ALKOXYPHENYL DERIVATIVES, PROTECTED NUCLEOSIDES AND PROTECTED NUCLEOTIDES, METHOD FOR PRODUCING OLIGONUCLEOTIDES, AND METHOD FOR REMOVING SUBSTITUENTS
20240239833 ยท 2024-07-18
Inventors
- Kazuhiro Chiba (Tokyo, JP)
- Yohei Okada (Tokyo, JP)
- Hideaki UMEMOTO (Hyogo, JP)
- Takuya ONAKA (Hyogo, JP)
Cpc classification
Y02P20/55
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C07H1/00
CHEMISTRY; METALLURGY
C07D413/04
CHEMISTRY; METALLURGY
C07H19/073
CHEMISTRY; METALLURGY
C07D417/12
CHEMISTRY; METALLURGY
C07D405/04
CHEMISTRY; METALLURGY
C07F9/65616
CHEMISTRY; METALLURGY
C07F9/65586
CHEMISTRY; METALLURGY
C07C235/52
CHEMISTRY; METALLURGY
C07H19/173
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to an alkoxyphenyl derivative capable of synthesizing an oligonucleotide by a quicker liquid phase synthesis method than in the prior art, a protected nucleoside and a protected nucleotide to which the alkoxyphenyl derivative is bonded, a method for producing an oligonucleotide using the same, and a method for selectively removing the alkoxyphenyl derivative moiety and the like.
A compound represented by the general formula (1) or a derivative thereof:
##STR00001##
(In the formula, R each independently represents an optionally substituted alkyl group having 10 to 40 carbons. m represents an integer between 1 and 5. When m is 2 or more, a plurality of ROs may be the same or different. X represents O, S, NH, or NR.sup.N. n represents an integer from 1 to 4. R.sup.N represents an optionally substituted alkyl group having 1 to 6 carbons.)
Claims
1. A compound represented by the general formula (3) or a derivative thereof: ##STR00135## wherein: R each independently represents an optionally substituted alkyl group having 10 to 40 carbon atoms; m represents an integer between 1 and 5, wherein if m is 2 or more, a plurality of ROs present may be the same or different; X represents O, S, NH, or NR.sup.N; n represents an integer from 1 to 4; R.sup.N represents an optionally substituted alkyl group having 1 to 6 carbons; Y represents the following general formula (4) or general formula (5): ##STR00136## wherein for formula (4): Base represents a nucleobase which may be modified, wherein if 2 or more Bases are present, a plurality of Bases present may be the same or different; B represents a hydrogen atom, an optionally protected hydroxyl group, or a halogen, wherein if 2 or more Bs are present, a plurality of Bs present may be the same or different; W represents a hydrogen atom or protecting group; R.sup.4 represents an alkyl group having 1 to 4 carbons and having an electron-withdrawing group, wherein if 2 or more R.sup.4s are present, a plurality of R.sup.4s present may be the same or different; Z represents O or S, wherein if 2 or more Zs are present, a plurality of Zs present may be the same or different; y1 represents any integer greater than or equal to 0; and * represents a bonding position in the above general formula (3); ##STR00137## wherein for formula (5): Base represents a nucleobase which may be modified, wherein if 2 or more Bases are present, a plurality of Bases present may be the same or different; Q represents a hydrogen atom or protecting group; V represents an alkoxy group having 1 to 6 carbon atoms, a di(C.sub.1-6 alkyl)amino group, or a piperazino group in which the nitrogen atom at the 4-position is protected with a protecting group and may be further substituted, wherein if 2 or more Vs are present, a plurality of Vs present may be the same or different; y2 represents any integer greater than or equal to 0; and * represents a bonding position in the above general formula (3).
2. The compound according to claim 1 or a derivative thereof represented by the general formula (6): ##STR00138## wherein: R.sup.1, R.sup.2, and R.sup.3 each independently represent an optionally substituted alkyl group having 10 to 40 carbons; X represents O, S, NH, or NR.sup.N; n represents an integer from 1 to 4; R.sup.N represents an optionally substituted alkyl group having 1 to 6 carbons; Y represents the following general formula (4) or general formula (5): ##STR00139## wherein for formula (4): Base represents a nucleobase which may be modified, wherein if 2 or more Bases are present, a plurality of Bases present may be the same or different; B represents a hydrogen atom, an optionally protected hydroxyl group, or a halogen, wherein if 2 or more Bs are present, a plurality of Bs present may be the same or different; W represents a hydrogen atom or protecting group; R.sup.4 represents an alkyl group having 1 to 4 carbons and having an electron-withdrawing group, wherein if 2 or more R.sup.4s are present, a plurality of R.sup.4s may be the same or different; Z represents O or S, wherein if 2 or more Zs are present, a plurality of Zs present may be the same or different; y1 represents any integer greater than or equal to 0; and * represents a bonding position in the above general formula (6); ##STR00140## wherein for formula (5): Base represents a nucleobase which may be modified, wherein if 2 or more Bases are present, a plurality of Bases present may be the same or different; Q represents a hydrogen atom or protecting group; V represents an alkoxy group having 1 to 6 carbon atoms, a di(C.sub.1-6 alkyl)amino group, or a piperazino group in which the nitrogen atom at the 4-position is protected with a protecting group and may be further substituted, wherein if 2 or more Vs are present, a plurality of Vs present may be the same or different; y2 represents any integer greater than or equal to 0; and * represents a bonding position in the above general formula (6).
3. The compound or a derivative thereof as claimed in claim 1, wherein W is a hydrogen atom, a trityl group, a di (C.sub.1-6 alkoxy)trityl group, a mono (C.sub.1-18 alkoxy)trityl group, a 9-(9-phenyl)xanthenyl group, or a 9-(9-phenyl)thioxanthenyl group.
4. The compound or a derivative thereof according to claim 1, wherein R.sup.4 is an ethylic group having an electron-withdrawing group at the 2-position.
5. The compound or a derivative thereof according to claim 1, wherein Q is a hydrogen atom, a trityl group, a di(C.sub.1-6 alkoxy)trityl group, a mono(C.sub.1-18 alkoxy)trityl group, a 9-(9-phenyl)xanthenyl group, or a 9-(9-phenyl)thioxanthenyl group.
6. The compound or a derivative thereof according to claim 1, wherein y1 or y2 is 1 to 100.
7. The compound or a derivative thereof according to claim 1, wherein y1 or y2 is 1 to 30.
8. The compound or a derivative thereof according to claim 1, wherein y1 or y2 is 0.
9. The compound or a derivative thereof according to claim 1, wherein n is 1 or 2.
10. The compound or a derivative thereof according to claim 1, wherein m is an integer of 2 to 4.
Description
MODE FOR CARRYING OUT THF INVENTION
[0188] Hereinafter, embodiments of the present invention will be described in detail. [0189] [Alkoxyphenyl compounds and derivatives thereof]
[0190] The alkoxyphenyl compounds of the present invention and the derivatives thereof are the compound represented by the general formula (1) or a derivative thereof.
##STR00026##
(In the formula, [0191] R each independently represents an optionally substituted alkyl group having 10 to 40 carbons. [0192] m represents an integer between 1 and 5. When m is 2 or more, a plurality of ROs may be the same or different. [0193] X represents O, S, NH, or NR.sup.N. [0194] n represents an integer from 1 to 4. [0195] R.sup.N represents an optionally substituted alkyl group having 1 to 6 carbons.)
[0196] In the general formula (1), R each independently represents an optionally substituted alkyl group having 10 to 40 carbons. The R may be an alkyl group having 13 to 30 carbons, or may be an alkyl group having 15 to 20 carbons, and among them, an alkyl group having 18 carbons may be preferred. In addition, when a plurality of Rs are present, they each independently may be a linear alkyl group or a branched alkyl group, but are preferably linear alkyl groups. Further, when the R is an alkyl group having 10 to 40 carbons, synthesis of the Tagged protected nucleoside and the Tagged protected nucleotide of the present invention becomes easy, and also an effect of improving solubility and separation ability can be obtained.
[0197] In the general formula (1), m represents an integer of 1 to 5. When m is 2 or more, a plurality of ROs may be the same or different. Preferably m is an integer from 2 to 4, more preferably m is 3. In addition, when the carbonyl group (C?O group) directly bonded to the phenyl group is set to the 1-position, the RO group is preferably bonded to the 3-position, the 4-position, or the 5-position, and when m=3, it is preferably bonded to the 3-position, the 4-position, or the 5-position. Further, by adjusting the value of m within the range, it is possible to adjust the solubility of the Tagged protected nucleoside and the Tagged protected nucleotide of the present invention in a nonpolar solvent.
[0198] In the general formula (1), X represents O, S, NH, or NR.sup.N. Among them, X is preferably O.
[0199] In the general formula (1), n represents an integer of 1 to 4. Among them, n is preferably 1 or 2.
[0200] In the general formula (1), R.sup.N represents an optionally substituted alkyl group having 1 to 6 carbons. Examples of the R.sup.N include methyl group, ethyl group, 1-propyl group, 1-methyl-1-ethyl group, 1-butyl group, 1-methyl-1-propyl group, 1,1-dimethyl-1-ethyl group, 2-methyl-1-propyl group, 1-pentyl group, and 2-pentyl group.
[0201] In addition, in the present invention, it is preferable that the alkoxyphenyl compound and a derivative thereof are a compound represented by the general formula (2) or a derivative thereof.
##STR00027##
(In the formula, [0202] R.sup.1, R.sup.2, and R.sup.3 each independently represent an optionally substituted alkyl group having 10 to 40 carbons. [0203] X represents O, S, NH, or NR.sup.N. [0204] n represents an integer from 1 to 4. [0205] R.sup.N represents an optionally substituted alkyl group having 1 to 6 carbons.)
[0206] In Formula (2), R.sup.1, R.sup.2, and R.sup.3 each independently represent an optionally substituted alkyl group having 10 to 40 carbons. The R.sup.1, R.sup.2 and R.sup.3 may be alkyl groups having 13 to 30 carbon, alkyl groups having 15 to 20 carbons, and among them, alkyl groups having 18 carbons are preferable. The R.sup.1, R.sup.2, and R.sup.3 are independent of each other, and may be straight-chain or branched-class groups, but all are preferably straight-chain groups.
[0207] In the general formula (2), X, n, and R.sup.N are the same as those of the general formula (1).
[0208] In addition, although the alkoxyphenyl compound of the present invention and a derivative thereof have been exemplified by the syn thesis method as an example, they may be synthesized using a know n method using a commercially available raw material. [0209] [Tagged protected nucleosides and Tagged protected nucleotides, etc.]
[0210] The Tagged protected nucleosides and the Tagged protected nucleotides in the present invention are a compound represented by the general formula (3) or a derivative thereof.
##STR00028##
(In the formula, [0211] R each independently represents an optionally substituted alkyl group having 10 to 40 carbons. [0212] m represents an integer between 1 and 5. When m is 2 or more, a plurality of ROs present may be the same or different. [0213] X represents O, S, NH, or NR.sup.N. [0214] n represents an integer from 1 to 4. [0215] R.sup.N represents an optionally substituted alkyl group having 1 to 6 carbons. [0216] Y represents the following general formula (4) or general formula (5).)
##STR00029##
(In the formula, [0217] Base represents a nucleobase which may be modified. When 2 or more Bases are present, a plurality of Bases present may be the same or different. [0218] B represents a hydrogen atom, an optionally protected hydroxyl group, or a halogen. When 2 or more Bs are present, a plurality of Bs present may be the same or different. [0219] W represents a hydrogen atom or protecting group. [0220] R.sup.4 represents an alkyl group having 1 to 4 carbons and having an electron-withdrawing group. If 2 or more R.sup.4s are present, a plurality of R.sup.4s present may be the same or different. [0221] Z represents O or S. When 2 or more Zs are present, a plurality of Zs present may be the same or different. [0222] y1 represents any integer greater than or equal to 0. [0223] * represents a bonding position in the general formula (3).)
##STR00030##
(In the formula, [0224] Base represents a nucleobase which may be modified. When 2 or more Bases are present, a plurality of Bases present may be the same or different. [0225] Q represents a hydrogen atom or protecting group. [0226] V represents an alkoxy group having 1 to 6 carbons, a di(C.sub.1-6 alkyl)amino group, or a piperazino group in which the nitrogen atom at the 4-position is protected with a protecting group and may be further substituted. When 2 or more Vs are present, a plurality of Vs present may be the same or different. [0227] y2 represents any integer greater than or equal to 0. [0228] * represents a bonding position in the general formula (3).)
[0229] In the general formula (3), R, m, X, n, and R.sup.N are the same as those of the general formula (1).
[0230] In the general formula (3), Y represents the following general formula (4) or the general formula (5).
[0231] In the general formula (4), Base represents a nucleobase which may be modified. When 2 or more Bases are present, a plurality of Bases present may be the same or different.
[0232] Examples of the Base include adenyl groups, guanyl groups, sitosyl groups, thyminyl groups, or uracil groups, and derivatives thereof, as well as modifications thereof. As the above-mentioned modifications, for example, a polar group or the like may be protected by a known protecting group or the like. In addition, a plurality of Bases present in the oligonucleotide may be the same or different.
[0233] In the general formula (4), B represents a hydrogen atom, an optionally protected hydroxyl group, or a halogen. When 2 or more B s are present, a plurality of Bs present may be the same or different. In addition, in the case of a protected hydroxyl group, a known method can be appropriately used as a protecting group and a protective method.
[0234] In the general formula (4), W represents a hydrogen atom or protecting group. When W is a protecting group, a known method can be appropriately used as a protecting group and a protecting method.
[0235] It is also preferred that W is a hydrogen atom, a trityl group, a di(C.sub.1-6 alkoxy)trityl group, a mono(C.sub.1-18 alkoxy)trityl group, a 9-(9-phenyl) xanthenyl group, or a 9-(9-phenyl)thioxanthenyl group. When W is any of the above, the synthesis of oligonucleotides can be more conveniently performed.
[0236] In the general formula (4), R.sup.4 represents an alkyl group having 1 to 4 carbons and having an electron-withdrawing group. If 2 or more R.sup.4s are present, a plurality of R.sup.4s present may be the same or different. It is also preferred that R.sup.4 is an ethylenic group having an electron-withdrawing group at the 2-position. Further, as the electron-withdrawing group, for example, a cyano group can be mentioned as a preferable example.
[0237] In the general formula (4), Z represents O or S. When 2 or more Zs are present, a plurality of Zs present may be the same or different.
[0238] In the general formula (4), y1 represents an arbitrary integer of 0 or more. y1 may be 1 to 100, 1 to 50, 1 to 30, 1 to 20, 1 to 10, or 0.
[0239] In the general formula (4), * represents a bonding position in the general formula (3).
[0240] In the general formula (5), Base is the same as in the general formula (4).
[0241] In the general formula (5), Q represents a hydrogen atom or protecting group. When Q is a protecting group, a known method can be appropriately used as a protecting group and a protecting method.
[0242] It is also preferred that Q is a hydrogen atom, a trityl group, a di(C.sub.1-6 alkoxy)trityl group, a mono(C.sub.1-18 alkoxy)trityl group, a 9-(9-phenyl) xanthenyl group, or a 9-(9-phenyl)thioxanthenyl group. When Q is any of the above, synthesis of oligonucleotides can be more conveniently performed.
[0243] In the general formula (5), V represents an alkoxy group having 1 to 6 carbons, a di(C.sub.1-6 alkyl)amino group, or a piperazino group in which a nitrogen atom at the 4-position is protected with a protecting group and may be further substituted. When 2 or more Vs are present, a plurality of Vs present may be the same or different.
[0244] In the general formula (5), y2 represents an arbitrary integer of 0 or more. y2 may be 1 to 100, 1 to 50, 1 to 30, 1 to 20, 1 to 10, or 0.
[0245] In the general formula (5), * represents a bonding position in the general formula (3).
[0246] Further, it is preferable that the Tagged protected nucleoside and the Tagged protected nucleotide of the present invention be the compound represented by the general formula (6) or a derivative thereof.
##STR00031##
(In the formula, [0247] R.sup.1, R.sup.2, and R.sup.3 each independently represent an optionally substituted, 10 to 40 carbons. [0248] X represents O, S, NH, or NR.sup.N. [0249] n represents an integer from 1 to 4. [0250] R.sup.N represents an optionally substituted alkyl group having 1 to 6 carbons. [0251] Y represents the following general formula (4) or general formula (5).)
##STR00032##
(In the formula, [0252] Base represents a nucleobase which may be modified. When 2 or more Bases are present, a plurality of Bases present may be the same or different. [0253] B represents a hydrogen atom, an optionally protected hydroxyl group, or a halogen. When 2 or more Bs are present, a plurality of Bs present may be the same or different. [0254] W represents a hydrogen atom or protecting group. [0255] R.sup.4 represents an alkyl group having 1 to 4 carbons and having an electron-withdrawing group. If 2 or more R.sup.4s are present, a plurality of R.sup.4s present may be the same or different. [0256] Z represents O or S. When 2 or more Zs are present, a plurality of Zs present may be the same or different. [0257] y1 represents any integer greater than or equal to 0. [0258] * represents a bonding position in the general formula (6).)
##STR00033##
(In the formula, [0259] Base represents a nucleobase which may be modified. When 2 or more Bases are present, a plurality of Bases present may be the same or different. [0260] Q represents a hydrogen atom or protecting group. [0261] V represents an alkoxy group having 1 to 6 carbons, a di(C.sub.1-6 alkyl)amino group, or a piperazino group in which the nitrogen atom at the 4-position is protected with a protecting group and may be further substituted. When 2 or more Vs are present, a plurality of Vs present may be the same or different. [0262] y2 represents any integer greater than or equal to 0. [0263] * represents a bonding position in the general formula (6).)
[0264] In the general formula (6), R.sup.1, R.sup.2, R.sup.3, X, n, and R.sup.N are the same as in the general formula (2).
[0265] In the general formula (6), Y is the same as in the general formula (3).
[0266] In addition, although the Tagged protected nucleoside and the Tagged protected nucleotide of the present invention have been exemplified by the synthesis method in the examples, they may be synthesized using a known method using a commercially available raw material.
[0267] As a method (synthesis method) for producing a Tagged protected nucleoside and a Tagged protected nucleotide of the present invention, for example, it can be obtained by a method of binding a nucleoside or a nucleotide with an alkoxyphenyl compound or a derivative thereof described above. As a binding method, for example, a method of subjecting the alkoxyphenyl compound or a derivative thereof to a condensation reaction with a nucleoside or a nucleotide can be mentioned. When using the condensation reaction above, for example, the method of combining the alkoxyphenyl compound represented by a general formula (1) or (2) and a nucleoside or a nucleotide using a condensation agent, or the method of binding the derivative (for example, ester derivative, acid chloride derivative, etc.) of the alkoxyphenyl compound represented by the general formula (1) or (2) whose reactivity has been enhanced by a substituent or the like to a nucleoside or a nucleotide, or the method of binding the alkoxyphenyl compound represented by the general formula (1) or (2) with a nucleoside or a nucleotide whose reactivity has been enhanced by a substituent or the like, can be appropriately used. [0268] [Method for Producing Protected Oligonucleotide and Method f or Removing Tag Moiety, etc.]
[0269] The method for producing a protected oligonucleotide of the present invention (synthesis method) and method for removing the Tag moiety of the present invention (substituent removing method) include a step (1) of subjecting a compound represented by the general formula (3) or a derivative thereof to reduction treatment.
##STR00034##
(In the formula, [0270] R each independently represents an optionally substituted alkyl group having 10 to 40 carbons. [0271] m represents an integer between 1 and 5. When m is 2 or more, a plurality of ROs present may be the same or different. [0272] X represents O, S, NH, or NR.sup.N. [0273] n represents an integer from 1 to 4. [0274] R.sup.N represents an optionally substituted alkyl group having 1 to 6 carbons. [0275] Y represents the following general formula (4) or general formula (5).)
##STR00035##
(In the formula, [0276] Base represents a nucleobase which may be modified. When 2 or more Bases are present, a plurality of Bases present may be the same or different. [0277] B represents a hydrogen atom, an optionally protected hydroxyl group, or a halogen. When 2 or more Bs are present, a plurality of Bs p resent may be the same or different. [0278] W represents a hydrogen atom or protecting group. [0279] R.sup.4 represents an alkyl group having 1 to 4 carbons and having an electron-withdrawing group. If 2 or more R.sup.4s are present, a plurality of R.sup.4s present may be the same or different. [0280] Z represents O or S. When 2 or more Zs are present, a plurality of Zs present may be the same or different. [0281] y1 represents any integer greater than or equal to 0. [0282] * represents a bonding position in the general formula (3).)
##STR00036##
(In the formula, [0283] Base represents a nucleobase which may be modified. When 2 or more Bases are present, a plurality of Bases present may be the same or different. [0284] Q represents a hydrogen atom or protecting group. [0285] V represents an alkoxy group having 1 to 6 carbon atoms, a di(C.sub.1-6 alkyl)amino group, or a piperazino group in which the nitrogen atom at the 4-position is protected with a protecting group and may be further substituted. When V are present in an amount of 2 or more, a plurality of V present may be the same or different. [0286] y2 represents any integer greater than or equal to 0. [0287] * represents a bonding position in the general formula (3).)
##STR00037##
(In the formula, [0288] Base represents a nucleobase which may be modified. When 2 or more Bases are present, a plurality of Bases present may be the same or different. [0289] B represents a hydrogen atom, an optionally protected hydroxyl group, or a halogen. When 2 or more Bs are present, a plurality of Bs present may be the same or different. [0290] W represents a hydrogen atom or protecting group. [0291] R.sup.4 represents an alkyl group having 1 to 4 carbons and having an electron-withdrawing group. If 2 or more R.sup.4s are present, a plurality of R.sup.4s present may be the same or different. [0292] Z represents O or S. When 2 or more Zs are present, a plurality of Zs present may be the same or different. [0293] y1 represents any integer greater than or equal to 0.)
##STR00038##
(In the formula, [0294] Base represents a nucleobase which may be modified. When 2 or more Bases are present, a plurality of Bases present may be the same or different. [0295] Q represents a hydrogen atom or protecting group. [0296] V represents an alkoxy group having 1 to 6 carbons, a di(C.sub.1-6 alkyl)amino group, or a piperazino group in which the nitrogen atom at the 4-position is protected with a protecting group and may be further substituted. When 2 or more Vs are present, a plurality of V presents may be the same or different. [0297] y2 represents any integer greater than or equal to 0.)
[0298] In the method for producing a protected oligonucleotide described above, the general formulas (3), (4), and (5) are the same as de scribed above.
[0299] In the general formula (7) in the method for producing a protected oligonucleotide above, Base, B, W, R.sup.4, Z, and y1 are the same as those of the general formula (4).
[0300] In the general formula (8) in the method for producing a protected oligonucleotide, Base, Q, V, and y2 are the same as those of the general formula (5).
[0301] In the method for producing a protected oligonucleotide of the present invention and method for removing the Tag moiety of the pre sent invention, it is preferable to include a step (1) of subjecting a compound represented by the general formula (6) or a derivative thereof to reduction treatment.
##STR00039##
(In the formula, [0302] R.sup.1, R.sup.2, and R.sup.3 each independently represent an optionally substituted alkyl group having 10 to 40 carbons. [0303] X represents O, S, NH, or NR.sup.N. [0304] n represents an integer from 1 to 4. [0305] R.sup.N represents an optionally substituted alkyl group having 1 to 6 carbons. [0306] Y represents the following general formula (4) or general formula (5).)
##STR00040##
(In the formula, [0307] Base represents a nucleobase which may be modified. When 2 or more Bases are present, a plurality of Bases present may be the same or different. [0308] B represents a hydrogen atom, an optionally protected hydroxyl group, or a halogen. When 2 or more Bs are present, a plurality of Bs present may be the same or different. [0309] W represents a hydrogen atom or protecting group. [0310] R.sup.4 represents an alkyl group having 1 to 4 carbons and having an electron-withdrawing group. If 2 or more R.sup.4s are present, a plurality of R.sup.4s present may be the same or different. [0311] Z represents O or S. When 2 or more Zs are present, a plurality of Zs present may be the same or different. [0312] y1 represents any integer greater than or equal to 0. [0313] * represents a bonding position in the general formula (6).)
