique known in the art. In one example, the kit or microarray kit or microarray chip as defined herein contains an array of one or more samples from one or more diseased tissues. The molecules on the array are, but are not limited to, polynucleotides, polypeptides or antibody molecules as described herein. The kit optionally also includes a detectable label or a labelled compound or agent capable of detecting expression of a gene product in a biological sample and the necessary reagents for labelling the sample and affecting hybridization to complementary sequences on the array. The kit optionally also includes means for determining the amount of transcript in the sample, such as a colorimetric chart or device.
[0140] More than one array may be included in the kit, wherein each array corresponds to a tissue afflicted with different diseases, and wherein each array contains a plurality of samples corresponding to a tissue afflicted with a disease. The compound or agent can be packaged in a suitable container. The kit can further include instructions for using the kit to detect protein or nucleic acid.
[0141] In one aspect, the present disclosure refers to a method of treating or preventing a proliferative disease in a subject in need thereof. In one example, the proliferative disease is characterized and/or diagnosed by: a decrease in a level of an acylcarnitine (C5:1) (when compared to a healthy control subject or group of control subjects); and/or an accumulation of at least one branched-chain amino acid (BCAA) (when compared to a healthy control subject or group of control subjects); and/or a suppression of transcripts-level of enzymes involved in the catabolism of at least one branched-chain amino acid (BCAA) (when compared to a healthy control subject or group of control subjects); and/or a suppression of enzyme activity involved in the catabolism of at least one branched-chain amino acid (BCAA) (when compared to a healthy control subject or group of control subjects). In one example, said method comprises administering a branched-chain amino acid catabolism enhancer and/or a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor).
[0142] In one aspect, the present disclosure refers to a method of treating or preventing a proliferative disease in a subject in need thereof. In one example, the proliferative disease is characterized and/or diagnosed by: a decrease in a level of an acylcarnitine (C5:1) (when compared to a healthy control subject or group of control subjects). In one example, said method comprises administering a branched-chain amino acid catabolism enhancer and/or a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor).
[0143] In one aspect, the present disclosure refers to a method of treating or preventing a proliferative disease in a subject in need thereof. In one example, the proliferative disease is characterized and/or diagnosed by: an accumulation of at least one branched-chain amino acid (BCAA) (when compared to a healthy control subject or group of control subjects). In one example, said method comprises administering a branched-chain amino acid catabolism enhancer and/or a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor).
[0144] In one aspect, the present disclosure refers to a method of treating or preventing a proliferative disease in a subject in need thereof. In one example, the proliferative disease is characterized and/or diagnosed by: a suppression of transcripts-level of enzymes involved in the catabolism of at least one branched-chain amino acid (BCAA) (when compared to a healthy control subject or group of control subjects). In one example, said method comprises administering a branched-chain amino acid catabolism enhancer and/or a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor).
[0145] In one aspect, the present disclosure refers to a method of treating or preventing a proliferative disease in a subject in need thereof. In one example, the proliferative disease is characterized and/or diagnosed by: a suppression of enzyme activity involved in the catabolism of at least one branched-chain amino acid (BCAA) (when compared to a healthy control subject or group of control subjects). In one example, said method comprises administering a branched-chain amino acid catabolism enhancer and/or a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor).
[0146] In one aspect, the present disclosure refers to a method of treating or preventing a proliferative disease in a subject in need thereof. In one example, the proliferative disease is characterized and/or diagnosed by: a decrease in a level of an acylcarnitine (C5:1) (when compared to a healthy control subject or group of control subjects); and an accumulation of at least one branched-chain amino acid (BCAA) (when compared to a healthy control subject or group of control subjects); and a suppression of transcripts-level of enzymes involved in the catabolism of at least one branched-chain amino acid (BCAA) (when compared to a healthy control subject or group of control subjects); and a suppression of enzyme activity involved in the catabolism of at least one branched-chain amino acid (BCAA) (when compared to a healthy control subject or group of control subjects). In one example, said method comprises administering a branched-chain amino acid catabolism enhancer and/or a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor).
[0147] As used herein, the term catabolic enzyme refers to enzymes that play a role in destructive metabolism or the breakdown of complex molecules in living organisms to form simpler ones, together with the release of energy. As such, the term branched amino acids (BCAA) catabolic enzymes refers to enzymes that play a role in destructive metabolism or the breakdown of branched amino acid (BCAA).
[0148] In one example, the method of the present disclosure detects an increased accumulation in one branched-chain amino acids level. In one example, the method of the present disclosure detects an increased accumulation in two branched-chain amino acids levels. In one example, the method of the present disclosure detects an increased accumulation in three branched-chain amino acids levels.
[0149] In one example, the method of the present disclosure detects that the proliferative disease further comprises the characteristics of an accumulation of at least one amino acid, which includes, but is not limited to, phenylalanine, methionine and asparagine. In one example, the method of the present disclosure detects that the proliferative disease further comprises the characteristics of an accumulation of at least two amino acids, which include, but are not limited to, phenylalanine, methionine and asparagine. In one example, the method of the present disclosure detects that the proliferative disease further comprises the characteristics of an accumulation of at least three amino acids, which include, but are not limited to, phenylalanine, methionine and asparagine.
