COMPOSITIONS AND METHODS FOR MODULATING PAYLOAD EXPRESSION AT A TRANSCRIPTIONAL LEVEL
20240238447 ยท 2024-07-18
Inventors
Cpc classification
A61K48/0058
HUMAN NECESSITIES
C12N2750/14143
CHEMISTRY; METALLURGY
C12N2830/007
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
A61K48/00
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
Abstract
Described herein are compositions comprising polynucleotides encoding for cell state specific transcription of a transgene. A polynucleotide may comprise a promoter that is engineered to promote cell state-specific transcription of a payload (e.g., a transgene). Also described herein are methods of treating, preventing, or ameliorating a disease or condition by delivering a polynucleotide to a cell of a subject and transcribing a transgene in a cell state-specific manner.
Claims
1. A recombinant transcription factor binding polynucleotide comprising a sequence having at least 95% sequence identity to SEQ ID NO: 26.
2. The recombinant transcription factor binding polynucleotide of claim 1, comprising the sequence of SEQ ID NO: 26.
3. The recombinant transcription factor binding polynucleotide of claim 1 or claim 2, wherein the recombinant transcription factor binding polynucleotide is capable of binding to a transcription factor, optionally, wherein the transcription factor is expressed more highly in a target cell than in a non-target cell.
4. The recombinant transcription factor binding polynucleotide of claim 3, wherein the target cell is a cell expressing a mutant protein, and wherein the non-target cell is a cell expressing a wild type protein.
5. The recombinant transcription factor binding polynucleotide of claim 3 or claim 4, wherein the target cell expresses a mutant MeCP2 protein, and wherein the non-target cell expresses a wild type MeCP2 protein.
6. The recombinant transcription factor binding polynucleotide of any one of claims 1-5 comprising DNA; optionally, wherein the recombinant transcription factor binding polynucleotide consists of DNA.
7. A recombinant polynucleotide comprising a promoter and a payload, wherein the promoter comprises: a transcription factor binding polynucleotide capable of binding to a transcription factor, wherein the transcription factor binding polynucleotide comprises the recombinant transcription factor binding polynucleotide of any one of claims 1-6, and a core promoter capable of recruiting a polymerase; wherein the payload comprises a coding sequence.
8. The recombinant polynucleotide of claim 7, wherein the promoter comprises: a) a sequence having at least 90% sequence identity to any one of SEQ ID NO: 113-SEQ ID NO: 131; b) a sequence having at least 95% sequence identity to any one of SEQ ID NO: 113-SEQ ID NO: 131; c) a sequence of any one of SEQ ID NO: 113-SEQ ID NO: 131; d) a sequence having at least 90% sequence identity to SEQ ID NO: 115; e) a sequence having at least 95% sequence identity to SEQ ID NO: 115; or f) a sequence of SEQ ID NO: 115.
9. The recombinant polynucleotide of claim 7 or claim 8, wherein the core promoter comprises a TATA box, an initiator sequence, an RNA polymerase binding sequence, a B recognition element, a CCAAT box, a Pribnow box, a sequence provided in TABLE 4, or combinations thereof.
10. The recombinant polynucleotide of any one of claims 7-9, wherein the coding sequence is capable of being transcribed by the polymerase upon binding of the transcription factor to the transcription factor binding polynucleotide and recruitment of the polymerase to the core promoter; optionally, wherein the polymerase is an RNA polymerase II.
11. The recombinant polynucleotide of any one of claims 7-10, wherein the coding sequence encodes a protein.
12. The recombinant polynucleotide of claim 11, wherein the protein is a neuronal protein; optionally, wherein the protein is associated with a genetic disorder, a neuronal disorder, or both.
13. The recombinant polynucleotide of any one of claims 7-12, wherein the protein is MeCP2.
14. The recombinant polynucleotide of any one of claims 7-10, wherein the coding sequence encodes a therapeutic polynucleotide; optionally, wherein the therapeutic polynucleotide is a gRNA or a tRNA.
15. The recombinant polynucleotide of claim 14, wherein the therapeutic polynucleotide targets a gene associated with a genetic disorder, a neuronal disorder, or both.
16. The recombinant polynucleotide of claim 14 or claim 15, wherein the therapeutic polynucleotide targets MECP2.
17. The recombinant polynucleotide of any one of claims 7-16, wherein the promoter is engineered to control a transcription level of the payload.
18. The recombinant polynucleotide of claim 17, wherein the transcriptional level is cell state-specific, cell type-specific, cell genotype-specific, or any combination thereof.