##STR00041##
(In the formula, [0314] Base represents a nucleobase which may be modified. When 2 or more Bases are present, a plurality of Bases present may be the same or different. [0315] Q represents a hydrogen atom or protecting group. [0316] V represents an alkoxy group having 1 to 6 carbons, a di(C.sub.1-6 alkyl)amino group, or a piperazino group in which the nitrogen atom at the 4-position is protected with a protecting group and may be further substituted. When 2 or more Vs are present, a plurality of Vs present may be the same or different. [0317] y2 represents any integer greater than or equal to 0. [0318] * represents a bonding position in the general formula (6).)
##STR00042##
(In the formula, [0319] Base represents a nucleobase which may be modified. When 2 or more Bases are present, a plurality of Bases present may be the same or different. [0320] B represents a hydrogen atom, an optionally protected hydroxyl group, or a halogen. When 2 or more Bs are present, a plurality of Bs present may be the same or different. [0321] W represents a hydrogen atom or protecting group. [0322] R.sup.4 represents an alkyl group having 1 to 4 carbons and having an electron-withdrawing group. If 2 or more R.sup.4s are present, a plurality of R.sup.4s present may be the same or different. [0323] Z represents O or S. When 2 or more Zs are present, a plurality of Zs present may be the same or different. [0324] y1 represents any integer greater than or equal to 0.)
##STR00043##
(In the formula, [0325] Base represents a nucleobase which may be modified. When 2 or more Bases are present, a plurality of Bases present may be the same or different. [0326] Q represents a hydrogen atom or protecting group. [0327] V represents an alkoxy group having 1 to 6 carbons, a di(C.sub.1-6 alkyl)amino group, or a piperazino group in which the nitrogen atom at the 4-position is protected with a protecting group and may be further substituted. When 2 or more Vs are present, a plurality of V presents may be the same or different. [0328] y2 represents any integer greater than or equal to 0.)
[0329] In the method for producing the protected oligonucleotide and method for removing the Tag moiety of the present invention, the general formulas (3), (4), and (5) are the same as described above.
[0330] In the method for producing the protected oligonucleotide and the inventive method for removing the Tag moiety, in the general formula (7), Base, B, W, R.sup.4, Z, and y1 are the same as those of the general formula (4).
[0331] In the method for producing the protected oligonucleotide and method for removing the Tag moiety of the present invention, in the general formula (8), Base, Q, V, and y2 are the same as those of the general formula (5).
[0332] In the method for producing the protected oligonucleotide and method for removing the Tag moiety of the present invention, it is preferable that the reduction treatment is one using a boron-containing reducing agent or using a boron-containing reducing agent and an a mine. By having the configuration, a protected oligonucleotide can be more conveniently synthesized.
[0333] As the boron-containing reducing agent, a known one can be used, but among them, lithium borohydride, sodium borohydride, lithium triethylborohydride, tetrabutylammonium borohydride, and the like are preferred. These compounds may be used alone, or 2 or more of them may be used in combination. By having the configuration, a protected oligonucleotide can be conveniently synthesized in better yield.
[0334] When the boron-containing reducing agent and an amine are used, a known one can be used as the amine, but among them, diisopropylethylamine, triethylamine, pyridine, and the like are preferred. These compounds may be used alone, or 2 or more of them may be used in combination. By having the configuration, a protected oligonucleotide can be conveniently synthesized in better yield.
[0335] In the step (1), a known method may be used using a commercially available raw material, unless the chemical structure of the compound or a derivative thereof where the synthesis method or the re action method is represented by the general formula (6) or the like are damaged.
[0336] The step (1) may be, for example, a step of dissolving or mixing a compound represented by the general formula (6) or the like or a derivative thereof with a boron-containing reducing agent or a boron-containing reducing agent and an amine in an organic solvent, and stirring and reacting the mixture at ?10? C. or at room temperature.
[0337] In addition, a method for producing a protected oligonucleotide of the present invention and a method for removing a Tag moiety of the present invention illustrate a synthesis method and a reaction method thereof in Examples, but other known methods may be used using a commercially available raw material.
[0338] As a method for producing a Tagged protected oligonucleotide of the present invention, for example, a 2 mer is taken as an example, and a Tagged protected nucleoside or a Tagged protected nucleotide described is subjected to a coupling reaction with an amidated nucleoside or nucleotide (Step A), and the obtained 2 mer is subjected to phosphoric esterification in an oxidation step (Step B), and deprotection of the protecting group W is performed (Step C), and filtration (Step D) is performed, whereby a 2 mer of a Tagged protected nucleotide can be obtained. Further, examples of the higher order (n+1) mer include a method in which the method is similarly obtained n times, and a method in which a nucleotide derivative having a certain length is used to bind them to each other.
Examples
[0339] Hereinafter, examples and the like specifically showing the configuration and effects of the present invention will be described. Hereinafter, the concentration operation in the examples was carried out under reduced pressure unless otherwise specified. The evaluation items in Examples and the like were measured as follows.
<Measurement of .SUP.1.H-NMR Spectrum>
[0340] .sup.1H-NMR spectrum was measured using a nuclear magnetic resonance apparatus (manufactured by Nippon Electronics Co., Ltd., product name AL400, and product name ECS-600) and tetramethylsilane as an internal standard.
<Determination of .SUP.13.C-NMR Spectrum>
[0341] .sup.13C-NMR spectrum was measured using nuclear magnetic resonators (manufactured by Japan Electronics Co., Ltd., under the product name AL400, and by Japan Electronics Co., Ltd., under the product name ECS-600) and using tetramethylsilane as an internal standard.
<Measure TOF/MS Spectrum>
[0342] TOF/MS spectra were measured using time-of-flight mass spectrometry (Waters, product name LCT-PremierXE and Japanese Electronic, product name JMS T-100LP).
1. Synthesis of 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetic Acid
(A) Process Via Tert-Butyl Ester
Example 1-1
(1) Synthesis of 2-(Tert-Butoxy)-2-Oxoethyl 3,4,5-Tris(Octadecyloxy)Benzoate
[0343] ##STR00044##
[0344] Triethylamine (0.39 g, 3.87 mmol) and 2-butyl tert-bromoacetate (0.76 g, 3.87 mmol) was added to a suspension of 3,4,5-tris(octadecyloxy)benzoic acid (1.80 g, 1.94 mmol) in THF (10 mL), and then stirred at 60? C. for 2 hours. After cooling the reaction solution to room temperature, the solid precipitated by dropping methanol (54 mL) was filtered. The solid was washed with methanol, and then dried in vacuo at 50? C. to give the title compound (1.95 g, 97%) as a white solid.
[0345] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.16-1.41 (m, 84H), 1.41-1.57 (m, 6H), 1.49 (s, 9H), 1.66-1.88 (m, 6H), 3.95-4.11 (m, 6H), 4.70 (s, 2H), 7.31 (s, 2H).
[0346] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 14.02, 22.48, 22.66, 22.83, 26.08, 26.11, 27.88, 28.08, 29.35, 29.40, 29.56, 29.64, 29.65, 29.70, 29.97, 30.22, 30.36, 31.76, 31.93, 32.10, 61.66, 69.35, 73.51, 82.32, 108.69, 108.90, 123.82, 123.93, 143.11, 143.38, 152.93, 165.83, 166.90.
[0347] TOF/MS (ESI): calcd for C.sub.67H.sub.124O.sub.7Na [M+Na].sup.+1063.9245, found 1063.9254.
Example 1-2
(2) Synthesis of 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetic Acid
[0348] ##STR00045##
[0349] Trifluoroacetic acid (11.40 g, 100.0 mmol) was added to a solution of 2-(tert-butoxy)-2-oxoethyl 3,4,5-tris(octadecyloxy)benzoate (5.21 g, 5.0 mmol) in chloroform (20 ml), and then stirred at 50? C. for 17 hours. After cooling the reaction solution to room temperature, the solid precipitated by dropping acetonitrile (50 mL) was filtered. The solid was washed with acetonitrile-chloroform mixture solvent, and then dried in vacuo at 50? C. to give the title compound (4.89 g, 99%) as a white solid.
[0350] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=7.0 Hz), 1.16-1.54 (m, 90H), 1.69-1.88 (m, 6H), 3.95-4.11 (m, 6H), 4.87 (s, 2H), 7.30 (s, 2H).
[0351] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 14.08, 22.68, 26.06, 26.10, 29.36, 29.41, 29.57, 29.65, 29.66, 29.72, 30.35, 31.93, 60.49, 69.30, 73.57, 108.53, 123.31, 143.17, 152.96, 165.74.
[0352] TOF/MS (ESI): calcd for C.sub.63H.sub.116O.sub.7Na [M+Na].sup.+1007.8619, found 1007.8639.
(B) Process Via Benzyl Esters
Example 1-3
(1) Synthesis of 2-Benzyloxy-2-Oxoethyl 3,4,5-Tris(Octadecyloxy)Benzoate
[0353] ##STR00046##
[0354] Triethylamine (0.20 g, 1.94 mmol) and benzyl 2-bromoacetate (0.45 g, 1.94 mmol) was added to a suspension of 3,4,5-tris(octadecyloxy)benzoic acid (0.90 g, 0.97 mmol) in chloroform (5 mL), and then stirred at 50? C. for 14 hours. After cooling the reaction solution to room temperature, the solid precipitated by dropping methanol (18 mL) was filtered. The solid was washed with methanol, and then dried in vacuo at 50? C. to give the title compound (1.02 g, 97%) as a white solid.
[0355] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.16-1.41 (m, 84H), 1.41-1.54 (m, 6H), 1.66-1.91 (m, 6H), 3.95-4.08 (m, 6H), 4.86 (s, 2H), 5.23 (s, 2H), 7.24-7.41 (m, 7H).
[0356] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 14.08, 22.71, 26.13, 26.16, 29.40, 29.43, 29.46, 29.62, 29.69, 29.71, 29.76, 30.00, 30.43, 31.98, 61.24, 67.07, 69.40, 73.59, 108.76, 123.69, 128.32, 128.50, 128.65, 135.35, 143.28, 152.96, 153.01, 165.84, 167.77.
Example 1-4
(2) Synthesis of 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetic Acid
[0357] ##STR00047##
[0358] 10% Pd-C (0.09 g) was added to a solution of 2-benzyloxy-2-oxoethyl 3,4,5-tris(octadecyloxy)benzoate (0.91 g, 0.85 mmol) in THF (4.3 mL), and then stirred under a hydrogen balloon at 40? C. for 19 hours. The reaction solution was cooled to room temperature, and then 10% Pd-C was removed by Celite filtration. After concentrating the filtrate, the solid precipitated by dropping acetonitrile (18 mL) to the residue was filtered. The solid was washed with acetonitrile, and then dried in vacuo at 50? C. to give the title compound (0.84 g, 100%) as a white solid. [0359] 2. Synthesis of thymidinyl-[3.fwdarw.5]-deoxycytidinyl-[3.fwdarw.5]-deoxycytidinyl-[3.fwdarw.5]-deoxycytidinyl-[3.fwdarw.5]-deoxyguanidyl-[3.fwdarw.5]-deoxycytidinyl-[3.fwdarw.5]-deoxycytidinyl-[3.fwdarw.5]thymidinyl-[3.fwdarw.5]-deoxyguanidyl-[3.fwdarw.5]-thymidinyl-[3.fwdarw.5]-deoxyguanidyl-[3.fwdarw.5]-deoxyadenylyl-[3.fwdarw.5]-deoxycytidinyl-[3.fwdarw.5]-deoxyadenylyl-[3.fwdarw.5]-thymidinyl-[3.fwdarw.5]-deoxyguanidyl-[3.fwdarw.5]-deoxycytidinyl-[3.fwdarw.5]-deoxyadenylyl-[3.fwdarw.5]-thymidinyl-[3.fwdarw.5]thymidine (20 mer oligonucleic acid)
Example 2-1
(1) Synthesis of 5-O-(4,4-Dimethoxytrityl)Thymidine-3-Yl 2-((3, 4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0360] ##STR00048##
[0361] COMU (4.73 g, 11.05 mmol) was added to a suspension of 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetic acid (4.95 g, 5.02 mmol), 5-O-(4,4-dimethoxytrityl)thymidine (3.28 g, 6.03 mmol), and 1-methylimidazole (2.27 g, 27.62 mmol) in THF (50 mL), and then stirred at room temperature for 3.5 hours. The solid precipitated by dropping acetonitrile (248 mL) to the reaction solution was filtered. The solid was washed with acetonitrile-THF mixture solvent, and then dried in vacuo at 50? C. to give the title compound (7.16 g, 95%).
[0362] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.16-1.54 (m, 93H), 1.69-1.88 (m, 6H), 2.42-2.58 (m, 2H), 3.42-3.55 (m, 2H), 3.78 (s, 6H), 3.95-4.05 (m, 6H), 4.18 (s, 1H), 4.82 (s, 2H), 5.56 (d, 1H, J=5.6 Hz), 6.40-6.50 (m, 1H), 6.80-6.90 (m, 4H), 7.20-7.40 (m, 9H), 7.61 (s, 1H), 8.03 (s, 1H).
[0363] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 11.62, 14.10, 22.71, 26.11, 26.15, 29.38, 29.45, 29.61, 29.68, 29.75, 30.40, 31.96, 37.88, 55.28, 61.12, 63.68, 69.35, 73.60, 83.93, 84.40, 87.36, 108.59, 111.66, 113.43, 123.26, 127.29, 128.08, 128.19, 130.10, 130.15, 135.20, 135.25, 135.32, 144.22, 150.11, 153.02, 158.92, 163.16, 165.85, 167.50.
[0364] TOF/MS (ESI): calcd for C.sub.94H.sub.146N.sub.2O.sub.13Na [M+Na].sup.+1534.0723, found 1534.0759.
Example 2-2
(2) Synthesis of Thymidine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0365] ##STR00049##
[0366] Pyrrole (1.54 g, 22.98 mmol) and trifluoroacetic acid (0.66 g, 5.75 mmol) were added to a solution of 5-O-(4,4-dimethoxytrityl)thymidine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (6.95 g, 4.60 mmol) in dichloromethane (174 mL), and then stirred at room temperature for 2.5 hours. the solid precipitated by dropping acetonitrile (52 mL) and acetonitrile (156 mL) to the reaction solution was filtered. The solid was washed with acetonitrile-acetone-dichloromethane mixture solvent and acetonitrile, and then dried in vacuo at 50? C. to give the title compound (5.04 g, 91%).
[0367] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.11-1.39 (m, 84H), 1.43-1.51 (m, 6H), 1.66 (s, 1H), 1.71-1.85 (m, 6H), 1.95 (s, 3H), 2.36-2.58 (m, 3H), 3.89-3.97 (m, 2H), 3.97-4.08 (m, 6H), 4.15 (dd, 1H, J=2.0, 2.4 Hz), 4.84 (s, 2H), 5.45-5.53 (m, 1H), 6.20 (dd, 1H, J=6.0, 8.8 Hz), 7.29 (s, 2H), 7.45 (d, 1H, J=1.2 Hz), 8.59 (s, 1H).
[0368] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 12.58, 14.12, 22.70, 26.07, 26.11, 29.33, 29.38, 29.43, 29.59, 29.67, 29.68, 29.73, 30.35, 31.94, 36.99, 61.12, 62.57, 69.24, 73.58, 75.97, 84.91, 86.46, 108.36, 111.48, 123.17, 136.41, 143.09, 150.29, 152.96, 163.40, 165.91, 167.71.
[0369] TOF/MS (ESI): calcd for C.sub.73H.sub.128N.sub.2O.sub.11Na [M+Na].sup.+1231.9416, found 1231.9432.
Example 2-3
(3) Synthesis of 5-O-((Cyanoethoxy)(Thymidine-3-Yl)Phosphoryl) Thymidine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0370] ##STR00050##
[0371] Under argon atmosphere, 5-benzylthio-1H-tetrazole (0.32 g, 1.65 mmol) was added to a suspension of thymidine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (1.00 g, 0.83 mmol) and 5-O-(4,4-dimethoxytrityl) thymidine-3-yl-phosphoroamidite (1.23 g, 1.65 mmol) in dichloromethane (15 mL), and then stirred at room temperature for 1.5 hours. Next, cumene hydroperoxide (content: 82%) (0.23 g, 1.24 mmol) was added, and then stirred at room temperature for 2 hours. Pyrrole (0.56 g, 8.27 mmol) and trifluoroacetic acid (0.28 g, 2.48 mmol) was added to the reaction solution, and then stirred at room temperature for 2 hours. The solid precipitated by dropping acetone (15 mL) and acetonitrile (45 mL) to the reaction solution was filtered. The solid was washed with acetonitrile-acetone-dichloromethane mixture solvent and acetonitrile, and then dried in vacuo at 50? C. to give the title compound (1.20 g, 92%) as a white solid.
[0372] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.11-1.55 (m, 90H), 1.65-2.05 (m, 12H), 2.40-2.60 (m, 4H), 2.75-2.90 (m, 2H), 3.84 (s, 2H), 3.95-4.10 (m, 6H), 4.15-4.50 (m, 6H), 4.85 (s, 2H), 5.15-5.25 (m, 1H), 5.35-5.55 (m, 1H), 6.10-6.35 (m, 2H), 7.29 (s, 2H), 7.35 (d, 1H, J=1.2 Hz), 7.47 (s, 1H), 9.60-9.95 (m, 2H).
[0373] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 12.42, 12.46, 14.10, 19.72, 19.79, 22.71, 26.12, 26.19, 29.38, 29.43, 29.49, 29.63, 29.70, 29.75, 30.43, 31.96, 36.47, 36.56, 38.46, 61.14, 61.91, 62.00, 62.63, 62.68, 62.75, 62.80, 67.53, 69.42, 73.64, 74.66, 74.77, 78.94, 79.12, 82.33, 82.40, 82.48, 85.60, 85.66, 85.79, 86.02, 86.21, 86.35, 108.61, 111.27, 111.33, 111.73, 111.82, 116.58, 116.66, 123.15, 135.87, 135.94, 136.53, 136.62, 143.41, 150.49, 150.59, 153.07, 163.94, 164.02, 165.69, 167.79, 167.83.
[0374] TOF/MS (ESI): calcd for C.sub.86H.sub.144N.sub.5O.sub.18PNa [M+Na].sup.+1589.0142, found 1589.0104.
Example 2-4
(4) 5-O-((2-cyanoethoxy)(5-O-((2-cyanoethoxy)(5-O-((2-cyanoethoxy) (5-O-((2-cyanoethoxy)(5-O-((2-cyanoethoxy)(5-O-((2-cyanoethoxy) (5-O-((2-cyanoethoxy)(5-O-((2-cyanoethoxy)(5-O-((2-cyanoethoxy) (5-O-((2-cyanoethoxy)(5-O-((2-cyanoethoxy) (5-O-((2-cyanoethoxy) (5-O-((2-cyanoethoxy)(5-O-((2-cyanoethoxy)(5-O-((2-cyanoethoxy) (5-O-((2-cyanoethoxy)(5-O-((2-cyanoethoxy)(5-O-((2-cyanoethoxy) (5-O-((2-cyanoethoxy)(thymidine-3-yl)phosphoryl)-N.SUP.4.Benzoyldeoxycytidine-3-yl)phosphoryl)-N.SUP.4.-benzoyldeoxycytidine-3-yl)phosphoryl)-N.SUP.4.-benzoyldeoxycytidine-3-yl)phosphoryl)-N.SUP.2.-isobutyryldeoxyguanosine-3-yl)phosphoryl)-N.SUP.4.-benzoyldeoxycytidine-3-yl)phosphoryl)-N.SUP.4.-benzoyl deoxycytidine-3-yl)phosphoryl)-thymidine-3-yl)phosphoryl)-N.SUP.2.-isobutyryldeoxyguanosine-3-yl)phosphoryl)-thymidine-3-yl)phosphoryl)-N.SUP.2.-isobutyryldeoxyguanosine-3-yl)phosphoryl)-N.SUP.6.-benzoyldeoxyadenosine-3-yl)phosphoryl)-N.SUP.4.-benzoyldeoxycytidine-3-yl)-phosphoryl)-N.SUP.6.-benzoyldeoxyadenosine-3-yl)phosphoryl)-thymidine-3-yl)phosphoryl)-N.SUP.2.-isobutyryldeoxyguanosine-3-yl)phosphoryl)-N.SUP.2.-benzoyldeoxycytidine-3-yl)phosphoryl)-N.SUP.6.-benzoyldeoxyadenosine-3-yl)phosphoryl)-thymidine-3-yl)phosphoryl)-thymidine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate
[0375] The same procedure as in Example 2-3 was repeated 18 times to give the title compound (1.10 g)
[0376] TOF/MS (ESI): m/z 3114.3 [M?3H].sup.3?, 2335.6 [M?4H].sup.4?, 1868.9 [M?5H].sup.5?, 1557.6 [M?6H].sup.6?.
Example 2-5
(5) Deprotection and Purification Steps
[0377] 28% ammonia water (2.1 mL) was added to the compound synthesized in Example 2-4 (50 mg, 5.4 ?mol), and then heated and stirred at 80? C. for 1.5 hours. After concentrating the reaction solution under reduced pressure, the insoluble compound precipitated by dropping acetonitrile (50 mL) adding 0.1 mol/L-triethylamine acetate buffer to the concentrated residue was filtered. The eluate obtained by purifying C-18 cartridges of the filtrate was dried, and then Thymidinyl-[3.fwdarw.5]-deoxycytidinyl-[3.fwdarw.5]-deoxycytidinyl-[3.fwdarw.5]-deoxycytidinyl-[3.fwdarw.5]-deoxyguanidyl-[3.fwdarw.5]-deoxycytidinyl-[3.fwdarw.5]-deoxycytidinyl-[3.fwdarw.5]-thymidinyl-[3.fwdarw.5]-deoxyguanidyl-[3.fwdarw.5]-thymidinyl-[3.fwdarw.5]-deoxyguanidyl-[3.fwdarw.5]-deoxyadenylyl-[3.fwdarw.5]-deoxycyidinyl-[3.fwdarw.5]-deoxyadenylyl-[3.fwdarw.5]-thymidinyl-[3.fwdarw.5]-deoxyguanidyl-[3.fwdarw.5]-deoxycytidinyl-[3.fwdarw.5]-deoxyadenylyl-[3.fwdarw.5]-thymidinyl-[3.fwdarw.5]-thymidine was obtained.
[0378] HPLC (shodexODP (4.6??150 mm), flow rate: 1.0 mL/min, transfer: 0.1 mol/L triethylamine-acetate buffer, acetonitrile gradient: 0-15 min (2 to 98% acetonitrile), Rt=3.9 min (98.6%)
[0379] TOF/MS (ESI): m/z 3020.9 [M?2H].sup.2?, 2013.4 [M?3H].sup.3?, 1509.8 [M?4H].sup.4?.
(6) Synthesis of 5-O-(4,4-Dimethoxytrityl)Thymidine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
Example 2-6
[0380] (When EDCI-HCl is used as the condensing agent)
##STR00051##
[0381] 4-dimethylaminopyridine (0.02 g, 0.18 mmol) and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (0.34 g, 1.77 mmol) was added to a solution of 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetic acid (0.87 g, 0.89 mmol) and 5-O-(4,4-dimethoxytrityl)thymidine (0.97 g, 1.77 mmol) in THF (9 mL), and then stirred at room temperature for 14 hours. The solid precipitated by dropping acetonitrile (18 mL) to the reaction solution was filtered. The solid was washed with acetonitrile-THF mixture solvent, and then dried under reduced pressure at 50? C. to obtain a crude compound (1.28 g). The crude compound was purified by column chromatography (spherical neutral silica gel, eluent: chloroform-THF) to give the title compound (1.06 g, 79%) as a white solid.
