CRISPR/CAS SYSTEM AND METHOD FOR GENOME EDITING AND MODULATING TRANSCRIPTION
20240247262 ยท 2024-07-25
Inventors
- Ryan E. Clarke (Chicago, IL, US)
- Bradley J. Merrill (Chicago, IL, US)
- Matthew S. MacDougall (Chicago, IL, US)
- Hannah M. Pennington (Chicago, IL, US)
- Brian R. Shy (Chicago, IL, US)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C07K2319/80
CHEMISTRY; METALLURGY
C07K2319/95
CHEMISTRY; METALLURGY
C12Y603/02019
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
A CRISPR/Cas system and method for editing or regulating transcription of a genome of a cell are provided, wherein the system includes a Cas endonuclease fused with one or more degron sequences and at least one activatable cognate single guide RNA harboring an inactivation sequence in a non-essential region of the cognate sgRNA, wherein said inactivation sequence comprises one or more endonuclease recognition sites of, e.g., a ribozyme.
Claims
1: A CRISPR/Cas system comprising a Cas endonuclease and a cognate single guide RNA (sgRNA), wherein: (a) the Cas endonuclease is fused with one or more degron sequences, wherein said degron has: (i) a non-canonical Cdc20 or Chd1 recognition motif, or (ii) a sequence targeted by a ligase selected from the group of EMI1, TRP1, CBL-PTK, CBL-MET, COP1, CRL4-CDT2, Kelch KEAP1, Kelch KLHL3, MDM2-SWIB, ODPH-VHL, SCF-SKP2, SCF-SKP2-CKS1, SCF-CULLIN, SCF-FBW7, SCF-FBX05, SCF-TRCP1, SCF-CUL4, E6-AP, SIAH, HECT domain family, RING finger family, U box family, and combinations thereof; (b) the cognate sgRNA is an activatable sgRNA harboring an inactivation sequence in a non-essential region of the activatable sgRNA, wherein said inactivation sequence comprises one or more endonuclease recognition sites; or (c) a combination of (a) and (b).
2: The system of claim 1, wherein the activatable sgRNA targets a transcribed strand of a nucleic acid molecule.
3: The system of claim 1, wherein the inactivation sequence is a cis-acting ribozyme encoded by a nucleic acid molecule of SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4.
4: The system of claim 1, wherein the activatable sgRNA is encoded by a nucleic acid molecule of SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21 or SEQ ID NO:22.
5: The system of claim 1, further comprising an array of activatable sgRNAs, where the cognate sgRNA targets at least one activatable sgRNA in the array of activatable sgRNAs.
6: A fusion protein comprising a Cas endonuclease fused with one or more degron sequences selected from the group of: (i) a non-canonical Cdc20 or Chd1 recognition motif, or (ii) a sequence targeted by a ligase selected from the group of EMI1, TRP1, CBL-PTK, CBL-MET, COP1, CRL4-CDT2, Kelch KEAP1, Kelch KLHL3, MDM2-SWIB, ODPH-VHL, SCF-SKP2, SCF-SKP2-CKS1, SCF-CULLIN, SCF-FBW7, SCF-FBX05, SCF-TRCP1, SCF-CUL4, E6-AP, SIAH, HECT domain family, RING finger family, U box family, and combinations thereof.
7: The fusion protein of claim 6, wherein the one or more degron sequences are fused to the Cas endonuclease with one or more linkers disposed therebetween.
8: The fusion protein of claim 6, wherein the one or more degron sequences are fused to the Cas endonuclease at the N-terminus, C-terminus, or N-terminus and C-terminus of the Cas endonuclease.
9: An activatable single guide RNA (sgRNA) harboring an inactivation sequence in a non-essential region of the sgRNA, wherein said inactivation sequence comprises one or more endonuclease recognition sites.
10: The activatable sgRNA of claim 9, wherein the activatable sgRNA binds a transcribed strand of a target nucleic acid molecule.
11: The activatable sgRNA of claim 9, wherein the inactivation sequence is a cis-acting ribozyme encoded by a nucleic acid molecule of SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4.
12: The activatable sgRNA of claim 9, wherein the activatable sgRNA is encoded by a nucleic acid molecule of SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21 or SEQ ID NO:22.
13: A method of editing or modulating transcription of a genome in a cell comprising introducing into the cell at least one Cas endonuclease and at least one cognate single guide RNA (sgRNA) that targets a nucleic acid sequence of the genome, wherein: (a) the Cas endonuclease is fused with one or more degron sequences selected from the group of: (i) a non-canonical Cdc20 or Chd1 recognition motif, or (ii) a sequence targeted by a ligase selected from the group of EMI1, TRP1, CBL-PTK, CBL-MET, COP1, CRL4-CDT2, Kelch KEAP1, Kelch KLHL3, MDM2-SWIB, ODPH-VHL, SCF-SKP2, SCF-SKP2-CKS1, SCF-CULLIN, SCF-FBW7, SCF-FBX05, SCF-TRCP1, SCF-CUL4, E6-AP, SIAH, HECT domain family, RING finger family, U box family, and combinations thereof; (b) the cognate sgRNA is an activatable sgRNA of claim 9; or (c) a combination of (a) and (b), thereby editing or modulating transcription of the genome of the cell.
14: The method of claim 13, wherein expression of the Cas endonuclease, activatable sgRNA or Cas endonuclease and activatable sgRNA are controlled by one or more regulatable promoters.
15: The method of claim 13, wherein at least two cognate sgRNAs that target two or more sequences in the genome are introduced into the cell.
16: The method of claim 15, wherein the at least two cognate sgRNAs are activatable sgRNA, which are sequentially activated to introduce two or more edits in the genome.
17: The method of claim 15, wherein the at least two cognate sgRNAs are activatable sgRNA, which are sequentially activated and comprise: (i) a first activatable sgRNA which targets nucleic acids encoding a second activatable sgRNA, and (ii) the second activatable sgRNA which targets a promoter in the genome.
18: The method of claim 13, wherein the at least one cognate sgRNA is inserted into nucleic acids encoding a 5- or 3-untranslated region of a gene.
19: A nucleic acid comprising a coding sequence, a 5-untranslated region and a 3-untranslated region, wherein said nucleic acid has inserted in the 5-untranslated region or 3-untranslated region an activatable single guide RNA of claim 9.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
DETAILED DESCRIPTION OF THE INVENTION
[0035] The Cas9 endonuclease has been adopted for genome editing across many species for its versatility and facile programmability. However, Cas9 is essentially a single-turnover nuclease as it remains bound to the double-strand break it generates, and many regions of a genome are refractory to genome editing. It has now been demonstrated that the refractory nature of Cas9 is due to Cas9 blocking the steps that follow its nuclease activity (DNA repair), therefore inhibiting completion of a genome edit. In this respect, a translocating RNA polymerase will collide with the Cas9-DSB complex and evict Cas9 from the DNA ends if the sgRNA is annealed to the template strand for the RNA polymerase, ultimately facilitating DNA repair and creating a strand bias for genome editing. To alleviate the strand bias and the need for an RNA polymerase, modifying Cas9 through destabilization also alleviates this blocking phenomena through increasing the rate at which Cas9 is removed from the DNA. Furthermore, by controlling the expression and degradation of Cas9 to correspond to the cell cycle, the type of genome edit (error prone NHEJ or precise HDR) can be influenced. In addition to modifying Cas9, it now has been shown that the frequency of mutations can be positively influenced by specifically designing the sgRNA to anneal to the transcribed strand of the gene. Design of sgRNA to anneal to the template strand significantly increases mutation frequencies/kinetics, whereas targeting the non-template strand can result in substantially lower mutation frequencies/kinetics due to slower genome editing kinetics. Moreover, by controlling the functionality of specific sgRNA, genome editing activities are not dependent on transcriptional or translational control of the Cas protein. Indeed, it has now been shown that implementing a series of activatable sgRNA, genome editing can be regulated from target site to target site in more of a temporal manner, sequential genome edits can be executed to function like a domino effect, and cells can be barcoded.
[0036] Accordingly, the present invention provides a CRISPR/Cas system and use of the same to in editing a genome of a cell, in particular a eukaryotic cell. The CRISPR/Cas system of this invention includes a Cas endonuclease and an activatable cognate sgRNA, wherein the Cas endonuclease is fused with one or more degron sequences and/or the activatable cognate sgRNA harbors an inactivation sequence in a non-essential region of the activatable cognate sgRNA. Given its improved gene editing capabilities, the CRISPR/Cas system of the invention finds use in gene therapy, drug screening, genetic recording, genetic circuitry, and disease diagnosis and prognosis.
[0037] The terms CRISPR/Cas, CRISPR/Cas system and nucleic acid-targeting system may be used interchangeably. CRISPR-Cas systems are known in the art. See, for example, U.S. Pat. Nos. 8,697,359; 8,771,945; 8,795,965; 8,865,406; 8,871,445; 8,889,356; 8,895,308; 8,906,616; 8,932,814; 8,945,839; 8,999,641; U.S. application Ser. Nos. 14/704,551; 15/192,095; and PCT Publication Nos. WO2016106244 and WO2014093622. See also, Komor, et al. (2017) Cell 168 (1-2): 20-36.
[0038] The CRISPR/Cas system of this invention includes an RNA-guided nuclease, also referred to herein as a Cas endonuclease or Cas protein, and a cognate guide RNA. As is conventional in the art, the guide RNA, also referred to herein as a single guide RNA, sgRNA, or gRNA, guides a cognate Cas protein to specific sites in the genome for targeted cleavage. As used herein, cognate refers to a Cas protein and a sgRNA that are capable of forming a nucleoprotein complex, which directly binds to a target nucleic acid molecule that is complementary to a nucleic acid sequence present in the sgRNA.
[0039] As is conventional in the art, complementarity refers to the ability of a nucleic acid molecule to form hydrogen bond (s) with another nucleic acid molecule (e.g., through traditional Watson-Crick base-pairing). A percent complementarity indicates the percentage of residues in a nucleic acid molecule that can form hydrogen bonds with a second nucleic acid sequence. When two polynucleotide sequences have 100% complementary, the two sequences are perfectly complementary, i.e., all of the contiguous residues of a first polynucleotide hydrogen bond with the same number of contiguous residues in a second polynucleotide.
[0040] Cas Fusion Protein. As indicated, this invention provides a CRISPR/Cas system including a Cas endonuclease fused with one or more degron sequences, generally referred to herein as a Cas fusion protein or fusion protein. Cas endonucleases are known in the art and include, but are not limited to, Cas proteins such as Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Cas12a, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, and homologs thereof, or modified versions thereof. In some embodiments, the Cas is a dCas9 protein (Cas9 endonuclease dead protein, e.g., with point mutations D10A and H840A) or fusion protein thereof. Although dCas9 lacks endonuclease activity, it is still capable of binding to its guide RNA and the target nucleic acid molecule. This ability to bind DNA can be used to either block transcription of the targeted gene by fusing the dCas9 to a transcriptional repressor peptide such as KRAB or to activate transcription by fusing the dCas9 with an activation domain such as VP64-p65-Rta (VPR). The nucleic acid and amino acid sequences of these Cas proteins are readily available from public sources including GENBANK and SwissProt. By way of illustration, the Streptococcus pyogenes Cas9 protein sequence is available under SwissProt accession number Q99ZW2. Likewise, the Actinobacillus suis Cas9 is available under GENBANK accession number WP 014991277. Preferably, the CRISPR enzyme is a Cas9 protein. Representative Cas9 proteins include, but are not limited to Cas9 from Streptococci including S. pyogenes, S. pneumoniae, and the like and Cas9 from Staphylococcus aureus, Neisseria meningitides and Treponema denticola. Additional RNA-guided nucleases include Cas12a nucleases (Cas12a formerly Cpf1) including Cas12a from Providicella, Francisella, Acidaminococcus and Lachnospiracae.
[0041] To regulate Cas protein stability and hence the rate at which Cas9 is removed from the DNA, this invention includes a fusion protein composed of a Cas endonuclease fused with one or more degron sequences. As used herein, a degron refers to a specific sequence of amino acids in a protein that confers metabolic instability of degradation. A degron sequence can occur at either the N- or C-terminal region, and these are called N-degrons or C-degrons, respectively. A degron may be any amino acid sequence, or combination of sequences, that confers degradation to a protein that it is fused to.
[0042] The ordered progression through the cell cycle depends on regulating the abundance of several proteins through ubiquitin-mediated proteolysis. Degradation is precisely timed and specific. One example of such degradation system is the anaphase promoting complex (APC), a ubiquitin protein ligase. APC is activated both during mitosis and late in mitosis/G1, by the WD repeat proteins Cdc20 and Cdh1, respectively. These activators target distinct sets of substrates. APC/C-Cdc20 and -Cdh1 coactivator complexes recognize most of their substrates through recognition of the canonical motifs: the D (destruction)-box degron (Arg-Xaa-Xaa-Leu-Asp (SEQ ID NO:111) or Arg-Xaa-Xaa-Leu (SEQ ID NO:112)) and the KEN box degron (a three amino acid motif of Lys-Glu-Asn). In this respect, a canonical Cdc20 or Cdh1 recognition motif refers to the classically characterized Cdc20 and Cdh1 recognition motifs, i.e., the D-box and KEN box motifs. In some embodiments, the degron contains a canonical Cdc20 or Cdh1 recognition motif. Examples of naturally occurring proteins that include a D-box degron are cell cycle-dependent cyclins (CDKs) such as Cyclin A and Cyclin B and other cell cycle-regulated proteins such as Hsl1, Cdc6, Fin1, p21 and Geminin. Representative D-box degron amino acid sequences include RPALSD (SEQ ID NO:113), RPALS (SEQ ID NO:114) and RLALD (SEQ ID NO:115). Examples for naturally occurring proteins that include a KEN box degron are Cdc20, Sgo1, Nek2 and B99. Other proteins which contain either a D-box or a KEN box are well-known in the art (Glotzer, et al. (1991) 991, Nature 349:132-138; Pfleger & Kirschner (2000) Genes Dev. 14 (6): 655-665).
[0043] In other embodiments, the degron is not a canonical Cdc20 or Cdh1 recognition motif. Accordingly, in some aspects, the degron is a non-canonical Cdc20 or Cdh1 recognition motif. A non-canonical Cdc20 or Cdh1 recognition motif refers to a Cdc20 or Cdh1 motif that is a motif other than a D-Box or KEN box motif. Non-canonical Cdc20 and Cdh1 recognition motifs include the LXXK motif, A-motif, CRY-box and RL tail.
[0044] LXXK degron is a non-canonical APC/Cdh1 target that renders its protein targetable to the proteasome. LXXK degrons include the amino acid sequence LXXK (SEQ ID NO:116), wherein X can be any amino acid residue. A representative LXXK degron sequence is LASK (SEQ ID NO:117).
[0045] The A-motif is a sequence that enhances APC-Cdh1 binding to facilitate targeting to the proteasome. A-motif degrons include the amino acid sequence EET. A representative A-motif degron sequence is EETAE (SEQ ID NO:118).
