Directed modification of glucosamine synthase mutant and application thereof

Abstract

The present invention discloses a directionally modified glucosamine synthase mutant and its application. The amino acid sequence of the glucosamine synthase mutant is as shown in sequence list SEQ ID No. 1, and the nucleotide sequence is as shown in sequence list SEQ ID No. 2. The genetic engineering bacteria of glucosamine synthase is successfully constructed. In order to improve the tolerance of recombinant bacteria against glucosamine, the glucosamine synthase is directionally modified. A glucosamine synthase mutant is selected from the mutant library via high-throughput screening method, the amino acid changes in the mutant induces the spatial conformational change in the enzyme, so as enlarged the region where the enzyme and substrate combines, therefor the combination efficiency of the enzyme and the substrate is increased. The glucosamine synthase of the present invention has various advantages, such as rich in raw material of glucose, and a convenient subsequent extraction.

Claims

1. A directionally modified glucosamine synthase mutant, having the amino acid sequence of SEQ ID No: 1.

2. The directionally modified glucosamine synthase mutant according to claim 1, wherein a gene encoding the directionally modified glucosamine synthase mutant have the nucleotide sequence of SEQ ID No: 2.

3. A method for biosynthesizing a glucosamine by using a directionally modified glucosamine synthase mutant, comprising the following step: converting glucosamine of a fermentation system into acetylated glucosamine through co-expressing the directionally modified glucosamine synthase mutant and a glucosamine acetyltransferase; wherein the directionally modified glucosamine synthase mutant has the amino acid sequence of SEQ ID No: 1.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a gene amplification electrophoretogram of gls.

(2) In the figure, M: Marker: lane 1 and lane 2: gls gene obtained from PCR, the target band can be seen in about 1800 bp.

(3) FIG. 2 is an optimization graph of the expression plasmids and expression hosts.

(4) In the figure, : pET-28a, .square-solid.: pET-24a, .box-tangle-solidup.: pRSFDuet-1, .diamond-solid.: pET-22b, A: the expression host of E. coli BL21(DE3); B: E. coli BL21(DE3) plss; C: E. coli Rosetta-gami(DE3).

(5) FIG. 3 is the GlcN yield of the mutant strain.

(6) In the figure, : Original strain; .square-solid.: The first round of optimal mutant; .box-tangle-solidup.: The second round of optimal mutant; .diamond-solid.: The third round of optimal mutant.

(7) FIG. 4 is the comparison diagram of hydrophobicity of wild enzyme and mutant enzyme M15-9.

(8) In the figure, (A) is wild-type enzyme, (B) is mutant enzyme M15-9.

(9) FIG. 5 is the comparison diagram of the hydrogen bonds of the two enzymes.

(10) In the figure, (A) is wild-type enzyme, (B) is mutant enzyme.

(11) FIG. 6 is the comparison diagram of the electric charge of the two enzymes.

(12) In the figure, (A) is wild-type enzyme, (B) is mutant enzyme.

(13) FIG. 7 is the GlcN yield of the co-expression recombinant bacteria.

(14) In the figure, 1 referred to recombinant bacteria with no gls mutation; 2 referred to recombinant bacteria with a gls mutation; 3 referred to recombinant bacteria co-expresses both gls and gnal after the mutation.

(15) FIG. 8 is the yield of GlcN and GlcNAc in 7 L fermentation broth.

(16) In the figure: : GlcNAc, .box-tangle-solidup.: GlcN, .square-solid.: GlcNAc+GlcNAc, .diamond-solid.: OD600, : pH.

DETAILED DESCRIPTION OF THE EMBODIMENTS

(17) The embodiments of the present invention are described in detail below. The scope of the present invention is not limited by the specific embodiments.

Embodiment 1

(18) Design primers according to the gls gene, the primer in 5 terminal is gls (1), the primer in 3 terminal is gls (2). Design primers according to the gnal gene the primer in 5 terminal is gnal (1), the primer in 3 terminal is gnal (2). The primer sequences related in the present invention are shown in table 1.