Example 2-7
[0382] (When CDI is used as the condensing agent)
##STR00052##
[0383] 1,1-carbonyldiimidazole (2.43 g, 15.0 mmol) was added to a suspension of dichloromethane (210 mL) of 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetic acid (9.86 g, 10.0 mmol) and 4-dimethylaminopyridine (0.12 g, 1.0 mmol) and stirred at room temperature for 1 hour, and then stirred at 30 to 35? C. for 4 hours. Next, 5-O-(4,4-dimethoxytrityl) thymidine (10.89 g, 20.0 mmol) was added, and then stirred at room temperature for 17 hours. Further, after 5-O-(4,4-dimethoxy trityl)thymidine (1.09 g, 0.4 mmol) was added to the reaction solution, the solution was stirred at room temperature for 4.5 hours. After dichloromethane (10 mL) was added to the reaction solution, the solid precipitated by dropping acetonitrile (400 mL) was filtered. The solid was washed with acetonitrile-dichloromethane mixture solvent, and then dried under reduced pressure at 50? C. to obtain a crude compound (14.44 g). The crude compound was purified by column chromatography (spherical neutral silica gel, eluent: dichloromethane-methanol) to give the title compound (11.11 g, 74%) as a white solid.
3. Synthesis of 5-O-((2-Cyanoethoxy)(5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)-N.SUP.2.-Isobutyryldeoxyguanosine-3-Yl)Phosphoryl)Thymidine-3-Yl)Phosphoryl)-N.SUP.6.-Benzoyldeoxyadenosine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
Example 3-1
(1) Synthesis of 5-O-(4,4-Dimethoxytrityl)-N.SUP.6.-Benzoyldeoxyadenosine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0384] ##STR00053##
[0385] The title compound (3.11 g, 96%) was obtained from 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetic acid (1.97 g, 2.00 mmol) and 5-O-(4,4-dimethoxytrityl)-N.sup.6-benzoyldeoxyadenosine (1.58 g, 2.40 m mol) according to the procedure of Example 2-1.
[0386] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.11-1.40 (m, 84H), 1.42-1.50 (m, 6H), 1.71-1.84 (m, 7H), 2.73 (dd, 1H, J=4.4, 12.8 Hz), 3.04-3.13 (m, 1H), 3.46 (d, 2H, J=4.0 Hz), 3.77 (s, 6H), 3.99-4.05 (m, 6H), 4.34-4.37 (m, 1H), 4.86 (s, 2H), 5.67 (d, 1H, J=5.6 Hz), 6.51 (dd, 1H, J=5.6, 8.4 Hz), 6.79 (d, 2H, J=9.4 Hz), 7.18-7.29 (m, 7H), 7.31 (s, 2H), 7.38 (d, 2H, J=7.2 Hz), 7.53 (dd, 2H, J=7.2, 7.6 Hz), 7.59-7.63 (m, 1H), 8.03 (d, 2H, J=7.2 Hz), 8.17 (s, 1H), 8.74 (s, 1H), 8.98 (s, 1H).
[0387] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 14.13, 22.71, 26.08, 26.11, 29.33, 29.38, 29.43, 29.60, 29.67, 29.74, 30.36, 31.94, 38.00, 55.23, 61.16, 63.52, 69.23, 73.58, 84.35, 84.48, 86.82, 108.35, 113.25, 123.22, 123.32, 127.03, 127.85, 127.95, 128.08, 128.91, 129.99, 130.04, 132.82, 133.66, 135.38, 135.42, 141.21, 143.07, 144.33, 149.53, 151.56, 152.75, 152.97, 158.63, 164.48, 165.89, 167.38.
[0388] TOF/MS (ESI): calcd for C.sub.101H.sub.149N.sub.5O.sub.12Na [M+Na].sup.+1647.1100, found 1647.1149.
Example 3-2
(2) Synthesis of N.SUP.6.-Benzoyldeoxyadenosine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0389] ##STR00054##
[0390] The title compound (2.25 g, 92%) was obtained from 5-O-(4,4-dimethoxytrityl)-N.sup.6-benzoyldeoxyadenosine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (3.00 g, 1.85 mmol) according to the procedure of Example 2-2.
[0391] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.11-1.40 (m, 84H), 1.44-1.50 (m, 6H), 1.71-1.85 (m, 7H), 2.53 (dd, 1H, J=5.6, 14.0 Hz), 3.21-3.28 (m, 1H), 3.89-3.96 (m, 1H), 3.98-4.06 (m, 6H), 4.36 (s, 1H), 4.87 (s, 2H), 5.70 (d, 1H, J=5.2 Hz), 5.91 (brs, 1H), 6.32 (dd, 1H, J=5.6, 10.0 Hz), 7.32 (s, 2H), 7.54 (dd, 2H, J=7.2, 8.0 Hz), 7.61-7.65 (m, 1H), 8.03 (d, 2H, J=7.2 Hz), 8.07 (s, 1H), 8.79 (s, 1H), 9.07 (s, 1H).
[0392] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 14.12, 22.70, 26.07, 26.11, 29.33, 29.37, 29.42, 29.59, 29.67, 29.73, 30.35, 31.94, 37.76, 61.20, 63.17, 69.28, 73.60, 87.18, 87.61, 108.39, 123.17, 124.66, 127.90, 128.96, 133.01, 133.39, 142.42, 143.17, 150.40, 150.68, 152.26, 153.00, 164.42, 165.97, 167.41.
[0393] TOF/MS (ESI): calcd for C.sub.80H.sub.131N.sub.5O.sub.10Na [M+Na].sup.+1344.9794, found 1344.9828.
Example 3-3
(3) Synthesis of 5-O-((2-Cyanoethoxy)(Thymidine-3-Yl)Phosphoryl)-N.SUP.6.-Benzoyldeoxyadenosine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0394] ##STR00055##
[0395] The title compound (2.50 g, 97%) was obtained from N.sup.6-benzoyldeoxyadenosine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (2.00 g, 1.51 mmol) and DMTr-dT-CE-phosphoroamidite (2.25 g, 3.02 mmol) according to the methods of Examples 2-3.
[0396] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.12-1.40 (m, 84H), 1.43-1.50 (m, 6H), 1.71-1.85 (m, 9H), 1.94 (s, 1H), 2.22-2.51 (m, 2H), 2.70-2.78 (m, 3H), 3.14-3.26 (m, 1H), 3.45-3.56 (m, 1H), 3.69-3.85 (m, 2H), 3.95-4.07 (m, 6H), 4.07-4.32 (m, 3H), 4.40-4.48 (m, 3H), 4.88 (s, 2H), 4.99-5.11 (m, 1H), 5.67-5.73 (m, 1H), 6.11-6.22 (m, 1H), 6.50-6.58 (m, 1H), 7.30 (s, 2H), 7.41-7.53 (m, 3H), 7.57-7.61 (m, 1H), 8.02-8.06 (m, 2H), 8.38 (m, 1H), 8.81 (m, 1H), 9.58-9.67 (m, 2H).
[0397] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 12.43, 14.14, 19.66, 19.73, 19.78, 22.71, 26.09, 26.15, 29.35, 29.38, 29.46, 29.61, 29.68, 29.74, 29.99, 30.38, 31.94, 36.57, 36.87, 38.35, 61.13, 61.84, 61.92, 62.45, 62.49, 62.58, 62.62, 67.39, 69.27, 73.61, 74.81, 75.06, 78.89, 79.19, 79.24, 82.98, 83.05, 83.12, 84.47, 84.54, 85.43, 85.48, 85.62, 85.67, 85.79, 85.93, 108.34, 111.22, 111.27, 116.52, 116.64, 123.01, 123.82, 124.08, 128.27, 128.31, 128.69, 128.72, 132.87, 132.94, 133.17, 133.41, 136.45, 141.68, 141.86, 143.18, 149.93, 150.00, 150.47, 151.84, 152.05, 152.67, 153.01, 163.81, 163.86, 165.43, 165.53, 165.99, 167.76.
[0398] TOF/MS (ESI): calcd for C.sub.93H.sub.147N.sub.8O.sub.17PNa [M+Na].sup.+1702.0520, found 1702.0604.
Examples 3-4
(4) Synthesis of 5-O-((2-Cyanoethoxy)(5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)-N.SUP.2.-Isobutyryldeoxyguanosine-3-Yl)Phosphoryl) Thymidine-3-Yl)Phosphoryl-N.SUP.6.-Benzoyldeoxyadenosine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0399] ##STR00056##
[0400] 5-Benzylthio 1H tetrazole (2.74 g, 14.25 mmol) was added to a suspension of 5-O-((2-cyanoethoxy)(thymidine-3-yl)phosphoryl)-N.sup.6-benzoyldeoxyadenosine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)acetate (7.98 g, 4.75 mmol) and N.sup.2-isobutyryl-DMTr-dG-CE phosphoroamidite (11.97 g, 14.25 mmol) in dichloromethane (90 ml), and then stirred at room temperature for 3 hours. Next, cumene hydroperoxide (content: 82%) (2.64 g, 14.25 mmol) was added, and then stirred at room temperature for 1 hours. The solid precipitated by dropping Acetone (120 mL) and acetonitrile (359 mL) to the reaction solution was filtered. The solid was washed with a mixture solvent of acetonitrile-acetone-dichloromethane, acetonitrile, and methanol, and then dried in vacuo at 50? C. to give the title compound (10.86 g, 94%). .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.12-1.40 (m, 90H), 1.43-1.50 (m, 6H), 1.71-1.93 (m, 9H), 1.95-2.16 (m, 2H), 2.35-2.87 (m, 9H), 3.16-3.37 (m, 3H), 3.76 (s, 6H), 3.99-4.05 (m, 6H), 4.09-4.43 (m, 10H), 4.86 (s, 2H), 5.07-5.26 (m, 2H), 5.65-5.71 (m, 1H), 5.91-6.22 (m, 2H), 6.49-6.54 (m, 1H), 6.78 (d, 4H, J=8.4 Hz), 7.15-7.27 (m, 8H), 7.30 (s, 2H), 7.34-7.36 (m, 2H), 7.43-7.48 (m, 2H), 7.54-7.59 (m, 1H), 7.69-7.71 (m, 1H), 7.98-8.02 (m, 2H), 8.30-8.41 (m, 1H), 8.75-8.82 (m, 1H), 9.43-9.58 (m, 1H), 9.88-10.27 (m, 1H), 12.09-12.22 (m, 1H).
[0401] 13C-NMR (100 MHz, CDCl.sub.3): ? 12.23, 12.36, 14.13, 18.84, 19.00, 19.05, 19.65, 19.73, 22.70, 26.09, 26.15, 29.35, 29.37, 29.46, 29.61, 29.68, 29.74, 29.77, 30.38, 31.94, 35.89, 36.47, 36.63, 55.26, 61.13, 62.47, 62.63, 62.68, 63.42, 67.55, 69.28, 73.61, 74.86, 75.05, 79.76, 81.43, 83.08, 83.59, 84.68, 86.85, 108.33, 111.11, 111.17, 113.15, 113.26, 116.48, 116.75, 116.88, 121.42, 121.59, 123.03, 124.05, 127.07, 127.12, 127.78, 127.85, 127.98, 128.06, 128.74, 129.14, 130.05, 132.88, 133.37, 135.23, 139.48, 141.92, 142.01, 143.18, 144.23, 147.35, 148.11, 148.27, 148.49, 149.98, 150.09, 151.80, 152.60, 153.01, 155.40, 155.47, 158.62, 158.68, 164.77, 165.20, 165.96, 167.71, 167.74, 179.81, 180.21.
[0402] TOF/MS (ESI): calcd for C.sub.131H.sub.186N.sub.14O.sub.26P.sub.2Na [M+Na].sup.+2456.3036, found 2456.2988.
Synthesis of 5-O-((2-Cyanoethoxy)(5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)Thymidine-3-Yl)Phosphoryl)-N.SUP.2.-Isobutyryldeoxyguanosine-3-Yl)Phosphoryl)-N.SUP.4.-Benzoyldeoxycytidine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
Example 3-5
(1) Synthesis of 5-O-(4,4-Dimethoxytrityl)-N.SUP.4.-Benzoyldeoxycytidine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0403] ##STR00057##
[0404] The title compound (3.10 g, 97%) was obtained from 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetic acid (1.97 g, 2.00 mmol) and 5-O-(4,4-dimethoxytrityl)-N.sup.4-benzoyldeoxycytidine (1.52 g, 2.40 mmol) according to the procedure of Example 2-1.
[0405] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.12-1.53 (m, 90H), 1.71-1.85 (m, 6H), 2.36-2.43 (m, 1H), 2.83-2.95 (m, 1H), 3.49 (ddd, 2H, J=3.2, 10.4, 18.0 Hz), 3.78 (s, 3H), 3.79 (s, 3H), 3.95-4.07 (m, 6H), 4.30-4.35 (m, 1H), 4.83 (dd, 2H, J=16.0, 23.6 Hz), 5.51-5.58 (m, 1H), 6.33 (dd, 1H, J=6.0, 7.6 Hz), 6.86 (dd, 4H, J=2.4, 8.8 Hz), 7.20-7.38 (m, 11H), 7.50-7.54 (m, 2H), 7.60-7.64 (m, 1H), 7.88 (d, 2H, J=7.2 Hz), 8.14 (d, 1H, J=7.6 Hz), 8.40-8.60 (brs, 1H).
[0406] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 14.09, 22.70, 26.10, 26.15, 29.38, 29.46, 29.61, 29.68, 29.75, 30.40, 31.95, 39.47, 55.26, 61.10, 63.17, 69.33, 73.59, 75.77, 84.68, 87.32, 108.54, 113.46, 123.32, 127.22, 128.10, 128.13, 129.10, 130.04, 130.10, 133.20, 135.13, 135.30, 144.07, 153.01, 158.84, 165.81, 167.43.
[0407] TOF/MS (ESI): calcd for C.sub.100H.sub.149N.sub.3O.sub.13Na [M+Na].sup.+1623.0988, found 1623.1069.
Examples 3-6
(2) Synthesis of N.SUP.4.-Benzoyldeoxycytidine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0408] ##STR00058##
[0409] The title compound (2.39 g, 97%) was obtained from 5-O-(4,4-dimethoxytrityl)-N.sup.6-benzoyldeoxycytidine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (3.04 g, 1.90 mmol) according to the procedure of Example 2-2.
[0410] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.20-1.51 (m, 90H), 1.71-1.85 (m, 6H), 2.46-2.53 (m, 1H), 2.69-2.80 (m, 1H), 3.92-4.04 (m, 8H), 4.27 (d, 1H, J=2.4 Hz), 4.84 (dd, 2H, J=16.4, 20.4 Hz), 5.51-5.53 (m, 1H), 6.26 (dd, 1H, J=5.6, 7.6 Hz), 7.29 (s, 2H), 7.48-7.62 (m, 4H), 7.88 (d, 2H, J=7.6 Hz), 8.28 (d, 1H, J=7.2 Hz), 8.66-8.91 (brs, 1H).
[0411] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 14.10, 22.71, 26.10, 26.14, 29.38, 29.45, 29.61, 29.68, 29.75, 30.39, 31.95, 38.46, 61.15, 62.37, 69.34, 73.61, 75.80, 85.82, 88.44, 108.55, 123.25, 127.61, 129.07, 133.25, 143.25, 145.32, 153.01, 162.38, 165.89, 167.79.
[0412] TOF/MS (ESI): calcd for C.sub.79H.sub.131N.sub.3O.sub.11Na [M+Na].sup.+1320.9681, found 1320.9723.
Examples 3-7
(3) Synthesis of 5-O-((2-Cyanoethoxy)(N.SUP.2.-Isobutyryldeoxyguanosine-3-Yl)Phosphoryl)-N.SUP.4.-Benzoyldeoxycytidine-3-Yl 2-((3,4,5-Tris(Octa Decyloxy)Benzoyl)Oxy)Acetate
[0413] ##STR00059##
[0414] The title compound (3.02 g, 99%) was obtained from N.sup.4-benzoyldeoxycytidine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (2.27 g, 1.75 mmol) and N.sup.2-isobutyryl-DMTr-dG-CE-phosphoroamidite (2.94 g, 3.50 mmol) according to the methods of Examples 2-3.
[0415] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.08-1.53 (m, 96H), 1.70-1.84 (m, 6H), 2.36-2.62 (m, 2H), 2.75-3.30 (m, 7H), 3.75-3.87 (m, 2H), 3.98-4.04 (m, 6H), 4.26-4.53 (m, 6H), 4.78-4.89 (m, 2H), 5.26-5.29 (m, 1H), 5.42-5.52 (m, 1H), 5.92-6.11 (m, 1H), 6.24-6.38 (m, 1H), 7.26-7.28 (m, 2H), 7.38-7.67 (m, 4H), 7.80-7.89 (m, 2H), 7.95-8.00 (m, 1H), 8.14-8.24 (m, 1H), 10.22-10.70 (m, 1H), 12.08-12.22 (m, 1H).
[0416] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 14.14, 18.96, 18.99, 19.05, 19.81, 19.87, 22.71, 26.08, 26.15, 29.34, 29.38, 29.46, 29.61, 29.68, 29.75, 30.37, 31.94, 36.01, 36.06, 38.37, 38.83, 39.11, 61.09, 62.01, 62.59, 62.64, 62.77, 62.82, 67.20, 67.51, 69.25, 73.60, 74.76, 75.03, 80.49, 83.50, 83.75, 84.57, 84.81, 86.32, 87.91, 88.04, 97.29, 97.50, 108.30, 116.55, 116.68, 120.72, 121.05, 123.01, 127.73, 127.80, 128.88, 128.93, 132.71, 132.81, 133.28, 138.19, 138.30, 143.13, 144.20, 144.42, 147.79, 147.99, 148.16, 148.33, 152.99, 155.25, 155.65, 162.86, 163.04, 165.92, 165.95, 167.77, 167.85, 179.77, 180.03.
[0417] TOF/MS (ESI): calcd for C.sub.96H.sub.152N.sub.9O.sub.18PNa [M+Na].sup.+1773.0891, found 1773.0914.
Examples 3-8
(4) Synthesis of 5-O-((2-Cyanoethoxy)(5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)Thymidine-3-Yl)Phosphoryl)-N.SUP.2.-Isobutyryldeoxyguanosine-3-Yl)Phosphoryl)-N.SUP.4.-Benzoyldeoxycytidine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0418] ##STR00060##
[0419] The title compound (3.44 g, 89%) was obtained from 5-O-((2-cyanoethoxy)(N.sup.2-isobutyryldeoxyguanosine-3-yl)phosphoryl)-N.sup.4-benzoyldeoxycytidine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (2.80 g, 1.60 mmol) and DMTr-dT-CE phosphoroamidite (3.58 g, 4.80 mmol) according to the methods of Examples 3-4.
[0420] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.13-1.55 (m, 99H), 1.71-1.84 (m, 6H), 1.95-2.14 (m, 2H), 2.27-2.95 (m, 9H), 3.00-3.55 (m, 3H), 3.73-3.81 (m, 6H), 3.99-4.04 (m, 6H), 4.14-4.48 (m, 11H), 4.82-4.85 (m, 2H), 5.05-5.53 (m, 3H), 6.00-6.46 (m, 3H), 6.76-6.87 (m, 4H), 7.20-7.36 (m, 11H), 7.44-7.64 (m, 4H), 7.72-7.88 (m, 3H), 8.11-8.22 (m, 1H), 9.00-9.15 (m, 1H), 10.29-10.49 (m, 1H), 12.14-12.17 (m, 1H).
[0421] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 11.67, 11.71, 14.13, 18.86, 18.90, 18.94, 18.98, 19.00, 19.59, 19.67, 19.81, 19.88, 22.70, 26.08, 26.15, 29.35, 29.37, 29.46, 29.61, 29.67, 29.74, 29.77, 30.37, 31.94, 35.88, 38.67, 55.29, 61.13, 62.66, 62.73, 62.87, 63.33, 69.25, 73.59, 84.20, 84.28, 85.31, 87.29, 108.31, 111.69, 111.73, 113.15, 113.35, 116.64, 116.79, 123.01, 127.31, 127.71, 127.77, 128.08, 128.99, 129.14, 130.09, 133.33, 134.93, 134.97, 135.01, 135.17, 143.14, 143.96, 144.04, 147.84, 147.93, 148.16, 150.40, 150.48, 152.99, 155.48, 158.83, 163.52, 165.96, 167.86, 179.65, 179.76.
[0422] TOF/MS (ESI): calcd for C.sub.130H.sub.186N.sub.12O.sub.27P.sub.2Na [M+Na].sup.+2432.2923, found 2432.2937.
Synthesis of 5-O-((2-Cyanoethoxy)(5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)Thymidine-3-Yl)Phosphoryl)Thymidine-3-Yl)Phosphoryl)-N.SUP.2.-Isobutyryldeoxyguanosine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
Examples 3-9
(1) Synthesis of 5-O-(4,4-Dimethoxytrityl)-N.SUP.2.-Isobutyryldeoxyguanosine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0423] ##STR00061##
[0424] The title compound (3.14 g, 98%) was obtained from 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetic acid (1.97 g, 2.00 mmol) and 5-O-(4,4-dimethoxytrityl)-N.sup.2-isobutyryldeoxyguanosine (1.54 g, 2.40 mmol) according to the procedure of Example 2-1.
[0425] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.86-0.89 (m, 12H), 1.03 (d, 3H, J=6.8 Hz), 1.11-1.40 (m, 84H), 1.42-1.50 (m, 6H), 1.70-1.83 (m, 6H), 1.95 (sept, 1H, J=6.8 Hz), 2.51 (dd, 1H, J=5.2, 12.4H z), 3.17-3.29 (m, 2H), 3.42 (dd, 1H, J=3.2, 10.4 Hz), 3.76 (s, 3H), 3.77 (s, 3H), 3.98-4.05 (m, 6H), 4.22 (s, 1H), 4.83 (s, 2H), 5.70 (d, 1H, J=6.0 Hz), 6.07 (dd, 1H, J=5.2, 9.2 Hz), 6.76-6.82 (m, 4H), 7.16-7.38 (m, 9H), 7.43-7.50 (m, 2H), 7.71 (s, 1H), 7.73 (s, 1H), 11.96 (s, 1H).
[0426] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 14.13, 18.64, 18.77, 22.71, 26.05, 26.11, 29.32, 29.37, 29.42, 29.60, 29.66, 29.68, 29.74, 29.75, 29.77, 30.33, 31.94, 36.17, 37.21, 55.24, 61.24, 63.48, 69.30, 73.64, 76.16, 83.94, 84.44, 86.49, 108.33, 113.27, 113.29, 122.34, 123.24, 127.15, 128.02, 129.99, 135.47, 135.77, 137.83, 143.04, 144.70, 147.18, 148.02, 152.94, 155.38, 158.74, 166.00, 167.35, 178.30.
[0427] TOF/MS (ESI): calcd for C.sub.98H.sub.151N.sub.5O.sub.13Na [M+Na].sup.+1629.1206, found 1629.1240.
Examples 3-10
(2) Synthesis of N.SUP.2.-Isobutyryldeoxyguanosine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0428] ##STR00062##
[0429] The title compound (2.42 g, 98%) was obtained from 5-O-(4,4-dimethoxytrityl)-N.sup.2-isobutyryldeoxyguanosine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (3.05 g, 1.90 mmol) according to the procedure of Example 2-2.
[0430] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.20-1.50 (m, 96H), 1.71-1.85 (m, 6H), 2.48 (dd, 1H, J=5.6, 14.0 Hz), 2.72 (sept, 1H, J=6.8 Hz), 2.97-3.05 (m, 1H), 3.49 (brs, 2H), 3.86-4.05 (m, 8H), 4.26 (s, 1H), 4.86 (s, 2H), 5.59 (d, 1H, J=6.0), 6.13 (dd, 1H, J=5.6, 9.2 Hz), 7.30 (s, 2H), 7.86 (s, 2H), 8.82 (s, 1H), 12.16 (s, 1H).
