<i>Sidwf1 </i>gene controlling internode length in sesame

Abstract

A Sidwf1 gene of Sesamum indicum, including two exons and an intron, is 1638 bp in total, and has a sequence represented by SEQ ID NO: 1. Also provided is a method for determining the internode length type in sesame samples, the method including: 1) extracting a genomic DNA of a sesame sample; 2) synthesizing three primers including SiSNPdwf1 F1, SiSNPdwf1 F2, and SiSNPdwf1 R; amplifying the Sidwf1 gene or an allele SiDWF1 thereof with the genomic DNA of the sesame sample as a template, with a combination of SiSNPdwf1 F1, SiSNPdwf1 F2, and SiSNPdwf1 R a combination of SiSNPdwf1 F1 and SiSNPdwf1 R, or a combination of SiSNPdwf1 F2 and SiSNPdwf1 R, as primers, thereby yielding a PCR product; and performing electrophoresis on the PCR product or sequencing the PCR product, and determining the phenotype of the sesame sample according to an electrophoresis or sequencing result.

Claims

1. A cDNA of an Sidwf1 gene of Sesamum indicum, the cDNA having a sequence consisting of cDNA SEQ ID NO:2.

2. A cDNA of an SiDWF1 gene of Sesamum indicum, the cDNA having a sequence consisting of SEQ ID NO:4.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows the images of sesame dwarf mutant Dw607 (dwf1 type, left) with short internode length and its parent variety Yuzhi 11 (wild type, right) with normal internode length in a field;

(2) FIG. 2 is the location of the candidate SNP sites of the dwarf gene associated with the short internode length based on the association analysis of hybrid population in sesame:

(3) FIG. 3 is a schematic diagram of the structure of Sidwf1 gene of the invention. Boxes indicate exons, and black lines between boxes indicate introns. The base in red indicated by an arrow is the SNP site in the DNA sequences of Sidwf1 gene and the allele SiDWF1;

(4) FIG. 4 is the PCR amplification of some sesame germplasm accessions using the forward primer pairs SiSNPdwf1 F1 and SiSNPdwf1 F2 and the reverse primer SiSNPdwf1 R designed for the SNP marker SiSNPdwf1 associated with the dwarf and short internode length trait, where:

(5) lane M indicates DL2000 marker showing partial DNA bands of 250 bp and 100 bp from top down; lanes 1-10 indicate the dwarf phenotype with short internode of the F.sub.2-3 population derived from a cross between dwarf mutant Dw607 and Yuzhi 11, wherein all of the samples contain only the Sidwf1 gene allele 1(i.e., dwf1 type);

(6) lanes 11-20 indicate the normal type with normal internode length of the F.sub.2-3 population derived from a cross between dwarf mutant Dw607 and Yuzhi 11, wherein the lanes 12, 13, 15, 16, 17, 19 and 20 contain Sidwf1 alleles 1 and 2, while the lanes 11, 14, 18 contain only Sidwf1 allele 1 (i.e. dwf1 type);

(7) lane 21-40 indicate 20 sesame germplasm accessions with normal phenotype, wherein all of the lanes contain only the Sidwf1 gene allele 2 (wt.):

(8) FIG. 5 is the PCR amplification of the sesame germplasm accessions using the primers of the dwarf SNP marker SiSNPdwf1, where:

(9) lane M indicates DL 2000 marker showing DNA bands 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp and 100 bp, from top down;

(10) lane 1-10 indicate 20 germplasm accessions (with normal phenotype), wherein all of the lanes contain only the Sidwf1 gene allele 2 (wt.);

(11) lanes 11-20 indicate the F.sub.2-3 population derived from a cross between dwarf mutant Dw607 and Yuzhi 11, wherein the lanes 22, 27, and 30 contain only Sidwf1 allele 2 (wt.);

(12) lanes 21, 23, 24, 25, 26, 28, and 29 contain Sidwf1 alleles 1 and 2;

(13) lanes 31-40 indicate the F.sub.2-3 population lines (dwarf phenotype with short internode) derived from a cross between dwarf mutant Dw607 and Yuzhi 11, wherein all of the lanes only contain Sidwf1 allele 1 (dwf1).

DETAILED DESCRIPTION OF THE EMBODIMENTS

(14) To further illustrate the invention, embodiments detailing a Sidwf1 gene of sesame are described below. It should be noted that the following embodiments are intended to describe and not to limit the disclosure.

(15) Sesame variety Yuzhi 11 is an important breeding material in China. The dwarf sesame mutant, Yuzhi Dw607, is a new variety bred from the progeny of the mutagenic sibling of Yuzhi 11 by Henan Sesame Research Center, Henan Academy of Agricultural Sciences. China. The dwarf sesame mutant Yuzhi Dw607 is characterized by the short internode length and high capsule density traits. The main traits of Yuzhi Dw607 are as follows: the average internode length ranging from 3.8-4.6 cm, three flowers per leaf axil, single stem, four-edge capsule, and white seed coat color.