[0150] In one example, the method of the present disclosure further comprises administering a branched-chain amino acid catabolism enhancer and/or a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor). In one example, the method of the present disclosure further comprises administering a branched-chain amino acid catabolism enhancer. In one example, the method of the present disclosure further comprises administering a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor). In one example, the method of the present disclosure further comprises administering a branched-chain amino acid catabolism enhancer and a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor).
[0151] In one example, the branched-chain amino acid catabolism enhancer used in the method of the present disclosure may be a peroxisome proliferator-activated receptor-alpha (PPARa) agonist.
[0152] In one example, the PPARa agonist used in the method of the present disclosure includes but is not limited to propan-2-yl 2-[4-(4-chlorobenzoyl)phenoxy]-2-methylpropanoate (fenofibrate), 2-[4-[2-[(4-chlorobenzoyl)amino]ethyl]phenoxy]-2-methylpropanoic acid (bezafibrate), 2-[4-[2-[4-cyclohexylbutyl(cyclohexylcarbamoyl)amino]ethyl]phenyl]sulfanyl-2-methylpropanoic acid (GW7647), and the like.
[0153] In one example, the BDK inhibitor used in the method of the present disclosure includes, but is not limited to, natural and synthetic BDK inhibitors. Thus, in one example, the BDK inhibitor is, but is not limited to, propan-2-yl 2-[4-(4-chlorobenzoyl)phenoxy]-2-methylpropanoate (fenofibrate), 2-[4-[2-[(4-chlorobenzoyl)amino]ethyl]phenoxy]-2-methylpropanoic acid (bezafibrate)), 3,6-dichloro-1-benzothiophene-2-carboxylate (BT2), and the like.
[0154] In one example, the method of the present disclosure is used to treat or prevent a proliferative disease, wherein the proliferative disease is cancer. In one example, the cancer which is treatable or preventable by the method of present disclosure includes, but is not limited to, liver cancer (such as hepatocellular carcinoma, and cholangiocarcinoma), head and neck squamous cell carcinoma, kidney cancer (such as kidney renal clear cell carcinoma, kidney papillary cell carcinoma, and kidney chromophobe renal cell carcinoma), colon and rectum adenocarcinoma, breast carcinoma, lung carcinoma, thyroid carcinoma, stomach adenocarcinoma, esophageal carcinoma, and the like.
[0155] In one aspect, the present disclosure refers to a method of treating or preventing a proliferative disease in a subject in need thereof. In one example, the proliferative disease is characterized and/or diagnosed by: a decrease in a level of an acylcarnitine (C5:1) (when compared to a healthy control subject or group of control subjects); and/or an accumulation of at least one branched-chain amino acid (BCAA) (when compared to a healthy control subject or group of control subjects); and/or a suppression of transcripts-level of enzymes involved in the catabolism of at least one branched-chain amino acid (BCAA) (when compared to a healthy control subject or group of control subjects); and/or a suppression of enzyme activity involved in the catabolism of at least one branched-chain amino acid (BCAA) (when compared to a healthy control subject or group of control subjects). In one example, said method comprises administering a meal replacement comprising low level of branched-chain amino acid (BCAA) to the subject in need thereof.
[0156] In one aspect, the present disclosure refers to a method of treating or preventing a proliferative disease in a subject in need thereof. In one example, the proliferative disease is characterized and/or diagnosed by: a decrease in a level of an acylcarnitine (C5:1) (when compared to a healthy control subject or group of control subjects). In one example, said method comprises administering a meal replacement comprising low levels of branched-chain amino acid (BCAA) to the subject in need thereof.
[0157] In one aspect, the present disclosure refers to a method of treating or preventing a proliferative disease in a subject in need thereof. In one example, the proliferative disease is characterized and/or diagnosed by: an accumulation of at least one branched-chain amino acid (BCAA) (when compared to a healthy control subject or group of control subjects). In one example, said method comprises administering a meal replacement comprising low levels of branched-chain amino acid (BCAA) to the subject in need thereof.
[0158] In one aspect, the present disclosure refers to a method of treating or preventing a proliferative disease in a subject in need thereof. In one example, the proliferative disease is characterized and/or diagnosed by: a suppression of transcripts-level of enzyme involved in the catabolism of at least one branched-chain amino acid (BCAA) (when compared to a healthy control subject or group of control subjects). In one example, said method comprises administering a meal replacement comprising low levels of branched-chain amino acid (BCAA) to the subject in need thereof.
[0159] In one aspect, the present disclosure refers to a method of treating or preventing a proliferative disease in a subject in need thereof. In one example, the proliferative disease is characterized and/or diagnosed by: a suppression of enzyme activity involved in the catabolism of at least one branched-chain amino acid (BCAA) (when compared to a healthy control subject or group of control subjects). In one example, said method comprises administering a meal replacement comprising low levels of branched-chain amino acid (BCAA) to the subject in need thereof.