19. The recombinant polynucleotide of claim 17 or claim 18, wherein a transcriptional level in a target cell is at least 1.3-fold a transcriptional level in a non-target cell.
20. An engineered viral vector comprising the recombinant polynucleotide of any one of claims 7-19 in a viral vector; optionally, wherein the viral vector is an adenoviral vector, an adeno-associated viral vector, or a lentivector; optionally, wherein the recombinant polynucleotide comprises DNA.
21. The engineered viral vector of claim 20, wherein the adeno-associated viral vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ/8, AAV-DJ/9, AAV1/2, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh43, AAV.Rh74, AAV.v66, AAV.Oligo001, AAV.SCH9, AAV.r3.45, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PhP.eB, AAV.PhP.V1, AAV.PHP.B, AAV.PhB.C1, AAV.PhB.C2, AAV.PhB.C3, AAV.PhB.C6, AAV.cy5, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17, and AAVhu68.
22. The engineered viral vector of claim 20 or claim 21, wherein a viral capsid of the viral vector is from a first viral vector and a viral inverted terminal repeat sequence of the viral vector is from a second viral vector; optionally, wherein the first viral vector, the second viral vector, or both is an adeno-associated viral vector.
23. A pharmaceutical composition comprising the recombinant polynucleotide of any one of claims 7-19 or the engineered viral vector of any one of claims 20-22, and a pharmaceutically acceptable carrier.
24. A composition comprising the recombinant polynucleotide of any one of claims 7-19, the engineered viral vector of any one of claims 20-22, or the pharmaceutical composition of claim 23 for use in a method of treating a disorder in a subject in need thereof, the method comprising administering to the subject the composition, thereby treating the disorder.
25. The composition of claim 24, wherein a level of transcription of the coding sequence is higher in the target cell than in a non-target cell of the subject.
26. The composition of claim 24 or claim 25, wherein the disorder is a genetic disorder, a neuronal disorder, or both; optionally, wherein the disorder is Rett syndrome.
27. A composition comprising the recombinant polynucleotide of any one of claims 7-19, the engineered viral vector of any one of claims 20-22, or the pharmaceutical composition of claim 23 for use in a method of expressing a coding sequence in a target cell, the method comprising administering to the subject the composition, thereby expressing the coding sequence in the target cell.
28. The composition of any one of claims 25-27, wherein the transcription factor is present at a higher level in the target cell than in the non-target cell; optionally, wherein the transcription factor is more active in the target cell than in the non-target cell.
29. The composition of any one of claims 25-28, wherein the non-target cell is a healthy cell.
30. The composition of any one of claims 25-29, wherein the target cell is a neuron.
31. The composition of any one of claims 25-30, wherein the target cell is a diseased cell; optionally, wherein the diseased cell comprises a genetic mutation associated with the disorder and has a disease phenotype associated with the genetic mutation.
32. The composition of claim 31, wherein the diseased cell comprises a mutation in MECP2 and expresses a mutant MeCP2 protein.
33. The composition of any one of claims 25-32, wherein a level of transcription of the coding sequence is higher in the target cell than in a non-target cell; optionally, wherein the target cell is a mutant MeCP2 cell, and the non-target cell is a wild type MeCP2 cell.
34. The composition of any one of claims 25-33, wherein the method further comprises expressing a protein encoded by the coding sequence in the target cell; optionally, wherein a level of expression of the protein is higher in the target cell than in the non-target cell.
35. The composition of claim 34, wherein the protein is a neuronal protein.
36. The composition of claim 34 or claim 35, wherein the protein is associated with a genetic disorder, a neuronal disorder, or both; optionally, wherein the protein is MeCP2.
37. The composition of any one of claims 25-33, wherein the method further comprises expressing a therapeutic polynucleotide encoded by the coding sequence in the target cell; optionally, wherein the therapeutic polynucleotide is a gRNA or a tRNA.
38. The composition of claim 37, wherein a level of expression of the therapeutic polynucleotide is higher in the target cell than in the non-target cell.
39. The composition of claim 37 or claim 38, wherein the therapeutic polynucleotide targets a gene associated with a genetic disorder, a neuronal disorder, or both; optionally wherein the therapeutic polynucleotide targets MECP2.