[0046] The CRY-box motif is a degron recognized by APC/C for targeting to the proteasome. This degron includes the amino acid sequence CRYXPS (SEQ ID NO:119), where X can be any amino acid residue. A representative CRY-box degron sequence is CRYIPS (SEQ ID NO:120).
[0047] The RL tail motif of Emi1/Emi2 serves as a docking site for the APC/C, thereby promoting the interaction and inhibition of the APC/C-Cdh1. This degron includes the amino acid sequence (T/S) KKSKKNL (R/Q) RL (SEQ ID NO:56), where X can be any amino acid residue. A representative RL tail degron sequence is TKKSKKNLRRL (SEQ ID NO:57).
[0048] In other aspects of this invention, the degron is neither a canonical nor non-canonical cdc20 or Cdh1 recognition motif. In accordance with this aspect of the invention, the degron may mediate ubiquitin-dependent degradation or ubiquitin-independent degradation (e.g., via PEST degrons disclosed herein). In some embodiments, the degron has a sequence targeted by a ligase selected from the group of EMI1, TRP1, CBL-PTK, CBL-MET, COP1, CRL4-CDT2, Kelch KEAP1, Kelch KLHL3, MDM2-SWIB, ODPH-VHL, SCF-SKP2, SCF-SKP2-CKS1, SCF-CULLIN, SCF-FBW7, SCF-FBX05, SCF-TRCP1, SCF-CUL4, E6-AP, SIAH, HECT domain family, RING finger family, U box family, and a combination thereof. Examples of degrons that do not serve as recognition motifs for either Cdc20 or Cdh1 include, e.g., the PHD domain, PIP motif, Cy motif, ABBA motif, and the like (Table 1).
TABLE-US-00001 TABLE1 Degron Substrate MotifSequence APC/ CyclinA2 FTIHVDEAE(SEQIDNO:80) CABBA PIP Cdt1 QRRVTDFF(SEQIDNO:81) Cdt1 QTSMTDFY(SEQIDNO:82) *** QXX(V/L/M/I)XX(F/Y)(F/Y) (SEQIDNO:83) PHD *** CHC domain Cymotif Cdt1 RRL HIV-1Viral RKL infectivityfactor *** RXL APC/ Anaphase-promoting SIR CTRP1 complexsubunit10 Celldivisioncycle GIR protein20homolog Fizzy-relatedprotein RIR homolog Kinesin-likeprotein NLR KIF18A Serine/threonine- GMR proteinkinaseNek2 CBL-PTK Tyrosine-protein DGYTPEP(SEQIDNO:84) kinaseZAP-70 Proteinsprouty NEYTEGP(SEQIDNO:85) homolog CBL-MET Hepatocytegrowth DYR factorreceptor COP1 Transcriptionfactor DEPQTVPD(SEQIDNO:86) jun-D Transcriptionfactor EEPQTVPE(SEQIDNO:87) AP-1 ETStranslocation DEQFVPD(SEQIDNO:88) variant5 CRL4- Cyclin-dependent TSMTDFYHSKRRL CDT2 kinaseinhibitor1 (SEQIDNO:58) Cyclin-dependent PLISDFFAKRKRS kinaseinhibitor1C (SEQIDNO:59) DNAreplicationfactor RRVTDFFARRRP Cdt1 (SEQIDNO:60) N-lysine RKLTDFYPVRRS methyltransferase (SEQIDNO:61) SETD8 Kelch Nuclearfactor DEETGE(SEQIDNO:89) KEAP1 erythroid2-related factor2 Serine/threonine- NVESGE(SEQIDNO:90) proteinphosphatase PGAM5 Inhibitorofnuclear NQETGE(SEQIDNO:91) factorkappa-Bkinase subunitbeta Nucleosome-remodeling DPENGE(SEQIDNO:92) factorsubunitBPTF Nuclearfactor DGETGE(SEQIDNO:93) erythroid2-related factor1 Kelch Serine/threonine- EPEEPEADQH KLHL3 proteinkinaseWNK1 (SEQIDNO:62) Serine/threonine- ECEETEVDQH proteinkinaseWNK3 (SEQIDNO:63) MDM2- Tumorprotein63 FQHIWDEL(SEQIDNO:94) SWIB Tumorproteinp73 FEHLWSSL(SEQIDNO:95) Cellulartumorantigen FSDLWKLL(SEQIDNO:96) p53 Proteinnumbhomolog FEAQWAAL(SEQIDNO:97) Numb-likeprotein FEAQWAAL(SEQIDNO:98) ODPH-VHL EndothelialPAS LAPYIPMDGEDFQL domain-containing (SEQIDNO:64) protein1 Hypoxia-inducible LAPAAGDTIISLDF factor1-alpha (SEQIDNO:65) SCF-FBW7 G1/S-specificcyclin- LLTPPQS(SEQIDNO:99) E1 G1/S-specificcyclin- LTPPQS(SEQIDNO:100) E1isoform-3 Transcriptionfactor PGETPPLS(SEQIDNO:101) AP-1 Uracil-DNAglycosylase PGTPPSS(SEQIDNO:102) H. SCF- Cyclin-dependent SVEQTPKK(SEQIDNO:103) SKP2- kinaseinhibitor1B CKS1 SCF- NF-kappa-Binhibitor DSGLGS(SEQIDNO:104) TRCP1 beta NF-kappa-Binhibitor DSGIES(SEQIDNO:105) epsilon Cateninbeta-1 DSGIHS(SEQIDNO:106) F-boxonlyprotein5 DSGYSS(SEQIDNO:107) SIAH POUdomainclass2- APTAVVLPH(SEQID associatingfactor1 NO:108) AF4/FMR2familymember KPTAYVRPM(SEQID 4 NO:109) E3ubiquitin-protein RPTAAVTPI(SEQID ligaseSH3RF1 NO:110) ***Consensus sequence. X represents any amino acid residue. See also, Guharoy, et al. (2016) Nat. Commun. 7:10239.
[0049] In some embodiments, the degron is obtained from the amino acid sequence of Cdt1, and preferably has an amino acid sequence as set forth in SEQ ID NO:76. In another embodiment, the degron is obtained from the amino acid sequence of geminin, and preferably has an amino acid sequence as set forth in SEQ ID NO:77. In other embodiments, the degron is obtained from the amino acid sequence of ornithine decarboxylase, and preferably has an amino acid sequence as set forth in SEQ ID NO:78 or SEQ ID NO:79.
[0050] Although a degron of a protein of any organism may be fused to Cas protein in any cell type to confer degradation to the nuclease, the use of a degron of a protein endogenous to a host cell, or a degron of a protein of the most closely related species to the host cell, is preferred.
[0051] The degron may be added to the Cas protein on its C-terminus, N-terminus or on both termini by conventional recombinant protein production methods. In this respect, the fusion protein is a non-naturally occurring or engineered CRISPR enzyme associated with at least one degron sequence. The degron may be inserted as a single copy or as multiple copies. Moreover, a Cas fusion protein may include more than one type of degron. In certain embodiments, nucleic acids coding for the Cas fusion protein may be codon optimized for expression in a eukaryotic cell.
[0052] In some embodiments, the Cas9 fusion protein of this invention cleaves both strands of DNA to produce a double strand break (DSB). In certain embodiments, the Cas9 fusion protein is a nickase. In other embodiments, the Cas9 fusion protein is a dual nickase. In further embodiments, the Cas9 fusion protein is a deadCas9 (dCas9), e.g., a Cas9 having substantially no nuclease activity, e.g., no more than 5% nuclease activity as compared with a wild-type Cas9 or Cas9 not having had mutations thereto. Moreover, the Cas9 fusion protein may be associated with one or more functional domains (e.g., transcriptional repressors or activators). More specifically, the Cas9 fusion protein is a dCas9 and/or is associated with one or more functional domains (e.g., transcriptional regulators such as VPR or KRAB).
[0053] In some aspects, the Cas9 fusion protein has a Rec2 or HD2 truncation. In some embodiments, the degron may be associated with the Cas endonuclease via a connector protein, for example using a system such as a marker system such as the streptavidin-biotin system. As such, provided is a fusion of a Cas endonuclease with a connector protein specific for a high affinity ligand for that connector, whereas the degron is bound to said high affinity ligand. For example, streptavidin may be the connector fused to the Cas endonuclease, while biotin may be bound to the degron. Upon co-localization, the streptavidin will bind to the biotin, thus connecting the Cas endonuclease to the degron.
[0054] Preferably, the Cas endonuclease is fused or covalently attached to the degron. In some embodiments, the fusion may be to the N-terminal end of the Cas endonuclease. In some embodiments, at least one degron is fused to the N-terminus of the Cas endonuclease. In other embodiments, the fusion may be to the C-terminal end of the Cas endonuclease. In further embodiments, at least one degron is fused to the C-terminus of the Cas endonuclease. In some embodiments, one degron may be fused to the N-terminal end of the Cas endonuclease with another degron fused to the C-terminal of the Cas endonuclease. In some embodiments, the Cas endonuclease is associated with at least two degrons and wherein a first degron is fused to the N-terminus of the Cas endonuclease and a second degron is fused to the C-terminus of the Cas endonuclease, the first and second degrons being the same or different. In some embodiments, the fusion may be to the N-terminal end of the degron. In other embodiments, the fusion may be to the C-terminal end of the degron. In some embodiments, the fusion may between the C-terminal end of the Cas endonuclease and the N-terminal end of the degron. In other embodiments, the fusion may between the C-terminal end of the degron and N-terminal end of the Cas endonuclease.
[0055] In some embodiments, one or two degrons may be fused to the N-terminal end of the Cas endonuclease with one or two degrons fused to the C-terminal of the Cas endonuclease. In some embodiments, the at least two degrons are associated with the Cas endonuclease and the degrons are the same degron, i.e., the degrons are homologous. In some embodiments, the at least two degrons are associated with the Cas endonuclease and the degrons are different degrons, i.e., the degrons are heterologous. Having two or more degrons which are heterologous may be advantageous as it would provide a greater level of degradation control. A tandem fusion of more than one degron at the N- or C-terminus may enhance degradation. It is envisaged that high levels of degradation would occur in the absence of either stabilizing ligand, intermediate levels of degradation would occur in the absence of one stabilizing ligand and the presence of the other (or another) stabilizing ligand, while low levels of degradation would occur in the presence of both (or two of more) of the stabilizing ligands.
[0056] The fusion protein may include the Cas protein directly fused to the degron, or alternatively the Cas protein is fused with the degron via a linker. In some embodiments, the linker is a Gly-Ser linker. In other embodiments, the fusion protein further includes at least one Nuclear Export Signal (NES). In some embodiments, the fusion protein includes two or more NESs. In some embodiments, the fusion protein includes at least one Nuclear Localization Signal (NLS). This may be in addition to an NES. In some embodiments, the fusion protein comprises, consists of, or consists essentially 41 Cas protein, degron and a localization (nuclear import or export) signal as, or as part of, the linker between the Cas protein and the degron. HA or FLAG? tags may also be used as linkers. In certain aspects, the fusion protein includes an NLS and/or NES and/or Gly-Ser linker having the amino acid sequence GSGGSGS or (GGGGS).sub.3 (SEQ ID NO:66).
[0057] Expression of the fusion protein may be placed under the control of a constitutive promoter or regulatable promoter, e.g., a tissue-specific promoter, chemically-inducible promoter or a cell cycle-regulated promoter such as, e.g., a promoter of a cyclin B, E, A, or D gene controlled by Rb or E2F transcription factors. Placing expression of the fusion protein under control of a cell-cycle promoter will regulate the timing of the expression and subsequent activities of the fusion protein.
[0058] Under control of a regulatable promoter or controlled by a regulatable promoter means that the DNA sequences encoding product of interest will be downstream of the promoter element that controls the transcription of its RNA products. A regulatable promoter is any promoter whose activity is affected by a cis- or trans-acting factor. A regulatable promote of this invention can be regulated by cell cycle, i.e., through endogenous transcription factors such as E2F or Rb being recruited to the promoter DNA elements at specific points in a cell's cycle to either repress or turn on transcription of that gene by RNA polymerase II; tissue-specific induction; chemical induction, i.e., via contact with a toxin, growth factor, steroid, heavy metal, etc.; or environmental stimuli, via e.g., light or temperature.
[0059] The present invention also provides a polynucleotide encoding the Cas-degron fusion protein. In some embodiments, the encoded fusion protein is operably linked to a first regulatory element. In some embodiments, a degron is also encoded and is operably linked to a second regulatory element. Advantageously, the degron here is to mop up the stabilizing ligand and is advantageously the same degron (i.e., the same type of domain) as that associated with the fusion protein. As used herein, the term mop up is meant in the sense of performing so as to contribute or conclude activity. In some embodiments, the first regulatory element is a promoter and may optionally include an enhancer. In some embodiments, the second regulatory element is a promoter and may optionally include an enhancer. In some embodiments, the first regulatory element is an early promoter. In some embodiments, the second regulatory element is a late promoter. In some embodiments, the second regulatory element is, comprises, or consists essentially of an inducible control element, optionally the tet system, or a repressible control element, optionally the tetr system. An inducible promoter may be favorable, e.g., rTTA, to induce tet in the presence of doxycycline.
[0060] The present invention further provides a means for delivering the Cas-degron fusion protein of the invention or polynucleotides encoding said fusion protein. Such delivery means can include, e.g., particle (s) of the fusion protein, vector (s) harboring polynucleotide (s) encoding the fusion protein; and/or RNA of the CRISPR/Cas complex. Vectors can include a DNA plasmid, a bacterial artificial chromosome (BAC), a yeast artificial chromosome (YAC), a viral vector, or a nucleic acid complexed with a delivery vehicle such as a liposome or poloxamer. In some embodiments, the vector may be a plasmid or a viral vector such as AAV, or lentivirus. Transient transfection with plasmids, e.g., into HEK cells may be advantageous, especially given the size limitations of AAV. While SpCas9 fits into AAV, one may reach an upper limit with nucleic acid encoding one or more degrons.
[0061] Activatable sgRNA. As is known in the art, a single guide RNA (sgRNA or gRNA) refers to a chimeric RNA molecule which is composed of a CRISPR RNA (crRNA) and trans-encoded CRISPR RNA (tracrRNA). A conventional sgRNA (
[0062] In accordance with this invention, the distance from the 5 start to the DNA guiding element or spacer sequence can be 0 (i.e., the start is part of the guiding element) to 40 nt (nucleotides), preferably 0 to 20, or 0 to 10 nt or even 1 to 5 nt in length. The DNA guiding element or sequence can be 8 to 50 nt in length, preferably 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 40, 42, 44, 46, 48 nt in length or any range in between; preferred are 15-30 nt in length an even more preferred length is 17-19 nt, which minimizes off-target events (Wiles, et al. (2015) Mamm. Genome 26:501-510). The distance between the DNA guiding element or sequence and the Cas binding element or sequence may be 0 nt (directly adjacent) to 30 nt, preferably 0 nt to 20 nt or 2 to 10 nt in length.