[0160] In one aspect, the present disclosure refers to a method of treating or preventing a proliferative disease in a subject in need thereof. In one example, the proliferative disease is characterized and/or diagnosed by: a decrease in a level of an acylcarnitine (C5:1) (when compared to a healthy control subject or group of control subjects); and an accumulation of at least one branched-chain amino acid (BCAA) (when compared to a healthy control subject or group of control subjects); and a suppression of transcripts-level of enzyme involved in the catabolism of at least one branched-chain amino acid (BCAA) (when compared to a healthy control subject or group of control subjects); and a suppression of enzyme activity involved in the catabolism of at least one branched-chain amino acid (BCAA) (when compared to a healthy control subject or group of control subjects). In one example, said method comprises administering a meal replacement comprising low level of branched-chain amino acid (BCAA) to the subject in need thereof.
[0161] As used herein, the term catabolic enzyme refers to enzymes that play a role in destructive metabolism or the breakdown of complex molecules in living organisms to form simpler ones, together with the release of energy. As such, the term branched-chain amino acids (BCAA) catabolic enzymes refers to enzymes that play a role in destructive metabolism or the breakdown of branched-chain amino acids (BCAA).
[0162] In one example, the method of the present disclosure detects an increased accumulation in one branched-chain amino acids level. In one example, the method of the present disclosure detects that an increased accumulation in two branched-chain amino acids levels. In one example, the method of the present disclosure detects an increased accumulation in three branched-chain amino acids levels.
[0163] In one example, the method of the present disclosure detects that the proliferative disease further comprises the characteristics of an accumulation of at least one amino acid, which includes but, is not limited to, phenylalanine, methionine and asparagine. In one example, the method of the present disclosure detects that the proliferative disease further comprises the characteristics of an accumulation of at least two amino acids, which include, but are not limited to phenylalanine, methionine and asparagine. In one example, the method of the present disclosure detects that the proliferative disease further comprises the characteristics of an accumulation of at least three amino acids, which include, but are not limited to phenylalanine, methionine and asparagine.
[0164] In one example, the method of the present disclosure further comprises administering a branched-chain amino acid catabolism enhancer and/or a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor). In one example, the method of the present disclosure further comprises administering a branched-chain amino acid catabolism enhancer. In one example, the method of the present disclosure further comprises administering a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor). In one example, the method of the present disclosure further comprises administering a branched-chain amino acid catabolism enhancer and a branched-chain ?-ketoacid dehydrogenase complex (BCKDC) kinase inhibitor (BDK inhibitor).
[0165] In one example, the branched-chain amino acid catabolism enhancer used in the method of the present disclosure is a peroxisome proliferator-activated receptor-alpha (PPARa) agonist.
[0166] In one example, the PPARa agonist used in the method of the present disclosure includes, but is not limited to, propan-2-yl 2-[4-(4-chlorobenzoyl)phenoxy]-2-methylpropanoate (fenofibrate), 2-[4-[2-[(4-chlorobenzoyl)amino]ethyl]phenoxy]-2-methylpropanoic acid (bezafibrate), 2-[4-[2-[4-cyclohexylbutyl(cyclohexylcarbamoyl)amino]ethyl]phenyl]sulfanyl-2-methylpropanoic acid (GW7647), and the like.
[0167] In one example, the method of the present disclosure is used to treat or prevent a proliferative disease, wherein the proliferative disease is cancer. In one example, the cancer which is treatable or preventable by the method of present disclosure includes, but is not limited to, liver cancer (such as hepatocellular carcinoma, and cholangiocarcinoma), head and neck squamous cell carcinoma, kidney cancer (such as kidney renal clear cell carcinoma, kidney papillary cell carcinoma, and kidney chromophobe renal cell carcinoma), colon and rectum adenocarcinoma, breast carcinoma, lung carcinoma, thyroid carcinoma, stomach adenocarcinoma, esophageal carcinoma, and the like.
[0168] The invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms comprising, including, containing, etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the inventions embodied therein herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.
[0169] The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.
[0170] Other embodiments are within the following claims and non-limiting examples. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.
EXPERIMENTAL SECTION
[0171] Methods
[0172] Animals and Statistics.
[0173] All animal studies were approved by the Institutional Animal Care and Use Committee at A*STAR. Animals were fed ad libitum and maintained in a specific pathogen free facility with constant ambient temperature and a 12-hour light cycle. C57BL/6 mice for breeding were obtained from Biological Resource Center, A*STAR. 15 day-old pups were injected i.p. with a single 50 mg/kg dose of diethylnitrosamine (DEN), then given a single 2 mg/kg dose of TCPOBOP i.p. 30 days later. To ensure sufficient tissue for transcriptomic, metabolomics, and proteomic analyses in
[0174] Homoscedastic two-tailed t-test values are shown unless otherwise noted. Standard error of the mean (s.e.m.) are shown for all quantitative data, except when smaller than data point symbols (cell proliferation growth curves) or for clarity (heat maps and dot plots). Samples were considered for exclusion only if identified by a Grubbs' test with an alpha value below 0.01.
[0175] Transcriptomic and Metabolomic Data.