40. The composition of any one of claims 37-39, wherein the therapeutic polynucleotide targets MECP2.
41. The composition of any one of claims 24-40, wherein the coding sequence is transcribed upon binding of the transcription factor to the transcription factor binding site and recruitment of the polymerase to the core promoter sequence.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0020] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
DETAILED DESCRIPTION
[0058] Described herein are polynucleotide compositions comprising a payload sequence under transcriptional control of a promoter. The polynucleotide compositions of the present disclosure may encode for transcription of the payload sequence at levels dependent on a cell state. In some embodiments, the polynucleotide compositions of the present disclosure are recombinant polynucleotides. In some embodiments, the level of transcription of the payload sequence may depend on a cell type (e.g., neuron, hepatocyte, retinal cell, epithelial cell, muscle cell, erythrocyte, platelet, bone marrow cell, endothelial cell, epidermal cell, lymphocyte, glial cell, interstitial cell, adipocyte, or fibroblast). In some embodiments, the level of transcription of the payload sequence may depend on a cell state, such as a cell genotype (e.g., presence or absence of one or more genetic mutations) or a cell phenotype (e.g., the presence or absence of the expression of one or more genetic mutations). In some embodiments, the level of transcription of the payload sequence may depend on both the cell type and the cell state. In some embodiments, the level of transcription of the payload sequence may depend on the cell type, the cell genotype, and the cell phenotype. The promoter may be selected or engineered to tune the level of transcription as well as the cell type- or cell state-dependence of payload sequence transcription. In some embodiments, tuning a transcription level may comprise adjusting transcription to a desired level. In some embodiments, the desired level may be cell type- or state-specific. In some embodiments, the desired level may be cell type- and state-specific. In some embodiments, tuning a transcription level may comprise selecting for a desired level of transcription in a cell state of interest. The transcription level of the payload sequence may control the expression level of a protein or nucleotide encoded by the payload sequence. For example, a high level of transcription of the payload sequence may lead to a high level of expression of the protein encoded by the payload sequence.
[0059] In some embodiments, the polynucleotide composition (e.g., a recombinant polynucleotide) may comprise a promoter. In embodiments, the promoter may comprise a transcription factor binding polynucleotide and a core promoter. In some embodiments, the transcription factor binding polynucleotide may be a recombinant transcription factor binding polynucleotide.
[0060] Also described herein are methods of delivering a polynucleotide composition (e.g., a recombinant polynucleotide) of the present disclosure to a subject. In some embodiments, the polynucleotide composition may be part of a viral vector capable of delivering the polynucleotide to a cell of the subject. The viral vector may comprise a viral inverted terminal repeat sequence that includes a viral origin of replication, enabling viral replication of the polynucleotide sequence. The viral vector may comprise a viral capsid encapsulating the polynucleotide and facilitating delivery of the polynucleotide into the cell. A method of delivering a polynucleotide composition (e.g., a recombinant polynucleotide of the present disclosure) to a subject may comprise administering a viral vector comprising the polynucleotide to the subject. Upon delivery of the polynucleotide to the subject, a payload sequence of the polynucleotide may be transcribed in a cell of the subject in a cell type- and/or cell state-dependent manner, resulting in expression of a protein or nucleotide encoded by the payload sequence in the target cell type and/or target cell state.
[0061] Further described herein are methods of treating a disease or condition by delivering a polynucleotide composition (e.g., a recombinant polynucleotide) of the present disclosure to a subject and expressing a protein or nucleotide encoded by the polynucleotide in the subject in a cell type- and/or cell state-dependent manner. The polynucleotide composition may be delivered to the subject as part of a viral vector. The subject may have a disease or condition, for example a disease or condition caused by mutation or having altered expression of a gene. In some embodiments, a payload sequence of the polynucleotide composition may be a transgene encoding a wild type copy of a protein encoded by the gene with the mutation or having altered expression. The transgene may be transcribed in a cell of the subject in a cell state-dependent manner upon delivery of the polynucleotide composition to the subject. In some embodiments, a protein encoded by the transgene is expressed in the subject at a level dependent on the level of transcription of the transgene. Transcription of the transgene, expression of the protein encoded by the transgene, or both, in a cell state-dependent manner may treat the disease or condition in the subject. Alternately or in addition, the payload sequence of the polynucleotide composition (e.g., a recombinant polynucleotide) may encode a therapeutic polynucleotide (e.g., a gRNA or tRNA) that targets the gene with the mutation or altered expression. The therapeutic polynucleotide may be transcribed in a cell of the subject in a cell state-dependent and/or cell type-dependent manner upon delivery of the polynucleotide composition to the subject. In some embodiments, the therapeutic polynucleotide encoded by the payload sequence is expressed in the subject at a level dependent on the level of transcription of the payload sequence. Transcription of the payload sequence, expression of the therapeutic polynucleotide encoded by the payload sequence, or both, in a cell state-dependent and/or cell type-dependent manner may treat the disease or condition in the subject.