[0431] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 14.10, 18.94, 18.97, 22.71, 26.09, 26.15, 29.38, 29.45, 29.61, 29.69, 29.75, 30.39, 31.96, 36.50, 37.85, 61.26, 62.92, 69.43, 73.67, 86.27, 86.34, 108.59, 122.49, 123.26, 138.42, 143.34, 147.09, 147.73, 153.04, 155.01, 166.02, 167.52, 178.69.
[0432] TOF/MS (ESI): calcd for C.sub.77H.sub.133N.sub.5O.sub.11Na [M+Na].sup.+1326.9899, found 1326.9879.
Example 3-11
(3) Synthesis of 5-O-((2-Cyanoethoxy)(Thymidine-3-Yl)Phosphoryl)-N.SUP.2.-Isobutyryldeoxyguanosine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0433] ##STR00063##
[0434] The title compound (2.68 g, 94%) was obtained from N.sup.2-isobutyryldeoxyguanosine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (2.25 g, 1.72 mmol) and DMTr-dT-CE-phosphoroamidite (2.57 g, 3.45 mmol) according to the methods of Examples 2-3.
[0435] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.05-1.52 (m, 96H), 1.71-1.89 (m, 9H), 2.24-2.78 (m, 8H), 3.38-3.49 (m, 1H), 3.69-4.05 (m, 8H), 4.17-4.89 (m, 7H), 5.20-5.29 (m, 1H), 5.55-5.66 (m, 1H), 6.08-6.24 (m, 2H), 7.30 (s, 2H), 7.42-7.54 (m, 1H), 7.68-7.73 (m, 1H), 8.64-8.83 (m, 1H), 10.20-10.32 (m, 1H), 12.11-12.22 (m, 1H).
[0436] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 12.46, 14.14, 18.59, 18.93, 19.06, 19.42, 19.66, 19.71, 19.73, 19.78, 22.71, 26.07, 26.14, 29.33, 29.38, 29.45, 29.61, 29.68, 29.74, 30.36, 31.94, 35.57, 35.93, 38.42, 61.12, 61.24, 61.71, 61.89, 62.56, 62.64, 62.69, 69.26, 73.62, 75.69, 75.81, 79.29, 82.80, 85.73, 86.04, 86.41, 108.29, 111.23, 111.32, 116.46, 116.51, 122.39, 122.98, 123.03, 136.55, 136.78, 139.04, 143.11, 143.18, 147.93, 147.98, 150.30, 150.37, 152.98, 155.39, 155.59, 163.53, 163.62, 166.00, 166.12, 167.69, 167.86, 179.92, 180.04.
[0437] TOF/MS (ESI): calcd for C.sub.90H.sub.149N.sub.8O.sub.18PNa [M+Na].sup.+1684.0625, found 1684.0648.
Example 3-12
(4) Synthesis of 5-O-((2-Cyanoethoxy)(5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)Thymidine-3-Yl)Phosphoryl)Thymidine-3-Yl)Phosphoryl)-N.SUP.2.-Isobutyryldeoxyguanosine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0438] ##STR00064##
[0439] The title compound (3.11 g, 89%) was obtained from 5-O-((2-cyanoethoxy)(thymidine-3-yl)phosphoryl)-N.sup.2-isobutyryldeoxyguanosine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (2.50 g, 1.50 mmol) and DMTr-dT-CE phosphoroamidite (3.36 g, 4.51 mmol) according to the methods of Examples 3-4.
[0440] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.4 Hz), 1.05-1.53 (m, 96H), 1.71-1.88 (m, 13H), 2.24-2.87 (m, 10H), 3.25-3.53 (m, 3H), 3.72-3.81 (m, 7H), 3.95-4.05 (m, 6H), 4.05-4.72 (m, 10H), 4.81-4.91 (m, 2H), 5.03-5.24 (m, 2H), 5.55-5.61 (m, 1H), 5.95-6.43 (m, 3H), 6.82-6.85 (m, 4H), 7.18-7.37 (m, 12H), 7.53 (s, 1H), 7.73 (s, 1H), 9.10-9.31 (m, 2H), 10.05-10.09 (m, 1H), 12.18 (s, 1H).
[0441] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 11.68, 11.72, 12.33, 12.37, 14.14, 18.78, 18.88, 19.13, 19.24, 19.58, 19.65, 19.70, 19.77, 22.70, 26.08, 26.16, 29.34, 29.38, 29.46, 29.62, 29.68, 29.74, 29.77, 30.36, 31.94, 35.84, 35.99, 37.65, 38.95, 55.29, 61.18, 62.62, 62.77, 62.83, 63.26, 67.10, 67.45, 69.27, 73.63, 75.55, 79.91, 82.62, 82.87, 84.27, 87.31, 108.29, 111.50, 111.80, 113.15, 113.35, 116.66, 116.74, 116.86, 122.51, 122.59, 123.07, 127.32, 128.08, 128.13, 129.13, 130.13, 134.95, 135.12, 136.32, 138.75, 143.10, 143.99, 147.93, 147.97, 148.04, 150.28, 150.37, 150.60, 150.69, 152.98, 155.49, 155.54, 158.81, 163.63, 163.68, 163.79, 166.02, 167.69, 167.71, 179.73, 179.77.
[0442] TOF/MS (ESI): calcd for C.sub.124H.sub.183N.sub.11O.sub.27P.sub.2Na [M+Na].sup.+2343.2658, found 2343.2742.
Synthesis of 5-O-((2-Cyanoethoxy)(5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)Thymidine-3-Yl)Phosphoryl)-N.SUP.2.-Isobutyryldeoxyguanosine-3-Yl)Phosphoryl)Thymidine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
Example 3-13
(1) Synthesis of 5-O-((2-Cyanoethoxy)(N.SUP.2.-Isobutyryldeoxyguanosine-3-Yl)Phosphoryl)Thymidine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzo Yl)Oxy)Acetate
[0443] ##STR00065##
[0444] The title compound (2.43 g, 98%) was obtained from thymidine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (1.82 g, 1.50 mmol) and N.sup.2-isobutyryl-DMTr-dG-CE phosphoroamidite (2.52 g, 3.00 mmol) according to the methods of Examples 2-3.
[0445] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=7.2 Hz), 1.00-1.41 (m, 90H), 1.41-1.54 (m, 6H), 1.71-1.85 (m, 6H), 1.92-2.00 (m, 3H), 2.24-2.97 (m, 6H), 3.68-4.08 (m, 8H), 4.14-4.54 (m, 6H), 4.78-4.92 (m, 2H), 5.14-5.78 (m, 2H), 5.95-6.24 (m, 2H), 7.27-7.43 (m, 3H), 7.87-7.95 (m, 1H), 10.19-10.49 (m, 2H), 12.24-12.38 (m, 1H).
[0446] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 12.35, 14.14, 19.01, 19.06, 19.10, 19.73, 19.80, 19.85, 22.70, 26.07, 26.14, 29.33, 29.38, 29.45, 29.61, 29.68, 29.74, 30.02, 30.36, 31.77, 31.94, 35.80, 35.92, 36.62, 38.19, 38.48, 61.05, 61.13, 62.26, 62.44, 62.49, 62.70, 62.75, 66.12, 67.37, 69.21, 73.58, 74.51, 80.47, 80.64, 82.33, 82.40, 85.33, 85.52, 86.12, 86.55, 86.84, 87.31, 108.24, 111.24, 112.18, 116.50, 116.83, 121.43, 121.59, 123.05, 123.08, 136.55, 137.73, 138.66, 138.99, 143.02, 143.06, 147.75, 147.78, 148.49, 150.42, 151.06, 152.96, 152.97, 155.23, 155.27, 164.76, 164.83, 165.92, 165.96, 167.73, 167.80, 180.26, 180.45.
[0447] TOF/MS (ESI): calcd for C.sub.90H.sub.149N.sub.8O.sub.18PNa [M+Na].sup.+1684.0625, found 1684.0643.
Examples 3-14
(2) Synthesis of 5-O-((2-Cyanoethoxy)(5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)Thymidine-3-Yl)Phosphoryl)-N.SUP.2.-Isobutyryldeoxyguanosine-3-Yl)Phosphoryl)Thymidine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0448] ##STR00066##
[0449] The title compound (2.76 g, 90%) was obtained from 5-O-((2-cyanoethoxy)(N.sup.2-isobutyryldeoxyguanosine-3-yl)phosphoryl)thymidine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (2.20 g, 1.32 m mol) and DMTr-dT-CE-phosphoroamidite (2.96 g, 3.97 mmol) according to the methods of Examples 3-4.
[0450] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.13-1.47 (m, 96H), 1.71-2.01 (m, 15H), 2.35-2.85 (m, 10H), 3.31-3.51 (m, 2H), 3.78 (s, 6H), 3.96-4.04 (m, 6H), 4.05-4.59 (m, 10H), 4.84 (s, 2H), 5.13-5.55 (m, 3H), 6.11-6.42 (m, 3H), 6.83 (d, 4H, J=8.8 Hz), 7.16-7.37 (m, 12H), 7.45-7.55 (m, 1H), 7.72-7.80 (m, 1H), 9.23-10.39 (m, 3H), 12.15-12.21 (m, 1H).
[0451] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 11.70, 12.39, 12.45, 14.14, 18.82, 18.86, 19.04, 19.08, 19.58, 19.65, 19.74, 19.80, 22.70, 26.08, 26.15, 29.34, 29.38, 29.46, 29.61, 29.68, 29.74, 29.77, 30.37, 31.94, 35.89, 36.13, 36.52, 38.68, 55.29, 61.12, 62.74, 62.89, 63.22, 63.32, 67.12, 69.23, 73.60, 74.76, 79.03, 79.98, 82.49, 84.28, 85.14, 87.28, 108.26, 111.37, 111.49, 111.69, 111.72, 113.14, 113.34, 116.74, 116.84, 116.92, 121.89, 121.96, 123.02, 127.08, 127.31, 127.76, 127.85, 128.08, 129.13, 130.11, 134.94, 134.99, 135.03, 135.20, 135.30, 136.93, 138.26, 139.46, 143.07, 143.96, 144.04, 147.98, 148.02, 148.14, 148.23, 150.46, 150.57, 150.62, 152.97, 155.42, 158.60, 158.79, 163.79, 164.43, 164.50, 165.96, 167.79, 179.87, 179.95.
[0452] TOF/MS (ESI): calcd for C.sub.124H.sub.183N.sub.11O.sub.27P.sub.2Na [M+Na].sup.+2343.2658, found 2343.2693.
Examples 3-15
Synthesis of 5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)-Thymidine-3-Yl)Phosphorothioyl)-Thymidine-3-Yl 2-((3,4,5-Tris(Octadecyl Oxy)Benzoyl)Oxy)Acetate
[0453] ##STR00067##
[0454] 5-benzylthio-1H-tetrazole (0.58 g, 3.00 mmol) was added to a suspension of thymidine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (1.82 g, 1.50 mmol) and DMTr-dT-CE phosphoroamidite (2.23 g, 3.00 mmol) in dichloromethane (27 mL), and then stirred at room temperature for 1.5 hours. Next, ((N,N-dimethylaminomethylidene)amino)-3H-1,2,4-dithiazoline-3-thione (1.13 g, 4.50 mmol) and pyridine (0.87 g, 9.00 mmol) were added, and then stirred at room temperature for 1.5 hours. The solid precipitated by dropping acetonitrile (109 mL) to the reaction solution was filtered. The solid was washed with acetonitrile-dichloromethane mixture solvent, acetonitrile, and methanol, and then dried in vacuo at 50? C. to give the title compound (2.71 g, 96%).
[0455] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.11-1.53 (m, 93H), 1.72-1.84 (m, 6H), 1.92-1.95 (m, 3H), 2.28-2.49 (m, 3H), 2.57-2.66 (m, 2H), 2.77 (dd, 1H, J=6.0, 7.2 Hz), 3.39-3.50 (m, 2H), 3.79 (s, 6H), 3.97-4.04 (m, 6H), 4.09-4.40 (m, 6H), 4.83 (d, 2H, J=6.8 Hz), 5.31-5.43 (m, 2H), 6.27-6.32 (m, 1H), 6.35-6.41 (m, 1H), 6.82-6.86 (m, 4H), 7.22-7.32 (m, 10H), 7.37-7.39 (m, 2H), 7.56 (s, 1H), 8.69-8.91 (m, 2H).
[0456] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 11.79, 12.58, 14.14, 19.31, 19.40, 19.47, 19.55, 22.70, 26.07, 26.13, 29.32, 29.38, 29.44, 29.60, 29.68, 29.73, 30.35, 31.94, 36.78, 39.00, 55.29, 61.06, 62.65, 62.69, 62.90, 62.94, 63.21, 67.63, 69.19, 73.56, 75.01, 75.09, 80.18, 82.27, 82.36, 84.40, 84.53, 84.91, 85.39, 87.31, 108.25, 111.74, 111.90, 113.37, 116.15, 116.39, 123.06, 127.28, 128.05, 128.11, 130.09, 134.97, 135.03, 135.06, 135.30, 143.01, 144.04, 150.22, 150.27, 150.35, 152.94, 158.78, 163.36, 163.46, 165.86, 165.88, 167.71, 167.76.
[0457] TOF/MS (ESI): calcd for C.sub.107H.sub.162N.sub.5O.sub.19PSNa [M+Na].sup.+1907.1220, found 1907.1223. [0458] 4. Synthesis of N.sup.4-benzoyl-5-O-((2-cyanoethoxy)(5-O-(4,4-dimethoxytrityl)-2-O-methyluridine-3-yl)phosphoryl)-2-O-methylcytidine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate
Example 4-1
(1) Synthesis of N.SUP.4.-Benzoyl-5-O-(4,4-Dimethoxytrityl)-2-O-Methylcytidine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0459] ##STR00068##
[0460] The title compound (2.96 g, 91%) was obtained from 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetic acid (1.97 g, 2.00 mmol) and N.sup.4-benzoyl-5-O-(4,4-dimethoxytrityl)-2-O-methylcytidine (1.59 g, 2.40 mmol) according to the procedure of Example 2-1.
[0461] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.10-1.38 (m, 84H), 1.42-1.50 (m, 6H), 1.70-1.85 (m, 6H), 3.48 (d, 1H, J=11.6 Hz), 3.62 (s, 3H), 3.69 (d, 1H, J=11.2 Hz), 3.71 (s, 1H), 3.83 (s, 5H), 3.97-4.04 (m, 6H), 4.18 (d, 1H, J=4.8 Hz), 4.36 (d, 1H, J=8.4 Hz), 4.80-4.89 (m, 2H), 5.29 (dd, 1H, J=4.8 Hz, 8.4 Hz), 6.11 (d, 1H, J=1.6 Hz), 6.90 (dd, 4H, J=2.0, 8.8 Hz), 7.27-7.42 (m, 11H), 7.52 (t, 2H, J=7.6 Hz), 7.62 (t, 1H, J=7.6 Hz), 7.89 (d, 2H, J=7.6 Hz), 8.55 (d, 1H, J=6.4 Hz), 8.61-8.72 (brs, 1H).
[0462] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 14.14, 22.70, 26.07, 26.09, 26.11, 29.31, 29.38, 29.43, 29.59, 29.66, 29.68, 29.73, 30.34, 31.94, 52.31, 55.24, 59.15, 60.47, 60.72, 61.06, 69.14, 70.07, 73.53, 80.42, 82.21, 87.49, 88.91, 108.22, 113.43, 123.33, 123.50, 127.27, 127.49, 128.17, 129.06, 130.06, 130.08, 133.17, 135.07, 135.22, 142.85, 143.86, 152.87, 152.90, 158.75, 165.64, 165.84, 167.17, 168.42.
[0463] TOF/MS (ESI): calcd for C.sub.101H.sub.151N.sub.3O.sub.14Na [M+Na].sup.+1653.1094, found 1653.1171.
Example 4-2
(2) Synthesis of N.SUP.4.-Benzoyl-2-O-Methylcytidine-3-Yl 2-((3,4,5-Tris(Octadecyloxy) Benzoyl)Oxy)Acetate
[0464] ##STR00069##
[0465] The title compound (2.26 g, 99%) was obtained from N.sup.4-benzoyl-5-O-(4,4-dimethoxytrityl)-2-O-methylcytidine-3-yl 2-((3,4,5-tris (octadecyloxy)benzoyl)oxy)acetate (2.80 g, 1.72 mmol) according to the methods of Examples 2-2.
[0466] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.10-1.55 (m, 90H), 1.70-1.85 (m, 6H), 3.51 (s, 3H), 3.79-3.83 (m, 2H), 3.95-4.08 (m, 7H), 4.34 (d, 1H, J=4.8 Hz), 4.50 (t, 1H, J=4.8H z), 4.83-4.90 (m, 2H), 5.44 (t, 1H, J=4.8 Hz), 5.73 (d, 1H, J=4.4 Hz), 7.29-7.30 (m, 2H), 7.47-7.66 (m, 3H), 7.90 (d, 2H, J=7.6 Hz), 8.16 (d, 1H, J=7.6 Hz), 8.75-9.00 (brs, 1H).
[0467] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 14.14, 22.71, 26.07, 26.11, 29.30, 29.38, 29.42, 29.59, 29.66, 29.68, 29.73, 30.34, 31.94, 52.32, 59.19, 60.97, 61.07, 61.24, 69.15, 69.20, 71.18, 73.56, 80.58, 83.43, 92.64, 108.28, 123.20, 123.50, 127.61, 129.09, 132.80, 133.36, 142.99, 147.07, 152.87, 152.93, 162.63, 165.85, 167.66, 168.43.
[0468] TOF/MS (ESI): calcd for C.sub.80H.sub.133N.sub.3O.sub.12Na [M+Na].sup.+1350.9787, found 1350.9855.
Example 4-3
(3) Synthesis of N.SUP.4.-Benzoyl-5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)-2-O-Methyluridine-3-Yl)Phosphoryl)-2-O-Methylcytidine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0469] ##STR00070##
[0470] A crude compound (2.80 g) was obtained from N.sup.4-benzoyl-2-O-methylcytidine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (2.10 g, 1.58 mmol) and 5-O-DMTr-2-O-methyluridine-CE phosphoro amidite (2.40 g, 3.16 mmol) according to the methods of Examples 3-4. The crude compound was purified by column chromatography (spherical neutral silica gel, eluent: dichloromethane-methanol) to give the title compound (2.21 g, 70%).
[0471] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.10-1.53 (m, 90H), 1.71-1.83 (m, 6H), 2.50-2.74 (m, 1H), 2.79 (t, 1H, J=6.4 Hz), 3.46-3.76 (m, 8H), 3.77 (s, 3H), 3.79 (s, 3H), 3.97-4.04 (m, 6H), 4.11-4.58 (m, 7H), 4.82-4.95 (m, 2H), 5.13-5.30 (m, 3H), 5.86-6.08 (m, 2H), 6.82-6.88 (m, 4H), 7.23-7.36 (m, 11H), 7.51 (t, 2H, 8.0 Hz), 7.61 (t, 1H, J=7.2 Hz), 7.82-8.05 (m, 4H), 8.69-8.96 (m, 2H).
[0472] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 14.14, 19.52, 19.58, 22.70, 26.07, 26.13, 29.33, 29.38, 29.45, 29.60, 29.68, 29.73, 30.35, 31.94, 55.25, 55.30, 58.84, 59.27, 60.82, 61.14, 62.35, 62.40, 62.68, 62.73, 65.55, 66.16, 69.19, 69.90, 70.16, 73.56, 74.28, 74.38, 79.38, 79.46, 79.52, 79.60, 81.32, 81.38, 81.52, 82.19, 86.71, 86.87, 87.46, 90.07, 90.64, 102.58, 102.62, 108.24, 113.34, 113.36, 116.36, 116.43, 123.19, 127.39, 127.44, 127.64, 128.10, 128.12, 128.26, 128.29, 129.04, 130.21, 130.27, 130.30, 133.28, 134.64, 134.73, 139.53, 139.75, 142.96, 143.82, 143.90, 150.02, 150.07, 152.93, 158.81, 158.84, 158.86, 162.70, 162.73, 165.77, 165.81, 167.22, 167.26.
[0473] TOF/MS (ESI): calcd for C.sub.114H.sub.167N.sub.6O.sub.22PNa [M+Na].sup.+2026.1769, found 2026.1764.
Synthesis of 5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)-2-Fluorodeoxyuridine-3-Yl)Phosphoryl)-2-Fluoro-N.SUP.2.-Isobutyryldeoxyguanosine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
Example 4-4
(1) Synthesis of 5-O-(4,4-Dimethoxytrityl)-2-Fluoro-N.SUP.2.-Isobutyryldeoxyguanosine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0474] ##STR00071##
[0475] The title compound (3.13 g, 96%) was obtained from 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetic acid (1.97 g, 2.00 mmol) and 5-O-(4,4-dimethoxytrityl)-2-fluoro-N.sup.2-isobutyryldeoxyguanosine (1.58 g, 2.40 mmol) according to the procedure of Example 2-1.
[0476] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.81 (d, 3H, J=6.8 Hz), 0.88 (t, 9H, J=6.8 Hz), 0.94 (d, 3H, J=7.2 Hz), 1.10-1.53 (m, 90H), 1.70-1.87 (m, 6H), 1.93 (sept, 1H, J=6.8 Hz), 3.17 (d, 1H, J=11.2H z), 3.59 (d, 1H, J=11.2 Hz), 3.77 (s, 6H), 3.97-4.05 (m, 6H), 4.32-4.34 (m, 1H), 4.85 (d, 1H, J=16.0 Hz), 4.92 (d, 1H, J=16.0 Hz), 5.92-6.07 (m, 2H), 6.18-6.24 (m, 1H), 6.78 (dd, 4H, J=5.2, 8.8 Hz), 7.16-7.29 (m, 7H), 7.30 (s, 2H), 7.36 (d, 2H, J=8.0 Hz), 7.79 (s, 1H), 8.01 (s, 1H), 11.92 (s, 1H).
[0477] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 14.14, 18.39, 18.47, 18.88, 18.91, 22.70, 25.61, 26.06, 26.11, 29.30, 29.38, 29.42, 29.59, 29.66, 29.68, 29.73, 30.34, 31.94, 36.25, 36.43, 55.24, 55.25, 60.68, 60.84, 61.24, 67.98, 69.25, 70.85, 71.00, 73.61, 79.97, 81.44, 83.15, 86.36, 86.47, 86.67, 90.96, 108.26, 113.15, 113.22, 122.23, 123.17, 127.08, 127.13, 127.76, 127.85, 127.89, 127.98, 129.13, 129.85, 129.92, 135.20, 135.66, 138.43, 138.70, 139.43, 143.05, 144.47, 147.30, 147.34, 147.47, 147.90, 152.93, 152.96, 155.04, 155.31, 158.62, 158.69, 165.65, 165.89, 167.23, 167.60, 178.18, 178.76.
[0478] TOF/MS (ESI): calcd for C.sub.98H.sub.150N.sub.5O.sub.13F [M+H].sup.+1623.1136, found 1623.1160.
Example 4-5
(2) Synthesis of 2-Fluoro-N.SUP.2.-Isobutyryldeoxyguanosine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0479] ##STR00072##
[0480] The title compound (2.40 g, 98%) was obtained from 5-O-(4,4-dimethoxytrityl)-2-fluoro-N.sup.2-isobutyryldeoxyguanosine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (3.00 g, 1.85 mmol) according to the procedure of Example 2-2.
[0481] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.10-1.55 (m, 96H), 1.70-1.85 (m, 6H), 2.71 (sept, 1H, J=6.8 Hz), 3.37-3.72 (brs, 2H), 3.80 (d, 1H, J=11.6 Hz), 3.99-4.05 (m, 7H), 4.34 (d, 1H, J=4.0 Hz), 4.94 (s, 2H), 5.69 (dt, 1H, J=4.4, 52.0 Hz), 5.78-5.84 (m, 1H), 5.97 (dd, 1H, J=4.0, 16.0 Hz), 7.31 (s, 2H), 7.90 (s, 1H), 9.22 (s, 1H), 12.15 (s, 1H).