[0176] RNA was extracted using Trizol (Life Technologies) and/or purified on RNAeasy columns (Qiagen), then analyzed for purity using RNA pico chips run on an Agilent 2100 bioanalyzer. Only samples with a RIN >7 and 28s:18s ratio >1.0 were used in analysis. Samples were sequenced by Beijing Genomics Institute (BGI, Hong Kong) using the paired-end sequencing method (91 bp) with approximately 40 million reads per sample. RNA-Seq data are deposited in the Gene Expression Omnibus under accession number GSE75677. Gene lists were analyzed using DAVID (david.ncifcrf.gov) and Ingenuity Pathway Analysis (Qiagen), and heat maps were generated with GenePattern (www.broadinstitute.org/cancer/software/genepattern). RT-PCR was run on an Applied Biosystems StepOnePlus with Power SYBR Green (Life Technologies) and the sequences and the SEQ ID NO of the RT PCR Primer used herein are listed in Table 1 at the end of this section. Amino acids were quantified by HPLC-MS/MS using purified standards (Sigma). Acylcarnitine measurements were made by flow injection tandem mass spectrometry using sample preparation methods described previously. The data were acquired using a Waters Acquity? UPLC system equipped with a TQ (triple quadrupole) detector and a data system controlled by MassLynx 4.1 operating system (Waters, Milford, Mass.). Tissue BCKDH activity was determined as previously described. Frozen liver samples were pulverized in liquid nitrogen, then 200 mg of tissue was homogenized in 1 mL of ice cold homogenization buffer (30 mM KPi pH7.5, 3 mM EDTA, 5 mM DTT, 1 mM ?-ketoisovalerate, 3% FBS, 5% Triton X-100, 1 ?M Leupeptin) using a QIAGEN TissueLyser II set at a frequency of 15/s for 1 minute. Homogenized samples were centrifuged for 10 minutes at 10,000?g and the supernatant was collected. 50 ?L of supernatant was added to 300 ?L of assay buffer (50 mM HEPES pH 7.5, 30 mM KPi pH7.5, 0.4 mM CoA, 3 mM NAD+, 5% FBS, 2 mM Thiamine Pyrophosphate, 2 mM MgCl.sub.2, 7.8 ?M [1-.sup.14C]?-ketoisovalerate) in a polystyrene test tube containing a raised 1 M NaOH CO.sub.2 trapping system. The tubes were capped and placed in a shaking water bath set at 37? C. for 30 min. Tubes were then placed on ice and the reaction mixture was acidified by injection of 100 ?l of 70% perchloric acid followed by shaking on an orbital shaker at room temperature for 1 hour. The .sup.14CO.sub.2 contained in the 1 M NaOH trap was counted in a liquid scintillation counter. For magnetic resonance spectroscopy studies, approximately 48 mg of [1-.sup.13C]2-ketoisocaproic acid (Sigma #750832), doped with 15 mM trityl-radical (OXO63, GE Healthcare) and 3 ?l of gadoterate meglumine (10 mM, Dotarem?, Guerbet), was hyperpolarized in a polarizer, with 60 min of microwave irradiation. The sample was subsequently dissolved in a pressurized and heated alkaline solution, containing 100 mg/L EDTA to yield a solution of 80 mM hyperpolarized sodium [1-.sup.13C]2-ketoisocaproate with a polarization of 30%, T1 of 25 seconds and physiological temperature and pH. Rats were positioned in a 9.4 T horizontal bore MR scanner interfaced to a Avance III console (Bruker Biospec), and inserted into a dual-tuned (.sup.1H/.sup.13C) rat abdominal coil (20 mm diameter). Correct positioning was confirmed by the acquisition of a coronal proton FLASH image (TE/TR, 8.0/100.0 ms; matrix size, 192?192; FOV, 50?36 mm; slice thickness, 2.0 mm; excitation flip angle, 30?). A respiratory-gated shim was used to reduce the proton linewidth to approximately 230 Hz. Immediately before injection, a respiratory-gated .sup.13C MR pulse-acquire spectroscopy sequence was initiated. 2.0-2.5 mL (0.5 mmol/kg body weight) of hyperpolarized 2-ketoisocaproate was intravenously injected over 10 s into the anesthetized rat. Thirty individual liver spectra were acquired over 1 min after injection (TR, 2 s; excitation flip angle, 25?; sweep width, 8,000 Hz; acquired points, 2,048; frequency centered on the ketoisocaproate resonance). Liver .sup.13C MR spectra were analyzed using the AMARES algorithm as implemented in the jMRUI software package. Spectra were baseline and DC offset-corrected based on the last half of acquired points. To quantify hepatic metabolism, the spectra were summed over the first 30 s upon 2-ketoisocaproate arrival. Metabolite peaks corresponding to [1-.sup.eC]2-ketoisocaproate (172.6 ppm) and its metabolic derivatives [1-.sup.13C]leucine (176.8 ppm) and [1-.sup.13C]bicarbonate (160.8 ppm) were fitted with prior knowledge assuming a Lorentzian line shape, peak frequencies, relative phases, and linewidths. For each animal, tCarbon is defined as the sum of all these three metabolite peaks. The normalized ratios [1-.sup.13C]leucine/tCarbon and [1-.sup.13C]bicarbonate/tCarbon were computed for statistical analysis.