Promoters
[0062] A polynucleotide (e.g., an RNA or a DNA polynucleotide) may comprise a promoter sequence to regulate or enhance transcription of a payload sequence (e.g., a transgene or a therapeutic polynucleotide) under transcriptional control of the promoter. In some embodiments, the polynucleotide may be a recombinant polynucleotide. In some embodiments, the polynucleotide may comprise a transcription factor (TF) binding polynucleotide that binds one or more transcription factors, coactivators, or corepressors, and a core promoter that functions as a site for preinitiation complex formation. In some embodiments, the sequence of the promoter may comprise a transcription factor (TF) binding sequence that binds one or more transcription factors, coactivators, or corepressors, and a core promoter sequence that functions as a site for preinitiation complex formation. The elements within the promoter sequence (e.g., the transcription factor binding sequence and the core promoter sequence) may be engineered to alter transcription rates of a downstream payload sequence. In some embodiments, the promoter may be engineered for cell type- and/or cell state-specific transcription. For example, the promoter may be engineered to promote high levels of transcription in target cell type (e.g., neurons) and low levels or no transcription in non-target cell types (e.g., non-neuronal cells). In another example, the promoter may be engineered to promote high levels of transcription in cells having a disease phenotype caused by a genetic mutation or variation (e.g., a genetic mutation or variation associated with a disease or a condition) and low levels or no transcription in cells lacking the disease phenotype.
[0063] In some embodiments, a promoter may promote cell type- and/or cell state-specific transcription if it promotes transcription of a payload sequence in a target cell type and/or target cell state at a level that is at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold a transcription level of the transgene in a non-target cell type and/or non-target cell state. A promoter as disclosed herein may be a recombinant promoter.
Transcription Factor Binding Sequences
[0064] The promoter of a polynucleotide may comprise a transcription factor binding polynucleotide that binds one or more transcription factors, coactivators, or corepressors to modulate transcription of a nearby polynucleotides. The promoter sequence of a polynucleotide may comprise a transcription factor binding polynucleotide sequence that binds one or more transcription factors, coactivators, or corepressors to modulate transcription of nearby polynucleotides. The transcription factor binding polynucleotide may recruit transcription factors to the polynucleotide that enhance, repress, or alter transcription of a downstream sequence (e.g., a transgene encoded by the polynucleotide). A transcription factor binding polynucleotide as disclosed herein may be a recombinant transcription factor binding polynucleotide. In some embodiments, the transcription factor binding polynucleotide may comprise one or more transcription factor binding motifs, each of which binds a transcription factor. Transcriptional enhancement, cell type-specificity, and/or cell state-specificity may be tuned by including different combinations, orientations, or variants of transcription factor binding motifs in the transcription factor binding polynucleotide.
[0065] Examples of ways in which transcription factor binding motifs may be combined in a transcription factor binding sequence of a promoter are illustrated in
[0066] A transcription factor binding polynucleotide (e.g., a recombinant transcription factor binding polynucleotide) may be engineered for one or more desired transcriptional properties, such as transcription level, cell type specificity, cell genotype specificity, and/or cell phenotype. For example, a transcription factor binding polynucleotide may be engineered to promote a moderate level of transcription in neurons with a phenotype resulting from a genetic mutation and little to no transcription in non-neuronal cell types and neurons lacking the phenotype resulting from the genetic mutation. Engineering a transcription factor binding polynucleotide for cell state specific transcription may comprise selecting or screening for transcription factors that are expressed in a cell state of interest and incorporating one or more transcription factor binding motifs that bind to the identified transcription factors into the transcription factor binding polynucleotide. For example, a transcription factor binding polynucleotide with neuron-specific transcription may comprise one or more transcription factor binding motifs that bind one or more transcription factors expressed in neurons. Examples of transcription factors expressed in neurons are provided in TABLE 1. In some embodiments, cell state specificity may be further tuned using identified transcription factors that are expressed at increased levels in a target cell state (e.g., a cell type of interest, a cell genotype of interest, and/or a cell phenotype of interest) relative to a non-target cell state. For example, a transcription factor binding polynucleotide with enhanced transcription levels in neurons relative to hepatocytes may comprise one or more transcription factor binding motifs that bind one or more transcription factors expressed more highly in neurons than in hepatocytes. Examples of empirically determined neuron to hepatocyte expression ratios of transcription factors expressed in neurons are provided in TABLE 1.