[0482] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 14.14, 18.85, 18.95, 22.70, 26.06, 26.11, 29.30, 29.38, 29.43, 29.60, 29.68, 29.74, 30.33, 31.94, 36.32, 60.86, 69.24, 71.25, 71.39, 73.60, 82.89, 87.22, 87.55, 89.60, 91.55, 108.27, 121.56, 123.15, 138.45, 142.99, 147.29, 148.08, 152.91, 155.03, 165.91, 167.26, 179.15.
[0483] TOF/MS (ESI): calcd for C.sub.77H.sub.132N.sub.5O.sub.11FNa [M+Na].sup.+1344.9805, found 1344.9834.
Examples 4-6
(3) Synthesis of 5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)-2-Fluorodeoxyuridine-3-Yl)Phosphoryl)-2-Fluoro-N.SUP.2.-Isobutyryldeoxyguanosine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0484] ##STR00073##
[0485] The title compound (3.07 g, 93%) was obtained from 2-fluoro-N.sup.2-isobutyryldeoxyguanosine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (2.20 g, 1.66 mmol) and 5-O-DMTr-2-fluoro-deoxyuridine-CE phosphoroamidite (2.49 g, 3.33 mmol) according to the methods of Examples 3-4.
[0486] .sup.1H-NMR (400 MHz, CDCl.sub.3): 0.88 (t, 9H, J=7.2 Hz), 0.97-1.53 (m, 96H), 1.71-1.83 (m, 6H), 2.56-2.75 (m, 3H), 3.37-3.66 (m, 2H), 3.74-3.79 (m, 6H), 3.97-4.55 (m, 12H), 4.78-5.08 (m, 2H), 5.08-5.50 (m, 3H), 5.70-6.01 (m, 4H), 6.80-6.84 (m, 4H), 7.17-7.40 (m, 11H), 7.57-7.73 (m, 2H), 8.94-9.07 (m, 1H), 10.00 (s, 1H), 12.18-12.26 (m, 1H).
[0487] ?.sup.13C-NMR (100 MHz, CDCl.sub.3): ? 14.14, 18.51, 18.76, 18.92, 19.20, 19.55, 19.62, 22.70, 26.07, 26.14, 29.33, 29.38, 29.45, 29.60, 29.68, 29.74, 30.36, 31.94, 35.90, 35.99, 55.23, 55.30, 60.70, 60.88, 62.85, 69.26, 73.61, 79.54, 79.63, 87.17, 87.21, 102.93, 108.31, 113.31, 116.34, 116.52, 122.55, 122.61, 122.95, 122.98, 127.25, 127.31, 128.07, 128.10, 130.14, 134.79, 134.88, 134.92, 138.65, 140.55, 143.15, 143.19, 143.92, 144.02, 147.71, 147.74, 148.30, 148.43, 149.68, 149.98, 152.98, 152.99, 155.30, 155.48, 158.74, 158.79, 162.67, 165.89, 166.00, 167.20, 179.68.
[0488] TOF/MS (ESI): calcd for C.sub.110H.sub.163N.sub.8O.sub.20F.sub.2PNa [M+Na].sup.+2008.1587, found 2008.1593.
Synthesis of 5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)-2-O-(Tert-Butyldimethylsilyl)Uridine-3-Yl)Phosphoryl)-2-O-(Tert-Butyldimethylsilyl) Uridine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
Examples 4-7
(1) Synthesis of 5-O-(4,4-Dimethoxytrityl)-2-O-(Tert-Butyldimethylsilyl)Uridine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0489] ##STR00074##
[0490] 4-dimethylaminopyridine (0.03 g, 0.25 mmol) and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (0.58 g, 3.00 mmol) was added to a suspension of 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy) acetic acid (2.46 g, 2.50 mmol) and 5-O-(4,4-dimethoxytrityl)-2-O-(tert-butyldimethylsilyl)uridine (1.98 g, 3.00 mmol) in dichloromethane (25 mL), and then stirred at room temperature for 5 hours. The solid precipitated by dropping acetonitrile (148 mL) to the reaction solution was filtered. The solid was washed with acetonitrile-dichloromethane mixture solvent, and then dried under reduced pressure at 50? C. to obtain a crude compound (2.89 g). The crude compound was purified by column chromatography (spherical neutral silica gel, eluent: dichloromethane-THF) to give the title compound (2.76 g, 68%) as a white solid.
[0491] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.08 (s, 3H), 0.11 (s, 3H), 0.81-0.92 (m, 18H), 1.04-1.53 (m, 90H), 1.70-1.84 (m, 6H), 3.49 (dd, 2H, J=10.8, 27.6 Hz), 3.79 (s, 6H), 3.79-4.04 (m, 6H), 4.26-4.27 (m, 1H), 4.56 (t, 1H, J=5.2 Hz), 4.81 (d, 1H, J=16.0 Hz), 4.96 (d, 1H, 16.4 Hz), 5.30 (d, 1H, J=8.0 Hz), 5.47 (t, 1H, J=4.0 Hz), 6.02 (d, 1H, J=5.6 Hz), 6.85 (d, 4H, J=8.4 Hz), 7.23-7.37 (m, 11H), 7.85 (d, 1H, J=8.4 Hz), 8.37 (s, 1H).
[0492] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? ?5.22, ?5.09, 14.14, 17.87, 22.71, 25.51, 26.07, 26.11, 29.30, 29.38, 29.43, 29.59, 29.67, 29.74, 30.34, 31.94, 55.25, 60.75, 62.47, 69.14, 73.36, 73.54, 74.40, 81.20, 87.58, 88.03, 102.56, 108.25, 113.40, 113.43, 123.33, 127.33, 128.03, 128.14, 130.03, 130.17, 134.71, 134.83, 140.00, 142.87, 144.10, 150.14, 152.89, 158.78, 158.83, 162.59, 165.67, 167.10.
[0493] TOF/MS (ESI): calcd for C.sub.99H.sub.158N.sub.2O.sub.14SiNa [M+Na].sup.+1650.1380, found 1650.1455.
Examples 4-8
(2) Synthesis of 2-O-(Tert-Butyldimethylsilyl)Uridine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0494] ##STR00075##
[0495] The title compound (2.05 g, 97%) was obtained from 5-O-(4,4-dimethoxytrityl)-2-O-(tert-butyldimethylsilyl)uridine-3-yl 2-((3,4,5-tris (octadecyloxy)benzoyl)oxy)acetate (2.60 g, 1.60 mmol) according to the procedure of Example 2-2.
[0496] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.04 (s, 3H), 0.07 (s, 3H), 0.81-0.92 (m, 18H), 1.11-1.53 (m, 90H), 1.70-1.85 (m, 6H), 2.95-3.10 (brs, 1H), 3.77-3.82 (m, 1H), 3.93-4.04 (m, 7H), 4.25-4.28 (m, 1H), 4.67 (t, 1H, J=5.2 Hz), 4.81 (d, 1H, 16.0 Hz), 4.96 (d, 1H, 16.0 Hz), 5.34 (dd, 1H, J=3.2, 4.8 Hz), 5.60 (d, 1H, J=5.6 Hz), 5.76 (d, 1H, J=8.0 Hz), 7.29 (s, 2H), 7.63 (d, 1H, J=8.0 Hz), 8.71 (s, 1H).
[0497] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? ?5.22, ?5.19, 14.14, 17.88, 22.71, 25.52, 26.07, 26.10, 29.30, 29.38, 29.42, 29.59, 29.66, 29.68, 29.73, 30.34, 31.94, 60.84, 61.84, 69.20, 72.78, 73.24, 73.57, 82.99, 92.46, 102.70, 108.32, 123.24, 141.88, 142.99, 150.17, 152.92, 162.72, 1 65.78, 167.38.
[0498] TOF/MS (ESI): calcd for C.sub.78H.sub.140N.sub.2O.sub.12SiNa [M+Na].sup.+1348.0073, found 1348.0115.
Examples 4-9
(3) Synthesis of 5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)-2-O-(Tert-Butyldimethylsilyl)Uridine-3-Yl)Phosphoryl)-2-O-(Tert-Butyldimethylsilyl) Uridine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0499] ##STR00076##
[0500] The title compound (2.84 g, 92%) was obtained from 2-O-(tert-butyldimethylsilyl) uridine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (1.95 g, 1.47 mmol) and 5-O-DMTr-2-O-(tert-butyldimethylsilyl) uridine-CE phosphoroamidite (2.53 g, 2.94 mmol) according to the methods of Examples 3-4.
[0501] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.03-0.13 (m, 12H), 0.86-0.90 (m, 27H), 1.02-1.53 (m, 90H), 1.68-1.84 (m, 6H), 2.45-2.69 (m, 1H), 2.73 (t, 1H, J=6.0 Hz), 3.48 (d, 1H, J=10.8 Hz), 3.60-3.68 (m, 1H), 3.76-3.84 (m, 6H), 3.97-4.04 (m, 6H), 4.10-4.58 (m, 8H), 4.73-4.84 (m, 1H), 4.90-5.03 (m, 2H), 5.20-5.25 (m, 2H), 5.67-5.78 (m, 2H), 5.95-6.03 (m, 1H), 6.80-6.89 (m, 4H), 7.21-7.44 (m, 12H), 7.84 (d, 1H, J=8.0 Hz), 8.72-8.83 (m, 2H).
[0502] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? ?5.27, ?5.24, ?5.07, ?4.94, ?4.92, 14.14, 17.86, 18.06, 19.50, 19.57, 19.65, 22.70, 25.50, 25.55, 25.60, 26.07, 26.13, 29.32, 29.38, 29.44, 29.60, 29.68, 29.74, 30.35, 31.94, 55.27, 55.30, 60.69, 61.96, 62.37, 62.42, 62.58, 62.63, 69.19, 71.39, 71.60, 72.86, 73.00, 73.57, 74.47, 79.43, 79.51, 81.75, 87.65, 87.68, 87.99, 88.18, 90.56, 91.22, 102.54, 102.64, 103.05, 103.13, 108.28, 113.39, 116.31, 116.40, 123.21, 127.43, 128.13, 128.21, 128.25, 130.25, 130.27, 130.32, 134.56, 134.65, 134.70, 134.73, 139.84, 140.05, 140.15, 142.97, 143.01, 143.92, 143.97, 149.95, 150.19, 150.40, 152.92, 158.83, 158.87, 162.53, 162.58, 162.69, 165.64, 165.68, 167.05, 167.12.
[0503] TOF/MS (ESI): calcd for C.sub.117H.sub.186N.sub.5O.sub.22Si.sub.2PNa [M+Na].sup.+2123.2763, found 2123.2769.
5. Synthesis of 3-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Propionic Acid
Example 5-1
(1) Synthesis of Tert-Butyl 3-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy) Propionate
[0504] ##STR00077##
[0505] 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (0.86 g, 4.5 mmol) was added to a suspension of 3,4,5-tris(octadecyloxy)benzoic acid (2.78 g, 3.0 mmol), 4-dimethylaminopyridine (0.04 g, 0.3 mmol), tert-butyl 3-hydroxypropionate (4.39 g, 30.0 mmol), and triethylamine (0.46 g, 4.5 mmol) in dichloromethane (60 mL), and then stirred at room temperature for 20 hours. The solid precipitated by dropping acetonitrile (180 mL) to the reaction solution was filtered. The solid was washed with acetonitrile-dichloromethane mixture solvent, and then dried under reduced pressure at 50? C. to obtain a crude compound (3.07 g). The crude compound was purified by column chromatography (spherical neutral silica gel, eluent: dichloromethane) to afford the title compound (1.90 g, 60%) as a white solid.
[0506] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=7.0 Hz), 1.15-1.55 (m, 99H), 1.70-1.85 (m, 6H), 2.68 (t, 2H, J=6.4 Hz), 3.95-4.05 (m, 6H), 4.53 (t, 2H, J=6.4 Hz), 7.23 (s, 2H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 14.08, 22.68, 26.08, 28.09, 29.35, 29.40, 29.57, 29.65, 29.71, 30.35, 31.93, 35.42, 60.72, 69.25, 73.51, 80.97, 108.19, 124.57, 152.84, 166.14, 169.93.
[0507] TOF/MS (ESI): calcd for C.sub.68H.sub.126O.sub.7Na [M+Na].sup.+1077.9401, found 1077.9427.
Example 5-2
(2) Synthesis of 3-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Propionic Acid
[0508] ##STR00078##
[0509] Methanesulfonic acid (3.75 g, 39.0 mmol) was added to a solution of tert-butyl 3-((3,4,5-tris(octadecyloxy)benzoyl)oxy)propionate (2.75 g, 2.6 mmol) in dichloromethane (52 mL), and then stirred at room temperature for 20 hours. The solid precipitated by dropping acetonitrile (156 mL) to the reaction solution was filtered. The solid was washed with acetonitrile-dichloromethane mixture solvent and acetonitrile, and then dried in vacuo at 50? C. to give the title compound (2.54 g, 98%) as a white solid.
[0510] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=7.0 Hz), 1.15-1.55 (m, 90H), 1.70-1.85 (m, 6H), 2.85 (t, 2H, J=6.6 Hz), 3.95-4.10 (m, 6H), 4.57 (t, 2H, J=6.4 Hz), 7.23 (s, 2H).
[0511] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 14.10, 22.71, 26.10, 26.13, 29.38, 29.45, 29.61, 29.68, 29.75, 30.38, 31.96, 33.54, 59.99, 69.34, 73.57, 108.35, 124.32, 142.88, 152.91, 166.17.
[0512] TOF/MS (ESI): calcd for C.sub.64H.sub.118O.sub.7Na [M+Na].sup.+1021.8775, found 1021.8817.
Synthesis of 2-(N-Methyl-3,4,5-Tris(Octadecyloxy)Benzamide)Acetic Acid
Example 5-3
(1) Synthesis of Tert-Butyl 2-(N-Methyl-3,4,5-Tris(Octadecyloxy)Benzamido)Acetate
[0513] ##STR00079##
[0514] 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (0.86 g, 4.5 mmol) was added to a suspension of 3,4,5-tris(octadecyloxy)benzoic acid (2.78 g, 3.0 mmol), 4-dimethylaminopyridine (0.04 g, 0.3 mmol), tert-butyl sarcosinate hydrochloride (2.73 g, 15.0 mmol), and triethylamine (1.52 g, 15.0 mmol) in dichloromethane (60 mL), and then stirred at room temperature for 20 hours. The solid precipitated by dropping acetonitrile (180 mL) to the reaction solution was filtered. The solid was washed with acetonitrile-dichloromethane mixture solvent, and then dried under reduced pressure at 50? C. to obtain a crude compound (3.07 g). The crude compound was purified by column chromatography (spherical neutral silica gel, eluent: dichloromethane-THF) to give the title compound (2.66 g, 84%) as a white solid.
[0515] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=7.0 Hz), 1.15-1.55 (m, 99H), 1.70-1.85 (m, 6H), 3.04 (s, 3H), 3.80-4.20 (m, 8H), 6.63 (s, 2H).
[0516] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 14.01, 22.66, 26.13, 26.15, 28.16, 29.35, 29.42, 29.48, 29.65, 29.71, 30.39, 31.93, 69.51, 73.52, 82.02, 106.19, 130.61, 139.93, 153.25, 168.33, 172.01.
[0517] TOF/MS (ESI): calcd for C.sub.68H.sub.127NO.sub.6Na [M+Na].sup.+1076.9561, found 1076.9591.
Example 5-4
(2) Synthesis of 2-(N-Methyl-3,4,5-Tris(Octadecyloxy)Benzamide) Acetic Acid
[0518] ##STR00080##
[0519] The title compound (2.38 g, 99%) was obtained from tert-butyl 2-(N-methyl-3,4,5-tris(octadecyloxy)benzamido)acetate (2.53 g, 2.4 mmol) as white solids according to the procedure of Examples 5-2.
[0520] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=7.0 Hz), 1.15-1.55 (m, 90H), 1.70-1.85 (m, 6H), 3.11 (s, 3H), 3.85-4.35 (m, 8H), 6.15-6.30 (brs, 1H), 6.66 (s, 2H).
[0521] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 14.05, 22.67, 26.12, 29.36, 29.43, 29.61, 29.66, 29.72, 29.98, 30.36, 31.93, 39.20, 50.02, 69.49, 73.56, 106.47, 129.16, 140.27, 152.97, 153.24, 172.11, 172.92.
[0522] TOF/MS (ESI): calcd for C.sub.64H.sub.118NO.sub.6 [M?H].sup.?996.8959, found 996.8947.
Synthesis of 3-(3,4,5-Tris(Octadecyloxy)Benzamide)Propionic Acid
Example 5-5
(1) Synthesis of Tert-Butyl 3-(3,4,5-Tris(Octadecyloxy)Benzamide) Propionate
[0523] ##STR00081##
[0524] 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (0.86 g, 4.5 mmol) was added to a suspension of 3,4,5-tris(octadecyloxy)benzoic acid (2.78 g, 3.0 mmol), 4-dimethylaminopyridine (0.04 g, 0.3 mmol), R-alanine tert-butyl ester hydrochloride (2.73 g, 15.0 mmol), and triethylamine (1.52 g, 15.0 mmol) in dichloromethane (60 mL), and then stirred at room temperature for 19.5 hours. The solid precipitated by dropping acetonitrile (180 mL) to the reaction solution was filtered. The solid was washed with acetonitrile-dichloromethane mixture solvent, and then dried under reduced pressure at 50? C. to obtain a crude compound (3.12 g). The crude compound was purified by column chromatography (spherical neutral silica gel, eluent: dichloromethane-THF) to give the title compound (2.75 g, 87%) as a white solid.
[0525] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=7.0 Hz), 1.15-1.55 (m, 99H), 1.70-1.85 (m, 6H), 2.55 (t, 2H, J=5.8 Hz), 3.66 (q, 2H, J=6.0 Hz), 3.95-4.05 (m, 6H), 6.72 (t, 1H, J=6.0 Hz), 6.94 (s, 2H).
[0526] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 14.09, 22.71, 26.11, 28.16, 29.38, 29.43, 29.61, 29.68, 29.74, 30.36, 31.95, 35.18, 35.58, 69.45, 73.53, 81.19, 105.86, 129.57, 141.32, 153.14, 167.20, 172.27.
[0527] TOF/MS (ESI): calcd for C.sub.68H.sub.127NO.sub.6Na [M+Na].sup.+1076.9561, found 1076.9579.
Example 5-6
(2) Synthesis of 3-(3,4,5-Tris(Octadecyloxy)Benzamide)Propionic Acid
[0528] ##STR00082##
[0529] The title compound (2.52 g, 101%) was obtained from tert-butyl 3-(3,4,5-tris(octadecyloxy)benzamido)propionate (2.64 g, 2.5 mmol) as white solids according to the procedure of Examples 5-2.
[0530] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=7.0 Hz), 1.15-1.55 (m, 90H), 1.65-1.85 (m, 6H), 2.74 (t, 2H, J=5.8 Hz), 3.72 (t, 2H, J=5.8 Hz), 3.90-4.05 (m, 6H), 6.95 (s, 2H).
[0531] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 14.06, 22.71, 26.16, 26.19, 29.40, 29.50, 29.53, 29.65, 29.71, 29.77, 30.44, 31.98, 33.68, 35.85, 39.37, 69.77, 73.67, 106.51, 128.33, 142.29, 153.35, 168.43, 175.46.
[0532] TOF/MS (ESI): calcd for C.sub.64H.sub.118NO.sub.6 [M?H].sup.?996.8959, found 996.8912.
Synthesis of 5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)Thymidine-3-Yl)Phosphoryl)Thymidine-3-Yl 3-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Propionate
Examples 5-7
(1) Synthesis of Thymidine-3-Yl 3-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Propionate
[0533] ##STR00083##
[0534] COMU (2.06 g, 4.80 mmol) was added to a suspension of 3-((3,4,5-tris(octadecyloxy)benzoyl)oxy)propionic acid (2.40 g, 2.40 mmol), 5-O-(4,4-dimethoxytrityl)thymidine (1.57 g, 2.88 mmol), and 1-methylimidazole (0.99 g, 12.00 mmol) in THF (24 mL), and then stirred at room temperature for 6.5 hours. Further, COMU (0.21 g, 0.48 mmol) was added, and then stirred at room temperature for 17.5 hours. The solid precipitated by dropping acetonitrile (120 mL) to the reaction solution was filtered. The solid was washed with acetonitrile-THF mixture solvent, and then dried under reduced pressure at 50? C. to obtain a crude compound (2.76 g). The crude compound was used for the next reaction without purification.
[0535] Pyrrole (0.57 g, 8.50 mmol) and trifluoroacetic acid (0.24 g, 2.13 mmol) were added to a dichloromethane solution (68 mL) of the crude compound (2.60 g), and then stirred at room temperature for 3.5 hours. Further, trifluoroacetic acid (0.05 g, 0.43 mmol) was added, and then stirred at room temperature for 1.5 hours. The solid precipitated by dropping acetone (20 mL) and acetonitrile (61 mL) to the reaction solution was filtered. The solid was washed with acetonitrile-acetone-dichloromethane mixture solvent and acetonitrile, and then dried under reduced pressure at 50? C. to obtain a crude compound (2.44 g). The crude compound was purified by column chromatography (spherical neutral silica gel, eluent: dichloromethane-THF) to give the title compound (0.52 g, 18%) as a white solid.
[0536] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.15-1.55 (m, 90H), 1.65-1.85 (m, 7H), 1.92 (s, 3H), 2.30-2.40 (m, 1H), 2.45-2.55 (m, 1H), 2.60-2.70 (m, 1H), 2.80-2.90 (m, 2H), 3.85-3.95 (m, 2H), 3.95-4.05 (m, 6H), 4.05-4.10 (m, 1H), 4.55-0.65 (m, 2H), 5.40-5.55 (m, 1H), 6.10-6.20 (m, 1H), 7.22 (s, 2H), 7.41 (s, 1H), 8.58-8.64 (m, 1H).
[0537] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 12.57, 14.14, 22.71, 26.07, 26.11, 29.33, 29.38, 29.43, 29.59, 29.67, 29.74, 30.02, 30.34, 31.94, 34.16, 36.90, 60.05, 62.58, 69.24, 73.54, 75.25, 85.10, 86.67, 108.06, 111.42, 124.14, 136.56, 142.69, 150.26, 152.87, 163.40, 166.10, 170.43.
[0538] TOF/MS (ESI): calcd for C.sub.74H.sub.130N.sub.2O.sub.11Na [M+Na].sup.+1245.9572, found 1245.9548.
Example 5-8
(2) Synthesis of 5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl) Thymidine-3-Yl)Phosphoryl)Thymidine-3-Yl 3-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Propionate
[0539] ##STR00084##
[0540] The title compound (2.22 g, 96%) was obtained as a white solid from thymidine-3-yl 3-((3,4,5-tris((octadecyloxy)benzoyl)oxy)propionate (1.50 g, 1.23 mmol) and DMTr-dT-CE phosphoroamidite (1.83 g, 2.45 mmol) according to the methods of Examples 3-4.
[0541] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.10-1.38 (m, 84H), 1.41-1.50 (m, 9H), 1.70-1.83 (m, 7H), 1.91 (s, 3H), 2.30-2.46 (m, 3H), 2.62-2.68 (m, 2H), 2.75 (t, 1H, J=6.0 Hz), 2.84 (dd, 2H, J=4.8, 6.4 Hz), 3.37-3.42 (m, 1H), 3.50-3.55 (m, 1H), 3.79 (s, 6H), 3.98-4.02 (m, 6H), 4.12-4.38 (m, 6H), 4.56 (dd, 2H, J=4.8, 7.2 Hz), 5.16-5.20 (m, 1H), 5.28-5.35 (m, 1H), 6.21-6.26 (m, 1H), 6.38-6.44 (m, 1H), 6.84 (d, 4H, J=7.6 Hz), 7.21-7.32 (m, 10H), 7.34-7.37 (m, 2H), 7.50-7.59 (m, 1H), 8.91-9.06 (m, 2H).