[0177] Cell Culture. Cell lines were obtained [Huh7 from Japanese Collection of Research Bioresources; Hep3B, SNU182, SNU387, SNU398, and SNU449 from ATCC; and Morris Hepatoma 3924a from German Cancer Research Center Tumor Collection] and not further verified. Only cell stocks that had been verified mycoplasma-negative within the prior 9 months were used. All cell lines were maintained in RPMI 1640 with 10% FBS and 1% Pen Strep (Gibco) and grown in a 37? C. humidified incubator with 5% CO.sub.2. Real-time cell growth measurements were taken on an xCELLigence RTCA SP (Acea) at 15-minute intervals. For compound treatment growth curves, cells were seeded in quadruplicate at 1,250, 2,500 or 5,000 cells per well and normalized 12 hours later (time 0 hours), immediately prior to changing half of the media to add compounds or vehicle. Proliferation rates were calculated over a 48-hour period beginning 2 hours after addition of BT2 (3,6-dichlorobenzo[b]thiophene-2-carboxylic acid; Matrix Scientific), Fenofibrate (Sigma), GW7647 (Sigma), Rapamycin (Tocris), Torin 1 (Tocris) or vehicle (DMSO). For immunoblots, cells were seeded in 10 cm dishes and allowed to grow for at least 24 hours. At approximately 80% confluence the media was changed to include indicated amounts of compound or vehicle (DMSO) and whole cell lysates were harvested 2 hours later. For inducible shRNA knockdowns, interfering RNA for target sequences were inserted into the pTRIPZ vector (Dharmacon; BCKDK shRNA1: CGCCTGTGTGAGCACAAGTAT, and shRNA2: GGACCCAGACAGATGGACTTA) or Tet-pLKO-puro (Addgene plasmid #21915; BCKDHA shRNA1: CCGGTCCTTCTACATGACCAACTATCTCGAGATAGT TGGTCATGTAGAAGGATTTTTG, and shRNA2: CCG GGC AGT CAC GAA AGA AGG TCA TCT CGA GAT GAC CTT CTT TCG TGA CTG CTT TTT G). The resulting constructs, along with lentiviral packaging vectors, were transfected into HEK293T cells with Lipofectamine 2000 (Invitrogen) following manufacturer's protocol. Supernatants containing lentivirus were collected 24 hours later, passed through 0.2 ?m filters, and added to recipient cell lines for 24 hours along with 8 ?g/mL polybrene (Sigma). Cells were then incubated in selection media (1-3 ?g/mL puromycin, depending on cell line sensitivity) for 5-7 days. For growth curves, cells were maintained in 250 ?g/mL doxycycline for 5 days, then seeded into wells with (+Dox) or without (?Dox) doxycycline in quadruplicate at 625, 1,250, 2,500 or 5,000 cells per well. Wells were normalized 12 hours later (Day 0) and allowed to grow without media change or addition of additional doxycycline (so that the average concentration was 125 ?g/mL). Proliferation rates were calculated over a 7-day period (Day 0 to Day 7). For immunoblots, cells were seeded in 10 or 15 cm dishes, and were split or received media change every 3-4 days to maintain a doxycycline concentration of 250 ?g/mL. After 10 days, cells were harvested as whole cell lysates, or as purified mitochondrial fractions using an isolation kit (Thermo Fisher). Results shown are one of at least three independent experiments. For CRISPR-Cas9-induced mutagenesis, previously published methods were followed. Briefly, sgRNAs were computationally identified (http://www.genome-engineering.org/crispr) and inserted into the lentiCRISPRv2 vector (Addgene plasmid #52961; BCKDK target the sequence GTCGGCCATCGACGCGGCAG). Lentivirus was produced as detailed above, and Hep3B cells were transduced and underwent with 1 ?g/mL puromycin selection for 7 days. Single-cell colonies were generated and 80 clones were examined for mutations by sequencing 15-20 PCR products of the target region. LentiCRISPRv2 empty vector-transduced Hep3B cells were used as controls, which behaved similarly to parental Hep3B cells and non-frameshift BCKDK mutant Hep3B clones. For growth curves, 1250 cells from each clone were plated in quadruplicate, normalized 6 hours later, and allowed to grow for 5 days. For immunoblots, cells were seeded into 10 cm or 15 cm dishes and harvested 5 days later as whole cell lysates or purified mitochondrial fractions, when the cells were approximately 80% confluent.
[0178] Immunoblots and Immunohistochemistry.
[0179] Antibodies were obtained from Cell Signaling [Cleaved Caspase 3 (9664), Cox IV (4844), p-Histone H2A.X (9718), S6 (2317), p-S6 (4858), S6K (9202), p-S6K (9234)], Santa Cruz [Bckdha (sc-67200), Bckdhb (sc160974), Gapdh (sc-32233)], Bethyl [p-Bckdha (A304-672A)], Sigma [Tubulin (T5168), Acads (HPA022271)], and Abcam [Acadsb (ab99951), Bckdk (ab125389 and ab151297), Ki67 (ab15580)]. All samples were harvested in RIPA buffer with protease inhibitors (Roche). For immunoblots, approximately 10 ?g protein samples were run by SDS-PAGE, transferred to PVDF membranes using iBlot2 (Life Technologies), blocked with 5% milk and incubated with primary antibodies in 5% BSA. Membranes were then incubated with ?-mouse/rabbit-HRP secondary antibodies (GE) and developed with ECL prime (GE). For immunohistochemistry, liver specimens were fixed with 10% neutral buffered formalin and 70% ethanol and embedded in paraffin. Sections were cut at 7 ?m, deparaffinized, subjected to citrate buffer antigen retrieval, and exposed to hydrogen peroxide to quench endogenous peroxidase prior to incubation with primary antibodies. Vectastain ABC kit and ImmPACT DAB (Vector Laboratories) were used for chromagen development, then counterstained with Harris hematoxylin.