TABLE-US-00001 TABLE 1 Exemplary Transcription Factors with Neuronal Expression Transcription Factor Gene Neuron to Hepatocyte Expression Ratio ZNF436 2.21 NR4A1 0.83 IRF8 0.01 ZBTB18 17.64 NRII3 0.01 ETV5 0.64 SOX2 28.68 JUNB 0.13 ZNF563 0.07 PPARA 0.05 MEF2C 60.82 NEUROD2 121.12 FOS 0.73 TCF4 37.34 HLF 0.17 MAF 0.07 LHX2 71.71 PBX1 4.73 FOXP1 0.49 ZBTB7A 0.40 CUX1 0.70 FOXO3 0.62 POU3F2 116.73 NFYC 0.48 NR3C1 0.06 BCL6 0.47 ZEB1 2.09 TCF3 0.99 NR1D1 0.55 ZFP28 4.14 ETS2 0.13 STAT1 0.24 POU3F1 62.31 ZBTB33 0.95 MXI1 2.20 NFIC 0.59 ETS1 0.13 VEZF1 2.06 KLF3 0.51 ZNF250 4.11 MAFB 0.19 NFIA 3.94 RFX5 0.73 BHLHE40 0.29 KLF12 0.53 STAT4 0.20 ETV1 1.51 RORA 0.12 MITF 0.79 NFE2L2 0.20 ESRRG 12.29 PBX3 0.95 TCF7L2 0.15 NKX3-1 0.04 NR1H4 0.00 ONECUT1 0.00 FOXA3 0.00 EMX1 117.31 FOXG1 67.80 BHLHE41 2.90 ISX 0.00 ZBTB7C 2.65 OTX1 119.38 PITX3 2.45 NR3C2 0.21 EGR4 N/A SCRT1 N/A CUX2 16.67 ONECUT2 0.08 POU6F2 14.19 RFX4 16.63 TBR1 51.44 HES5 4.21 XBP1 0.04 SOX11 81.53 DLX1 9.35 RORB 75.19 FOXN3 0.71 NR1D2 0.66 SMAD5 0.61 PLAGL1 8.94 NFIB 42.71 BBX 0.50 DPF1 68.62 YBX1 1.26 ZBTB20 0.38 ZNF177 0.20 ZNF385D 16.15 ZNF189 0.53
[0067] The transcription level, cell type specificity, and/or cell state specificity of a transcription factor binding polynucleotide (e.g., a recombinant transcription factor binding polynucleotide) may be further tuned by varying the sequence of one or more transcription factor binding motifs to alter the affinity to the corresponding transcription factor. In some embodiments, a transcription factor may have a preferred binding sequence (also referred to herein as a consensus transcription factor binding motif or a consensus motif). The preferred binding sequence may bind the transcription factor with higher affinity than other binding motifs or variants of the binding motif. In some embodiments, a consensus motif may increase recruitment of the corresponding transcription factor relative to other binding motifs or variants of the binding motif. Transcription levels may be tuned by introducing sequence variations into a consensus motif to alter affinity of the motif for the transcription factor. For example, to tune a level of transcription and prevent over-expression of a payload, a transcription factor binding motif comprising one or more sequence variations relative to a consensus transcription factor binding motif may be included in the transcription factor binding polynucleotide. The transcription factor binding polynucleotide comprising the variant transcription factor binding motif may promote reduced transcription of a payload sequence relative to a transcription factor binding sequence comprising a consensus transcription factor binding motif.
[0068] In some embodiments, a variant transcription factor binding motif may comprise at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 98% sequence identity to a consensus transcription factor binding motif. In some embodiments, a variant transcription factor binding motif may comprise no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, no more than about 95%, no more than about 98% sequence identity to a consensus transcription factor binding motif. Examples of sequence preferences of select transcription factors are illustrated in
[0069] Examples of transcription factor binding motifs that may be included in a transcription factor binding motif to promote cell type- or cell state-specific expression of a payload sequence are provided in TABLE 2. These transcription factor binding motifs may promote cell type- or cell-state specific transcription in a corresponding cell state or cell type. In some embodiments, a transcription factor binding motif may comprise at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 87%, at least about 90%, at least about 93%, at least about 95%, or at least about 98%, or about 100% sequence identity to a transcription factor binding motif provided in TABLE 2.