[0063] The DNA guiding element or spacer sequence can be chosen freely to hybridize to a target nucleic acid molecule. sgRNA/CRISPR targeting and methods of selecting suitable DNA guiding sequences and modifications of the guide RNA are disclosed in, e.g., WO 2014/093709, WO 2014/144761, WO 2015/089486, WO 2015/048577, WO 2015/123339, WO 2015/089486, WO 2015/089427, and WO 2015/113063. The guiding element or spacer sequence typically shares 100% sequence identity with the target sequence, although at least 80%, 85%, 90%, and 95% sequence identity to the target sequence is also contemplated so long as the sgRNA provides the necessary specificity for the CRISPR/Cas system. As used herein, target nucleic acid, target nucleic acid molecule, target sequence or target DNA molecule refers to a genomic or mitochondrial DNA site to be edited by the CRISPR/Cas system. The sequence of the sgRNA allows for many variations as long as it is capable of binding Cas and having a complementary region that binds to the target nucleic acid.
[0064] In particular embodiments, the sgRNA has a DNA guiding element that is complementary or specifically hybridizes to the template or transcribed strand of the target nucleic acid molecule. The data presented herein indicate that mutagenesis frequencies can be increased by specifically targeting the sgRNA to the template strand of the target nucleic acid molecule. More particularly, during genome editing, the Cas nuclease is targeted to a genomic DNA sequence via the sgRNA. Upon Watson-crick base pairing of sgRNA to the target nucleic acid molecule, Cas introduces a double stranded break. The Cas:sgRNA-DSB (Cas: DSB) state is unusually stable and remains in complex unless a substantial force, such as a translocating RNA polymerase (RNAP) collides with it. Collisions of RNAP with the Cas-DSB disrupt the complex only if the sgRNA is annealed to the template strand for the RNAP. This mechanism for disrupting the Cas-DSB complex increases mutagenesis frequencies substantially and provides an explanation for the observation that the dissociation of Cas-DSB complex is the rate-limiting step of genome editing. Accordingly, selection of an sgRNA that targets the transcribed strand can be used to increase kinetics of genome editing, whereas selection of the non-template can be used to decrease kinetics of genome editing. Modulating the kinetics via template or non-template strand selection is of use in modulating the barcoding and/or bioprocessing technologies described herein.
[0065] To select the template strand for a single gene, the orientation of the gene within the genome is first determined. Specifically, it is assessed whether the strand utilized by RNA polymerase as the template is oriented on the plus or minus strand of the genome. Typically, a user can identify a template sgRNA by accessing the DNA sequence of a gene of interest from a public database. Notably, public databases generally orient genes so that the coding strand is in the 5.fwdarw.3 orientation. Prospective sgRNA for introducing a genetic knock-out may be chosen to hybridize to a sequence located downstream of the start codon (but within an exonpreferably exons 1, 2, or 3) by using an online sgRNA selection tool (e.g., CRISPOR) or finding a suitable protospacer-adjacent motif (PAM) site (e.g., 5-NGG-3, 5-NNNNGATT-3, 5-NNAGAAW-3 or 5-NAAAAC-3) on the template strand. Selection of a number of potential sgRNA should be performed for each experiment and each sgRNA should be checked for off-target activity. Furthermore, the user should confirm that the gene of interest is known to be expressed and if the gene exists in a state of closed chromatin (e.g., by looking at DNase hypersensitive site data). Closed chromatin can negatively impact mutation frequencies, and lack of transcription through the Cas target site will reduce the effect of strand selection.
[0066] The Cas binding element or sequence of an sgRNA preferably includes a stem loop or at least a double strand region. Preferably the stem loop is 6 to 50 nt in length, e.g., 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 30, 32, 34, 36, 38, 40, 45, 50 nt or more in length or any range in between these values. The stem loop may have 60% to 100% complementary nucleotides, including A-U (coded by T on the sense-strand of a dsDNA), G-C and G-U (coded by T) base pairs. Preferably the complementary nucleotides are 70% to 95% or 80% to 90% complementary. The sequence of the loop is not essential and may even protrude the Cas binding region, and leave only the stem region in the Cas binding pocket. Upon binding to the specific target nucleic acid via the sgRNA, Cas generates a break (e.g., double- or single-strand break) in the target nucleic acid at the PAM site.
[0067] The 3 portion of the sgRNA may be 20 to 600 nt in length. Usually this region can be designed relatively freely. If too long, it may even be digested by naturally occurring enzymes, which will automatically result in a suitable size for the CRISPR/Cas system. Possible lengths are 20 to 400 nt, 25 to 300 nt or 30 to 200 nt. In total, the sgRNA has preferably a size 60 to 2000 nt in length, preferably 70 to 1500 nt, or 80 to 1000 nt, 90 to 800 nt, 100 to 500 nt, 120 to 300 nt in length.
[0068] Structural analysis of Cas9 indicates that whereas the bulge and nexus regions of the cognate sgRNA are the most critical features for Cas9 targeting, hairpin 1, hairpin 2, and the upper and lower stem loop regions are relatively tolerant to sequence variations, including nucleotide substitutions, insertions and deletions and even predicted structural disruptions (Briner, et al. (2014) Mol. Cell 56 (2):333-339).
[0069] Accordingly, the present invention takes advantage of these non-essential regions of the sgRNA to insert inactivation sequences that allow for the production an sgRNA that is nonfunctional until activated. In this respect, in addition, or as an alternative to the Cas-degron fusion protein, this invention also provides an activatable sgRNA. As used herein, an activatable sgRNA refers to a modified sgRNA molecule that exists in a state where Cas cannot bind to the modified sgRNA and introduce DNA breaks. In certain embodiments, an activatable sgRNA is integrated or inserted into a genome of interest. During the inactive state, activatable sgRNA are transcribed, but the RNA molecule is non-functional for Cas binding/activity due to the presence of an inactivation sequence located in a non-essential region of the sgRNA. The inactivation sequence is located in regions within or outside of the sgRNA that can handle modification, but that are not dispensable for Cas function. In certain embodiments, a nonessential region refers to a hairpin (e.g., hairpin 1 or hairpin 2 of Cas9 sgRNA), an upper stem loop and/or a lower stem of the sgRNA. In particular embodiments a nonessential region of an sgRNA is a hairpin.
[0070] An inactivation sequence refers to a nucleic acid sequence that causes the sgRNA to be inactive via (i) steric hindrance of Cas binding through bulky structures that, e.g., disrupt sgRNA folding, intrinsic RNA structures or recruited protein binding; (ii) cis- or trans-ribozyme insertion; or (iii) cellular (endogenous or exogenous) RNase activity (e.g., RNase P/Z). An inactive, activatable sgRNA can be activated through targeting a Cas or specific nuclease to the DNA of each inactivation sequence. This targeting introduces a mutation that destroys a critical region of the inactivation sequence, and restores the ability for Cas to bind the newly modified and functional activatable sgRNA. In certain embodiments, the activatable sgRNA harbors an inactivation sequence in a non-essential region of the sgRNA, wherein said inactivation sequence includes one or more endonuclease recognition sites. The term endonuclease recognition site refers to a nucleic acid sequence or structural motif recognized by an endonuclease, which cleaves the nucleic acid at or near the structural motif. In certain embodiments, a pair of endonuclease recognition sites is used that are targeted by the same or different endonucleases. Ideally, the pair of endonuclease recognition sites are at the ends of (i.e., flank) the sequence inactivation to allow endonuclease-mediated removal of the inactivation sequence. In certain embodiments, the endonuclease recognition sites are recognized and cleaved by Cas9. Notably, insertion of an activatable sgRNA into the 5- or 3-UTR of an endogenous gene functions to regulate Cas9 activity by linking sgRNA expression (and hence availability for binding with Cas9) to expression of the gene in which the sgRNA is inserted. In this aspect, the activatable sgRNA is expressed in an off-state, an RNA-guided nuclease (e.g., Cas9) excises the activation sequence from the activatable sgRNA thereby converting the activatable sgRNA to the on-state where it can bind to its cognate Cas endonuclease.
[0071] In certain embodiments of this invention, the inactivation sequence is a cis-acting ribozyme. A cis-acting ribozyme is a catalytic RNA molecule that can act on a target RNA that is adjacent or proximal to its location. Ribozyme cleavage is site-specific and is mediated by hydrogen bonding between complementary bases at target regions. Cis-acting ribozymes are known in the art and include, e.g., Hammerhead, Hepatitis delta virus (HDV), hairpin, Varkud satellite (VS), Group I intron, and Group II intron ribozymes (Doudna & Cech (2002) Nature 418:222-228). In certain embodiments, the inactivation sequence is a cis-acting ribozyme encoding by a nucleic acid molecule of SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4.
[0072] In particular embodiments of this invention, the activatable sgRNA is encoded by a nucleic acid molecule as set forth in Table 2, wherein n{circumflex over ()}n represents a nucleotide sequence of an endonuclease recognition site, each of which may be recognized by the same or different endonuclease; and X represents an inactivation sequence. In certain embodiments, X represents a cis-acting ribozyme and n{circumflex over ()}n represents endonuclease recognitions sites for Cas9 endonuclease.
TABLE-US-00002 TABLE2 SEQID sgRNA Sequence NO: Cas9 gttttagagctagaaatagcaagttaaaataaggcta 14 gtccgttatcaacttn.sup.?nxn.sup.?naagtggcaccgagtc ggtgctttt Sth gttttagagctgggtn.sup.?nxn.sup.?acccagcgagttaaa 15 CRISPR3 ataaggcttagtccgtactcaacttgaaaaggtggca ccgattcggtgttttt Sth gttttagagctgggtacccagcgagttaaaataaggc 16 CRISPR3 ttagtccgtactcaacttgaan.sup.?nxn.sup.?aaggtggca ccgattcggtgttttt Sth gtttttgtactctggtn.sup.?nxn.sup.?accagaagctacaa 17 CRISPR1 agataaggcttcatgccgaaatcaacaccctgtcatt ttatggcaggtgtttt Sth gtttttgtactctggtaccagaagctacaaagataag 18 CRISPR1 gcttcatgccgaaatcaacaccctgtcattn.sup.?nxn.sup.? ttatggcaggtgtttt Cas12a tagatgttgtcatctttaan.sup.?nxn.sup.? 19 Cas12a tagatgttgtcatcn.sup.?nxn.sup.?tttaa 20 Sa gttttagtactctggaaacagaatctactaaaacaag 21 CRISPR gcaan.sup.?nxn.sup.?gacgaatgccgtgtttatctcgtcaa cttgttggcgagattttttt Sa Gttttagtactctggaaacagaatctactaaaacaag 22 CRISPR gcaagacgaatgccgtgtttatctcgtcaact n.sup.?nxn.sup.?tgttggcgagattttttt Sp, Steptococcus pyogenes; Sth, Streptococcus thermophilus; Sa, Staphylococcus aureus.
[0073] For use in the system and method of this invention, the sgRNA may be provided as an isolated polynucleotide (e.g., DNA molecule) encoding the sgRNA, which may optionally be included in a vector (e.g., a plasmid). In certain embodiments, it is preferable that the activatable sgRNA is integrated into the genome. The activatable sgRNA of this invention is useful in a variety of applications including, for example, lineage tracing wherein an array of activatable sgRNA target each other in a temporally controlled manner; sequential genetic knock-outs wherein mutations are introduced over time in a controlled manner; transcriptional programming using Cas9-VPR and 14 nt sgRNAs, Cas9 nucleases with altered PAM specificities, or orthogonal RNA-guided nucleases using an array of activatable sgRNA where some or all sgRNA have a secondary function to either bind to or activate another sgRNA that functions to direct a transcriptional activity of dCas9 (nuclease dead Cas9) or Cas9-14 nt sgRNA complex to a target gene; and/or biological circuits, i.e. if gene A is on turn off gene B. Accordingly, in certain embodiments of this invention, the system further provides an array of activatable sgRNAs, where the activatable cognate sgRNA targets at least one activatable sgRNA in the array of activatable sgRNAs. See, e.g.,
[0074] The CRISPR/Cas system of this invention may include the use of a conventional Cas protein in combination with an activatable cognate sgRNA; a Cas-degron fusion protein in combination with a conventional sgRNA, or both a Cas-degron fusion protein and an activatable sgRNA. One or both components of the CRISPR/Cas system may be provided in a kit for genome editing, which includes nucleic acids encoding one or both of the Cas-degron fusion protein and activatable sgRNA, e.g., in the form of plasmids, as well as instructions for using the CRISPR/Cas system for genome editing. The kit may optionally include, e.g., ligation components, storage buffers, reaction buffers, and transformation competent cells. The sgRNA of the system and kit can be tailored to specifically target a gene of interest by insertion of a suitable DNA guiding element. In certain embodiments, the sgRNA is targets the template or non-template strand, wherein template strand increases kinetics of activation and non-template reduces kinetics.
[0075] In addition to a CRISPR/Cas system, Cas-degron fusion protein, activatable sgRNA, and kit, this invention also provides a method of editing or modulating transcription of a genome of a cell (e.g., nuclear DNA or mitochondrial DNA) by introducing or delivering to the eukaryotic cell at least one Cas endonuclease and at least one cognate sgRNA that targets a nucleic acid sequence of the genome, wherein the Cas endonuclease is fused with one or more degron sequences and/or the cognate sgRNA harbors an inactivation sequence in a non-essential region of the cognate sgRNA. In certain embodiments, introduction of the at least one Cas endonuclease and at least one cognate sgRNA (e.g., activatable sgRNA) includes integration of the Cas endonuclease and/or cognate sgRNA into the genome of the cell that is being edited or transcriptionally regulated. Accordingly, the instant system, kit and method are of use in the manipulation of endogenous genes as well as heterologous genes. A cell is intended to include prokaryotic and eukaryotic cells such as fungal cells (such as yeast), plant cells, animal cells, mammalian cells and human cells. In certain embodiments, the cell is a eukaryotic cell. Depending on the Cas protein selected, genome editing and modulation of transcription can include insertions, deletions, methylations or alterations in transcription of the target nucleic acid (e.g., by dCas9 or dCas9 fusions with transcriptional repressors or activators). Alternations in transcription include suppression of transcription, activation or increase in transcription, which can be facilitated by selection of a suitable Cas9 protein, e.g., a fusion protein with repressors or activators or use of sequentially activated activatable sgRNA (see, e.g., Examples 8, 10 and 12). In certain embodiments, the Cas protein of the instant method is a Cas9 endonuclease. In other embodiments, the expression of the Cas endonuclease, cognate sgRNA or Cas endonuclease and cognate sgRNA are controlled by one or more regulatable promoters described herein, e.g. cell cycle, tissue-specific, chemically or environmentally regulatable promoters. In embodiments relating to the use of cell cycle regulatable promoters to modulate the expression of an sgRNA, it is preferable that the sgRNA is flanked by two cis-acting ribozymes to allow for proper synthesis of the sgRNA.