[0180] Human Expression Data.
[0181] RNA-Seq raw count data were downloaded from The Cancer Genome Atlas (http://cancergenome.nih.gov) and differentially expressed genes were quantified with the DESeq2 package in R. For multi-cancer analyses, genes with an unadjusted P-value<0.001 were considered significant, and for single-cancer analyses genes P-values<2.44?10.sup.?6 (meeting Bonferroni correction criteria) were considered significant. Gene lists were analyzed using DAVID (david.ncifcrf.gov). The survMisc package in R and Cutoff Finder (http://molpath.charite.de/cutoff) were used to identify appropriate cutoff values for splitting patients into high and low expression groups. Combined expression indexes were screened, developed, and analyzed using a method similar to the Steepest Decent. Kaplan-Meier survival estimate curves and associated statistics were generated with the Survival package in R. Adjustments in hazard ratios include age at initial pathologic diagnosis, gender (male/female) tumor stage (1-4), tumor grade (1-4), radiation therapy (yes/no/unspecified), pharmaceutical therapy (yes/no/unspecified), additional therapies (additional pharmaceutical therapy, additional radiation therapy, or additional surgery procedure yes/no/unspecified), and tumor subtype (colon adenocarcinoma or rectum adenocarcinoma for colorectal adenocarcinoma; adenocarcinoma diffuse type, intestinal adenocarcinoma tubular type, intestinal adenocarcinoma mucinous type, intestinal adenocarcinoma papillary type, adenocarcinoma signet ring type, adenocarcinoma not otherwise specified, or intestinal adenocarcinoma not otherwise specified for stomach adenocarcinoma). Heat maps were generated using GenePattern (www.broadinstitute.org/cancer/software/genepattern). Oncomine (www.oncomine.org) data were analyzed with filters [data type: mRNA, gene rank threshold: all; fold change threshold: 1.5; p-value threshold: 0.05]. Biopsy immunohistochemical micrographs from male patients were downloaded from The Human Protein Atlas (http://www.proteinatlas.org).
[0182] Human Dietary Analysis.
[0183] NHANES III (1988-1994) is a US nationally-representative population-based survey of non-institutionalized individuals over 2 years of age. The study population included 6779 non-pregnant, non-lactating adults with reliable energy intake (400-7000 kcal), ages 50-90 with mortality follow-up from the date of participation (1988-1994) through Dec. 31, 2011. Data from the structured household interview and mobile examination center (MEC) physical examination were included in the present analysis. Variables deemed important in the literature were evaluated for potential confounding, and adjusted for in final analyses. Age, sex, race/ethnicity, years of education, cigarette smoking, leisure-time physical activity, dietary intake, dietary behaviors, and doctor-diagnosed medical history were self-reported. Waist circumference was measured by trained personnel to the nearest 0.1 cm at the iliac crest. Dummy variables were created for smoking status (current, former, never) based on responses to the questions Have you smoked at least 100 cigarettes during your entire life? and Do you smoke cigarettes now? Participants were coded as never smokers if they had not smoked at least 100 cigarettes and did not currently smoke cigarettes; former smokers had smoked at least 100 cigarettes but did not currently smoke, and current smokers responded affirmatively to both questions. Three dummy variables were created for race-ethnicity (Non-Hispanic white, Non-Hispanic black, and Mexican-American). Three dummy variables were also created for years of education (less than high school education, high school graduate, and college graduate). Self-reported history (y/n) of doctor diagnosed diabetes, cancer, and cardiovascular disease were included as binary variables in all models. Dietary behaviors including intentional weight loss in the last year (y/n), dietary changes in the last year (y/n), and whether intake on the dietary recall was less than, more than, or comparable to their usual day were included as covariates. Total kilocalories, percent kilocalories from fat, carbohydrate, and non-BCAA protein were computed from the 24-hour recall used to assess dietary intake. Total leisure-time physical activity was estimated by a physical activity questionnaire, which asked participants to report the frequency (over the past 30 days) of engaging in nine activities and up to four additional other activities not queried directly in the survey. Weekly frequencies of each activity were multiplied by a validated intensity rating in metabolic equivalents (MET) and summed for each individual. MET values used in NHANES III were defined by the Compendium of Physical Activities. In this cohort, the observation that BCAAs comprised 17.3% of total protein was calculated. Given dietary recommendations for protein intake at 10-35% of total kcal, the threshold for low BCAA intake group was set at 1.73% (10% protein/total kcal?17.3% BCAA/total protein kcal). Few individuals consumed very high protein diets (>35% of total kcal), and therefore the threshold for high BCAA intake was set as above the mean of recommended protein intake (22.5% protein/total kcal?17.3% BCAA/total protein kcal). Cox Proportional Hazard Models adjusted for covariates were used to evaluate the association between BCAA intake as a percent of total kilocalories and cancer mortality stratified by age group (50-66 and 66 and older). The effect of replacing kilocalories from BCAA with carbohydrates and fat was estimated by examining the continuous multivariable-adjusted association between BCAA intake and cancer mortality while simultaneously including these macronutrients in the model. Effects of interchanging different macronutrients were estimated by computing the differences between linear coefficients and their corresponding covariance matrix to obtain HRs and 95% CIs. It was not possible to estimate the effect of replacing BCAA with non-BCAA protein due to multicollinearity (r=0.975), but in sensitivity analyses where non-BCAA protein intake was modeled as the primary exposure variable, associations with cancer mortality were attenuated. All analyses were conducted with SAS 9.4 software (SAS Institute).