(19) TABLE-US-00001 TABLE1 Theprimersusedintheexperiment. Retriction Name Primersequence(5-3) sites gls(1) CGCGGATCCATGTGTGGAATC BamHI GTAGGTTAT gls(2) CCGGAATTCTTATTCAACGGT EcoRI CACGCTTTTGGC gnal(1) CCCAAGCTTAAGGAGATATA HindIII CCATGAGCCTGCCGGATGGT TTT gnal(2) CCGCTCGAGTTATTTACGAAT XhoI TTGCATTTCGAC

(20) The gls gene is cloned by primers gls (1) and gls (2). Extaq polymerase is used to amplify in the reaction. The reactions are carried out in a 50 L reaction system with the following PCR conditions: pre-denaturation at 94 C. for 10 min; denaturation at 94 C. for 30 s, annealing at 62 C. for 45 s, extending at 72 C. for 60 s, 35 cycles; final extending at 72 C. for 10 min. The PCR product is electrophoresed on 1.0% agarose gel (FIG. 1) and the target sequences are collected. The g/s is ligated to pMD19-T to construct cloning plasmid, and the cloning plasmid and expression plasmid are digested respectively by BamH I and EcoR I, then expression plasmid is reconstructed through T.sub.4 ligase reaction.

Embodiment 2

(21) Four different expression plasmid, pET-22b, pET-24a, pET-28a and pRSFduet-1 are selected respectively. The expression plasmids are conducted enzyme digestion by EcoR I and BamH I. Gls is connected to the expression plasmids through the T.sub.4 ligase to construct the recombinant plasmids pET-22b-gls, pET-24a-gls, pET-28a-gls and pRSFduet-1-gls respectively. E. coli Rosetta-gami (DE3), E. coli BL21 (DE3), E. coli BL21 (DE3) plss are taken as expression host to establish different gls recombinant expression systems. IPTG is added into the positive clone after screening to conduct induced expression. The result shows that when pET-24a is taken as expression plasmid, the expression system obtained the highest glucosamine synthesis ability, which reaches at 1.31 g/L, 1.37 g/L and 1.63 g/L in E. coli BL21 (DE3), E. coli BL21 (DE3) plss and E. coli Rosetta-gami (DE3) respectively (See FIG. 2).

Embodiment 3

(22) In order to improve the tolerance of glucosamine synthase against glucosamine and the yield ability of glucosamine, the glucosamine synthase is conducted to directional modify the GLS via error-prone PCR. The reaction system of error-prone PCR after optimization is as shown in table 2:

(23) TABLE-US-00002 TABLE 2 The reaction system of error-prone PCR Reagent volume (L) error-prone PCR Mix, 10x 3 Special dNTP for error-prone PCR, 10x 3 MnCl.sub.2, 5 mM 4 DNA template 1 Special GTP for error-prone PCR 1 gls(1) 1 gls(2) 1 Taq DNA polymerase 1 ddH.sub.2O 15 Total 30

(24) The PCR reaction condition: starts with pre-denaturation at 94 C. for 10 min; followed by 30 cycles of denaturation at 94 C. for 30 s, annealing at 62 C. for 45 s, extending at 72 C. for 60 s; with a final extending at 72 C. for 10 min. After PCR reaction, PCR products are conducted 1.0% agarose gel electrophoresis. The target bands are excised from the gel and eluted using Elution buffer to conduct re-dissolution. The PCR product is conducted 1.0% agarose gel electrophoresis to gel extract the target sequences through the gel extraction kit. The gls and pET-24a are conducted double enzyme digestion by BamH I and EcoR I, then pET-24a-gls recombinant plasmid is constructed through T.sub.4 ligase reaction.

Embodiment 4

(25) The mutant recombinant plasmid is converted into E. coli Rosetta-gami (DE3), transferring to be conducted domestication in 5 mL LB medium contained 25 g/L of glucosamine, culturing under the condition of 37 C., 220 rpm for 10 h. The cultured bacterial fluid is coated on the solid plate containing 25 g/L of glucosamine and cultured in the 37 C. incubator for 12 h, the growth situation of the bacterial colony is real-time monitored. The transformant is selected and transferred into the TB liquid medium containing 3% of glucose to culture in the 96-deep well cultural plate, at the same time, each of the selected bacterial strain is made superscript in the well cultural plate. Each well correspond to a positive transformant, while two wells are reserved as contrast, one added with the starting strain, the other added with the culture medium only but no any strains. The culture condition is 37C, 220 rpm. When the OD.sub.600 is 0.6-0.8 in culture, the IPTG with a final concentration of 0.5 mM is added into and conducted induction of enzyme yield, and the culture condition changes into 25 C., 220 rpm. The glucosamine content is determined after fermentation for 24 h.