[0076] In some aspects of the method, the cognate sgRNA targets a transcribed strand of the nucleic acid sequence of the genome. In other embodiments, the cognate sgRNA is inserted or embedded in nucleic acids encoding a 5- or 3-untranslated region (UTR) of a heterologous or endogenous gene of interest. When introduced into a 5-UTR or 3-UTR, the inserted sgRNA preferably does not disrupt gene expression (i.e., transcription) or function of the protein encoded by the gene. Insertion of an activatable sgRNA into the UTR of a heterologous or endogenous gene provides for the expression of said gene as well as the presence of a functional or non-functional activatable sgRNA. In this respect, the instant invention links Cas9 activity to the expression of the gene the sgRNA is embedded within. In particular embodiments, the inactivation sequence of the cognate sgRNA is a cis-acting ribozyme, e.g., encoded by a nucleic acid molecule of SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4. In particular embodiments, the cognate sgRNA is encoded by a nucleic acid molecule of SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21 or SEQ ID NO:22.
[0077] In other aspects of the method, at least two cognate sgRNAs that target two or more sequences in the genome are introduced or deliver to the cell. In one embodiment, the at least two activatable sgRNA are sequentially activated to introduce two or more edits in the genome (see, e.g., Example 7). In another embodiment, a first activatable sgRNA of the at least two activatable sgRNA is targeted to the DNA encoding a second activatable sgRNA, so that upon activation the second sgRNA modulates transcription of a gene of interest, e.g., by binding to the promoter (see, e.g., Examples 8, 10 and 12).
[0078] The method of this invention can be used to edit or regulate transcription within the genome of a cell for a variety of reasons including, e.g., enhanced biotherapeutics production in eukaryotic cells, enhanced commodity chemical production in prokaryotic or eukaryotic cells, gene drives in organisms or cell cultures, in vivo or ex vivo gene therapy, ex vivo cell transfection for diagnostics or research, ex vivo cellular differentiation, and production of transgenic organisms. In a preferred embodiment, cells are isolated from the subject organism, transfected with an sgRNA and Cas protein or nucleic acids (gene or cDNA) encoding an sgRNA and Cas protein, and re-infused back into the subject organism (e.g., a patient). Various cell types suitable for ex vivo transfection are well known to those of skill in the art. In another embodiment, the isolated cells are subject to genomic integration (e.g., Cas9-mediated HDR or lentiviral transduction) of the described invention wherein the integrated DNA encodes a program to control cellular behavior either outside or once inside of the organism.
[0079] When used for the production of transgenic animals, the instant method can include the development of transgenic animals as disease models, as well as animals with desirable traits. Embryos may be treated using the methods and compositions of the invention to develop transgenic animals. In some embodiments, suitable embryos may include embryos from small mammals (e.g., rodents, rabbits, etc.), companion animals, livestock, and primates. Non-limiting examples of rodents may include mice, rats, hamsters, gerbils, and guinea pigs. Non-limiting examples of companion animals may include cats, dogs, rabbits, hedgehogs, and ferrets. Non-limiting examples of livestock may include horses, goats, sheep, swine, llamas, alpacas, and cattle. Non-limiting examples of primates may include capuchin monkeys, chimpanzees, lemurs, macaques, marmosets, tamarins, spider monkeys, squirrel monkeys, and vervet monkeys. In other embodiments, suitable embryos may include embryos from fish, reptiles, amphibians, or birds. Alternatively, suitable embryos may be insect embryos, for instance, a Drosophila embryo or a mosquito embryo.
[0080] Transgenic organisms contemplated by the methods and compositions of this invention also include transgenic plants and seeds. Examples of suitable transgenes for introduction include exogenous nucleic acid molecules encoding one or more functional polypeptides or RNA, with or without one or more promoters, which impart desirable traits to the organism. Such traits in plants include, but are not limited to, herbicide resistance or tolerance; insect resistance or tolerance; disease resistance or tolerance (viral, bacterial, fungal, nematode); stress tolerance and/or resistance, as exemplified by resistance or tolerance to drought, heat, chilling, freezing, excessive moisture, salt stress; oxidative stress; increased yields; food content and makeup; physical appearance; male sterility; standability; starch, oil, or protein quantity and/or quality; amino acid composition; and the like. Of course, any two or more exogenous nucleic acids of any description, such as those conferring herbicide, insect, disease or drought resistance, male sterility, prolificacy, starch properties, oil quantity and quality, or those increasing yield or nutritional quality may be employed as desired.
[0081] The following non-limiting examples are provided to further illustrate the present invention.
Example 1: Cas9 Fusion Proteins
Materials and Methods
[0082] Recombinant Cas9 Purification. Cas9 (pMJ806, Addgene) was expressed and purified by a combination of affinity, ion exchange and size exclusion chromatographic steps according to conventional methods (Anders & Jinek (2014) Methods Enzymol. 546: 1-20).
[0083] sgRNA Plasmids and RNA Generation. All sgRNAs were cloned into pSPgRNA (Addgene). RNA was generated via PCR-mediated fusion of the T7 RNA polymerase (RNAP) promoter to the 5 end of the sgRNA sequence. The column-purified PCR products were used as transcription templates in reactions containing 5.0 ?g/ml purified recombinant T7 RNAP and 1? transcription buffer: 40 mM Tris (pH8.0), 2 mM spermidine, 10 mM MgCl.sub.2, 5 mM DTT, and 2.5 mM rNTPs. Reactions were treated with DNase I and purified using the RNA Clean & Concentrator? Kit (Zymo Research).
[0084] Generation of Cas9 Variant Constructs and Ctnnb1:EGFP Donor DNA. Nucleotide sequences encoding Cdt1 and Geminin were ordered as gBlock gene fragments (IDT), which were fused to 3-end of the nucleotide sequences encoding Cas9 (Addgene) using GIBSON ASSEMBLY? (NEB). Nucleic acids encoding the resulting Cas9-Cdt1 and Cas9-Gem fusion proteins are set forth herein in SEQ ID NO:67 and SEQ ID NO:68, respectively. Nucleic acids encoding the Cas9-Cdt1 and Cas9-Gem fusion proteins were respectively inserted downstream of the mouse cyclin B and mouse cyclin E promoters (see SEQ ID NO:69 and SEQ ID NO:70, respectively). The amino acid sequences of the Cas9-Cdt1 and Cas9-Gem fusion proteins are set forth in SEQ ID NO:71 and SEQ ID NO:72, respectively. The Ctnnb1:EGFP donor DNA was generated through PCR amplification of the Ctnnb1:EGFP locus (Shy, et al. (2016) Nucl. Acids Res. 44 (16): 7997-8010) to include 500 bp homology arms. The PCR product was TA cloned and the sequence was verified.
[0085] Cell Culture. Mouse embryonic stem (ES) cells: for normal passage of wild-type, Rex1:EGFPd2, or Rosa26:TetOn-Otx2-mCherry ES cells, single-cell suspensions of 1-2?10.sup.6 C57BL/6 mouse ES cells were plated onto 10-cm dishes previously coated with 0.1% gelatin (Millipore). Cells were grown in KnockOut? Dulbecco's Modified Eagle Medium (DMEM; GIBCO) supplemented with the following: 15% KnockOut? Serum Replacement (GIBCO), 2 mM L-Glutamine (GIBCO), 1000 U/ml Pen Strep (GIBCO), 1 mM HEPES (Thermo Scientific), 1?MEM Non-Essential Amino Acids (GIBCO), 55 PM 2-mercaptoethanol (GIBCO), 100 U/ml LIF (Millipore), and 3 ?M CHIR99021 (Glycogen synthase kinase 3 inhibitor, Sigma). Cells were split 1:10 with 0.25% trypsin-EDTA (GIBCO) every 2-3 days. HEK293 and Neuro2a:HEK293 cells are known in the art. All cells were maintained in DMEM supplemented with 10% fetal bovine serum Sigma) (FBS; and 100 ?g/mL Penicillin-Streptomycin. Cell line identity of HEK293 was verified by deep sequencing.
[0086] Transfection and Selection Conditions. For ES cells, 1?10.sup.5 cells were transfected shortly after being plating in 12-well dishes for about 18 hours. For each well, 5 ?l of Lipofectamine? 2000 and relevant DNAs were incubated in 250 ?l OPTI-MEM? (GIBCO). Where appropriate, transfections included 250 ng pPGKpuro (Addgene) to allow for elimination of non-transfected cells. In addition, cells were transfected with 250 ng pX330 Cas9 (wild-type or variant) expression plasmid and 250 ng corresponding pSPgRNA plasmid. For the Ctnnb1:EGFP assay, an additional 400 ng of Ctnnb1:EGFP plasmid was added and after 48 hours cells were split into 2 ?g/ml puromycin and selection was applied for 48 hours.
[0087] For Neuro2a cells, 0.5?10.sup.5 cells were plated the night before transfection in 6-well dishes. For each well, 6 ?l of Lipofectamine? 2000 and relevant DNAs were incubated in 500 ?l OPTI-MEM? (GIBCO) before adding to wells. The Ctnnb1:EGFP assay contained 400 ng Cas9 expression plasmid, 400 ng corresponding pSPgRNA plasmid, 400 ng pPGKpuro to allow for elimination of non-transfected cells, and 800 ng Ctnnb1:EGFP plasmid. After 48 hours, cells were split into 4 ?g/ml puromycin and selection was applied for 96 hours.
[0088] For HEK293 cells, 0.5?10.sup.5 cells were plated the night before transfection in 6-well dishes. For each well, 6 ?l of Lipofectamine? 2000 and relevant DNAs were incubated in 500 ?l OPTI-MEM? (GIBCO) before adding to wells. All transfections contained 1 ?g Cas9 expression plasmid, and 1 ?g corresponding pSPgRNA plasmid. For deep sequencing noise controls, cells were transfected with an empty pSPgRNA plasmid.
[0089] T7 Endonuclease I Assays. Editing was monitored by T7 Endonuclease I (T7E1) or restriction enzyme digestion. Briefly, edited mouse embryonic stem cells (mESCs) were harvested 36 hours after transfection and genomic DNA was extracted using Bradley lysis buffer with proteinase K, followed by EtOH/NaCl-mediated precipitation and subsequent EtOH washes. Genomic DNA (50 ng) was used as a template in a PCR reaction using PHUSION? high GC buffer (NEB) and standard PCR conditions (98? C. for 30 seconds, 30 cycles of 98? C. for 5 seconds, 64? C. for 10 seconds and 72? C. for 15 seconds, and one cycle of 72? C. for 5 minutes). Aliquots (200 ng) of purified PCR DNA were subjected to T7EI and resolved on a 1.5% agarose gel. Gel images were quantified using ImageJ.
[0090] Flow Cytometry. Single-cell suspensions were prepared by trypsinization and re-suspension in 2% FBS/PBS/2 mM EDTA. Cells were analyzed on a LSRFortessa? flow cytometer. Data analysis was performed using FlowJo v9.3.2. Live cells were gated by forward scatter and side scatter area, singlets were gated by side scatter area and side scatter width. At least 5?10.sup.5 singlet, live cells were counted for each sample (higher counts for more infrequent events). Green fluorescence events were quantified by gating the appropriate channel using fluorescence negative cells as control. Cells used in the Ctnnb1:EGFP assay were subject to flow cytometry one week after transfection. Cells used in the Rex1:EGFPd2 disruption assay were subject to flow cytometry 40 hours after transfection.
[0091] Western Blotting and Immunofluorescence. For western blot analysis, Neuro2a, HEK293, and mESC were transfected with Cas9 plasmids in equimolar concentrations respectively, and lysates were generated 48 hours after transfection. FLAG?-tagged Cas9 was detected using an ?FLAG? antibody (Sigma).
[0092] For immunofluorescence, Neuro2a cells were co-transfected with respective Cas9 and mCherry expression plasmids onto 18-mm glass discs. Forty-eight hours after transfection, cells were fixed and permeabilized with 4% paraformaldehyde at room temperature for 10 minutes. Cells were then blocked with 0.3% TRITON? X-100, 2% FBS, and 1% bovine serum albumin (BSA) for 45 minutes at room temperature. Cas9 was probed with a 1:3000 dilution of ?FLAG? antibody, endogenous Cdt1 was probed with a 1:1000 dilution of ?Cdt1 antibody (Abcam), and endogenous Geminin was probed with a 1:500 dilution of ?Geminin antibody (Proteintech). All antibodies were dilution in blocking buffer and incubated overnight at 4? C. Cells were then probed with ?Mouse-FITC-conjugated secondary antibody for Cas9 detection, and Cdt1/Gem was probed with aRabbit-cy5 conjugate for 45 minutes at room temperature. Cells were then washed 3?, with the second wash containing 300 nM DAPI. Cells were then mounted and imaged on a Zeiss LSM 710 confocal microscope.
Expression and Analysis of Cas9-Degron Fusion Proteins
[0093] Degron-tagged, destabilized Cas9 variants have been suggested (Gutschner, et al. (2016) Cell Rep. 14:1555-1566; Maji, et al. (2017) Nat. Chem. Biol. 13:9-11; Howden, et al. (2016) Stem Cell Rep. 7:508-517). However, these tagged Cas9 variants have been tested for use in inactivating Cas9 rather than stimulating genome editing. To assess whether destabilizing the Cas9 protein could reduce the rate-limiting dissociation step for genome editing, degrons from Cdt1 (target of SCF.sup.Skp2) and Geminin (target of APC.sup.Cdh1) were used as cell cycle sensors (Tada (2007) Front. Biosci. 12:1629-41). In addition to being sensors, Cdt1 and Geminin are active in the nucleus thereby enabling active Cas9 to enter the nucleus before being degraded. Indeed, expression of the Cas9Cdt1 and Cas9Gem fusion proteins demonstrated that Cas9 fusion protein levels fluctuated throughout the different phases of the cell cycle when examined through immunofluorescence. Furthermore, western blot analysis revealed that protein levels were different amongst the variants as a result of destabilization and/or cell cycle regulated promoter.
[0094] To assess genome editing, mouse embryonic stem (ES) cells were initially used because of their rapid oscillations through the cell cycle with minimal effects based on cell-cycle phase specificity (Ballabeni, et al, (2011) Proc. Natl. Acad. Sci. USA 108:19252-7). Destabilized Cas9 fusion proteins were expressed at lower levels than untagged Cas9. However, destabilized Cas9 fusion proteins more effectively generated indel mutations when targeted to EGFP in Rex1:EGFPd2 of ES cells. Destabilizing Cas9 also increased mutagenesis using the non-template sgRNA (sgm3) targeting mCherry, supporting a conclusion that Cas9 destabilization overcomes the rate-limiting dissociation step for genome editing.