[0542] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 11.72, 12.46, 14.13, 19.59, 19.66, 19.75, 22.70, 26.08, 26.15, 29.37, 29.46, 29.61, 29.67, 29.74, 30.36, 31.94, 33.94, 36.62, 38.95, 55.29, 59.89, 59.93, 62.39, 62.45, 62.54, 62.59, 63.23, 67.62, 69.27, 73.55, 74.09, 79.77, 79.82, 79.87, 79.92, 82.52, 84.29, 84.34, 84.46, 84.53, 85.36, 85.57, 87.34, 108.14, 111.70, 111.82, 113.36, 116.17, 116.36, 124.17, 127.34, 128.08, 128.14, 130.13, 134.94, 135.03, 135.07, 135.35, 135.49, 142.74, 143.97, 143.99, 150.23, 150.27, 150.38, 150.46, 152.89, 158.84, 163.40, 163.50, 166.14, 170.29, 170.34.
[0543] TOF/MS (ESI): calcd for C.sub.108H.sub.164N.sub.5O.sub.20PNa [M+Na].sup.+1905.1605, found 1905.1636.
Synthesis of 5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)Thymidine-3-Yl)Phosphoryl)Thymidine-3-Yl 2-(N-Methyl-3,4,5-Tris(Octadecyloxy) Benzamide)Acetate
Examples 5-9
(1) Synthesis of 5-O-(4,4-Dimethoxytrityl)Thymidine-3-Yl 2-(N-Methyl-3,4,5-Tris(Octadecyloxy)Benzamide)Acetate
[0544] ##STR00085##
[0545] COMU (1.80 g, 4.20 mmol) was added to a suspension of 2-(N-methyl 3,4,5-tris(octadecyloxy)benzamide)acetic acid (2.10 g, 2.10 m mol), 5-O-(4,4-dimethoxytrityl)thymidine (1.37 g, 2.52 mmol) and 1-methylimidazole (0.86 g, 10.50 mmol) in THF (32 mL), and stirred at room temperature for 3.5 hours. Further, COMU (0.27 g, 0.63 mmol) was added, and then stirred at room temperature for 20 hours. The solid precipitated by dropping acetonitrile (158 mL) to the reaction solution was filtered. The solid was washed with acetonitrile-THF mixture solvent, and then dried under reduced pressure at 50? C. to obtain a crude compound (2.96 g). The crude compound was purified by column chromatography (spherical neutral silica gel, eluent: dichloro methane-THF) to give the title compound (2.51 g, 78%) as a white solid.
[0546] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.15-1.55 (m, 93H), 1.65-1.90 (m, 6H), 2.35-2.60 (m, 2H), 3.08 (s, 3H), 3.45-3.55 (m, 2H), 3.79 (s, 6H), 3.85-4.00 (m, 6H), 4.10-4.40 (m, 3H), 5.50-5.60 (m, 1H), 6.40-6.50 (m, 1H), 6.65 (s, 2H), 6.80-6.90 (m, 4H), 7.20-7.40 (m, 9H), 7.62 (s, 1H), 8.36 (s, 1H).
[0547] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 11.64, 14.07, 22.71, 26.17, 29.38, 29.48, 29.65, 29.70, 29.75, 30.41, 31.97, 38.01, 55.30, 63.79, 69.54, 73.58, 76.72, 84.09, 84.54, 87.42, 106.36, 111.64, 113.49, 127.31, 128.09, 128.26, 129.90, 130.15, 135.30, 135.38, 140.18, 144.29, 150.20, 153.29, 159.01, 163.21, 168.70, 172.20.
[0548] TOF/MS (ESI): calcd for C.sub.95H.sub.149N.sub.3O.sub.12Na [M+Na].sup.+1547.1039, found 1547.1042.
Example 5-10
(2) Synthesis of Thymidine-3-Yl 2-(N-Methyl-3,4,5-Tris(Octadecyloxy)Benzamide)Acetate
[0549] ##STR00086##
[0550] The title compound (1.86 g, 98%) was obtained as a white solid from 5-O-(4,4-dimethoxytrityl)thymidine-3-yl 2-(N-methyl-3,4,5-tris (octadecyloxy)benzamide)acetate (2.36 g, 1.55 mmol) according to the method of Example 2-2.
[0551] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.05-1.55 (m, 90H), 1.65-1.85 (m, 6H), 1.92 (s, 3H), 2.30-2.60 (m, 3H), 3.09 (s, 3H), 3.85-4.05 (m, 8H), 4.05-4.35 (m, 3H), 5.45 (s, 1H), 6.05-6.30 (brs, 1H), 6.64 (s, 2H), 7.44 (s, 1H), 8.28 (s, 1H).
[0552] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 12.50, 14.08, 22.71, 26.17, 29.38, 29.47, 29.51, 29.65, 29.70, 29.75, 30.41, 31.97, 37.20, 39.06, 62.67, 69.59, 73.60, 75.74, 85.09, 86.62, 106.33, 111.45, 129.86, 136.38, 140.23, 150.26, 153.33, 163.22, 168.96, 172.29.
[0553] TOF/MS (ESI): calcd for C.sub.74H.sub.131N.sub.3O.sub.10Na [M+Na].sup.+1244.9732, found 1244.9786.
Example 5-11
(3) Synthesis of 5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl) Thymidine-3-Yl)Phosphoryl)Thymidine-3-Yl 2-(N-Methyl-3,4,5-Tris(Octadecyloxy)Benzamide)Acetate
[0554] ##STR00087##
[0555] The title compound (2.54 g, 96%) was obtained from thymidine-3-yl 2-(N-methyl-3,4,5-tris(octadecyloxy)benzamide)acetate (1.71 g, 1.40 mmol) and DMTr-dT-CE-phosphoroamidite (2.09 g, 2.80 mmol) as white solids according to the methods of Examples 3-4.
[0556] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.6 Hz), 1.05-1.55 (m, 93H), 1.65-1.85 (m, 6H), 1.91 (s, 3H), 2.30-2.55 (m, 3H), 2.60-2.80 (m, 3H), 3.08 (s, 3H), 3.35-3.45 (m, 1H), 3.50-3.60 (m, 1H), 3.78 (s, 3H), 3.79 (s, 3H), 3.90-4.05 (m, 6H), 4.10-4.45 (m, 8H), 5.10-5.20 (m, 1H), 5.30-5.45 (m, 1H), 6.10-6.30 (brs, 1H), 6.35-6.45 (m, 1H), 6.64 (s, 2H), 6.75-6.90 (m, 4H), 7.15-7.40 (m, 10H), 7.49 (d, 1H, J=6.4 Hz), 8.50-8.75 (m, 2H).
[0557] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 11.76, 12.41, 12.46, 14.07, 19.63, 19.70, 19.78, 19.85, 22.70, 26.20, 29.37, 29.50, 29.52, 29.70, 29.75, 29.79, 30.43, 31.96, 36.86, 38.50, 39.03, 55.30, 55.34, 61.99, 62.10, 62.50, 62.55, 62.63, 63.33, 67.69, 69.61, 69.64, 73.60, 74.61, 79.78, 81.51, 82.43, 84.41, 84.52, 84.57, 85.65, 85.88, 86.36, 87.47, 106.43, 111.40, 111.78, 111.83, 111.89, 113.31, 113.50, 116.07, 116.42, 127.09, 127.38, 127.86, 128.11, 128.27, 129.21, 130.20, 135.07, 135.18, 135.45, 135.54, 136.37, 139.66, 140.30, 144.12, 147.51, 150.16, 150.21, 150.26, 150.38, 153.30, 158.81, 159.03, 163.33, 168.90, 172.25, 172.43.
[0558] TOF/MS (ESI): calcd for C.sub.108H.sub.165N.sub.6O.sub.19PNa [M+Na].sup.+1904.1765, found 1904.1780.
Synthesis of 5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)Thymidine-3-Yl)Phosphoryl)Thymidine-3-Yl 3-(3,4,5-Tris(Octadecyloxy)Benzamide) Propionate
Example 5-12
(1) Synthesis of 5-O-(4,4-Dimethoxytrityl)Thymidine-3-Yl 3-(3, 4,5-Tris(Octadecyloxy)Benzamide)Propionate
[0559] ##STR00088##
[0560] COMU (1.88 g, 4.40 mmol) was added to a suspension of 3-(3,4,5-tris(octadecyloxy)benzamide)propionic acid (2.20 g, 2.20 mmol), 5-O-(4,4-dimethoxytrityl)thymidine (1.44 g, 2.64 mmol), and 1-methylimidazole (0.90 g, 11.00 mmol) in THF (44 mL), and stirred at room temperature for 3.5 hours. Further, 1-methylimidazole (0.36 g, 4.4 mmol) and COMU (0.94 g, 2.20 mmol) were added, and the mixture was stirred at room temperature for 68 hours. The solid precipitated by dropping acetonitrile (220 mL) to the reaction solution was filtered. The solid was washed with acetonitrile-THF mixture solvent and methanol, and then dried under reduced pressure at 50? C. to obtain a crude compound (3.07 g). The crude compound was purified by column chromatography (spherical neutral silica gel, eluent: dichloromethane-THF) to give the title compound (2.01 g, 60%) as a white solid.
[0561] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.15-1.55 (m, 93H), 1.60-1.85 (m, 6H), 2.40-2.55 (m, 2H), 2.65-2.75 (m, 2H), 3.40-3.55 (m, 2H), 3.65-3.75 (m, 2H), 3.78 (s, 6H), 3.95-4.05 (m, 6H), 4.14 (d, 1H, J=1.6 Hz), 5.47 (d, 1H, J=4.8 Hz), 6.42 (t, 1H, J=6.2 Hz), 6.59 (t, 1H, J=6.0 Hz), 6.80-6.90 (m, 4H), 6.94 (s, 2H), 7.20-7.45 (m, 9H), 7.60 (s, 1H), 8.43 (s, 1H).
[0562] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 11.62, 14.14, 22.71, 26.11, 29.38, 29.45, 29.61, 29.68, 29.74, 30.33, 31.94, 34.05, 35.35, 37.92, 55.24, 63.65, 69.36, 73.51, 75.85, 83.94, 84.34, 87.24, 105.67, 111.65, 113.15, 113.32, 127.26, 127.76, 127.85, 128.06, 128.10, 129.12, 130.04, 130.08, 135.03, 135.24, 135.35, 141.26, 144.12, 150.23, 153.10, 158.78, 163.39, 167.36, 172.25.
[0563] TOF/MS (ESI): calcd for C.sub.95H.sub.149N.sub.3O.sub.12Na [M+Na].sup.+1547.1039, found 1547.1014.
Example 5-13
(2) Synthesis of Thymidine-3-Yl 3-(3,4,5-Tris(Octadecyloxy)Benz Amide)Propionate
[0564] ##STR00089##
[0565] The title compound (1.51 g, 99%) was obtained as a white solid from 5-O-(4,4-dimethoxytrityl)thymidine-3-yl 3-(3,4,5-tris(octadecyloxy)benzamide)propionate (1.91 g, 1.25 mmol) according to the method of Example 2-2.
[0566] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.15-1.55 (m, 90H), 1.65-1.85 (m, 6H), 1.91 (s, 3H), 2.30-2.55 (m, 2H), 2.55-2.75 (m, 3H), 3.65-3.75 (m, 2H), 3.85-3.95 (m, 2H), 3.95-4.05 (m, 6H), 4.05-4.10 (m, 1H), 5.35-5.40 (m, 1H), 6.16 (dd, 1H, J=6.0, 8.4 Hz), 6.55-6.65 (m, 1H), 6.95 (s, 2H), 7.43 (s, 1H), 8.25-8.55 (m, 1H).
[0567] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 12.51, 14.09, 22.71, 26.13, 26.16, 29.38, 29.47, 29.62, 29.69, 29.75, 29.99, 30.38, 31.96, 34.26, 35.57, 37.12, 62.57, 69.57, 73.59, 75.09, 85.06, 86.65, 106.04, 111.41, 129.08, 136.51, 141.64, 150.33, 153.20, 163.40, 167.46, 172.39.
[0568] TOF/MS (ESI): calcd for C.sub.74H.sub.131N.sub.3O.sub.10Na [M+Na].sup.+1244.9732, found 1244.9789.
Examples 5-14
(3) Synthesis of 5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl) Thymidine-3-Yl)Phosphoryl)Thymidine-3-Yl 3-(3,4,5-Tris(Octadecyloxy)Benzamide)Propionate
[0569] ##STR00090##
[0570] The title compound (2.07 g, 95%) was obtained as white solids from thymidine-3-yl 3-(3,4,5-tris(octadecyloxy)benzamide)propionate (1.41 g, 1.15 mmol) and DMTr-dT-CE-phosphoroamidite (1.71 g, 2.30 mmol) according to the methods of Examples 3-4.
[0571] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.15-1.55 (m, 93H), 1.65-1.85 (m, 7H), 1.90 (d, 3H, J=1.2 Hz), 2.25-2.55 (m, 3H), 2.55-2.80 (m, 5H), 3.30-3.45 (m, 1H), 3.50-3.60 (m, 1H), 3.60-3.75 (m, 2H), 3.78 (s, 3H), 3.79 (s, 3H), 3.90-4.05 (m, 6H), 4.05-4.40 (m, 6H), 5.10-5.25 (m, 1H), 5.30-5.40 (m, 1H), 6.15-6.25 (m, 1H), 6.40-6.50 (m, 1H), 6.75-6.90 (m, 4H), 6.99 (d, 2H, J=3.6 Hz), 7.20-7.40 (m, 9H), 7.50-7.60 (m, 1H), 8.95-9.05 (m, 1H), 9.05-9.15 (m, 1H).
[0572] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 11.72, 12.49, 14.14, 19.59, 19.67, 19.75, 22.71, 26.11, 26.14, 29.38, 29.47, 29.63, 29.69, 29.75, 29.78, 30.35, 31.94, 34.03, 35.53, 35.58, 36.64, 38.95, 55.29, 62.36, 62.41, 62.52, 62.57, 63.24, 67.60, 69.38, 73.53, 73.84, 79.90, 82.35, 82.44, 84.25, 84.32, 84.39, 85.48, 85.67, 87.35, 105.86, 111.64, 111.74, 111.88, 113.14, 113.35, 116.25, 116.44, 127.34, 127.76, 127.85, 128.09, 129.03, 129.13, 130.13, 134.91, 134.95, 135.00, 135.07, 135.48, 135.61, 141.22, 143.93, 143.97, 150.21, 150.26, 150.46, 150.49, 153.03, 158.83, 163.48, 163.53, 167.47, 167.51, 172.19.
[0573] TOF/MS (ESI): calcd for C.sub.108H.sub.165N.sub.6O.sub.19PNa [M+Na].sup.+1904.1765, found 1904.1807.
6. Synthesis of (4-(((6-(N.SUP.6.-Benzoyladenine-9-Yl)-4-Tritylmorpholin-2-Yl)Methoxy)(Dimethylamino)Phosphoryl)-6-(Thymine-1-Yl)Morpholin-2-Yl)Methyl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
Example 6-1
(1) Synthesis of (6-(Thymine-1-Yl)-4-Tritylmorpholin-2-Yl)Methyl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0574] ##STR00091##
[0575] The title compound (2.85 g, 98%) was obtained from 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetic acid (1.97 g, 2.00 mmol) and 6-(hydroxymethyl)-4-tritylmorpholin-2-yl)-5-methylpyrimidine-2,4-(1H, 3H)-dione (1.16 g, 2.40 mmol) according to the procedure of Example 2-1.
[0576] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.11-1.53 (m, 91H), 1.68-1.83 (m, 6H), 1.84 (s, 3H), 3.13 (d, 1H, J=12.0 Hz), 3.37 (d, 1H, J=11.2 Hz), 3.98-4.04 (m, 6H), 4.17 (d, 2H, J=5.2 Hz), 4.37-4.41 (m, 1H), 4.78 (s, 2H), 6.13 (dd, 1H, J=2.0, 9.6 Hz), 7.00 (s, 1H), 7.15-7.26 (m, 3H), 7.26-7.38 (m, 8H), 7.34-7.58 (m, 6H), 8.34 (s, 1H).
[0577] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 12.45, 14.13, 22.70, 26.07, 26.11, 29.32, 29.38, 29.42, 29.59, 29.66, 29.68, 29.73, 30.35, 31.94, 49.01, 51.85, 60.89, 65.08, 69.19, 73.55, 74.58, 80.50, 108.31, 110.68, 123.33, 126.64, 127.97, 129.13, 135.33, 142.95, 149.63, 152.91, 163.23, 165.75, 167.64.
[0578] TOF/MS (ESI): calcd for C.sub.92H.sub.143N.sub.3O.sub.10Na [M+Na].sup.+1473.0671, found 1473.0629.
Example 6-2
(2) Synthesis of (6-(Thymine-1-Yl)Morpholin-2-Yl)Methyl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate Trifluoroacetic Acid Salt
[0579] ##STR00092##
[0580] The title compound (2.44 g, 97%) was obtained from (6-(thy mine-1-yl)-4-tritylmorpholin-2-yl)methyl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (2.76 g, 1.90 mmol) according to the method of Ex ample 2-2.
[0581] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.10-1.39 (m, 84H), 1.42-1.50 (m, 6H), 1.70-1.83 (m, 6H), 1.87 (s, 3H), 2.95-3.16 (m, 2H), 3.42 (d, 1H, J=11.2 Hz), 3.62-3.75 (m, 1H), 3.95-4.05 (m, 6H), 4.31 (d, 1H, J=8.4 Hz), 4.46 (d, 2H, J=10.0 Hz), 4.86 (s, 2H), 6.17 (d, 1H, J=9.6 Hz), 7.25 (s, 1H), 7.30 (s, 2H), 10.15-10.75 (brs, 1H).
[0582] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 12.48, 14.13, 22.71, 26.09, 26.15, 29.35, 29.39, 29.47, 29.63, 29.69, 29.75, 29.78, 30.38, 31.94, 43.24, 44.99, 60.87, 63.56, 69.21, 72.38, 73.57, 108.30, 112.18, 114.99, 117.90, 123.12, 134.33, 143.10, 150.40, 152.99, 162.55, 162.90, 163.78, 166.02, 167.45.
[0583] TOF/MS (ESI): calcd for C.sub.73H.sub.129N.sub.3O.sub.10CF.sub.3COOH [M?H].sup.?1320.9528, found 1320.9517.
Example 6-3
(3) Synthesis of (4-(((6-(N.SUP.6.-Benzoyladenine-9-Yl)-4-Tritylmorpholin-2-Yl)Methoxy)(Dimethylamino)Phosphoryl)-6-(Thymine-1-Yl)Morpholin-2-Yl)Methyl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0584] ##STR00093##
[0585] (6-(N.sup.6-benzoyladenine-9-yl)-4-tritylmorpholin-2-yl)methyldimethylphosphoramidechloridate (3.81 g, 5.27 mmol) was added to a solution of (6-(thymine-1-yl)morpholin-2-yl)methyl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate trifluoroacetic acid salt (2.32 g, 1.76 mmol) and N,N-diisopropylethylamine (4.16 g, 32.16 mmol) in 1,3-dimethyl-2-imidazolidinone (16 mL)-THF (18 mL), and then stirred at room temperature for 2.5 hours. The slurry liquid by adding methanol (93 mL) to the reaction solution was obtained, and then was concentrated under reduced pressure. The slurry liquid obtained by adding methanol to the concentrated residue was stirred at room temperature for 30 minutes, and then filtered. The solid was washed with methanol, and then dried under reduced pressure at 50? C. to obtain a crude compound (3.23 g). The crude compound was purified by column chromatography (spherical neutral silica gel, eluent: dichloromethane-methanol) to give the title compound (1.96 g, 59%) as a white solid.
[0586] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.10-1.53 (m, 90H), 1.55-1.97 (m, 12H), 2.46 (d, 3H, J=10.4 Hz), 2.63 (d, 3H, J=9.6 Hz), 2.46-2.63 (m, 1H), 3.12-3.60 (m, 4H), 3.75-4.07 (m, 10H), 4.15-4.50 (m, 2H), 4.78-4.91 (m, 2H), 5.41-5.53 (m, 1H), 6.42 (d, 1H, J=10.4 Hz), 7.12-7.20 (m, 4H), 7.20-7.32 (m, 9H), 7.40-7.58 (m, 8H), 8.05 (d, 2H, J=7.6 Hz), 8.07-8.10 (m, 1H), 8.68-8.80 (m, 1H), 9.50-9.76 (m, 2H).
[0587] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 12.44, 12.53, 14.14, 22.70, 26.08, 26.12, 29.32, 29.38, 29.43, 29.60, 29.68, 29.73, 30.35, 31.94, 36.47, 36.51, 36.63, 36.67, 44.56, 44.84, 47.02, 48.64, 48.78, 52.81, 53.10, 60.93, 64.23, 65.34, 65.69, 69.19, 73.56, 74.90, 74.97, 75.34, 79.53, 79.61, 79.97, 80.79, 108.27, 110.92, 111.25, 122.82, 123.26, 126.65, 128.00, 128.22, 128.29, 128.57, 128.63, 129.16, 132.47, 132.57, 133.49, 133.92, 134, 74, 134.80, 140.75, 140.78, 142.97, 143.00, 149.31, 149.68, 149.82, 150.12, 150.89, 151.40, 152.65, 152.77, 152.92, 152.94, 163.62, 165.02, 165.23, 165.82, 165.84, 167.56, 167.63.
[0588] TOF/MS (ESI): calcd for C.sub.111H.sub.165N.sub.10O.sub.14PNa [M+Na].sup.+1916.2142, found 1916.2216.
Synthesis of (4-(((6-(N.SUP.4.-Benzoylcytosine-1-Yl)-4-Tritylmorpholin-2-Yl)Methoxy)(Dimethylamino)Phosphoryl)-6-(N.SUP.2.-Isobutyrylguanine-9-Yl) Morpholin-2-Yl)Methyl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
Example 6-4
(1) Synthesis of (6-(N.SUP.2.-Isobutyrylguanine-9-Yl)-4-Tritylmorpholin-2-Yl)Methyl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0589] ##STR00094##
[0590] The title compound (3.00 g, 97%) was obtained from 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetic acid (1.97 g, 2.00 mmol) and N-(9-(6-(hydroxymethyl)-4-tritylmorpholin-2-yl))-6-oxo-6,9-dihydro-1H-purine-2-yl)isobutylamide (1.51 g, 2.60 mmol) according to the procedure of Example 2-1.
[0591] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.10-1.60 (m, 97H), 1.70-1.90 (m, 7H), 2.64 (sept, 1H), 3.18 (d, 1H, J=12.0 Hz), 3.45 (d, 1H, J=11.6 Hz), 3.95-4.15 (m, 6H), 4.13-4.25 (m, 2H), 4.37-4.46 (m, 1H), 4.72 (d, 1H, J=16.0 Hz), 4.84 (d, 1H, J=16.0 Hz), 5.89 (dd, 1H, J=2.2, 9.8 Hz), 7.06-7.37 (m, 12H), 7.39-7.55 (m, 5H), 7.61 (s, 1H), 8.18 (s, 1H), 11.92 (s, 1H).
[0592] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 14.14, 18.93, 19.03, 22.71, 26.07, 26.12, 29.33, 29.37, 29.42, 29.60, 29.67, 29.74, 30.35, 31.94, 36.64, 49.04, 52.24, 60.90, 65.03, 69.25, 73.58, 74.22, 80.36, 108.38, 121.30, 123.27, 126.69, 127.96, 129.18, 136.12, 143.08, 147.32, 147.42, 152.95, 155.36, 165.98, 167.61, 177.85.