(16) Sesame variant 15N41 employed in the examples of the disclosure presents normal internode length, single flower per leaf axillary, branch, quadrilateral capsule and black seed coat color. The sesame variant 15N41 and other germplasm accessions, such as the sesame variety Yuzhi 11 described in the examples, are chosen for research. These germplasm accessions are available from the germplasm reservoir of Henan Sesame Research Center, Henan Academy of Agricultural Sciences, or other germplasm banks.

Example 1

(17) 1. Analysis of the Genetic Background of Internode Length Trait

(18) The positive and reciprocal crosses between the mutant Dw607 with short internode and the germplasm materials with normal internode such as Yuzhi 11 and 15N41 were performed in 2012 (the cross combination shown in Table 1 below). The phenotype of internode length trait in F.sub.1 progeny of the crosses was investigated.

(19) The phenotypic differences between the mutant Dw607 and the parent Yuzhi 11 with normal internode were shown in FIG. 1. The statistical results in detail were shown in Table 1 below, where χ.sup.2.sub.(0.05, 1)=3.84; ‘*’ indicates the internode length less than 5.0 cm as short internode length: the internode length larger than 5.0 cm as normal internode length.

(20) TABLE-US-00003 TABLE 1 Crosses and phenotype statistics of sesame population Parental Number of plants with normal intemode/Number of plants combination with short internode* Theoretical Parent 1 Parent 2 BC.sub.1 F.sub.2 ratio (dwf1) (wt.) F.sub.1 (χ.sup.2 value) BC.sub.2 (χ.sup.2 value) BC.sub.1 F.sub.2 Dw607 15N41 281/0 78/72 110/0 132/48 1:1 3:1 (0.1667) (0.1852) Dw607 Yuzhi 260/0 188/198 245/0 202/61 1:1 3:1 11 (0.2098) (0.3363)

(21) The results showed that the F.sub.1 progeny presented the normal phenotype of plant height and internode length, suggesting that the mutated trait is controlled by single nuclear recessive gene. The F.sub.2 progeny in all field experiments were undertaken for trait investigation during the mature period. The results showed that the segregation ratio of the dwarf and short internode length trait in the mutant and the wild type accorded with 1:3, suggesting that the mutated trait is controlled by single recessive gene. Further investigation results of the back-cross population showed that the mutated trait in the progeny fitted with the expected ratio of 1:1 and demonstrated that the short internode length trait is controlled by single recessive gene.

(22) 2. Construction of F2 Population Using the Short Internode Sesame and the Normal Internode Sesame as Parents

(23) A recombination inbred line (RIL) population was constructed using the short internode mutant Dw607 and the sesame variant 15N41 from 2013 to 2016. In 2016, the F.sub.6 seeds of the RIL population were sowed in nutrition pots at Sanya experimental station of Henan Sesame Research Center, Henan Academy of Agricultural Sciences. The size of the population was larger than 600.

(24) 3. Mapping of Sidwf1 Gene

(25) (1) Genome Re-Sequencing of Parents and the 113 Individuals of F.sub.6 Population

(26) On the basis of the preparation, the 113 individual F.sub.6 plants were chosen from the RIL population. Young leaves of the 113 individual plants and the 2 parents were collected for DNA extraction according to the improved method of Wei et al. (2008). Illumina sequencing method was used to re-sequence the genomes of the 115 samples with the sequencing coverage ≥30×.

(27) (2) The sequencing data of each sample was aligned using the sesame reference genome data and BWA package.

(28) (3) During the final flowering of sesame, the internode length trait of the 113 individual F.sub.6 plants and the 2 parental plants was measured.

(29) Based on the genomic and phenotypic data of the F.sub.6 population, the P-value of the variants associated with the internode length trait in sesame was calculated using the software Tassele 5.0. The detailed results were shown in FIG. 2.

(30) The results showed that a variant with the lowest P-value was located on the fourth chromosome. All of the variants within the flanking region covering the upstream 200 Kb and the downstream 200 Kb segments were analyzed. Further analysis showed that 58 polymorphic SNP/InDel sites were included in the region, with P-value ranging from 9.08E-05 to 2.59E-15.

(31) Further, the variants were screened using a variant database of 824 sesame germplasm accessions, and 12 variants were retained shown in FIG. 2 (green dots).

(32) Further, the 12 variants were screened using the variant data of two bulked pools of F.sub.2-3 population derived from dwarf mutant Dw607×Yuzhi 11. The results showed that only the locus C9_6989486 was significantly associated with the dwarf trait (the results were shown in Table 2 below).