[0095] To test whether cell cycle regulation and destabilization of Cas9 during S/G2 phases of the cell cycle could increase HDR-mediated editing, constitutively expressed (promoter: Cbh) Cas9Gem, Cas9Cdt1 and cell cycle promoter (Cycline E or B) controlled Cas9Gem, Cas9Cdt1 and WT-Cas9 were compared to constitutively expressed WT-Cas9 for generating on-target insertion of EGFP into the Ctnnb1 gene (Shy, et al. (2016) Nucl. Acids Res. 44 (16): 7997-8010) as well as on target mutations (indels). mESC were transfected with the respective Cas9 construct (
[0096] Increasing the frequency Cas9 DSB could potentially result in increased off-target mutations. To test this possibility, sgRNA with off-target activities were used. This analysis used sgRNA targeted to sites in the endogenous EMX1 and ZSCAN2 genes, which have been previously characterized by GUIDE-seq (Kleinstiver, et al. (2016) Nature 529 (7487): 490-5). On-target and off-target mutations were measured in HEK293 cells by deep sequencing PCR amplicons from genomic DNA of transfected cells. Both destabilized Cas9 fusion proteins displayed reduced off-target mutations for the EMX1 sgRNA (
[0097] Together, the findings herein demonstrate the importance of the genome in the process of genome editing and show how activity at target sites can affect the rate limiting step in genome editing procedures. Sites where Cas9 is not dislodged from the DSB are mutated less frequently in these experiments, and can be predicted by RNA Pol II translocation through a site. When targets sites reside within genes that are expressed in the cell used for genome editing or necessitate an sgRNA that targets the non-template strand, destabilization of Cas9 can increase efficiency of genome editing. For experiments requiring rapid genome editing outcomes, use of destabilized Cas9 variants can decrease the time needed for iterations of break-and-repair cycles, increasing mutagenesis at target sites. Combining the cell cycle-specific destabilization with cell cycle specific expression offers the potential to target genome editing to specific points in the cell cycle.
[0098] Exemplary ubiquitin-dependent destabilized Cas9 fusion proteins include, but are not limited to, Cas9-Cdt1 (SEQ ID NO:71) and Cas9-Gem (SEQ ID NO:72) fusion proteins. It is also contemplated that ubiquitin-independent degrons can also be used including, e.g., the PEST sequence from mouse ornithine decarboxylase (MODC), which is known to reduce the half-life of GFP by introduction of these additional proteolytic signals. Cas9-PEST fusion proteins are set forth herein in SEQ ID NO:73, SEQ ID NO:74 and SEQ ID NO:75.
Example 2: Ribozyme-Mediated Inactivation of CRISPR sgRNAs
[0099] The sgRNA of Streptococcus pyogenes Cas9 (
[0100] The ability for these ribozyme-sgRNA variants to facilitate Cas9-mediated mutations in live cells was subsequently tested by targeting the variants to GFP in mouse 67N cells. All three variants were targeted to six distinct sequences within GFP, and none mediated significant disruption of the gene, as measured by flow cytometry detection of GFP fluorescence (
[0101] It was subsequently determined whether Cas9 recognition sites flanking or internal to the ribozyme sequence could convert an activatable sgRNA into a function sgRNA through mutagenesis of the ribozyme (
[0102] In light of these results, sequences encoding cis-acting ribozymes can be inserted anywhere within the sgRNA as long as the ribozyme functions to cleave the sgRNA immediately upon proper folding into its secondary structure during transcription (within seconds in the presence of Mg.sup.2+). More specifically, nucleotides sequences encoding cis-acting ribozymes can be cloned into nonessential regions (e.g., stem loops and hairpins) of sgRNA molecules thereby serving as a means to activate the sgRNA molecules upon transcription of the same. Activatable sgRNA can be RNAs that bind any RNA-guided nuclease from, e.g., S. pyogenes, S. thermophilus, Staphylococcus aureus, Francisella novicida, Neisseria meningitidis, or Brevibacillus laterosporus, Lachnospiraceae bacterium, or Acidaminococcus sp. Like cis-acting ribozyme, it is posited that trans-acting ribozymes can be heterologously expressed and designed to target any region of the sgRNA to mediate cleavage of the sgRNA.
[0103] Examples of nucleic acid molecules encoding sgRNA variants including ribozymes inserted into nonessential regions are presented in Table 3.
TABLE-US-00003 TABLE3 SEQID sgRNA VariantSequence(5->3) NO: SpCas9 gttttagagctagaaatagcaagttaaaataaggctag 5 tccgttatcaacttcgggcgcctcagatacggtcgcct gtcaccggatgtgctttccggtctgatgagtccgtgag gacgaaacaggcgattttttaacttcgggcgcctcaga tacgggcccgaagtggcaccgagtcggtgctttt SpCas9 gttttagagctagaaatagcaagttaaaataaggctag 6 tccgttatcaacttcgggcgcctcagatacggggtgcc taacactgccaatgccggtcccaagcccggataaaagt ggagggggcattttttaacttcgggcgcctcagatacg ggcccgaagtggcaccgagtcggtgctttt SpCas9 gttttagagctagaaatagcaagttaaaataaggctag 7 tccgttatcaacttcgggcgcctcagatacggggggtg cttcggatgctgatgagtccgtgaggacgaaacagggc aacctgtccatccggtatcccttttttaacttcgggcg cctcagatacgggcccgaagtggcaccgagtcggtgct tt Sth gttttagagctgggtcgggcgcctcagatacggggggt 8 CRISPR3 gcttcggatgctgatgagtccgtgaggacgaaacaggg caacctgtccatccggtatcccaacttcgggcgcctca gatacgggcccgacccagcgagttaaaataaggcttag tccgtactcaacttgaaaaggtggcaccgattcggtgt tttt Sth gttttagagctgggtacccagcgagttaaaataaggct 9 CRISPR3 tagtccgtactcaacttgaacgggcgcctcagatacgg ggggtgcttcggatgctgatgagtccgtgaggacgaaa cagggcaacctgtccatccggtatcccaacttcgggcg cctcagatacgggcccgaaggtggcaccgattcggtgt tttt Sth gtttttgtactctggtcgggcgcctcagatacgggggg 10 CRISPR1 tgcttcggatgctgatgagtccgtgaggacgaaacagg gcaacctgtccatccggtatcccaacttcgggcgcctc agatacgggcccgaccagaagctacaaagataaggctt catgccgaaatcaacaccctgtcattttatggcaggtg tttt Sth gtttttgtactctggtaccagaagctacaaagataagg 11 CRISPR1 cttcatgccgaaatcaacaccctgtcattcgggcgcct cagatacggggggtgcttcggatgctgatgagtccgtg aggacgaaacagggcaacctgtccatccggtatcccaa cttcgggcgcctcagatacgggcccgttatggcaggtg tttt Sa gttttagtactctggaaacagaatctactaaaacaagg 12 CRISPR caacgggcgcctcagatacggtcgcctgtcaccggatg tgctttccggtctgatgagtccgtgaggacgaaacagg cgaaacttcgggcgcctcagatacgggcccgaagtggc accgagtcggtgcttttgacgaatgccgtgtttatctc gtcaacttgttggcgagattttttt Sa gttttagtactctggaaacagaatctactaaaacaagg 13 CRISPR caagacgaatgccgtgtttatctcgtcaactcgggcgc ctcagatacggtcgcctgtcaccggatgtgctttccgg tctgatgagtccgtgaggacgaaacaggcgaaacttcg ggcgcctcagatacgggcccgaagtggcaccgagtcgg tgctttttgttggcgagattttttt Sp, Streptococcus pyogenes; Sth, Streptococcus thermophilus; Sa, Staphylococcus aureus.
[0104] Similar to ribozyme sequences, other types of inactivation target sites can be introduced into the sgRNA sequence to inactive the sgRNA. For example, steric hinderance strategies such as the addition of nucleotide sequences that cause secondary RNA structures within the sgRNA RNA molecule that inhibit Cas9 binding can be placed anywhere or outside of within the sgRNA. Furthermore, sequences that recruit RNA binding proteins which block Cas9 binding, recruit RNases, or bind endogenous/exogenous ligands/chemicals can also be placed anywhere within or outside of the sgRNA. Moreover, extrinsic RNase recruitment sequences that target RNase activity to the sgRNA can be placed anywhere within or outside of the sgRNA. Specifically, tRNA molecules can be placed within the sgRNA so that RNase P/Z acts upon the sgRNA to degrade it and render it nonfunctional for Cas9.
[0105] Cell lines containing one or more activatable sgRNA can be created through lentiviral transduction, or targeted homology directed repair to a safe harbor locus in mouse (Rosa26) or human cells (AAVS1). Mouse models are made through zygote injection of respective reagents or injection of mouse embryonic stem cells into blastocysts.
Example 3: Activatable sgRNA Array
[0106] A series of activatable sgRNA are generated to contain one or more sgRNA that function to target and activate each other (
[0107] General Barcoding of Cells with Activatable sgRNA. Barcoding uses an activatable sgRNA array in a manner that gives each activatable sgRNA at least two target sites. Target site 1 is the subsequent and inactivate sgRNA in the activatable sgRNA array, target 2 (and beyond) is the same exact target sequence but at a distinct site in the genome (
[0108] Cell Cycle-Controlled Barcoding of Cells. Activatable sgRNA constructs from one or more species can function in a multi-regulatory cassette driven by Cas9 (or any RNA-guided nuclease), wherein the nuclease activities are regulated by the cell cycle (e.g., destabilized Cas9 controlled by cell cycle promoter element). For example, two arrays of activatable sgRNAs from two different species (e.g., S. pyogenes and S. thermophilus) can be encoded in the genome of cells that also harbor two distinct cell cycle-regulated nucleases. These nucleases can exist in opposite phases of the cell cycle so that their nuclease activities do not overlap. Each nuclease can only use an sgRNA from its species that has been activated, and each activated sgRNA will be targeted to an sgRNA of the other species. Using a similar strategy, two Cas9 nucleases regulated by the cell cycle can activate activatable sgRNA, in a single array (
[0109] Alternatively, each activatable sgRNA within an array can be targeted to the non-template strand of another inactive sgRNA in the array (
[0110] Transcriptional Programming with Activatable sgRNA. Similar to dual functionality for the purpose of acting on the array while simultaneously barcoding, activatable sgRNA can serve to bind to and/or activate another sgRNA that functions to regulate transcriptional activity with a dCas9 activator/repressor (
Example 4: Strand Bias of Cas9 Endonucleases
Materials and Methods
[0111] Recombinant Cas9 Purification. Cas9 (pMJ806) was expressed and purified by a combination of affinity, ion exchange and size exclusion chromatographic steps by conventional methods (Anders, et al. (2015) Meth. Enzymol. 558: 515-537).
[0112] sgRNA Synthesis for In Vitro Cas9-RNP. All sgRNAs were cloned into pSPgRNA (Addgene) following a protocol optimized for pX330 base plasmids (Cong, et al. (2013) Science 339: 819-823). Templates for in vitro transcription were generated via PCR-mediated fusion of the T7 RNAP promoter to the 5 end of the sgRNA sequence using the appropriate pSPgRNA as the reaction template DNA. PCR reactions were performed using PHUSION? high GC buffer (NEB) and standard PCR conditions (98? C. for 30 seconds, 30 cycles of 98? C. for 5 seconds, 64? C. for 10 seconds and 72? C. for 15 seconds, and one cycle of 72? C. for 5 minutes). PCR products were then column-purified (Qiagen) and eluted in TE (10 mM Tris-HCl pH 8.0, 1 mM EDTA). DNA concentrations were determined using a Nanodrop? 2000 (ThermoFisher Scientific), and then were diluted to 200 nM when used as templates for in vitro transcription reactions. The transcription reactions contained 5.0 ?g/ml purified recombinant T7 RNAP and 1? transcription buffer (40 mM Tris-HCl pH 8.0, 2 mM spermidine, 10 mM MgCl.sub.2, 5 mM DTT, 2.5 mM rNTPs). Following incubation at 37? C. for 1 hour, reactions were treated with RNase-free DNase I (Thermo Fisher Scientific) and column-purified using the RNA Clean & Concentrator? Kit (Zymo Research) following the manufacturer's protocol. The purified RNA products were eluted from the column in 15 ?l of water.
[0113] DNA templates for In Vitro Cas9 Nuclease Reactions. Linear target DNAs for hybrid digestion and transcription assays included mouse Lef1, mCherry, and GFP target DNAs, which were generated by PCR amplification using 50 ng genomic DNA from mESC Rosa26:TetON-Otx2-mCherry cells in a reaction using PHUSION? high GC buffer (NEB) and standard PCR conditions (98? C. for 30 seconds, 30 cycles of 98? C. for 5 seconds, 64? C. for 10 seconds and 72? C. for 15 seconds, and one cycle of 72? C. for 5 minutes). ?NM1 genomic DNA was amplified with the same parameters, except using PHUSION? HF buffer. All PCR products were column-purified (Qiagen), eluted in TE, and concentrations were determined with a Nanodrop? 2000 (ThermoFisher Scientific). Different segments of the mouse Lef1 gene were used in experiments testing the effects of T7 RNAP on titration of Cas9, titration of template DNA, kinetics of DSB generation, distance between the TSS and Cas9 cleavage site, template strand collisions and non-template strand collisions.
[0114] For reactions that required circular dsDNA templates (experiments testing accessibility of endonuclease or ligase enzymes), plasmid target DNAs were prepared using TOPO? TA cloning. PCR products of the previously described Lef1:PGK-neo and Ctnnb1:EGFP DNA sequences (Shy, et al. (2016) Nucl. Acids. Res. 44:7997-8010) were cloned into the pCR4-TOPO? Vector (ThermoFisher Scientific).
[0115] In Vitro Cas9 DSB Formation Assays. The basic Cas9 DSB formation assay was prepared in 1? Cas9 digestion buffer (40 mM Tris, pH 8.0, 10 mM MgCl.sub.2, 5 mM DTT) with a final concentration of 100 nM Cas9. Prior to addition of DNA templates, sgRNA was added in molar excess, and incubated at room temperature for 10 minutes to ensure formation of the Cas9-RNP. Target DNA was added to a final concentration of 200 nM and a final reaction volume of 50 ?l. Reactions were incubated at 37? C. for 25 minutes, then either heat-inactivated at 75? C. for 10 minutes or treated with Proteinase K at 37? C. for 15 minutes. DNA fragments from a portion of each reaction (approximately 15 ?l) were separated by electrophoresis on a 1.5% agarose gel, and visualized with ethidium bromide staining. Percent cleavage values were determined by measuring densitometry of individual DNA bands in ImageJ, then dividing the total cleaved DNA by total DNA.
[0116] For reactions involving T7 RNAP transcription, basic Cas9 digestion conditions were applied, except 1? transcription buffer was used, unless otherwise stated. Upon addition of the target DNA, T7 RNAP was added to a final concentration of 5.0 ?g/ml. Reactions were placed at 37? C. for 25 minutes, unless otherwise stated, and then heat-inactivated at 75? C. for 10 minutes. DNase-free RNase A (NEB) was added to all reactions and incubated at 37? C. for 30 minutes before separating DNA fragments on a 1.5% agarose gel.