[0593] TOF/MS (ESI): calcd for C.sub.96H.sub.148N.sub.6O.sub.10Na [M+Na].sup.+1568.1155, found 1568.1176.
Example 6-5
(2) Synthesis of (6-(N.SUP.2.-Isobutyrylguanine-9-Yl)Morpholin-2-Yl)Methyl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate Trifluoroacetic Acid Salt
[0594] ##STR00095##
[0595] The title compound (2.45 g, 96%) was obtained from (6-(N.sup.2-isobutyrylguanine-9-yl)-4-tritylmorpholin-2-yl)methyl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (2.78 g, 1.80 mmol) according to the procedure of Example 2-2.
[0596] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.87 (t, 9H, J=6.8 Hz), 1.00-1.53 (m, 96H), 1.69-1.88 (m, 6H), 2.72-2.88 (m, 1H), 3.19-3.38 (m, 1H), 3.44-3.63 (m, 1H), 3.75-4.13 (m, 8H), 4.25-4.63 (m, 3H), 4.69-4.94 (m, 2H), 6.06-6.31 (m, 1H), 7.20-7.30 (m, 3H), 7.87-8.06 (m, 1H), 10.19-10.63 (brs, 1H), 12.19-12.63 (brs, 1H).
[0597] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 14.12, 18.92, 22.70, 26.09, 26.16, 29.35, 29.38, 29.47, 29.63, 29.68, 29.75, 29.79, 30.04, 30.38, 31.94, 36.17, 42.86, 60.73, 63.62, 69.21, 71.44, 73.57, 108.29, 115.13, 118.04, 123.10, 143.09, 148.28, 152.95, 156.00, 165.93, 167.50, 180.39.
[0598] TOF/MS (ESI): calcd for C.sub.77H.sub.134N.sub.6O.sub.10CF.sub.3COOH [M?H].sup.?1416.0012, found 1415.9960.
Example 6-6
(3) Synthesis of (4-(((6-(N.SUP.4.-Benzoylcytosine-1-Yl)-4-Tritylmorpholin-2-Yl)Methoxy)(Dimethylamino)Phosphoryl)-6-(N.SUP.2.-Isobutyrylguanine-9-Yl)Morpholin-2-Yl)Methyl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0599] ##STR00096##
[0600] The title compound (2.87 g, 91%) was obtained from (6-(N.sup.2-isobutyrylguanine-9-yl)morpholin-2-yl)methyl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate trifluoroacetic acid salt (2.27 g, 1.60 mmol) and (6-(N.sup.4-benzoylcytosine-1-yl)-4-tritylmorpholin-2-yl)methyldimethylphosphoramidochloridate (3.35 g, 4.80 mmol) according to the procedure of Example 6-3.
[0601] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.88 (t, 9H, J=6.8 Hz), 1.00-1.56 (m, 96H), 1.69-1.88 (m, 9H), 2.38-2.97 (m, 8H), 3.06-3.69 (m, 5H), 3.75-4.56 (m, 12H), 4.69-4.94 (m, 2H), 5.34-5.63 (m, 1H), 6.28-6.50 (m, 1H), 7.13-8.00 (m, 23H), 8.69-8.94 (brs, 1H), 9.31-9.63 (brs, 1H), 10.06-10.31 (brs, 1H), 12.13-12.31 (m, 1H).
[0602] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 14.13, 19.01, 19.04, 19.17, 19.22, 22.70, 26.07, 26.12, 29.32, 29.37, 29.43, 29.60, 29.67, 29.73, 29.98, 30.35, 31.94, 36.17, 36.27, 36.64, 36.68, 36.74, 36.78, 45.00, 45.08, 46.96, 47.43, 48.25, 48.76, 52.48, 60.82, 60.90, 64.27, 65.84, 69.20, 69.22, 73.57, 74.31, 74.51, 75.41, 79.30, 80.47, 81.36, 81.59, 108.31, 121.25, 122.00, 123.26, 123.33, 126.67, 126.73, 127.73, 127.99, 128.80, 128.98, 132.71, 133.07, 133.27, 136.19, 137.10, 142.90, 143.01, 147.88, 148.00, 148.09, 152.89, 152.93, 155.79, 155.90, 165.79, 165.91, 167.56, 167.58, 178.67, 179.37.
[0603] TOF/MS (ESI): calcd for C.sub.114H.sub.170N.sub.11O.sub.15PNa [M+Na].sup.+1987.2513, found 1987.2521. [0604] 7. Confirmation of Tag removal
Example 7-1
Synthesis of 5-O-((2-Cyanoethoxy)(5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)Thymidine-3-Yl)Phosphoryl)-N.SUP.2.-Isobutyryldeoxyguanosine-3-Yl)Phosphoryl)Thymidine
[0605] ##STR00097##
[0606] A mixture solution of 5-O-((2-cyanoethoxy)(5-O-((2-cyanoethoxy) (5-O-(4,4-dimethoxytrityl)thymidine-3-yl)phosphoryl)-N.sup.2-isobutyryl deoxyguanosine-3-yl)phosphoryl)thymidine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (233 mg, 0.10 mmol) in THF (9 mL)-2-propanol (1 mL) was cooled to 0? C. In cool, 4 mol/L-lithium borohydride-THF solution (0.125 m L, 0.50 mmol) was added and stirred at the same temperature for 30 min. An aqueous ammonium chloride solution was added to the reaction solution, and then extracted 3 times with dichloromethane. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered to remove sodium sulfate, and then the filtrate was concentrated. The solid precipitated by suspending the concentrated residue in acetonitrile was removed by filtration, and the filtrate was concentrated. A portion (2.5 mL) of the dimethyl sulfoxide-methanol mixture solution (1:1, 5 mL) of the concentrated residue was purified by preparative chromatography in 5 portions to give the title compound (64 mg, 95%) as a white solid.
[0607] Preparative chromatographic conditions: Column MightysilRP-18 GP (5 ?m, 20 ??250 mm) manufactured by Kanto Chemical Co., Lt d., flow rate 5 mL/min, mobile phase acetonitrile-water (gradient 0-30 min (ratio of acetonitrile 50.fwdarw.60%)
[0608] .sup.1H-NMR (600 MHz, DMSO-d.sub.6): ? 1.12 (d, 6H, J=6.0 Hz), 1.42 (d, 3H, J=7.2 Hz), 1.74 (d, 3H, J=2.8 Hz), 2.07 (s, 1H), 2.30-2.41 (m, 3H), 2.60-2.90 (m, 6H), 3.18-3.29 (m, 2H), 3.73 (d, 6H, J=4.2 Hz), 4.00-4.43 (m, 12H), 4.97 (s, 1H), 5.10 (s, 1H), 5.51-5.52 (m, 1H), 6.15-6.25 (m, 3H), 6.88 (d, 4H, J=9.0 Hz), 7.20-7.50 (m, 11H), 8.17 (q, 1H, J=1.8 Hz), 11.33-12.07 (m, 3H).
[0609] .sup.13C-NMR (151 MHz, DMSO-d.sub.6): ? 10.56, 10.88, 17.66, 33.65, 35.78, 52.00, 53.86, 56.34, 61.48, 61.80, 65.49, 66.58, 68.73, 76.58, 77.11, 81.63, 82.11, 82.52, 82.87, 84.98, 90.73, 108.72, 112.08, 116.98, 119.14, 125.69, 126.46, 126.77, 128.53, 133.81, 134.00, 134.26, 134.70, 136.15, 143.26, 147.04, 147.32, 149.14, 153.53, 156.99, 162.50, 168.14, 178.89.
[0610] TOF/MS (ESI): calcd for C.sub.61H.sub.69N.sub.11O.sub.21P.sub.2Na [M+Na].sup.+1376.4, found 1376.6.
Example 7-2
Synthesis of 5-O-((2-Cyanoethoxy)(5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)-N.SUP.2.-Isobutyryldeoxyguanosine-3-Yl)Phosphoryl)Thymidine-3-Yl)Phosphoryl)-N.SUP.6.-Benzoyldeoxyadenosine
[0611] ##STR00098##
[0612] The title compound (55 mg, 75%) was obtained as a yellow solid from 5-O-((2-cyanoethoxy)(5-O-((2-cyanoethoxy)(5-O-(4,4-dimethoxytrityl)-N.sup.2-isobutyldeoxyguanosine-3-yl)phosphoryl)thymidine-3-yl)phosphoryl)-N.sup.6-benzoyldeoxyadenosine-3-yl 2-((3,4,5-tris(octadecyloxy) benzoyl)oxy)acetate (244 mg, 0.10 mmol) according to the procedure of Example 7-1.
[0613] .sup.1H-NMR (600 MHz, DMSO-d.sub.6): ? 1.17-1.30 (m, 7H), 1.74-1.79 (m, 3H), 1.97-2.30 (m, 2H), 2.45-2.51 (m, 2H), 2.68-2.76 (m, 1H), 2.79-2.83 (m, 1H), 2.96 (dt, 4H, J=6.4, 12.4 Hz), 3.03-3.12 (m, 1H), 3.22 (t, 1H, J=11.3 Hz), 3.77 (s, 6H), 3.93 (s, 1H), 4.07-4.38 (m, 11H), 5.07-5.45 (m, 5H), 6.05-6.45 (m, 3H), 6.85 (t, 4H, J=10.7 Hz), 7.24 (d, 5H, J=8.9 Hz), 7.29 (t, 2H, J=7.6 Hz), 7.36 (d, 2H, J=7.6 Hz), 7.49-7.56 (m, 3H), 7.65 (t, 1H, J=7.2 Hz), 7.90 (dt, 1H, J=3.0, 8.1 Hz), 8.07 (d, 2H, J=7.6 Hz), 8.13-8.16 (m, 1H), 10.89-12.13 (m, 3H).
[0614] .sup.13C-NMR (151 MHz, DMSO-d.sub.6): ? 12.52, 14.58, 19.33, 35.33, 36.13, 37.02, 55.48, 60.34, 62.73, 63.24, 64.06, 67.31, 68.33, 70.66, 77.30, 79.12, 82.64, 83.37, 84.09, 84.74, 86.25, 113.58, 118.69, 121.00, 123.54, 127.24, 128.19, 128.72, 128.94, 130.23, 132.68, 133.50, 134.55, 135.77, 136.46, 137.81, 139.68, 145.08, 148.56, 149.12, 150.82, 155.31, 158.56, 161.08, 164.11, 165.03, 180.61.
[0615] TOF/MS (ESI): calcd for C.sub.68H.sub.72N.sub.14O.sub.20P.sub.2Na [M+Na].sup.+1489.4, found 1489.4.
Example 7-3
Synthesis of 5-O-((2-Cyanoethoxy)(5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)Thymidine-3-Yl)Phosphoryl)-N.SUP.2.-Isobutyryldeoxyguanosine-3-Yl)Phosphoryl)-N.SUP.4.-Benzoyldeoxycytidine
[0616] ##STR00099##
[0617] The title compound (57 mg, 79%) was obtained as a white solid from 5-O-((2-cyanoethoxy)(5-O-((2-cyanoethoxy)(5-O-(4,4-dimethoxytrityl) thymidine-3-yl)phosphoryl)-N.sup.2-isobutyryldeoxyguanosine-3-yl)phosphoryl)-N.sup.4-benzoyldeoxycytidine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (243 mg, 0.10 mmol) according to the procedure of Example 7-1.
[0618] .sup.1H-NMR (600 MHz, DMSO-d.sub.6): ? 1.09-1.12 (m, 6H), 1.42 (s, 3H), 1.75-2.10 (m, 4H), 2.61-2.95 (m, 7H), 3.15-3.25 (m, 3H), 3.70-3.77 (m, 7H), 4.08-4.36 (m, 11H), 5.09 (d, 2H, J=41.9 Hz), 5.32 (d, 2H, J=44.0 Hz), 6.18-6.29 (m, 3H), 6.85-6.88 (m, 4H), 7.20-7.22 (m, 5H), 7.29 (q, 2H, J=6.9 Hz), 7.34 (d, 2H, J=7.6 Hz), 7.41-7.53 (m, 4H), 7.86 (d, 2H, J=7.6 Hz), 8.19 (dt, 1H, J=4.4, 8.2 Hz), 8.84 (q, 1H, J=6.4 Hz), 11.34-12.05 (m, 3H).
[0619] .sup.13C-NMR (151 MHz, DMSO-d.sub.6): ? 12.17, 19.35, 27.86, 35.35, 55.56, 57.07, 63.19, 63.61, 67.29, 68.60, 70.86, 78.19, 78.93, 82.62, 83.40, 83.86, 84.14, 86.67, 110.47, 113.78, 118.59, 118.88, 120.91, 127.38, 128.02, 128.69, 130.24, 131.86, 134.55, 135.51, 135.97, 137.92, 144.97, 148.76, 149.02, 150.84, 154.36, 155.25, 158.69, 164.09, 165.95, 166.18, 180.60.
[0620] TOF/MS (ESI): calcd for C.sub.67H.sub.72N.sub.12O.sub.21P.sub.2Li [M+Li].sup.+1449.5, found 1449.6.
Example 7-4
Synthesis of 5-O-((2-Cyanoethoxy)(5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)Thymidine-3-Yl)Phosphoryl)Thymidine-3-Yl)Phosphoryl)-N.SUP.2.-Isobutyryldeoxyguanosine
[0621] ##STR00100##
[0622] The title compound (63 mg, 93%) was obtained as a white solid from 5-O-((2-cyanoethoxy)(5-O-(2-cyanoethoxy)(5-O-(4,4-dimethoxytrityl) thymidine-3-yl)phosphoryl)thymidine-3-yl)phosphoryl)-N.sup.2-isobutyldeoxianosine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (232 m g, 0.10 mmol) according to the method of Example 7-1.
[0623] .sup.1H-NMR (600 MHz, DMSO-d.sub.6): ? 1.12 (d, 6H, J=6.2 Hz), 1.42 (d, 3H, J=7.6 Hz), 1.73 (d, 3H, J=2.7 Hz), 2.07 (s, 1H), 2.32-2.43 (m, 3H), 2.61-2.91 (m, 6H), 3.20-3.29 (m, 2H), 3.73 (d, 6H, J=3.8 Hz), 4.04-4.43 (m, 12H), 4.97 (s, 1H), 5.10 (s, 1H), 5.51-5.52 (m, 1H), 6.13-6.26 (m, 3H), 6.88 (d, 4H, J=8.9 Hz), 7.23 (d, 5H, J=7.6 Hz), 7.30 (t, 2H, J=6.2 Hz), 7.36 (d, 2H, J=8.2 Hz), 7.43-7.47 (m, 2H), 7.89-8.18 (m, 1H), 11.33-12.07 (m, 3H).
[0624] .sup.13C-NMR (151 MHz, DMSO-d.sub.6): ? 10.46, 10.84, 17.69, 17.83, 33.61, 35.32, 36.22, 53.86, 61.50, 61.98, 65.53, 66.44, 68.89, 75.88, 77.15, 80.92, 81.78, 82.16, 82.47, 82.92, 83.51, 85.00, 108.75, 108.90, 112.08, 116.92, 119.11, 125.71, 126.48, 126.77, 128.55, 133.80, 134.02, 134.33, 134.53, 136.24, 143.27, 146.96, 147.20, 149.17, 153.63, 157.01, 162.41, 178.92.
[0625] TOF/MS (ESI): calcd for C.sub.61H.sub.69N.sub.11O.sub.21P.sub.2Na [M+Na].sup.+1376.4, found 1376.6.
Example 7-5
Synthesis of 5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)-Thymidine-3-Yl)Phosphorothioyl)-Thymidine
[0626] ##STR00101##
[0627] A mixture solution of 5-O-((2-cyanoethoxy)(5-O-(4,4-dimethoxytrityl)-thymidine-3-yl)phosphorothioyl)-thymidine-3-yl 2-((3,4,5-tris (octadecyloxy)benzoyl)oxy)acetate (189 mg, 0.10 mmol) in THF (9 m L)-2-propanol (1 mL) was cooled to 0? C. In cool, 4 mol/L-lithium borohydride-THF solution (0.125 m L, 0.50 mmol) was added and stirred at the same temperature for 30 min. An aqueous ammonium chloride solution was added to the reaction solution, and then extracted 3 times with dichloromethane. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered to remove sodium sulfate, and then the filtrate was concentrated. The solid precipitated by suspending the concentrated residue in acetonitrile was removed by filtration, and the filtrate was concentrated. The concentrated residue was purified by column chromatography (silica gel, eluent: chloroform-methanol) to give the title compound (86 mg, 93%) as a white solid.
[0628] .sup.1H-NMR (600 MHz, CDCl.sub.3): ? 1.46 (d, 3H, J=15.8 Hz), 1.91 (d, 3H, J=8.2 Hz), 2.21-2.79 (m, 6H), 3.39-3.49 (m, 2H), 3.79 (d, 6H, J=3.4 Hz), 4.08-4.52 (m, 8H), 5.26-5.31 (m, 1H), 6.25-6.41 (m, 2H), 6.85 (dd, 4H, J=2.7, 8.9 Hz), 7.22-7.38 (m, 9H), 7.58 (d, 1H, J=24.1 Hz), 9.45-10.50 (m, 2H).
[0629] .sup.13C-NMR (151 MHz, CDCl.sub.3): ? 11.90, 12.57, 19.43, 38.92, 39.90, 55.30, 62.59, 63.36, 67.70, 71.03, 80.38, 84.66, 85.46, 87.28, 111.32, 111.97, 113.38, 116.54, 127.28, 128.00, 128.11, 130.06, 135.00, 135.80, 144.09, 150.64, 150.92, 158.74, 163.98.
[0630] TOF/MS (ESI): calcd for C.sub.44H.sub.48N.sub.5O.sub.13PSNa [M+Na].sup.+940.3, found 940.2.
Example 7-6
Synthesis of 5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)-2-Fluorodeoxyuridine-3-Yl)Phosphoryl)-2-Fluoro-N.SUP.2.-Isobutyryldeoxyguanosine
[0631] ##STR00102##
[0632] A mixture solution of 5-O-((2-cyanoethoxy)(5-O-(4,4-dimethoxytrityl)-2-fluorodeoxyuridin-3-yl)phosphoryl)-2-fluoro-N.sup.2-isobutyryldeoxyguanosine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (0.397 g, 0.200 mmol) in THF (27 mL)-2-propanol (3 mL) was cooled to 0 to ?10? C. In cool, 4 mol/L-lithium borohydride-THF solution (0.10 m L, 0.400 mmol) was added and stirred at the same temperature for 20 min. 10% aqueous ammonium chloride (4 mL) was added to the reaction solution, and then the mixture was separated, and the organic layer was washed with 10% brine. The organic layer was dried over anhydrous sodium sulfate, filtered to remove sodium sulfate, and then the filtrate was concentrated. The solid precipitated by adding methanol to the concentrated residue was removed by filtration, and the filtrate was concentrated and dried. The concentrated residue was purified by column chromatography (spherical neutral silica gel, eluent: dichloromethane-methanol) to give the title compound (0.137 g, 67%) as a white solid.
[0633] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 1.16-1.26 (m, 6H), 2.19 (s, 2H), 2.45-2.87 (m, 3H), 3.44-3.66 (m, 2H), 3.72-3.75 (m, 6H), 3.92-4.18 (m, 2H), 4.25-4.50 (m, 4H), 4.89-5.55 (m, 6H), 5.85-6.00 (m, 2H), 6.80-6.82 (m, 4H), 7.15-7.30 (m, 7H), 7.33-7.37 (m, 2H), 7.71-7.82 (m, 2H), 10.05-10.42 (brs, 1H), 10.55-10.87 (brs, 1H), 12.36 (s, 1H).
[0634] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 18.75, 18.85, 19.01, 19.07, 19.38, 19.45, 36.01, 50.81, 55.26, 55.28, 60.65, 62.85, 67.86, 80.26, 81.13, 87.13, 87.19, 87.53, 87.88, 90.59, 92.53, 102.62, 113.33, 116.74, 121.28, 127.26, 128.05, 128.19, 130.22, 134.80, 134.91, 134.96, 135.07, 140.41, 144.01, 144.11, 148.00, 148.06, 148.50, 148.55, 150.44, 155.70, 158.76, 163.72, 180.33, 180.39.
[0635] TOF/MS (ESI): calcd for C.sub.47H.sub.49N.sub.8O.sub.14F.sub.2PNa [M+Na].sup.+1041.2972, found 1041.2975.
Examples 7-7
Synthesis of N.SUP.4.-Benzoyl-5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)-2-O-Methyluridine-3-Yl)Phosphoryl)-2-O-Methylcytidine
[0636] ##STR00103##
[0637] Mixture solutions of N,N-diisopropylethylamine (0.065 g, 0.50 mmol) in THF (13.5 mL) and 2-propanol (1.5 mL) were cooled from 0 to ?10? C. In cool, 4 mol/L-lithium borohydride-THF solution (0.125 mL, 0.50 mmol) was added and stirred at the same temperature for 10 min. A mixture solution of N.sup.4-benzoyl-5-O-((2-cyanoethoxy) (5-O-(4,4-dimethoxytrityl)-2-O-methyluridine-3-yl)phosphoryl)-2-O-methylcytidine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (0.200 g, 0.10 mmol) in THF (0.9 mL)-2-propanol (0.1 mL) was then added and stirred at the same temperature for 0.5 hours. 10% aqueous ammonium chloride (2 mL) was added to the reaction solution, and then the mixture was separated, and the organic layer was washed with 10% brine. The organic layer was dried over anhydrous sodium sulfate, filtered to remove sodium sulfate, and then the filtrate was concentrated. The solid precipitated by adding methanol to the concentrated residue was removed by filtration, and the filtrate was concentrated and dried. The concentrated residue was purified by column chromatography (spherical neutral silica gel, eluent: dichloromethane-methanol) to give the title compound (0.055 g, 53%) as a white solid.
[0638] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 2.00-2.27 (brs, 2H), 2.55-2.74 (m, 1H), 2.80 (t, 1H, J=6.2 Hz), 3.14-3.41 (m, 1H), 3.44-3.92 (m, 14H), 4.03-4.64 (m, 7H), 5.12 (q, 1H, J=5.6 Hz), 5.27 (t, 1H, J=8.0 Hz), 5.87-6.05 (m, 2H), 6.78-6.89 (m, 4H), 7.19-7.64 (m, 12H), 7.76-8.16 (m, 4H), 9.05-9.42 (brs, 1H), 9.50-9.87 (b rs, 1H).
[0639] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 19.54, 19.56, 19.61, 19.64, 55.28, 55.32, 58.80, 58.82, 58.93, 61.30, 61.34, 62.38, 62.43, 62.68, 62.73, 66.03, 66.08, 66.41, 66.46, 67.85, 67.95, 74.30, 74.34, 74.42, 74.47, 81.32, 81.41, 81.49, 81.58, 81.64, 81.72, 82.17, 82.99, 83.08, 86.58, 86.79, 87.46, 87.48, 89.42, 89.51, 96.78, 102.69, 102.71, 113.39, 116.35, 116.48, 127.37, 127.42, 127.80, 127.85, 128.12, 128.25, 128.29, 128.57, 128.90, 128.93, 130.22, 130.27, 130.30, 131.01, 132.94, 133.02, 133.14, 133.17, 134.72, 134.75, 134.82, 134.84, 139.51, 139.66, 143.90, 143.97, 144.26, 150.43, 154.73, 158.81, 158.85, 162.82, 162.86, 163.22, 166.72.
[0640] TOF/MS (ESI): calcd for C.sub.51H.sub.53N.sub.6O.sub.16PNa [M+Na].sup.+1059.3153, found 1059.3202.