TABLE-US-00002 TABLE2 ExemplaryTranscriptionFactorBindingMotifs Transcription Factor SEQIDNO Sequence CUX1 SEQIDNO:45 AGGGGGATCGATGG CUX1 SEQIDNO:46 ATATGTATTTGTTA ESRRG SEQIDNO:47 TCAAGGTCA ESRRG SEQIDNO:48 TGGGGGACA ETV5 SEQIDNO:49 GAGCAGGAAGTGAG ETV5 SEQIDNO:50 GGGCAGAAGGCGGA IRF8 SEQIDNO:51 AAAAGAGGAAGTGAAAGTAA IRF8 SEQIDNO:52 CACCAGGGAAATGAGCGTGC KLF12 SEQIDNO:53 AGGGGCGGGGC KLF12 SEQIDNO:54 TGGGGCGGGTA TFDP1 SEQIDNO:55 GGCAGCGGGTAC TFDP1 SEQIDNO:56 GGCAGAGGAGAC ZFP57 SEQIDNO:57 TGCCGCAGCGGC ZFP57 SEQIDNO:58 TGCCGCAGCGCG ZFP57 SEQIDNO:59 CCGCTGGGGCAG ZFP57 SEQIDNO:60 CCGCTCCGGCAT TEAD4 SEQIDNO:61 AGGAATACGGAG TEAD4 SEQIDNO:62 TGCAATAAGGAG NEUROD1 SEQIDNO:63 ACCGACGGACGG NEUROD1 SEQIDNO:64 GCCGACGGAGGG NEUROD2 SEQIDNO:65 AACAGATGG NEUROD2 SEQIDNO:66 GGGAGATGG NFIA SEQIDNO:67 TTGGCACGGTGCCAA NFIA SEQIDNO:68 CTGAGCCGGTACCCT NFIC SEQIDNO:69 CTTGGCTCCCTGCCAAG NFIC SEQIDNO:70 GTTGCCTGTTTCCCCCG NR1D1 SEQIDNO:71 TACAAGCTTTGTCACCGGT NR1D1 SEQIDNO:72 GGAAATTTGGGACAGAAGA NR1D1 SEQIDNO:73 AGGGAAGTGGGTCAGAAGG NR1D1 SEQIDNO:74 AAGCAAGTGGGTCAGAAGG NR1D1 SEQIDNO:75 AGCAAACTGGGCCTATCGA NR1D1 SEQIDNO:76 GGCTATCTTGGGCATTCGG ONECUT2 SEQIDNO:77 AAAAAATCGATAAT ONECUT2 SEQIDNO:78 TATAAATCAATAAG PBX3 SEQIDNO:79 TGATTGACAGG PBX3 SEQIDNO:80 TGAGTGATCCG PPARA SEQIDNO:81 AACTGGGGCAAAGGTCA PPARA SEQIDNO:82 AGCTGGATCAAATAACA RFX4 SEQIDNO:83 CGTTGCCATGGCAACG RFX4 SEQIDNO:84 AGCAACCATGGTTACG RORA SEQIDNO:85 AACTAGGTCAGGG RORA SEQIDNO:86 AGTTCGGGCACTG RORB SEQIDNO:87 AAATGGGTGAT RORB SEQIDNO:88 AATTAGGTCAC RORB SEQIDNO:89 AAATAGGTCAG RORB SEQIDNO:90 AACCAGGTCAA RORB SEQIDNO:91 ACTTAGGTCAA RORB SEQIDNO:92 TTGTATGTCAT TBR1 SEQIDNO:93 AGGTGTGAAA TBR1 SEQIDNO:94 GGGTGTTAAA TCF7L2 SEQIDNO:95 CCCTTTGATGTGG TCF7L2 SEQIDNO:96 CGCTCTGAAATAG ZBTB7C SEQIDNO:97 GCGACCACCGAA ZBTB7C SEQIDNO:98 GCAACCCCCTCC ZNF436 SEQIDNO:99 TCAGGGAAGGCTTCCTGGAGG AGG ZNF436 SEQIDNO:100 TCTTGAAGCACTCCCTGGAAG AGG XBP1 SEQIDNO:101 ATGGACACGTCACC BCL6 SEQIDNO:102 TGCTTTCCAGGAA HES5 SEQIDNO:103 CGGCACGTGCCA NFIC SEQIDNO:104 CTTGGTTCCGTTCCACT TCF7L2 SEQIDNO:105 TCCTTTGATGACG SOX11 SEQIDNO:106 AACAATTGCATTGTT BCL6 SEQIDNO:107 CCCTTTCCAAGAA HES5 SEQIDNO:108 CGGCACGTGCCG TCF7L2 SEQIDNO:109 CCCTTTGATGTTG NEUROD2 SEQIDNO:110 CACAGATGG HES5 SEQIDNO:111 TGGCACGTGCCA ESRRG SEQIDNO:112 TCAAGCTCG
[0070] In some embodiments, a sequence of a transcription factor binding polynucleotide (e.g., a recombinant transcription factor binding polynucleotide) may comprise one or more transcription factor binding motifs that bind to one or more of a ZNF436, NR4A1, IRF8, ZBTB18, NR113, ETV5, SOX2, JUJNB, ZNF563, PPARA, MEF2C, NEUIROD1, NEUIROD2, FOS, TCF4, HLF, MAF, LHX2, PBX1, FOXP1, ZBTB7A, CUX1, FOX03, POU3F2, NFYC, NR3C1, BCL6, ZEB1, TCF3, NR1D1, ZFP28, ZFP57, ETS2, STAT1, POU3F1, ZBTB33, MXI1, NFIC, ETS1, VEZF1, KLF3, ZNF250, MAFB, NFIA, RFX5, BHLHE40, KLF12, STAT4, ETV1, RORA, MITF, NFE2L2, ESRRG, PBX3, TCF7L2, NKX3-1, NR1H4, ONECUT1, FOXA3, EMX1, FOXG1, BHLHE41, ISX, ZBTB7C, OTX1, PITX3, NR3C2, EGR4, SCRT1, CUX2, ONECUT2, POU6F2, RFX4, TBR1, HES5, XBP1, SOX11, DLX1, RORB, FOXN3, NR1D2, SMAD5, PLAGL1, NFIB, BBX, DPF1, TFDP1, TEAD4, YBX1, ZBTB20, ZNF177, ZNF385D, or a ZNF189 transcription factor, or combinations thereof. In some embodiments, a transcription factor binding sequence may comprise one or more transcription factor binding motifs that bind to a transcription factor differentially expressed