(26) After the fermentation, the deep well plate is taken out to conducted centrifugation, and then 100 L acetylacetone reagent is added into the deep well plate. And then the deep well plate is fixed in a water bath at 90 C. to conduct water bath for 1 h. After removed out from the water bath and cooled down, 1 mL of 96% ethanol is added to the deep well plate, and then 100 L DMAB reagent is added. Then coloring at room temperature for 1 h, after that, 200 L of the sample is corresponding sucked from the deep well plate to the 96-deep well plate by a volley. The 96-well plate is placed on a microplate reader to measure the spectrophotometric values at 530 nm to screen out the strains whose OD.sub.530 are higher than that of the starting strain. The screened strains are selected from the plate to culture and measure the yield of GlcN.

(27) The pET-24a-gls is taken as a template in the experiment. When gls is mutated in vitro via error-prone PCR technology, the high concentration GlcN is applied to conducted domestication to select the mutant strains through high throughput screening on the 96-well plate. 22 mutant strains with improved yield traits are screened from 1152 cloned strains in the first round of error-prone PCR. After screening verification, the yield of the mutant strain numbered M4-27 is 2.84 g/L, increased by 74.2%. Plasmids of the mutant strain are extracted as a template to conduct the next round of mutation and screening, 15 mutant strains are selected from 864 cloned strains. The highest yield is 3.39 g/L (Number M6-9). 20 mutant strains are selected from 691 cloned strains in the third round experiment, the highest yield reaches 3.57 g/L (Number M15-9), the yield of which cumulatively increased by 119% (See FIG. 3).

Embodiment 5

(28) The original strain MO-0 and the best mutant strain M15-9 are inoculated in the LB seed culture medium, and transferred to ferment in the TB (3% glucose) fermentation medium under the condition of 37 C., 220 r/min. When OD.sub.600 of bacterial fluid reaches 0.6-0.8, the IPTG is added into the fermentation broth and conducted induction at 25 C., the final concentration of IPTG is 0.5 mmol/L. The yield is determined after fermentation is conducted for 18 hs' later. The comparison of each indexes of wild bacteria and mutant bacteria is as shown in table 3.

(29) TABLE-US-00003 TABLE 3 The fermentation indexes comparison of shake flask Fermentation parameters Wild type M4-27 M6-9 M15-9 GlcN (g/L) 1.48 0.22 2.57 0.17 3.32 0.31 3.79 0.54 DCW (g/L) 3.52 0.14 3.22 0.09 3.49 0.17 3.15 0.33 Glucose consumption (g/L) 22.27 1.83 20.85 1.52 23.03 2.14 22.17 2.92 GlcN production intensity (gL.sup.1h.sup.1) 0.08 0.01 0.14 0.01 0.18 0.02 0.21 0.03 Conversion of glucose to GlcN (%) 6.65 0.99 12.33 0.82 14.42 1.35 17.10 2.44 Specific enzyme activity (%) 100 161.43 3.82 188.93 5.37 197.17 7.27

(30) By controlling the content of MnCl.sub.2 and dGTP in the reaction system in the embodiment, the base mutation rate is controlled within 2-3% to ensure the positive mutations can be obtained in each round of mutant strains. The mutational bases and amino acid sites of each round are shown in Table 4. The strain M15-9 with high and stable yield is obtained through multi-round advantage accumulation. The nucleotide sequence of the mature protein of the mutant enzyme is as shown in SEQ ID NO.2 and the amino acid sequence of which is as shown in SEQ ID NO. 1. The amino acid sequence of the wild-type glucosamine synthase is as shown in SEQ ID NO.3 and the amino acid sequence of which is shown as SEQ ID NO.4.