Examples 7-8
[0641] Synthesis of 5-O-((2-cyanoethoxy)(5-O-(4,4-dimethoxytrityl)-2-O-(tert-butyldimethylsilyl)uridine-3-yl)phosphoryl)-2-O-(tert-butyldimethylsilyl) uridine
##STR00104##
[0642] A mixture solution of 5-O-((2-cyanoethoxy)(5-O-(4,4-dimethoxytrityl)-2-O-(tert-butyldimethylsilyl)uridine-3-yl)phosphoryl)-2-O-(ter t-butyldimethylsilyl)uridine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (0.420 g, 0.20 mmol) in THF (27 mL)-2-propanol (3 mL) was cooled to 0 to ?10? C. In cool, 4 mol/L-lithium borohydride-THF solution (0.25 m L, 1.00 mmol) was added and then stirred at the same temperature for 1.5 h. 10% aqueous ammonium chloride (4 mL) was added to the reaction solution, and then the mixture was separated, and the organic layer was washed with 10% brine. The organic layer was dried over anhydrous sodium sulfate, filtered to remove sodium sulfate, and then the filtrate was concentrated. The solid precipitated by adding methanol to the concentrated residue was removed by filtration, and the filtrate was concentrated and dried. The concentrated residue was purified by column chromatography (spherical neutral silica gel, eluent: dichloromethane-methanol) to give the title compound (0.135 g, 60%) as a white solid.
[0643] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.11-0.15 (m, 12H), 0.89-0.93 (m, 18H), 1.66-1.84 (brs, 2H), 2.50-2.77 (m, 3H), 3.46-3.67 (m, 2H), 3.80 (s, 6H), 3.98-4.55 (m, 9H), 4.92-4.96 (m, 1H), 5.23-5.27 (m, 1H), 5.61-5.75 (m, 2H), 5.97-6.00 (m, 1H), 6.84-6.87 (m, 4H), 7.14-7.45 (m, 10H), 7.77-7.87 (m, 1H), 9.00-9.50 (b rs, 2H).
[0644] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? ?5.14, ?4.98, ?4.96, ?4.90, ?4.82, ?4.76, ?4.74, ?4.70, ?4.68, 17.96, 18.02, 18.06, 19.54, 19.60, 19.67, 25.56, 25.60, 25.66, 25.69, 55.31, 62.02, 62.29, 62.34, 62.52, 62.57, 62.62, 67.06, 67.12, 67.32, 69.38, 69.54, 70.49, 70.93, 73.61, 74.57, 74.63, 74.71, 74.88, 81.55, 81.60, 81.73, 81.84, 81.93, 82.01, 87.37, 87.65, 87.85, 87.95, 88.05, 91.58, 91.81, 93.18, 93.89, 102.60, 102.67, 102.76, 102.82, 102.86, 113.41, 116.26, 116.30, 127.41, 127.45, 128.13, 128.17, 128.21, 130.16, 130.23, 130.29, 130.34, 134.65, 134.69, 134.72, 134.75, 139.67, 139.75, 140.36, 140.40, 141.65, 141.77, 143.99, 144.03, 149.97, 150.09, 150.19, 150.40, 150.55, 150.75, 158.83, 158.88, 162.93, 163.00, 163.18.
[0645] TOF/MS (ESI): calcd for C.sub.54H.sub.72N.sub.5O.sub.16Si.sub.2PNa [M+Na].sup.+1156.4148, found 1156.4148.
Synthesis of 5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)Thymidine-3-Yl)Phosphoryl)Thymidine
Examples 7-9
(1) Synthesis from 5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)Thymidine-3-Yl)Phosphoryl)Thymidine-3-Yl 3-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Propionate
[0646] ##STR00105##
[0647] The title compound (0.136 g, 76%) was obtained as a white solid from 5-O-((2-cyanoethoxy)(5-O-(4,4-dimethoxytrityl)thymidine-3-yl)phosphoryl)thymidine-3-yl 3-((3,4,5-tris(octadecyloxy)benzoyl)ox y)propionate (0.377 g, 0.200 mmol) according to the method of Examples 7-8.
[0648] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 1.41 (d, 3H, J=5.4 Hz), 1.87 (d, 3H, J=2.0 Hz), 2.19-2.27 (m, 1H), 2.34-2.48 (m, 2H), 2.62-2.77 (m, 3H), 3.39 (t, 1H, J=7.2 Hz), 3.47-3.52 (m, 1H), 3.78 (s, 6H), 4.07-4.55 (m, 8H), 5.12-5.18 (m, 1H), 6.18-6.24 (m, 1H), 6.35-6.40 (m, 1H), 6.84 (d, 4H, J=8.8 Hz), 7.21-7.31 (m, 8H), 7.32-7.38 (m, 2H), 7.51-7.58 (m, 1H), 9.92-10.14 (m, 2H).
[0649] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 11.78, 12.45, 12.49, 19.59, 19.67, 19.71, 38.83, 39.01, 39.61, 39.67, 55.31, 62.45, 62.50, 62.60, 62.65, 63.31, 67.74, 70.84, 80.08, 84.40, 84.50, 85.60, 87.30, 87.36, 111.23, 111.34, 111.91, 112.00, 113.37, 116.49, 116.74, 127.32, 128.10, 130.11, 130.14, 134.98, 135.01, 135.04, 135.19, 136.00, 144.01, 144.06, 150.69, 151.00, 151.05, 158.80, 163.96, 164.16.
[0650] TOF/MS (ESI): calcd for C.sub.44H.sub.48N.sub.5O.sub.14PNa [M+Na].sup.+924.2833, found 924.2836.
Examples 7-10
(2) Synthesis from 5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl)Thymidine-3-Yl)Phosphoryl)Thymidine-3-Yl 2-(N-Methyl-3,4,5-Tris(Octadecyloxy)Benzamide)Acetate
[0651] ##STR00106##
[0652] A mixture solution of 5-O-((2-cyanoethoxy)(5-O-(4,4-dimethoxytrityl) thymidine-3-yl)phosphoryl)thymidine-3-yl 2-(N-methyl-3,4,5-tris (octadecyloxy)benzamido)acetate (189 mg, 0.10 mmol) in THF (9 mL)-2-propanol (1 mL) was cooled to 0? C. In cool, 4 mol/L-lithium borohydride-THF solution (0.125 m L, 0.50 mmol) was added and stirred at the same temperature for 30 min. An aqueous ammonium chloride solution was added to the reaction solution, and then extracted 3 times with dichloromethane. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered to remove sodium sulfate, and then the filtrate was concentrated. The solid precipitated by suspending the concentrated residue in acetonitrile was removed by filtration, and the filtrate was concentrated. The concentrated residue was purified by column chromatography (silica gel, eluent: chloroform-methanol) to give the title compound (89 mg, 98%) as a white solid.
[0653] TOF/MS (ESI): calcd for C.sub.44H.sub.48N.sub.5O.sub.14PNa [M+Na].sup.+924.3, found 924.2.
Example 7-11
(3) Synthesized from 5-O-((2-Cyanoethoxy)(5-O-(4,4-Dimethoxytrityl) Thymidine-3-Yl)Phosphoryl)Thymidine-3-Yl 3-(3,4,5-Tris(Octadecyloxy)Benzamide)Propionate
[0654] ##STR00107##
[0655] A mixture solution of 5-O-((2-cyanoethoxy)(5-O-(4,4-dimethoxytrityl) thymidine-3-yl)phosphoryl)thymidine-3-yl 3-(3,4,5-tris(octadecyloxy)benzamide)propionate (189 mg, 0.10 mmol) in THF (9 mL)-2-propanol (1 mL) was cooled to 0? C. In cool, 4 mol/L-lithium borohydride-THF solutions (0.125 mL, 0.50 mmol) were added, and then stirred at room temperature for 1 hours. An aqueous ammonium chloride solution was added to the reaction solution, and then extracted 3 times with dichloromethane. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered to remove sodium sulfate, and then the filtrate was concentrated. The solid precipitated by suspending the concentrated residue in acetonitrile was removed by filtration, and the filtrate was concentrated. The concentrated residue was purified by column chromatography (silica gel, eluent: chloroform-methanol) to give the title compound (74 mg, 82%) as a white solid.
[0656] TOF/MS (ESI): calcd for C.sub.44H.sub.48N.sub.5O.sub.14PNa [M+Na].sup.+924.3, found 924.2.
Example 7-12
Synthesis of (6-(N.SUP.6.-Benzoyladenine-9-Yl)-4-Trityl-Morpholin-2-Yl)Methyl P-(2-(Hydroxymethyl)-6-Thymine-1-Yl)Morpholino)-N,N-Dimethylphosphonoamidate
[0657] ##STR00108##
[0658] The title compound (0.114 g, 61%) was obtained as a white solid from (4-((6-(N.sup.6-benzoyladenine-9-yl)-4-tritylmorpholin-2-yl)methoxy) (dimethylamino)phosphoryl)-6-(thymine-1-yl)morpholin-2-yl)methyl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (0.379 g, 0.20 mmol) according to the procedure of Examples 7-7.
[0659] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.87-1.95 (m, 6H), 2.01 (s, 1H), 2.45-2.64 (m, 7H), 3.06-4.04 (m, 9H), 4.43-4.46 (m, 1H), 5.52 (d d, 1H, J=2.4, 10.4 Hz), 6.41 (dt, 1H, J=2.4, 10.0 Hz), 7.05-7.64 (m, 19H), 8.03 (d, 2H, J=8.4 Hz), 8.09 (s, 1H), 8.71-8.80 (m, 1H), 9.69-9.78 (m, 1H), 10.28 (s, 1H), 10.75-11.05 (brs, 1H).
[0660] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 12.41, 12.45, 36.54, 36.58, 36.62, 36.66, 44.61, 44, 82, 47.13, 48.68, 48.78, 52.80, 52.85, 62.72, 62.78, 65.46, 65.61, 75.07, 75.14, 75.45, 75.52, 78.06, 78.13, 78.27, 78.33, 79.60, 79.65, 80.01, 80.49, 110.96, 111.03, 122.47, 122.78, 126.65, 128.00, 128.24, 128.41, 128.49, 128.62, 129.17, 132.61, 132.69, 133.48, 133.64, 134.86, 134.96, 140.94, 149.54, 149.75, 149.82, 150.02, 151.23, 151.42, 152.66, 152.75, 163.75, 163.79, 165.25.
[0661] TOF/MS (ESI): calcd for C.sub.48H.sub.51N.sub.10O.sub.8PNa [M+Na].sup.+949.3527, found 949.3545.
Example 7-13
Synthesis of (6-(N.SUP.4.-Benzoylcytosine-1-Yl)-4-Tritylmorpholin-2-Yl)Methyl P-(2-(Hydroxymethyl)-6-(N.SUP.2.-Isobutyrylguanine-9-Yl)Morpholino)-N,N-Dimethylphosphonoamidate
[0662] ##STR00109##
[0663] The title compound (0.052 g, 52%) was obtained as a white solid from (4-(((6-(N.sup.4-benzoylcytosine-1-yl)-4-tritylmorpholin-2-yl)methoxy) (dimethylamino)phosphoryl)-6-(N.sup.2-isobutyrylguanine-9-yl)morpholin-2-yl)methyl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (0.197 g, 0.10 mmol) according to the methods of Examples 7-7.
[0664] .sup.1H-NMR (400 MHz, CDCl.sub.3): ? 0.78-1.55 (m, 9H), 2.37-2.95 (m, 8H), 3.08-3.94 (m, 9H), 4.13-4.43 (m, 2H), 5.42-5.54 (m, 1H), 6.22-6.38 (m, 1H), 7.05-7.80 (m, 19H), 7.93 (d, 2H, J=7.2H z), 9.58-9.92 (brs, 1H), 10.64-10.86 (brs, 1H), 12.05-12.21 (br s, 1H).
[0665] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 13.91, 14.12, 19.03, 19.06, 19.28, 22.69, 25.76, 28.55, 29.36, 29.70, 31.72, 31.92, 35.99, 36.05, 36.62, 36.65, 36.69, 44.63, 44.92, 47.15, 47.56, 48.44, 48.79, 52.26, 52.42, 61.85, 62.58, 62.73, 65.66, 66.15, 71.09, 71.69, 75.40, 75.86, 75.91, 78.19, 79.73, 80.56, 81.37, 81.76, 97.87, 120.56, 120.92, 126.65, 127.96, 128.04, 128.70, 128.83, 128.92, 129.13, 131.00, 132.21, 132.97, 133.02, 133.14, 136.66, 137.43, 144.02, 144.54, 147.92, 147.98, 148.00, 154.99, 155.57, 155.62, 162.69, 163.09, 167.24, 179.62, 179.86.
[0666] TOF/MS (ESI): calcd for C.sub.51H.sub.56N.sub.11O.sub.9PNa [M+Na].sup.+1020.3898, found 1 020.3942.
Examples 7-14
Confirmation of De-Tagging of 8 Mer
(1) Synthesis of 5-O-((2-Cyanoethoxy)(5-O-((2-Cyanoethoxy)(5 -O-((2-Cyanoethoxy)(5-O-((2-Cyanoethoxy)(5-O-((2-Cyanoethoxy)(5-O-((2-Cyanoethoxy)(5-O-((2-Cyanoethoxy)(N.SUP.4.-Benzoyldeoxycytidine-3-Yl)Phosphoryl)-N.SUP.6.-Benzoyldeoxyadenosine-3-Yl)Phosphoryl)Thymidine-3-Yl)Phosphoryl)-N.SUP.2.-Isobutyryldeoxyguanosine-3-Yl)Phosphoryl)-N.SUP.4.-Benzoyldeoxycytidine-3-Yl)Phosphoryl)-N.SUP.6.-Benzoyldeoxyadenosine-3-Yl)Phosphoryl) Thymidine-3-Yl)Phosphoryl)Thymidine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate (8 Mer)
[0667] Under argon atmosphere, 5-benzylthio-1H-tetrazole (0.38 g, 1.96 mmol) was added to a suspension of thymidine-3-yl 2-((3,4,5-tris (octadecyloxy)benzoyl)oxy)acetate (1.19 g, 0.98 mmol) and 5-O-(4,4-dimethoxytrityl) thymidine-3-yl-phosphoroamidite (1.46 g, 1.96 mmol) in dichloromethane (10 mL), and stirred at room temperature for 1.5 hours. Next, pyridine (0.93 g, 11.77 mmol), water (0.11 g, 5.89 mmol), and iodine (1.25 g, 4.91 mmol) were added, and then stirred at room temperature for 4 hours. 1.2 mol/L-ascorbic acid aqueous solution (3 mL) was added to the reaction solution, and then stirred at room temperature for 15 minutes. The solid precipitated by dropping acetonitrile (24 mL) to the reaction solution was filtered. The solid was washed with acetonitrile-dichloromethane mixture solvent, and then dried under reduced pressure at 50? C. to obtain a DMTr (2.22 g)
[0668] Next, pyrrole (0.33 g, 4.91 mmol) and trifluoroacetic acid (0.13 g, 1.18 mmol) were added to a suspension of DMTr (1.83 g, 0.98 mmol) in dichloromethane (15 mL), and then stirred at room temperature for 1.5 hours. The solid precipitated by dropping acetonitrile (37 mL) and methanol (18 mL) to the reaction solution was filtered. The solid was washed with acetonitrile-methanol-dichloromethane mixture solvent, and then dried under reduced pressure at 50? C. to obtain a 2 mer (1.48 g).
[0669] The same procedure as was repeated 6 times to obtain 2.94 g of 8 mer.
[0670] TOF/MS (ESI): m/z 2106.3 [M+2H].sup.2+, 1403.9 [M+3H].sup.3+.
Example 7-15
(2) De-Tagging of 5-O-((2-Cyanoethoxy)(5-O-((2-Cyanoethoxy) (5-O-((2-Cyanoethoxy)(5-O-((2-Cyanoethoxy)(5-O-((2-Cyanoethoxy)(5 -O-((2-Cyanoethoxy)(5-O-((2-Cyanoethoxy)(N.SUP.4.-Benzoyldeoxycytidine-3-Yl)Phosphoryl)-N.SUP.6.-Benzoyldeoxyadenosine-3-Yl)Phosphoryl)Thymidine-3-Yl)Phosphoryl)-N.SUP.2.-Isobutyryldeoxyguanosine-3-Yl)Phosphoryl)-N.SUP.4.-Benzoyldeoxycytidine-3-Yl)Phosphoryl)-N.SUP.6.-Benzoyldeoxyadenosine-3-Yl)Phosphoryl) Thymidine-3-Yl)Phosphoryl)Thymidine-3-Yl 2-((3,4,5-Tris(Octadecyloxy)Benzoyl)Oxy)Acetate
[0671] N,N-Diisopropylethylamine (65 mg, 0.50 mmol) was added to a mixture solution of dichloromethane (0.4 mL), THF (0.2 mL) and 2-propanol (0.04 mL), and then cooled to 0 to ?10? C. Next, 4 mol/L-lithium borohydride-THF solution (0.125 m L, 0.50 mmol) was added, and then stirred at the same temperature for 20 minutes to prepare a reducing reagent. The reducing reagents were added to a mixture of 8 mer (84 mg, 0.02 mmol) in dichloromethane (4.2 mL)-THF (1.8 mL)-2-propanol (0.4 mL) previously cooled to 0 to ?10? C., and then the mixture was stirred at the same temperature for 40 minutes. 10% aqueous ammonium chloride (5 mL) was added to the reaction solution, and then was extracted with dichloromethane. The organic layer was washed with brine, and then the organic layer was concentrated to dryness. The precipitated solid was collected by suspending the concentrated residue in dichloromethane. The solid was washed with dichloromethane and dried in vacuo, and then 5-O-((2-cyanoethoxy) (5-O-((2-cyanoethoxy)(5-O-((2-cyanoethoxy)(5-O-((2-cyanoethoxy) (5-O-((2-cyanoethoxy)(5-O-((2-cyanoethoxy)(5-O-((2-cyanoethoxy) (N.sup.4-benzoyldeoxycytidine-3-yl)phosphoryl)-N.sup.6-benzoyldeoxyadenosine-3-yl)phosphoryl)thymidine-3-yl)phosphoryl)-N.sup.2-isobutyryldeoxyguanosine-3-yl)phosphoryl)-N.sup.4-benzoyldeoxycytidine-3-yl)phosphoryl)-N.sup.6-benzoyldeoxyadenosine-3-yl)phosphoryl)thymidine-3-yl)phosphoryl)thymidine (25 mg) was obtained.
[0672] TOF/MS (ESI): m/z 1621.9 [M+2H].sup.2+, 1081.6 [M+3H].sup.3+, 811.2 [M+4H].sup.4+.
8. Comparison of the Rate of Progression of De-Tagging
Example 8
[0673] 5-O-(4,4-Dimethoxytrityl)thymidine-3-yl 2-((3,4,5-tris(octadecyloxy)benzoyl)oxy)acetate (abbreviated as A-Tag-dT-DMTr) and 3,4,5-tris(octadecyloxy)benzyl 5-O-(4,4-dimethoxytrityl)thymidine-3-yl succinate (abbreviated as S-Tag-dT-DMTr) were compared for the rate of progression of de-tagging under ammonia basic conditions as shown below.
<De-tagging Conditions>
[0674] A-Tag-dT-DMTr or S-Tag-dT-DMTr 50 ?mol [0675] 28% aqueous ammonia 2.0 mL [0676] Ethanol 0.5 mL [0677] THF 0.5 mL [0678] Reaction temperature 35? C.
<Formation Rate of dT-DMTr (Tag-Free Form)>
TABLE-US-00001 TABLE 1 1 hr 2 hr 3 hr 4 hr 5 hr A-Tag-dT-DMTr 34% 74% 91% 98% 100% S-Tag-dT-DMTr 0% 2% 3% 4% 5%
<HPLC Condition>
[0679] Columns: Inertsil WP 300 Diol (5 ?m, 4.6 0?150 mm) [0680] Flow rate: 1.0 mL/min [0681] Mobile phase: n-hexane, CHCl.sub.3-MeOH (1/1) [0682] Gradient: 0-11 min; 5 to 30% (CHCl.sub.3-MeOH) [0683] Detection method: UV (?=254 nm) [0684] Retention time: A-Tag-dT-DMTr: Rt=4.23 min, S-Tag-dT-DMTr: Rt=4.17 min, dT-DMTr: Rt=9.40 min [0685] Production rate: (dT-DMTr)/[(A-Tag-dT-DMTr or S-Tag-dT-DMT r)+(dT-DMTr)]
[0686] As described above, we confirmed that A-Tag is more rapidly de-Tagged than succinate esters in common deprotection conditions for oligonucleic acid synthesis.
9. Summary of Synthesis Examples
[0687] Hereinafter, those summarizing the synthesis examples in each of the above-described examples will be described. [0688] 9.1 Synthesis of the 3 mer
TABLE-US-00002 TABLE 2 Synthesis of the 3 mer
[0689] As shown in Table 2 above, various Tag-conjugated 3 mer DNA oligomers could be obtained in high yields. [0690] 9.2 Synthesis of the dimer
TABLE-US-00003 TABLE 3 Synthesis of the dimer
[0691] As shown in Table 3 above, various Tag-conjugated oligonucleotides (dimers) were obtained in high yields. [0692] 9.3 Synthesis of the dimer
TABLE-US-00004 TABLE 4 Synthesis of the dimer
[0693] As shown in Table 4 above, various Tag-conjugated oligonucleotides (dimers) were obtained in high yields. [0694] 9.4 Synthesis of the dimer
TABLE-US-00005 TABLE 5 Synthesis of the dimer
[0695] As shown in Table 5 above, various Tag binding oligonucleotides (dimers) were obtained in high yields. [0696] 9.5 Synthesis and Deprotection of 20 mers
Chemical Formula 109
Synthesis and Total Deprotection of 20 Mers
[0697]
TABLE-US-00006 5-OH-dT-3-A-Tag.fwdarw.5-OH-d(TC.sup.BzC.sup.BzC.sup.BzG.sup.BuC.sup.BzC.sup.BzTG.sup.BuTG.sup.BuA.sup.Bz C.sup.BzA.sup.BzTG.sup.BuC.sup.BzA.sup.BzTT)-3-A-Tag.fwdarw.5-OH-d (TCCCGCCTGTGACATGCATT)-3-OH
[0698] By using the alkoxyphenyl derivative of the present invention and the Tagged protected nucleotide, the Tagged protected oligonucleotide (20 mer) could be easily obtained. Moreover, by removing Tag moieties as well as protecting groups, oligonucleotides could be conveniently obtained. [0699] 9.6 de-Tag of the 3 mer
TABLE-US-00007 TABLE 6 de-Tag of the 3 mer
De-Tag of the 3Mer
[0700] As shown in Table 6 above, Tag moieties of various Tagged protected oligonucleotides (3 mers) were removed, and each protected oligonucleotide (3 mer) could be obtained in high yield. [0701] 9.7 de-Tag of the dimer
TABLE-US-00008 TABLE 7 de-Tag of the dimer
[0702] As shown in Table 7 above, the Tag moieties of the various Tagged protected oligonucleotides (dimers) were removed and each protected oligonucleotide (dimer) was obtained in high yield. [0703] 9.8-de-Tag of the dimer
TABLE-US-00009 TABLE 8 de-Tag of the dimer
[0704] As shown in Table 8 above, the Tag moieties of the various Tagged protected oligonucleotide (dimers) were removed and each protected oligonucleotide (dimer) was obtained in high yield. [0705] 9.9 de-Tag of the dimer
TABLE-US-00010 TABLE 9 de-Tag of the dimer
[0706] As shown in Table 9 above, the Tag moieties of the various Tagged protected oligonucleotides (dimers) were removed and each protected oligonucleotide (dimer) was obtained in high yield.
INDUSTRIAL APPLICABILITY
[0707] The alkoxyphenyl derivative of the present invention is available for the production of the Tagged protected nucleosides and Tagged protected nucleotides and the like. Also, a method for producing an oligonucleotide, such as a Tagged protected nucleoside and a Tagged protected nucleotide of the present invention, and a method for selective Tag moiety removal of a Tagged protected nucleoside or a Tagged protected nucleotide are available for the synthesis of protected oligo nucleotides, particularly in liquid phase synthesis (including pseudo-liquid phase synthesis). All of these are very useful compounds and methods for nucleic acid drug development, biological mechanism elucidation, and the like.