in a target cell type (e.g., neurons, hepatocytes, retinal cells, epithelial cells, muscle cells, erythrocytes, platelets, bone marrow cells, endothelial cells, epidermal cells, lymphocytes, glial cells, interstitial cells, adipocytes, fibroblasts, or combinations thereof). In some embodiments, a transcription factor binding sequence may comprise one or more transcription factor binding motifs that bind to a transcription factor differentially expressed in a cell with a genotype of interest (e.g., a genotype associated with a disease or condition). In some embodiments, a transcription factor binding sequence may comprise one or more transcription factor binding motifs that bind to a transcription factor differentially expressed in a cell with a phenotype of interest (e.g., a phenotype resulting from a genotype associated with a disease or condition).
[0071] A transcription factor binding motif sequence, such as a sequence that binds to a transcription factor listed in TABLE 1, may comprise an endogenous transcription factor binding motif sequence. In some embodiments, the transcription factor binding motif sequence may be engineered based on an endogenous transcription factor binding motif sequence. For example, an engineered transcription factor binding motif sequence may have at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 87%, at least about 90%, at least about 93%, at least about 95%, or at least about 98%, or about 100% sequence identity to an endogenous transcription factor binding motif. Alternatively or in addition, the transcription factor binding motif sequence may be a synthetic transcription factor binding motif sequence that is engineered de novo to enhance transcription in a cell type- and/or cell state-specific manner. In some embodiments, the synthetic transcription factor binding motif sequence may be engineered to bind a transcription factor (e.g., a transcription factor listed in TABLE 1).
[0072] In some embodiments, the transcription factor binding motif may be a consensus transcription factor binding motif. In some embodiments, the transcription factor binding motif may be a variant transcription factor binding motif. In some embodiments, the transcription factor binding motif may be a reverse complement of a consensus transcription factor binding motif or a reverse complement of a variant transcription factor binding motif.
[0073] A workflow for tuning the transcription level and cell state specificity of a transcription factor binding sequence may comprise identifying transcription factors that are differentially expressed in a cell state of interest, generating candidate transcription factor binding sequences comprising combinations, duplications, reverse complements, or variants of transcription factor binding motifs that bind to the identified transcription factors, and screening the candidate transcription factor binding sequences for transcription level and cell state specificity. In some embodiments, a library of polynucleotides comprising different transcription factor binding sequences may be screened for transcription level and cell state specificity. In some embodiments, a library of polynucleotides comprising different transcription factor binding sequences and different core promoters may be screened for transcription level and cell state specificity of the promoter.