[0184] Result and Discussion
[0185] In an attempt to identify novel targetable pathways in oncogenesis, differential expression analysis was performed on RNA-seq data published by The Cancer Genome Atlas (TCGA). First, the transcriptomic profiles of human liver, stomach, colorectal, and esophageal cancers were compared to their respective normal tissues, as these gastrointestinal cancers are all among the top 6 leading causes of cancer-related death. Overall, relative to respective normal tissues, 1082 genes were significantly upregulated and 419 genes were significantly downregulated across all 4 cancers (
[0186] Surprisingly, transcript levels of the BCAA catabolic enzymes were not only suppressed in tumors when compared to adjacent normal tissue, but the degree of suppression was correlated with multiple indicators of disease progression and tumor aggressiveness, including stage, grade, vascular invasion, lymph node invasion, and distant metastasis (
[0187] Somatic copy number variation (CNV) loss of the BCAA catabolic enzymes affected an estimated 22% of tumors, depending on gene and cancer type, and led to the most potent decreases in mRNA expression (
[0188] Finally, the differential expression analysis was performed on all individual cancer subtypes profiled by TCGA with at least five adjacent normal samples for appropriate comparison. Overall, approximately 70% of cancers displayed significant suppression of at least half of the BCAA catabolic pathway (
[0189] KEGG pathway analysis of differentially expressed genes among individual cancers revealed that suppression of BCAA catabolic enzymes was particularly robust in liver cancers, ranking as the top pathway for both hepatocellular carcinoma (HCC) and cholangiocarcinoma (
[0190] To further explore changes in BCAA catabolism, the investigation was focused on putative rate-limiting steps. The accumulation of BCAAs and reduction of the C5:1 acylcarnitine indicated that the catabolic enzymes acting between these metabolites, namely, BCKDHA, ACADS, and ACADSB are critical. Indeed, the branched-chain ketoacid dehydrogenase (BCKD) complex is the first irreversible, and in many cases rate-limiting step in BCAA catabolism. Inhibition of the complex's activity is achieved through suppression of total protein levels, as well as phosphorylation of the BCKDHA subunit by the kinase BCKDK. While Morris Hepatoma tumors had dramatic reductions in total protein levels of all BCAA catabolic enzymes assayed, DEN-induced tumors displayed more overt changes in BCKDHA phosphorylation (
[0191] Next, to examine the potential functional consequences of BCAA accumulation, multiple strategies to manipulate the BCAA catabolic enzyme activity across normal liver and tumorigenic HCC cell lines were used. In order to recapitulate the loss of BCAA catabolic enzyme activity in tumors, a key subunit of the BCKDH complex in the immortalized hepatocyte cell line AML12 was targeted. Knocking down BCKDHA with inducible shRNAs led to a clear enhancement of proliferation rates as well as an increased cell density at confluency (
[0192] While BCAAs are reported to have pleiotropic effects, the most potent and extensively-characterized is the stimulation of the mechanistic target of rapamycin (mTOR). Activation of the mTOR pathway potently enhances cell growth and tumorigenesis, including liver cancer in humans and rodent models. Thus, it was hypothesized that BCAA accumulation would influence cell proliferation, at least in part, by modulating mTOR activity. As expected, all HCC cell lines examined had active mTOR pathways under basal growth conditions, and were at least partially sensitive to the inhibitors rapamycin and Torin 1 (