[0117] T7 and T5 exonuclease assays were performed in 1? Cas9 digestion buffer, unless otherwise stated. T7 exonuclease assays was performed with the Lef1:PGK-Neo plasmid and digested using sgLef1. T5 exonuclease assays were performed with Ctnnb1:EGFP plasmid and digested using sgG2. T5 exonuclease assays containing T7 RNAP were performed in 1? transcription buffer. All reactions contained 100 nM Cas9:RNP, 200 nM target DNA, and 10 U of the appropriate exonuclease. Reactions were subject to Proteinase K treatment before loading onto a 1% agarose gel.
[0118] T4 DNA ligase and Cas9 digestion assays were performed in T4 DNA Ligase buffer containing ATP. Cas9-containing reactions were performed with 200 nM Cas9:RNP (sgLef1) and 100 nM Lef1:PGK-Neo plasmid. Cas9-containing reactions were allowed to incubate for 30 minutes at 37? C., then the temperature was lowered to 16? C. and 40 U of T4 DNA ligase was added. Reactions were carried out for 30 minutes and subsequently transformed into competent DH5a in 3 serial dilutions. Ampicillin-resistant colony forming units were determined following an overnight incubation at 37? C.
[0119] Cas9 hybrid digestion and transcription reactions were performed using sgm2 and by titrating an mCherry target DNA. Cleavage frequencies were measure using ImageJ. Rate (v) was calculated and plotted against substrate concentration to generate Michaelis-Menten constants.
[0120] Ku70/80 Competition Assay. Recombinant human Ku70/80 was purified by conventional methods (Hanakahi (2007) Protein Expr. Purif. 52:139-145). A biotinylated primer (5-GCCTCACACGGAATCT-3; SEQ ID NO:23) and a FITC-conjugated primer (5-GAGAGCCCTCTCCCAATCTTC-3; SEQ ID NO:24) (Integrated DNA Technologies) were used to amplify a 650 bp Lef1 target DNA, PCR products were column-purified (Qiagen), and eluted in TE. MyOne? Dynabeads? (ThermoFisher) were prepared as described by the manufacturer to immobilize 750 ng of target DNA to about 4 ?l of beads. Cas9 and sgRNA were pre-incubated in 1? Cas9 digestion buffer (40 mM Tris, pH 8.0, 10 mM MgCl.sub.2, 5 mM DTT) for 30 minutes at room temperature, added to the immobilized DNA in a 5:1 molar ratio, and incubated for 25 minutes at 37? C. Control reactions without Cas9, but containing DNase, PmeI, and/or Ku70/80 were prepared simultaneously and incubated for 25 minutes at 37? C. Reactions containing Cas9 were then subjected to Proteinase K treatment or addition of excess Ku70/80, and incubated for 15 minutes at 37? C. Bead-bound DNA fragments were then collected by placing reaction tubes on a magnet, and 10 ?l of the soluble fraction was transferred to a 384-well plate in technical triplicates. FITC fluorescence levels were measured using a Tecan Infinite? Pro200. Calculations were made after subtracting the background fluorescence levels of reactions lacking FITC-labeled DNA. Three independently set up reactions were performed for each reaction condition.
[0121] Cell Culture. Mouse embryonic stem (ES) cells harboring the Rex1:EGFPd2 insertion (Kalkan & Smith (2014) Philos. Trans. R. Soc. Lond. B Biol. Sci. 369 (1657)), or a Rosa26:TetOn-Otx2-mCherry insertion (Yang, et al. (2014) Cell Rep. 7:1968-1981) were maintained in 10-cm dishes previously coated with 0.1% gelatin (Millipore) in KnockOut? DMEM (GIBCO) media supplemented with 15% KnockOut? Serum Replacement (GIBCO), 2 mM L-Glutamine (GIBCO), 1000 U/ml Pen Strep (GIBCO), 1 mM HEPES (Thermo Scientific), 1?MEM Nonessential Amino Acids (GIBCO), 55 ?M 2-mercaptoethanol (GIBCO), 100 U/ml LIF (Millipore), and 3 ?M CHIR99021 (Sigma). Cell cultures were routinely split 1:10 with 0.25% trypsin-EDTA (GIBCO) every 2-3 days.
[0122] Transfection and Selection Conditions. Within 2 hours of transfections, 0.25?10.sup.5 ES cells were freshly plated in each well of 24-well dishes. For each well, 2.5 ?l of Lipofectamine? 2000 and relevant DNAs were incubated in 125 ?l OPTI-MEM? (GIBCO) before adding to wells. For the Cas9 mutagenesis of 40 distinct genes in ES cells, transfections included 150 ng pPGKpuro (Addgene), 150 ng pX330 (lacking sgRNA insert), and 150 ng of the relevant pSPgRNA plasmid. To assess background mutation rate due to possible deep sequencing or amplification errors, a transfection containing pSPgRNA with empty sgRNA site was assessed alongside the other sgRNA-containing transfections. Two days after transfection, cells were split into 2 ?g/ml puromycin and selection was applied for 48 hours before isolating genomic DNA by overnight lysis with Bradley Lysis buffer (10 mM Tris-HCl, 10 mM EDTA, 0.5% SDS, 10 mM NaCl) containing 1 mg/ml Proteinase K, followed by EtOH/NaCl precipitation, 2 EtOH washes, and elution in 50 ?l of TE. For mCherry targeting, transfections contained the same DNA, except pSPgRNA targeted the mCherry genomic insertion, genomic DNA was isolated 48 hours after transfection in 50 ?l of QuickExtract? solution (Epicentre) for T7 Endonuclease 1 assays. Table 4 provides a listing of the sgRNA sequences, approximate distances from the predicted transcription start site (TSS) of the tetracycline response element (TRE) and computationally predicted on-target scores of sgRNA (Doench, et al. (2015) Nat. Biotech. 34(2):184-191).
TABLE-US-00004 TABLE4 sgRNA SEQID Distance Name Sequence NO: Strand fromTSS Score sgm1 GGAGCCGTACATGAACTGAG 25 Template 365 74 sgm2 GGCACCAACTTCCCCTCCGA 26 Template 567 58 sgm3 GTAATGCAGAAGAAGACCAT 27 Non- 594 68 Template sgm4 GCCGAGGGCCGCCACTCCAC 28 Template 840 67 sgm5 CCATGCCGCCGGTGGAGTGG 29 Template 837 56 sgm6 CTACAACGTCAACATCAAGT 30 Template 767 71 sgm7 CAACTTGATGTTGACGTTGT 31 Non- 755 44 Template sgm8 TGAAGGGCGAGATCAAGCAG 32 Template 661 68 sgm9 TCTGCTTGATCTCGCCCTTC 33 Non- 648 19 Template sgm10 GACCCAGGACTCCTCCCTGC 34 Template 512 51 sgm11 GAACTCGCCGTCCTGCAGGG 35 Non- 512 66 Template sgm12 CTTGAAGCTGTCCTTCCCCG 36 Template 437 63 sgm13 CCACTTGAAGCCCTCGGGGA 37 Non- 437 53 Template sgm14 GAAGGGCAGGGGGCCACCCT 38 Non- 326 40 Template sgm15 AAGCTGAAGGTGACCAAGGG 39 Template 324 59 sgm16 GGGCGAGGGCCGCCCCTACG 40 Template 287 51 sgm17 TCTGGGTGCCCTCGTAGGGG 41 Non- 285 54 Template sgm18 CTCGAACTCGTGGCCGTTCA 42 Non- 242 45 Template sgm19 CATGCGCTTCAAGGTGCACA 43 Template 224 52 sgm20 GGATAACATGGCCATCATCA 44 Template 197 60
[0123] T7 Endonuclease 1 (T7E1) Assays. Genomic DNA was used as a template in a PCR reaction using PHUSION? polymerase (NEB) and standard PCR conditions (98? C. for 30 seconds, 30 cycles of 98? C. for 5 seconds, 55? C. for 10 seconds and 72? C. for 25 seconds, and one cycle of 72? C. for 5 minutes). Column-purified (Qiagen) PCR products were prepared as 200 ng DNA in 20 ?l of 1? NEBuffer 2 (NEB), denatured at 95? C. for 10 minutes, then brought down to room temperature by decreasing the temperature 1? C. per second. One half microliter of T7E1 (NEB) was added to each reaction, and allowed to incubate at 37? C. for 5 minutes. DNA fragments were separated by electrophoresis through a 1.5% agarose gel. Gel images were analyzed and indel frequencies were quantified using ImageJ. Statistical analyses were performed by generating p values for each sgRNA with a two-sample t-test to compare plus and minus doxycycline, then all p values were adjusted via Bonferroni correction in RStudio version 1.0.136.
[0124] Bioinformatic Analysis of RNA Seq VS Indel Frequencies. The source of large scale indel mutagenesis and RNA-seq data were from previously published reports (Chari, et al. (2015) Nat. Methods 12:823-826; Chavez, et al. (2016) Nat. Methods 13:563-567). Blat and bedtools command line tools (Quinlan, & Hall (2010) Bioinformatics 26: 841-842) were used to classify each of the sgRNA used by Chari et al, ((2015) Nat. Methods 12: 823-826) as targeting either the template or non-template gene strand. All data were merged and visualized using RStudio version 1.0.136 (package: ggplot2), allowing for the determination of the effect of FPKM and strand orientation on indel frequency. Statistical analyses and significance were determined with Multiple Comparisons of Means with Tukey contrasts (package: multcomp).
[0125] Flow Cytometry. Single-cell suspensions were prepared by trypsinization and re-suspension in 2% FBS/PBS/2 mM EDTA. Cells were analyzed on a LSRFortessa? flow cytometer. Data analysis was performed using FlowJo v9.3.2. Live cells were gated by forward scatter and side scatter area. Singlets were gated by side scatter area and side scatter width. At least 5?10.sup.5 singlet, live cells were counted for each sample. mCherry fluorescence events were quantified by gating the appropriate channel using fluorescence negative cells as control.
[0126] Targeted Deep-Sequencing Preparation and Analysis. Genomic DNA was harvested four days after transfection and approximately 100 ng of DNA was used in PCR to amplify respective target sites while attaching adapter sequences for subsequent barcoding steps. PCR products were analyzed via agarose gel and then distinct amplicons were pooled for each replicate respectively in equal amounts based on ImageJ quantification. Pooled PCR products were purified with AMPure beads (Agilent), and 5 ng of the purified pools was barcoded with Fluidigm Access Array? barcodes using AccuPrime? II (ThermoFisher Scientific) PCR mix (95? C. for 5 minutes, 8 cycles of 95? C. for 30 seconds, 60? C. for 30 seconds and 72? C. for 30 seconds, and one cycle of 72? C. for 7 minutes). Barcoded PCR products were analyzed on a 2200 TapeStation (Agilent) before and after 2 rounds of 0.6? solid phase reversible immobilization bead purification to exclude primer dimers. A final pool of amplicons was created and loaded onto an Illumina MiniSeq generating 150 bp paired-end reads.
[0127] Determination of indel frequencies made use of CRISPResso command line tools that demultiplexed by amplicon, where appropriate, and then determined indel frequency by alignment to reference amplicon files (Pinello, et al. (2016) Nat. Biotechnol. 34:695-697). Outputs were assembled and analyzed using custom command-line, python, and R scripts.
[0128] Generation of Spacers Targeting ?NM1. Plasmids harboring Cas9, tracrRNA and single-spacer arrays targeting ?NM1 were constructed via BsaI cloning onto pDB114 as described previously (Heler, et al. (2015) Nature 519:199-202). Specifically, spacers RC1 (plasmid pRH320), RC2 (pRH322), RC3 (pRH324) and RC4 (pRH326) were constructed.
[0129] ?NM1 Infection Assays. Phage ?NM1h1 was isolated as an escaper of CRISPR type III targeting of ?NM1 with spacer 4B (Goldberg, et al. (2014) Nature 514: 633-637). Plate reader growth curves of bacteria infected with phage were conducted as described previously ((Goldberg, et al. (2014) Nature 514: 633-637) with minor modifications. Overnight cultures were diluted 1:100 into 2 ml of fresh BHI broth supplemented with appropriate antibiotics and 5 mM CaCl.sub.2) and grown to an OD.sub.600 of about 0.2. Immune cells carrying targeting spacers were diluted with cells lacking CRISPR-Cas in a 1:10,000 ratio and infected with either ?NM1h1 or ?NM1g6 at MOI 1. To produce plate reader growth curves, 200 ?l of infected cultures, normalized for OD.sub.600, were transferred to a 96-well plate in triplicate. OD.sub.600 measurements were collected every 10 minutes for 24 hours.
Genomic Strand Selection Influences Mutation Frequencies
[0130] Biochemical and biophysical characterization of Cas9 has identified unique properties of the nuclease. The enzyme-product complex of Cas9 bound to the DNA is notably stable, with a reported 5.5-hour lifetime in vitro (Richardson, et al. (2016) Nat. Biotechnol. 34:339-344). Given that a diploid mammalian genome typically possesses only two (before DNA replication) to four (after DNA replication) on-target substrates for Cas9, it was reasoned that the Cas9 off-rate could be the rate limiting step in genome editing and that Cas9 binding prevents DSB repair. Using purified proteins, Cas9-generated DSBs were not amenable substrates for bacteriophage repair T7 enzymes, T4 DNA ligase and exonuclease, unless Cas9 was removed by heat denaturation. By measuring the release of a 3-fluorescent tag from dsDNA molecules attached to beads via a 5-biotin, the Cas9-generated DSB did not release DNA ends from the beads. When purified mammalian DNA end-binding proteins (complexed human Ku70/80) were added to the immobilized DNA, Ku70/80 bound the available DNA ends and was precipitated with beads. In contrast, addition of Ku70/80 did not increase soluble fluorescence of DNA cut by Cas9, indicating that Ku70/80 could not displace Cas9 from the DSB. Thus, persistent Cas9 binding to DNA made the DSB inaccessible to other DNA end binding proteins.
[0131] In light of this analysis, it was posited that an increase in the off-rate of Cas9 after cleavage could increase genome editing efficiency. To demonstrate this, a method was needed for experimentally manipulating the off-rate of Cas9 in vivo. Therefore, several in vitro conditions were tested to find a way of removing Cas9 from the DSB. Protection of the DSB was not eliminated by salt concentration between 4 nM to 250 mM NaCl or by temperature between 4 to 59? C. By comparison, colliding T7 RNAP into Cas9 made the DSB accessible to exonuclease activity.