(33) TABLE-US-00004 TABLE 2 Information of the variants significantly associated with the internode length trait in sesame Contig Variation type Variant Chromosome (Scaffold) Wild dwf1 Located Variant name location location type type gene location C9_6958525 SiChr.4 6958525 T TA / Intergenic region C9_6986819 SiChr.4 6986819 G GA / Intergenic region C9_6989486 SiChr.4 6989486 C T C9.scaffold2.572 2.sup.nd exon C9_7080799 SiChr.4 7080799 T TA / Intergenic region C9_7225874 SiChr.4 7225874 TTATA TTATATA, / Intergenic T, TTA region

Example 2

(34) On the basis of Example 1, the disclosure further provides the analysis information of target gene cloning and sequencing. The processes were introduced as follows:

(35) Based on the obtained variants in Example 1, the SNP C9_6989486 was determined as the target SNP site using the genome data of Yuzhi 11, and the located geneC9. scaffold2.572 was named Sidwf1. Sequence analysis detected that the gene was annotated as SiGIB1D gene in sesame genome (var. Yuzhi 11).

(36) Subsequently, to amplify the sequence of Sidwf1 gene controlling internode length in sesame, a primer pair was designed using the software Primer premier 5.0 based on the genome data.

(37) The following PCR primer pair was used to amplify the Sidwf1 gene:

(38) TABLE-US-00005 (SEQ ID NO: 5) SiDWF1 F: 5′- GGGGTGGGGTGAAAGACAA -3′; (SEQ ID NO: 6); SiDWF1 R: 5′- TCGCCAACACAAATGACAGG -3′.

(39) Furthermore, PCR reaction was performed using the DNA of dwarf mutant Dw607 as PCR template (DNA extraction method referred in Example 1) and the above primer pairs.

(40) PCR reaction was performed on a PTC 100 Thermal Cycler (MJ Research Inc.). Reaction condition was designed as follows: Pre-denaturation at 94° C. for 3 min, denaturation at 94° C. for 30 sec; 30 cycles with denaturation at 94° C. for 30 sec, annealing at 55° C. for 30 sec, and extension at 72° C. for 1 min; and final extension at 72° C. for 5 min. Finally, the PCR products were preserved at 4° C.

(41) The amplified products were purified and sequenced (Tianjin Biochip Technology Co., Ltd.). The results showed that the full-length genome sequence of the Sidwf1 gene is 1638 bp containing 2 exons and 1 intron. The base sequence is represented by SEQ ID NO: 1.

(42) Further, the genome DNA of Yuzhi 11 with normal internode trait was applied as a template to amplify the gene SiDWF1 controlling normal internode length using the above primers. The amplified gene SiDWF1 was sequenced and represented by SEQ ID NO: 3.

(43) The gene Sidwf1 sequence was aligned to the allele SiDWF1 sequence, as shown in FIG. 3.

(44) The gene Sidwf1 sequence was the same with the allele SiDWF1 except the 1057th base of the gene Sidwf1 sequence mutated from C to T. When the 1057th base is mutated from C to T, the 150th amino acid of an encoded protein was mutated from proline (P) to serine (S) and results in a change of the normal internode length to short type (dwf1 type).

Example 3

(45) Based on the results of Example 2, to determine whether Sidwf1 gene is the target gene regulating the internode length in sesame, SNP primers were designed. Six hundred germplasm accessions and an F.sub.2 population were applied to validate the SNP site. The processes were introduced as follows:

(46) The following three SNP primers are used to distinguish the Sidwf1 gene and the allele SiDWF1:

(47) TABLE-US-00006 (SEQ ID NO: 7) SiSNPdwf1 F1 sequence: 5′- GTATCTGTGAATTATCGTCGATAGC -3′; (SEQ ID NO: 8) SiSNPdwf1 F2 sequence: 5′- ATAATGTATCTGTGAATTATCGTCGATAGT -3′; (SEQ ID NO: 9) SiSNPdwf1 R sequence: 5′-CTCTCTGATCCTTCCCACTCTG -3′.

(48) The following two rules should be considered before designing a SNP primer pair for detecting the SNP alleles in sesame varieties:

(49) (1) Three specific SNP primers are designed, with an introduction of a mismatched base at the 3rd position from the 3′ end of each specific SNP primer, in order to improve the specificity of the amplified products. The principle of introducing a mismatch is as follows: the mismatched base at the 3rd position from the 3′ end of the primer can form a complementary structure with the SNP site, that is, a strong mismatched base (C/T or GA) matches a weak mismatched base (C/A or G/T), and a medium mismatched base (A/A, C/C, G/G or TT) matches another medium mismatched base.

(50) (2) For the two forward primers containing the SNP site, 5 bases are randomly added to the 5′end of one of the primer sequences, which is convenient to distinguish the PCR product containing different SNP alleles in the subsequent gel electrophoresis.