(31) TABLE-US-00004 TABLE 4 Mutational bases and amino acid Amino acid Amino Strains Base site Mutant base site acid mutation Wild type First round 382 T-C 128 V-A M4-27 1054 A-C 352 D-A 1412 T-G 471 D-E Second round 1666 T-C 556 L-P M6-9 1293 C-G 432 L-V 1698 T-A 567 V-E Third round 177 G-T 60 A-S M15-9 1059 C-T 354 R-C 1265 T-G 422 I-M

(32) Construction of glucosamine synthase model: The online software SWISS-MODEL is used to conduct homology modeling to obtain the three-dimensional structure model of glucosamine synthase via protein sequences analysis with high internal homology from the protein database (PDB). Through sequence and structure analysis show that there are two sites changed near the active center 5 of the three-dimensional structure in glucosamine synthase. The changes of mutation sites 352 (D-A) and 354 (R-C) have a significant influence to the combination region of the substrate fructose-6-phosphate. Specific changes are as follows:

(33) {circle around (1)} Comparison of Hydrophobic

(34) As FIG. 4B shows, the changes in amino acid residues of the enzyme lead to the increasing of hydrophobic of the mutant enzyme compared to the wild type, which causes the residues of enzyme active center to gather insides or sideways that changes the spatial conformation of the enzyme. Further, the combination region of the enzyme and substrate is enlarged and the combination efficiency of the enzyme is improved.

(35) {circle around (2)} Comparison of Hydrogen Bonds

(36) As shown in FIG. 5 (A), the wild-type enzyme contains 5 hydrogen bonds, while there are 7 hydrogen bonds in the mutant one as shown in FIG. 5 (B), which enhanced the hydrogen bond in the active center. The hydrogen bonding and hydrophobic interaction play an important role in maintaining the stability of three-dimensional conformation of enzyme molecules. The hydrogen bonds are connected around the active center to enhance hydrophobic interactions between nonpolar groups, and make the three-dimensional conformation of the enzyme molecules more stable. The change of residues leads to the increase, decrease, and the interaction of hydrogen bonds, which affects the spatial structure of enzymes, so that the three-dimensional conformation of enzyme molecules is affected, and the combination efficiency of enzymes and substrates is improved.

(37) {circle around (3)} Comparison of the Charge

(38) The change in amino acid residues of the enzyme leads to the significant reduction of the negatively charged amino acids of the mutant enzyme compared to wild type as shown in FIG. 4B. The negatively charged amino acids changing into neutral amino acids weaken the polarity of the enzyme molecule, which is more beneficial to the combination region of enzymes and substrates, and the combination efficiency of the enzyme is improved.

Embodiment 6

(39) Because of its less stimulation to cells and ability to conduct deacetylation to convert into GlcN by weak acid in the downstream extraction process, the acetylglucosamine is often chosen as the fermentation product. The gnal gene is amplified by primer gnal (1) and gnal (2). The PCR product is conducted 1.0% agarose gel electrophoresis to gel extract the target sequences, then the gls and pET-24a-gls are conducted double enzyme digestion by Hind III and Xho I, after then pET-24a-gls recombinant plasmid is constructed through T.sub.4 ligase reaction. The recombinant plasmids are transformed into E. coli Rosetta-gami (DE3). The successfully validated positive clones are introduced into the fermentation medium. When the OD.sub.600 of bacterial fluid reaches 0.6-0.8 in the fermentation under the condition of 37 C., 250 r/min, IPTG of a final concentration at 0.5 mmol/L is added into the fermentation broth, and transfer to conduct induction at 25 C. The content of GlcN and GlcNAc is determined after fermentation for 18 h. The result shows that the cumulative yield of GlcN and GlcNAc reaches 8.57 g/L, which is increased 2.4 times compared with the yield of single expression of gls (FIG. 7).

(40) The fed-batch fermentation is conducted in 7 L numerical control fermenter. The fermentation is conducted with an initial loading volume of 4 L, an inoculation amount of 5% vol at 37 C. firstly, and change to 25 C. after induction. Due to the acid generated in the fermentation process, ammonia is added to adjust pH in the experiment. FIG. 8 is a fed-batch fermentation process curve of the 7 L fermenter. The biomass OD.sub.600 reaches the maximum at 16 h, while the concentrations of GlcN, GlcNAc reach the maximum after 20 h, with the yield of 3.93 g/L, 5.86 g/L respectively. The cumulant of both reaches the maximum at 22 h, with the amount of 9.79 g/L.

(41) The above disclosure shows some specific embodiments of the present invention, however, the present invention is not limited to these embodiments. Various modifications of the disclosed embodiments as well as alternative embodiments of the invention will become apparent to persons skilled in the art. It is therefore contemplated that the appended claims will cover any such modifications or embodiments that fall within the scope of the invention.