[0193] Next, the hypothesis whether a BCAA-mediated stimulation of pro-tumorigenic pathways was also utilized by developing tumors in vivo was explored. As essential amino acids, BCAAs are derived exclusively from dietary sources. Therefore, DEN-injected mice were fed diets with normal or high levels of BCAAs (
[0194] In a follow-up cohort, the hypothesis whether restricting BCAAs in the diet by 50% could limit tumor burden was also investigated (
[0195] Finally, to determine if dietary intake of BCAAs correlated with cancer mortality in a human population, the NHANES III dataset with linked mortality data was analyzed. Individuals 50-66 years old in the highest tertile of BCAA intake had a 200% increased risk of death from cancer relative to the lowest tertile, even when adjusting for known confounders, as well as percent kilocalories from fat, carbohydrate, and non-BCAA protein intake (
[0196] In summary, comprehensive transcriptomic and metabolomic analyses of human cancers and animal tumors and regenerating tissues identified a mechanism specifically utilized by cancer cells to enhance the accumulation of BCAAs (
Tables
[0197]
TABLE-US-00003 TABLE1 ListofPCRprimersused PrimersequencesusedforMouseSample Target Sequence ABAT 5-GAGGCCGTGCACTTTTTCTG-3 SEQIDNO:1 5-CCAGAGCCGGATGGTTGTAA-3 SEQIDNO:2 ACAA1 5-ACAGTGTTCATCGGGACTGC-3 SEQIDNO:3 5-AGATATTCCCAGGGTTCCCCA-3 SEQIDNO:4 ACAA2 5-ACATAACTTCACGCCCCTGG-3 SEQIDNO:5 5-GAGGGGCAAAAGCTTCGTTC-3 SEQIDNO:6 ACADS 5-TTGCCGAGAAGGAGTTGGTC-3 SEQIDNO:7 5-AGGTAATCCAAGCCTGCACC-3 SEQIDNO:8 ACADSB 5-GGACTGGCCCAAGGATGTTT-3 SEQIDNO:9 5-CGAGCCTAGCAGCGTTGTAT-3 SEQIDNO:10 ALDH6A1 5-GCGTGGGCAGACACATCTAT-3 SEQIDNO:11 5-CTCCCAGCATGAGGGATGTC-3 SEQIDNO:12 AOX1 5-TACGTGAATGGCCAGAAGGT-3 SEQIDNO:13 5-GGATGATGCCTGATCGCCTT-3 SEQIDNO:14 BCKDHA 5-GACCTGGTGTTTGGCCAGTA-3 SEQIDNO:15 5-GCCGTAGTGAACAGGCATCT-3 SEQIDNO:16 ECHS1 5-CTCTTGGTGGGGGTTGTGAA-3 SEQIDNO:17 5-TTGCTAGCGATTTGCCGACT-3 SEQIDNO:18 HIBCH 5-AGGCGTCATAACGCTCAAC-3 SEQIDNO:19 5-TCCTCCGGCTCCCTTTATGA-3 SEQIDNO:20 HMGCS2 5-GCCCAAACGTCTAGACTCCC-3 SEQIDNO:21 5-CTCCATTAGACGGGACACCG-3 SEQIDNO:22 MCCC1 5-TGGGGTAGCCCGTAAATCCA-3 SEQIDNO:23 5-GAGCTCCTTCTGCACTCACT-3 SEQIDNO:24 ?-ACTIN 5-CAAGGTCATCCATGACAACTTTG-3 SEQIDNO:25 5-GGCCATCCACAGTCTTCTGG-3 SEQIDNO:26 GAPDH 5-CAAGGTCATCCATGACAACTTTG-3 SEQIDNO:27 5-GGCCATCCACAGTCTTCTGG-3 SEQIDNO:28 PrimersequencesusedforRatSample Target Sequence ABAT 5-GAGGCCGTGCACTTTTTCTG-3 SEQIDNO:29 5-CGCGTTTTGAGGCTGTTGAA-3 SEQIDNO:30 ACAA1 5-TTACGACATTGGCATGGCCT-3 SEQIDNO:31 5-CAGCCACATTCTCCGAGGTT-3 SEQIDNO:32 ACAA2 5-GGCAAAGTTCCACCGGAAAC-3 SEQIDNO:33 5-ACTGGAAACCAGAGCCACAG-3 SEQIDNO:34 ACADS 5-AGCCTTTCACCAAGGAGTCG-3 SEQIDNO:35 5-CATCTCGGTAGTAGCGCTCG-3 SEQIDNO:36 ACADSB 5-GGACTGGCCCAAGGATGTTT-3 SEQIDNO:37 5-ATAAATGGCCTCCCGGCTTC-3 SEQIDNO:38 ALDH6A1 5-AGTACCTGGAGCAACCATGC-3 SEQIDNO:39 5-CGAAGATGTACTCTCCCGCC-3 SEQIDNO:40 AOX1 5-ACCGTACCTGAGGAAGAACCT-3 SEQIDNO:41 5-TGCCCTCTACTGTGGTGACT-3 SEQIDNO:42 BCKDHA 5-CAACGATGTGTTTGCGGTGT-3 SEQIDNO:43 5-TTGACCTCATCCACCGAACG-3 SEQIDNO:44 ECHS1 5-AGGCCATCCAATGTGCAGAA-3 SEQIDNO:45 5-TCCACAAAGGCAGACATCCC-3 SEQIDNO:46 HIBCH 5-TGGAACAGATTAAGTTCTCATTGAC-3 SEQIDNO:47 5-TATGGTGTGCTGACCCTTGC-3 SEQIDNO:48 HMGCS2 5-GCCCAAACGTCTAGACTCCC-3 SEQIDNO:49 5-CGGGCATATTTTCTGCGGTG-3 SEQIDNO:50 MCCC1 5-AAGGCATGTGGAAGTCCAGG-3 SEQIDNO:51 5-CAGGATCAATACCAGGCGCT-3 SEQIDNO:52 ?-ACTIN 5-CAAGGTCATCCATGACAACTTTG-3 SEQIDNO:53 5-GGCCATCCACAGTCTTCTGA-3 SEQIDNO:54 GAPDH 5-CAAGGTCATCCATGACAACTTTG-3 SEQIDNO:55 5-GGCCATCCACAGTCTTCTGA-3 SEQIDNO:56