(51) 600 individual plants were randomly chosen from the F.sub.2-3 population derived from Dw607×Yuzhi 11, and the internode length type of each individual plantlet in the field was investigated. Young leaves of 600 individual plants and 2 parents were collected and the genomic DNA was extracted using the modified CTAB method (refers to Example 1).

(52) The extracted genomic DNAs were employed as the template to perform PCR reaction using the three SNP primers (i.e. a combination of the primer SiSNPdwf1 F.sub.1 and the primer SiSNPdwf1 R or a combination of the primer SiSNPdwf1 F2 and the primer SiSNPdwf1 R).

(53) 10 μL of PCR reaction system comprised:

(54) Template DNA (50 ng/μL), 1.0 μL;

(55) 10×PCR Buffer (Mg.sup.2+), 1.0 μL;

(56) Taqase enzyme (5 U/μL), 0.2 μL:

(57) dNTP (10 mmol/L), 0.2 μL;

(58) Forward Primer 1(10 μM), 0.5 μL;

(59) Forward specific Primer 2 (10 μM), 0.5 μL:

(60) Reverse Primer (10 μM), 1.0 μL;

(61) Ultrapure water, 5.6 μL

(62) PCR reaction was performed on a PTC 100 Thermal Cycler (MJ Research Inc.). PCR condition was recommended as follows: 94° C. for 3 min, 30 cycles of 30 s at 94° C., 30 s at 55° C., 30 s at 72° C., and a final 5 min extension at 72° C. PCR products were preserved at 4° C.

(63) The PCR product was analyzed by non-denaturing polyacrylamide gel electrophoresis, where the gel concentration was 8-10%, the gel size was 180 mm×120 mm×2 mm, the electrophoresis buffer was 0.5×TBE, and the electrophoresis was performed at 150V constant voltage for 1.5-2 h.

(64) After the electrophoresis, the gel was stained with silver nitrate, 0.1% (w/v) aqueous solution, and place on a horizontal shaker for 10 min for a deeper silver penetration. Addition of mixed solution containing 2% sodium hydroxide and 0.4% formaldehyde, the gel was placed on a horizontal shaker to develop a moderate color. The gel was rinsed repeatedly with deionized water and the data was recorded.

(65) Part of the electrophoresis results were shown in FIG. 4. The results showed that plants with short internode length phenotype had the amplicon with a band size of 126 bp, parent plants with normal internode length phenotype had the amplicon with a band size of 121 bp, and hybrid plants had amplicons with band sizes of 126 bp and 121 bp and the phenotype was normal internode length.

(66) The results showed that the gene Sidwf1 was a gene that controls the internode length in sesame, which can be used to investigate the regulation mechanism of plant height and internode length traits in sesame and other crops.

Example 4

(67) One hundred plant samples were chosen randomly from a hybrid offspring of Dw607 and Yuzhi 11, and another 100 plant samples were chosen from germplasm bank for breeding (the plant height and the internode length types were determined during flowering stage).

(68) Genomic DNA of each of 200 plantlets was extracted and applied for PCR amplification using the three SNP primers disclosed in Example 3 to evaluate the reliability of SNP markers.

(69) After PCR amplification, the PCR products of 121 bp were amplified using the forward primer 1 and the reverse primer, and the PCR products of 126 bp were amplified using the forward primer 2 and the reverse primer.

(70) Further, the PCR products were subjected to the gel electrophoresis, part results were shown in FIG. 5.

(71) The selection results of the SiSNPdwf1 locus in the disclosure showed that the sesame plants containing the SiSNPdwf1 allele 1 (a band of 121 bp, i.e. the SiSNPdwf1 site in the disclosure) should exhibit normal internode length. The sesame plants containing SiSNPdwf1 allele 2 (a band of 126 bp, with a base mutated from C to T at the SiSNPdwf1 site) should exhibit short internode length. The sesame plants containing SiSNPdwf1 alleles 1 and 2 (121 bp and 126 bp, respectively) were heterozygous and should exhibit normal internode length.

(72) The results indicated that all of the plantlets containing SiSNPdwf1 allele 1 (with a 121 bp band) are normal in internode length, with a reliability of 100%; all of the sesame plants containing SiSNPdwf1 allele 2 (with a 126 bp band) exhibited short internode length, with a reliability of 100%; all of the plantlets containing SiSNPdwf1 alleles 1 and 2 (with 121 bp and 126 bands) are also normal in internode length, with a reliability of 100%.

(73) The experimental results showed that the SNP marker described in the disclosure was a genetic marker associated with the short internode length trait and can be used to predict the plant height and internode length type, to apply in molecular marker assisted breeding, and to breed new varieties with short internode length in sesame.

(74) It will be obvious to those skilled in the art that changes and modifications may be made, and therefore, the aim in the appended claims is to cover all such changes and modifications.