[0132] The accessibility to the DNA end suggests that as the polymerase translocates through the sgRNA target site, the collision with Cas9 dislodges the nuclease from the DSB. Interestingly, displacing Cas9 by T7 RNAP did not eliminate nuclease activity of the dislodged Cas9 RNP molecules. Displacing Cas9 from its DSB also did not appear to stimulate an exchange or loss of the sgRNA from the Cas9 RNP. Indeed, retained nuclease activity of dislodged Cas9 RNP enabled cutting of additional DNA molecules in vitro (
[0133] Cas9 recognizes a short motif known as the PAM or protospacer adjacent motif in order to distinguish self from non-self. Previous s biochemical analyses demonstrated an asymmetry in the freedom of DNA strands associated with Cas9 (Richardson, et al. (2016) Nat. Biotechnol. 34:339-344); the dsDNA from PAM-proximal side of Cas9 remains stably bound to Cas9, whereas the non-targeted DNA strand is released from PAM-distal side. To determine if the ability of T7 RNAP to stimulate multi-turnover nuclease activity depended on which surface of Cas9 it struck, the T7 promoter was moved to the opposite end of the linear DNA substrate. Reactions using these substrates indicated that Cas9 was refractory to T7 RNAP translocating from the PAM-proximal direction (
TABLE-US-00005 TABLE5 sgRNA/ SEQID % Fold- spacer Sequence+PAM NO: GC change* RC2 GTTCAATCTGATTTCTTTTATGG 45 25 1.51 RC1 TAGATTGTCTAAAGTTGAGATGG 46 30 1.51 RC3 GTTTCTAAAGGTTATCTCTTAGG 47 30 1.46 RC4 TCGATTTCGCTATCAAATTCTGG 48 35 1.28 sgm1 GTAATGCAGAAGAAGACCATGGG 49 40 2.07 sgm2 TGTCCCCTCAGTTCATGTACGG 50 47 1.50 sgL1 GCCTCAACACGAACAGAGAAAGG 51 50 2.36 sgm3 GGAGCCGTACATGAACTGAGGG 52 53 2.01 sgG2 TCGTGACCACCCTGACCTACGG 53 58 1.44 sgG1 GTGAACCGCATCGAGCTGAAGGG 54 59 1.31 sgG3 CTGAAGCACTGCACGCCGTAGG 55 63 2.25 *when processive.
[0134] In cells, individual sgRNA display variable efficiency for genome editing. Some variability has been attributed to the formation and the function of the Cas9 RNP itself (Wang, et al. (2014) Science 343:80-84). Some chromatin characteristics, such the presence of as nucleosomes or low levels of target gene transcription, correlate with low activity sgRNA (Chari, et al. (2014) Nat Methods 12:823-826; Hinz, et al. (2015) Biochemistry 54:7063-7066; Horlbeck, et al. (2016) Elife 5, pii:e12677). It was posited that a template strand bias also affects efficiency of Cas9-mediated genome editing, because the off-rate of Cas9 could be a rate limiting step in genome editing. If so, then sgRNA annealing to the template strand of transcribed genes would be more efficient than sgRNA annealing to the non-template strand. This was demonstrated in three distinct ways. First, previously reported indel mutation rates by 975 sgRNA in HEK293 cells (Chari, et al. (2014) Nat Methods 12:823-826) were analyzed by assigning template/non-template strand status to sgRNA and binning the sgRNA based on the relative mRNA level of the target gene. Genes in the top two quartiles of mRNA levels were more frequently mutated when targeted by template strand sgRNA. Second, 40 genes expressed in mouse ES cells were individually targeted (17 template, 23 non-template sgRNA) and the indel frequency of each target was measured by targeted deep sequencing. The percent indel frequency was significantly higher for template strand sgRNA compared to non-template strand sgRNA (
TABLE-US-00006 TABLE 6 SgRNA Name Strand % Indel ?Dox % Indel +Dox sgm1 Template 14.5 39.1 sgm2 Template 16.7 52.3 sgm3 Non-Template 19.7 26.7 sgm4 Template 11.0 23.1 sgm5 Template 7.2 19.9 sgm6 Template 6.7 13.2 sgm7 Non-Template 4.3 5.5 sgm8 Template 6.5 17.5 sgm9 Non-Template 3.6 2.5 sgm10 Template 11.5 19.6 sgm11 Non-Template 21.0 25.2 sgm12 Template 19.2 39.5 sgm13 Non-Template 27.0 17.6 sgm14 Non-Template 12.6 15.5 sgm15 Template 20.3 58.6 sgm16 Template 11.0 20.1 sgm17 Non-Template 6.7 4.9 sgm18 Non-Template 8.3 6.9 sgm19 Template 15.5 14.7 sgm20 Template 18.0 46.8
[0135] Measuring indel formation with T7 endonuclease 1 assays showed that stimulating transcription significantly increased indel formation only for template strand sgRNA (
[0136] Cas9 functioning as a multi-turnover nuclease could significantly enhance bacteriophage immunity in bacteria, which may need to survive an infection when many phage genomes are present. Interestingly, the nucleotide composition of bacteriophage genomes differ in the plus and minus strands (Jin, et al. (2014) BMC Genomics 15:793; Kwan, et al. (2005) Proc. Natl. Acad. Sci. USA 102:5174-5179; Lobry (1996) Mol. Biol. Evol. 13:660-665; Uchiyama, et al. (2008) Appl. Environ. Microbiol. 74:4149-4163), which is illustrated by a skew toward adenine and guanine in the plus strand of Streptococcus phages that infect S. pyogenes and S. thermophilus (34% adenine:27% threonine, and 22% guanine:17% cytosine) (Table 7). Consequently, the PAM sites for SpCas9 (NGG) and StCas9 (NNAGAAW) preferentially target the template strand at about a 2:1 ratio, which is similar to the high frequency of crRNA that target the template strand of bacteriophage in bacteriophage insensitive mutant strains (Achigar, et al. (2017) Sci. Rep. 7:43438; Levin, et al. (2013) PLOS Genet. 9:e1003312).
TABLE-US-00007 TABLE 7 # # Non- % Phage PAM Template Template Template Phage: NNAGAAW 179 52 77.5% 2972: 34704 bp NGG 1450 777 65.1% Phage NNAGAAW 108 45 70.6% 128: 34593 bp NGG 1381 833 62.4% Phage NNAGAAW 183 63 74.4% 73: 36377 bp NGG 1467 793 64.9% Phage NNAGAAW 166 69 70.6% 53: 34239 bp NGG 1381 804 63.1% Phage NNAGAAW 169 64 72.5% 858: 35543 bp NGG 1476 758 66.1% Phage NNAGAAW 219 96 69.5% 5093: 37184 bp NGG 1329 714 65.1% Phage NNAGAAW 176 93 65.4% 7029: 35466 bp NGG 1371 794 63.3% Prophage NNAGAAW 302 117 72.1% 20167: 48800 bp NGG 1999 1115 64.2% Phage NNAGAAW 209 84 71.3% Sfi11: 39807 bp NGG 1544 802 65.8% Phage NNAGAAW 190 95 66.7% Sfi19: 37307 bp NGG 1516 822 64.8% Phage NNAGAAW 222 108 67.3% Sfi21: 40793 bp NGG 1520 896 62.9% Prophage NNAGAAW 200 81 71.2% TP-778L: 41757 bp NGG 1600 920 63.5% Prophage NNAGAAW 226 91 71.3% TP-J134: 45606 bp NGG 1711 967 63.9% Phage NNAGAAW 286 80 78.1% NM4: 40365 bp NGG 1406 624 69.3% Phage NNAGAAW 303 105 74.3% NM1: 43219 bp NGG 1387 688 66.8% Phage NNAGAAW 173 52 76.9% A25: 33900 bp NGG 1472 779 70.9% Phage NNAGAAW 164 67 72.9% T12: 37976 bp NGG 1431 798 63.6%
[0137] The data suggest that the strand biased PAM sequences of StCas9 and SpCas9 evolved to target the plus strand of bacteriophage genomes, because it provides a selective advantage for bacteria against bacteriophage. Compared to an evolutionarily challenging barrier of changing a genome-wide GC skew in bacteriophage, changing the PAM sequence used by Cas9 is relatively simpler and requires only a small number of mutations (Kleinstiver, et al. (2015) Nature 523: 481-485). Targeting of the bacteriophage plus strand provides an advantage because it will more frequently result in multi-turnover nucleases upon transcription of lytic genes.
[0138] To directly test a strand bias effect on bacterial immunity, two virulent versions of the ?NM1 phage were used. One contained a mutation that inactivates the promoter required for transcription of lysogeny cassette (?NM1?6; Goldberg, et al. (2014) Nature 514: 633-637), and the other expresses the lysogeny cassette but harbors an inactivating deletion within the cI repressor gene (?NM1h1). Therefore, neither phage can establish lysogeny, but they differ in the transcription of the lysogeny cassette. Different bacterial strains were generated which harbored spacers targeting either template or non-template strand sequences within the repressor gene found in both ?NM1?6 and ?NM1h1. Each strain was infected with each phage and their survival determined by measuring OD.sub.600 over time. The interference efficiency of each spacer against the two phages was interpreted from plate-reader growth curves of infected bacterial cultures. The two spacers targeting the non-template strand (RC2 and RC4) showed similar interference against either phage. On the contrary, spacers targeting the template strand (RC1 or RC3) were notably more effective at cleaving ?NM1h1's transcribed target. The same four target sites within ?NM1 were tested for the ability of T7 RNAP translocation to turn Cas9 into a multi-turnover nuclease in vitro (
[0139] In summary, displacing Cas9 from its DSB stimulates genome editing efficiency and increases CRISPR immunity. The data indicate that the orientation-dependent displacement of Cas9 by RNAP provided a method for measuring the strand-bias effect on genomes. In addition to RNAP translocation through Cas9, other DNA metabolic processes, including replication and repair activities, likely generate sufficient force to dislodge Cas9 (
Example 5: Additional Methods
[0140] Synthetically Directing Transcription Through the Cas9 Target Site. Transcription factor Cas9s: An RNA-guided nuclease (e.g., Cas9 or Cas12a) that is nuclease inactive (e.g., dCas9) is fused to a transcriptional activation domain or its sgRNA contains transcriptional activation domains (e.g., dCas9-VP64), and functions to recruit RNA polymerases to a specific region in the genome.
[0141] Directing RNA polymerase to Cas9 target sites: Transcription factor Cas9s is targeted upstream of the actual genome editing target site (the sequence that nuclease active Cas9 is directed). Both the transcription factor Cas9 and nuclease active Cas9 are present in the cell at the same time, and the transcription factor Cas9 directs RNA polymerase activity through a template bound nuclease active Cas9. Transcription factor Cas9s is a different species than nuclease active Cas9 to avoid the sharing of sgRNAs. For example, transcription factor Cas9 from S. thermophilus has a sgRNA that S. pyogenes cannot utilize. Therefore, S. pyogenes Cas9 can be the nuclease active one and the two can cooperate within this system.
[0142] Small Molecule Influenced Dissociation of Cas9 from the DSB. Small molecules that disrupt the Cas9-DSB complex may be identified via a high throughput screen including an assay where disruption of the complex mediates either release of DSB from Cas9 with dissociated Cas9 non-functional, or release of Cas9 from the DSB so that Cas9 is functional and a multi-turnover enzyme. Suitable assays include recombinant Cas9 from the desired species, purified sgRNA, and target DNA that is fluorescent. The fluorescence target DNA exists in the non-fluorescent form when it is in the Cas9-DSB state or free in the uncleaved state. The cleaved DNA that is dissociated from Cas9 will fluoresce as a readout for disruption of the Cas9-DSB complex. This assay is an example of the many fluorescent assays that could be used to detect the right small molecule.
[0143] Alternatively, small molecules that disrupt the Cas9-DSB complex with energetics that cause Cas9 dissociation from the DSB without completely inhibiting Cas9 association with target DNA may be designed. More particularly, small molecules are designed to specifically interact with the general Cas9-DSB complex so that they disruptively bind: [0144] i) within the target DNA R loop (Intercalation between DNA strands); [0145] ii) within the sgRNA:DNA hybrid (Intercalation between RNA and DNA strands); [0146] iii) within the RuvC domain and non-target strand interaction (Intercalation between amino acid residues and DNA); [0147] iv) within the HNH domain and target strand interaction (Intercalation between amino acid residues and DNA); [0148] v) with the PAM sequence and the PAM interaction domain (Intercalation between amino acid residues and DNA); [0149] vi) within the scaffold region of the sgRNA (the non-programmable region) to cause sgRNA or Cas9 unfolding; [0150] vii) within or on the outer surface of the RuvC or HNH nuclease domains to disrupt sgRNA or Cas9 folding; or [0151] viii) within or outside of any region of Cas9 or sgRNA that disrupts its folding and/or ability to bind the DSB.
[0152] Enzymatic Destruction of the sgRNA:DNA Hybrid. A Cas9 nuclease fused to an RNase H enzyme, domain or any RNA:DNA binding enzyme that has RNA:DNA degradation activities acts to dissociate the Cas9-DSB complex by destroying the sgRNA:DNA hybrid. Once Cas9 forms a complex with the DSB, the RNase recognizes this as a substrate and degrades it, resulting in release of Cas9 from the DSB. RNases are attached to the N- or C-terminus of Cas9 with a linker (glycine-serine type) that exists in a long or short format. Depending on the species of Cas9 that is used, the length may vary due to the amount of reach the enzyme needs to get to its substrate.
[0153] Enzymatic Destruction of the Surrounding DNA Sequence. A Cas9 nuclease is fused to one or more nucleases with specific or non-specific activities. The function of the additional nuclease is to cleave the immediately nearby genomic sequences so that the Cas9-DSB complex is completely removed and literally floats away. These additional nucleases can be fused to the N- or C-terminus of Cas9 using short or long linkers (glycine-serine) and are restriction enzymes that have small consensus sequences (less than 5 or 6 nucleotides).
[0154] Mutational Modification of the Cas9 Nuclease. The Cas9 nuclease is mutated by changing/deleting/inserting one or more amino acids residues such that the enzyme functions to release the DSB rather than staying bound, and the nuclease also may have newfound multi-turnover enzymatic activities. Such mutations can exist within or around the PAM interaction domain, the RuvC nuclease domain, and/or the HNH nuclease domain. These mutations can be generated through PCR or Gibson assembly, or a library of Cas9 mutants can be generated through error-prone PCR, then the mutants screened for multi-turnover nuclease activity and/or rapid dissociation from the DSB.
Example 6: Achieving Time-Regulated, Sequentially-Acting, Predetermined Cellular Behaviors Through Bioprocessor-Mediated Genetic Recording and Cellular Programming
[0155] Genetic Recording of Cellular Processes. The dynamic events that occur over a cell's lifetime can be recorded into its genome using combinations of the modules, i.e., Cas fusion protein, activatable sgRNA, and strand bias, described herein. Cellular events of interest (natural or synthetic), which result in transcription can be linked to the modules to serve as inputs for either direct or indirect genetic recording of the event. For example, a gene containing an embedded normal sgRNA within its 3-UTR will result in mutagenic activity by the sgRNA at a distinct genomic site once the gene is transcribed, ultimately creating a genetic record of the event. While simultaneously recording events of interest, a genetic recorder linked to cell cycle progression will record each cell division leading to a specific genomic barcode, hereafter termed generational barcoding (
[0156] Bioprocessors and Bioprocessing. A bioprocessor is composed of one or more activatable sgRNA linked to one or several of the other modules described herein with the purpose of executing a series of sequential genetic events. The activatable sgRNA serve as the program, and the regulation over Cas9 activity directed by these sgRNA serve as the central code. Cas9 activity is directly controlled by the activatable sgRNA existing in the on state or a normal sgRNA being present, and the sgRNA target site. The nature of the bioprocessor program provides sequential regulation of Cas9 activity, rendering a specific Cas9 activity to be dependent on completion of another Cas9 activity, such as conversion of an activatable sgRNA within the bioprocessor (
[0157] The initiation of a bioprocessor's activity depends on a cellular event for which the bioprocessor is programmed to respond to. The general direct input to initiate bioprocessor activity requires transcription of a normal or on-state activatable sgRNA. These sgRNA can be embedded within endogenous or synthetic genes themselves, or can be controlled by their own promoter. The presence of the cellular event that causes transcription of the active sgRNA will result in a direct genetic recording event, wherein the cellular event causes activity of an sgRNA, or indirect genetic recording event, wherein the cellular event results in downstream control of sgRNA activity, such as a signaling cascade. This genetic recording event converts an activatable sgRNA from the off to the on state, allowing the next event programmed within the bioprocessor to begin.
[0158] The act of bioprocessing is sequential completion of the pre-programmed events by the required modules, and the central program of the bioprocessor are arrays of activatable sgRNA (
[0159] Outputs. The direct outputs of a bioprocessor are Cas9-mediated mutagenesis (genetic changes and barcoding), or transcriptional activation or repression (epigenetic regulation). These activities lead to changes in cellular behavior and can be multiplexed through design of the bioprocessor. Importantly, each output can be regulated by the number of cell cycle completions, such as expressing or mutating endogenous genes at specific or multiple points in the cell's lifetime. Outputs can be further regulated through bioprocessor dependencies on endogenous transcription. For example, 3-UTR embedded sgRNA mediate the process of barcoding a cell or mutating/transcriptionally regulating a series of target genes when the gene of interest is expressed. The dependencies for a specific output can encompass few or many cellular activities and the only major requirement is validated Cas9 activity in the species of interest.
Example 7: Genetic Knock Outs to Induce Apoptosis After a Specific Number of Cell Cycle Completions
[0160] Generational Barcoding. The cellular process being tracked is cell cycle progression. The generational barcoding bioprocessor uses a series of activatable sgRNA in combination with either the strand bias by targeting of the non-template strand (
[0161] Strand Bias. Ten activatable sgRNA are placed in an array to count 10 cell divisions with each containing their own human U6 promoter for mammalian cells, or an SNR52 promoter for yeast. Each activatable sgRNA is targeted to the DNA of the activatable sgRNA directly adjacent and downstream of its own DNA. Each sgRNA binds to the non-template strand, allowing for one activatable sgRNA per cell cycle to be converted from the off to the on state. The first activatable sgRNA in the array will be activated through either transfection of the activating sgRNA, or it will be a normal sgRNA and transcription will be controlled through an inducible promoter. Activity by the first sgRNA will start begin the process of recording 10 cells divisions.
[0162] Cell Cycle Cas9. Twenty sgRNA are placed in an array, with odd numbered sgRNAs corresponding to the G1-phase specific Cas9 (PAM=NGG) and even numbers corresponding to G2-phase specific Cas9 (PAM=NAG). Each sgRNA in the array will be targeted to the nascent sgRNA's DNA as shown in
[0163] Bioprocessing. Upon conversion from off state to on, the final sgRNA (sgRNA KS1) in the array is targeted to the genomically integrated DNA of another sgRNA at another location. The sgRNA at the second location (sgRNA KS2) is converted to the on state and targets Cas9 activity to three distinct sgRNAs (sgRNA KS3, sgRNA KS4 and sgRNA KS5) located at three other locations in the genome. Cas9 bound to sgRNA KS2 converts sgRNA KS3, sgRNA KS4 and sgRNA KS5 to the on state.
[0164] Output. sgRNA KS3 is targeted to the template strand of the Bcl2 open reading frame (ORF), sgRNA KS4 is targeted to the template strand of the MDM2 ORF, and sgRNA KS5 is targeted to the template strand of the AKT ORF. Template strand targeting ensures fast genome editing kinetics to maximize the rate of genetic disruption to these proteins. Bcl2, MDM2, and AKT all promote cell survival via different mechanisms. Disruption of all the genes results in efficient activation of the intrinsic apoptotic pathway. In yeast, the homologs to these proteins are Bcl2 (Bcl2) and Sch9p (AKT), and MDM2 is replaced by an sgRNA targeting Tps1. Furthermore, the generational barcoding locus can be sequenced to reconstruct lineage trees from surviving cells.
Example 8: Genetic Knock Outs and Transcriptional Activation to Induce Cellular Quiescence After a Specific Number of Cell Cycle Completions
[0165] Genetic Recording of Cellular Processes. The process being tracking is cell cycle progression, and the generational barcoding system employed is largely similar to the one described Example 7, except only the strand bias is used in this example. In this system, the Cas9 nuclease utilized is a nuclease active Cas9 fused to the transcriptional activation domain VPR (Kiani, et al. (2015) Nature Meth. 12 (11):1051-4). Nuclease activity and recruitment of RNA polymerase II (RNAP) is modulated by changing the length of the sgRNA. A 20 nt sgRNA allows Cas9 to cleave DNA and mediate mutagenesis, while a 14 nt sgRNA ablates Cas9 activity, but the nuclease remains bound to DNA and can recruit RNAP to transcribe the target locus (see, e.g.,
[0166] Bioprocessing. The final sgRNA in the generational barcoding system (sgRNA QT2) targets another sgRNA's DNA (sgRNA QT2), and activated QT2 then targets three distinct sgRNA's DNA (sgRNA QT3, sgRNA QT4, and sgRNA QT5). In this example, sgRNA QT3 is a 20 nt sgRNA targeted to E2F, sgRNA QT4 is 14 nt sgRNA targeted to the promoter of P16.sup.ink4a, and sgRNA QT5 is 14 nt sgRNA targeted to the promoter of P21. The 14 nt sgRNAs target the promoters within 200 bp of the transcription start site (TSS) to efficiently activate transcription.
[0167] Outputs. sgRNA QT3 is targeted to the template strand of E2F to induce a genetically disrupting mutation. Loss of E2F results in permanent cell cycle arrest in the G1 phase or entrance into the G0 phase. sgRNA QT4-mediated expression of P16.sup.ink4a and sgRNA QT5-mediated expression of P21 induces entrance into the G0 phase, rendering cell growth inhibition and efficient quiescence. For yeast homologs, E2F (E2F), transcriptional activation of P16.sup.ink4a and P21 are replaced with retinoblastoma protein, RB. Furthermore, the generational barcoding locus can be sequenced to reconstruct lineage trees.
Example 9: A Bioprocessor that Detects Cellular Stress and Inducing Apoptosis
[0168] Genetic Recording of Cellular Processes. The cellular process being recorded in this system is the metabolic stress consequence, reactive oxygen species (ROS). In order to monitor this process, a normal sgRNA is embedded into the 3-untranslated regions (3-UTR) in 3 respective ROS-induced genes, NF-kappaB, ATF, and AP-1. The embedded sgRNA is flanked by two cis-cleaving ribozymes (RGR), resulting in the production of a functional sgRNA upon full transcription of the gene (see, e.g.,
[0169] Bioprocessing. Upon transcription of any of the three genes, a functional sgRNA is produced. This sgRNA (sgRNA NF1) is targeted to the DNA of three distinct activatable sgRNAs (NF2, NF3 and NF4). sgRNAs NF1, sgRNA NF2, and sgRNA NF3 are all complementary to DNA which contains an NGG PAM sequence, rendering their ability to mediate mutagenesis specific to WT-Cas9. sgRNA NF4 binds DNA containing an NAG PAM, rendering its activity specific to dCas9-KRAB. Successful conversion of sgRNA NF2 to the on state targets Cas9 mutagenic activity to Bcl2, conversion of sgRNA NF3 targets activity to MDM2, and conversion of sgRNA NF4 represses transcription of TNF? through binding within 50 bp after the TSS. These activities can also be performed in the presence of the generational barcoding to ascertain timing of ROS accumulation with respect to cell aging as long as the DNA of sgRNA NF2, sgRNA NF3 and sgRNA NF4 is sequenced.
[0170] Outputs. Mutagenesis of Bcl2 and MDM2 will result in induction of the intrinsic apoptotic pathway. Repression of the TNF? locus will preclude the secretion of TNF? to ultimately reduce inflammatory responses and necrosis of nearby cells. In yeast, the homologs to these proteins are Bcl2 (Bcl2), MDM2 is replaced by an sgRNA targeting Tps1, and TNF? has no replacement.
Example 10: Time-Encoded Induction of a Heterologous Gene of Interest That Confers Transcription of Cell Survival Genes and Repression of Inflammatory Genes
[0171] Genetic Recording of Cellular Processes. The major process being recorded and serving as the main input for the bioprocessor is cell cycle progression. In this system, the generational barcoding process records 10 cell divisions by using strand bias. The barcoding and transcriptional activation events are mediated by Cas9-VPR (PAM=NGG), and the cells also express dCas9-KRAB (PAM=NAG).
[0172] Bioprocessing 1. Upon completion of 10 cell cycles, the final sgRNA in the generational barcoding array (sgRNA H1) is a 20 nt sgRNA that is targeted to the DNA of a 14 nt sgRNA (sgRNA H2). sgRNA H2 is targeted to the promoter of the transcriptionally silent heterologous gene of interest (GOI). The 14 nt sgRNA H2 binds a sequence with an NGG PAM, resulting in Cas9-VPR targeting to the site and transcriptional activation of the heterologous gene product.
[0173] Output 1. Expression of the heterologous gene occurs, which encodes two normal sgRNA, RGRs in the 3-UTR (RGR H3 and RGR H4).
[0174] Bioprocessing 2. The RGRs become functional sgRNAs upon transcription, converting to sgRNA H3 and sgRNA H4. sgRNA H3 targets Cas9-VPR to the Bcl2 promoter, and sgRNA H5 targets dCas9-KRAB near the TSS of Interferon alpha.
[0175] Output 2. Activity by sgRNA H4 results in transcription of Bcl2 which promotes cell survival by inhibiting apoptosis. sgRNA H5 represses Interferon alpha which reduces potential cellular stress responses and secretion of inflammatory cytokines to surrounding cells.
Example 11: Bioprocessor-Mediated Linkage of Two Independent Endogenous Pathways to Produce a Novel Cellular Behavior
[0176] Genetic Recording of Cellular Processes. The processes being recorded are receptor-mediated signaling of one pathway, and transcriptional activity of a second pathway, with the second pathway depending on the first pathway. The recording is mediated by Cas9-VPR activity directed by 3-UTR normal sgRNA in a gene regulated by the receptor signaling cascade (gene 1) and the conversion of a 3-UTR embedded activatable sgRNA to the on state in gene 2.
[0177] Bioprocessing. Gene 2 is constantly transcribed and contains an inactive, activatable RGR in its 3-UTR (sgRNA 2). The conversion of sgRNA 2 to the on state depends on the expression of sgRNA 1, which is a normal sgRNA embedded in the 3-UTR of gene 1. Upon receptor-ligand binding, the signaling cascade of interest induces transcription of gene 1, resulting in the expression of sgRNA 1. sgRNA 1 converts sgRNA 2 to the on state. sgRNA 2 is targeted to the DNA of activatable sgRNA 3, converting it to the on state. sgRNA 3 is a 14 nt sgRNA and is targeted to the promoter of the target gene of interest.
[0178] Outputs. The activity of sgRNA 3 causing the expression of some target gene is entirely dependent on these two pathways being expresses at the same time, thus allowing the linkage of two normally unassociated pathways. If performed in the context of generational barcoding, the DNA of the activatable sgRNA can be sequenced to ascertain kinetics and timing of the process.
Example 12: Induction of Genes at Specific Cell Cycle Completion Numbers to Manipulate Cell Fitness
[0179] Genetic Recording of Cellular Processes. Cell cycle progression is recorded through Cas9-VPR-mediated generational barcoding utilizing strand bias for 10 cell cycles. Activatable sgRNAs converted to the on state after completion of 5 (sgRNA C1), 7 (sgRNA C2) and 10 (sgRNA C3) cell divisions have secondary targets to either mediate transcription or mutations at distinct endogenous genes.
[0180] Bioprocessing. Upon completion of 5 cell divisions, sgRNA C1 is activated and is targeted to the DNA of sgRNA F1. sgRNA F1 is a 14 nt sgRNA and is targeted to the promoter of a heterologous gene of interest to promote transcription. Upon completion of 7 cell cycles, sgRNA C2 is converted to the on state and is targeted to the DNA of sgRNA F2. sgRNA F2 is 20 nt sgRNA that is targeted to the DNA of three distinct, 14 nt activatable sgRNAs (sgRNA E1, E2 and E3). This targeting converts these sgRNA to the on state, and they bind the promoters of Malic enzyme (sgRNA E1), catalase (sgRNA E2), and superoxide dismutase (sgRNA E3) to activate transcription. After the 10th and final recorded cell division, sgRNA C3 is activated and targets the DNA of sgRNA F3 (20 nt). sgRNA F3 converts sgRNA E4, E5 and E6 to the on state through genome editing at the associated DNA. sgRNA E4 is targeted to the ORF of Bcl2, sgRNA E5 is targeted to the ORF of MDM2 and sgRNA E6 is targeted to the ORF of AKT>
[0181] Outputs. At the 5.sup.th cell division, the heterologous gene of interest is expressed continuously throughout the remainder of cell survival. After the 7th cell cycle, NAPDH producing Malic enzyme is targeted to increase the level of expression simultaneously as catalase and superoxide dismutase. These targeting efforts endeavor to decrease the cellular stress caused by ROS accumulation as the heterologous gene product is being made. After 10 cell cycles, apoptosis is induced.
Example 13: Tracking Cellular Histories of Biotherapeutic Producing Cells for Automating Cellular Behaviors Through Bioprocessor Technologies
[0182] It is known that viability and productivity of CHO cell cultures producing a monoclonal antibody (mAB) over 7 days decreases when highest mAB titers are achieved at approximately days 5-6. The system of the invention barcode cells before they divide and couples cell division with other cellular behaviors, such as mAB expression and toxicity levels. By way of illustration, whereas cell division numbers 1-9 do not exhibit any signs of toxicity and maintain high mAB expression, at cell division number 13 a medium amount of toxicity, reduced mAB expression and antibody aggregation is detected, and at cell division umber 17 a high level of toxicity, no product secretion and beginning of cell death are detected (