[0074] A workflow for tuning the transcription level and cell type specificity of a transcription factor binding sequence may comprise identifying transcription factors that are differentially expressed in a cell type of interest, generating candidate transcription factor binding sequences comprising combinations, duplications, reverse complements, or variants of transcription factor binding motifs that bind to the identified transcription factors, and screening the candidate transcription factor binding sequences for transcription level and cell type specificity. In some embodiments, a library of polynucleotides comprising different transcription factor binding sequences may be screened for transcription level and cell type specificity. In some embodiments, a library of polynucleotides comprising different transcription factor binding sequences and different core promoters may be screened for transcription level and cell type specificity of the promoter.
[0075] A workflow for tuning the transcription level and cell phenotype of a transcription factor binding sequence may comprise identifying transcription factors that are differentially expressed in a cell phenotype of interest, generating candidate transcription factor binding sequences comprising combinations, duplications, reverse complements, or variants of transcription factor binding motifs that bind to the identified transcription factors, and screening the candidate transcription factor binding sequences for transcription level and cell phenotype specificity. In some embodiments, a library of polynucleotides comprising different transcription factor binding sequences may be screened for transcription level and cell phenotype specificity. In some embodiments, a library of polynucleotides comprising different transcription factor binding sequences and different core promoters may be screened for transcription level and cell phenotype specificity of the promoter.
[0076] A workflow for tuning the transcription level, cell type, and cell phenotype of a transcription factor binding sequence may comprise identifying transcription factors that are differentially expressed in a cell type and in a cell phenotype of interest, generating candidate transcription factor binding sequences comprising combinations, duplications, reverse complements, or variants of transcription factor binding motifs that bind to the identified transcription factors, and screening the candidate transcription factor binding sequences for transcription level, cell type specificity, and cell phenotype specificity. In some embodiments, a library of polynucleotides comprising different transcription factor binding sequences may be screened for transcription level, cell type specificity, and cell phenotype specificity. In some embodiments, a library of polynucleotides comprising different transcription factor binding sequences and different core promoters may be screened for transcription level, cell type specificity, and cell phenotype specificity of the promoter.
[0077] A workflow for tuning the transcription level, cell type, and cell genotype of a transcription factor binding sequence may comprise identifying transcription factors that are differentially expressed in a cell type and in a cell genotype of interest, generating candidate transcription factor binding sequences comprising combinations, duplications, reverse complements, or variants of transcription factor binding motifs that bind to the identified transcription factors, and screening the candidate transcription factor binding sequences for transcription level, cell type specificity, and cell genotype specificity. In some embodiments, a library of polynucleotides comprising different transcription factor binding sequences may be screened for transcription level, cell type specificity, and cell genotype specificity. In some embodiments, a library of polynucleotides comprising different transcription factor binding sequences and different core promoters may be screened for transcription level, cell type specificity, and cell genotype specificity of the promoter.
[0078] The transcription factor binding motifs described herein (e.g., a transcription factor binding motif provided in TABLE 2 or a transcription factor binding motif that binds to a transcription factor provided in TABLE 1) may be combined to form a transcription factor binding sequence of a transcription factor binding polynucleotide (e.g., a recombinant transcription factor binding polynucleotide). In some embodiments, a transcription factor binding sequence may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 transcription factor binding motifs. For example, a transcription factor binding sequence may comprise three transcription factor binding motifs. For example, a transcription factor binding sequence may comprise four transcription factor binding motifs. For example, a transcription factor binding sequence may comprise five transcription factor binding motifs. Examples of transcription factor binding sequences that may promote cell type- or cell state-specific expression are provided in TABLE 3. In some embodiments, a transcription factor binding sequence may comprise at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 87%, at least about 90%, at least about 93%, at least about 95%, or at least about 98%, or about 100% sequence identity to a transcription factor binding motif sequence in TABLE 3. In some embodiments, a transcription factor binding sequence may comprise at least 9Ce sequence identity to SEQ ID NO: 26. In some embodiments, a transcription factor binding sequence may comprise at least 9300 sequence identity to SEQ ID NO: 26. In some embodiments, a transcription factor binding sequence may comprise at least 950 sequence identity to SEQ ID NO: 26. In some embodiments, a transcription factor binding sequence may comprise at least 98A sequence identity to SEQ ID NO: 26. In some embodiments, a transcription factor binding sequence may comprise SEQ ID NO: 26.
TABLE-US-00003 TABLE3 ExemplaryTranscriptionFactorBindingSequencesandCorrespondingCell StateorCellType SEQID Cell NO Sequence Type/State SEQID ACCGACGGACGGGGCAGCGGGTACCCGCTGGGGCAGT MeCP2 NO:26 GCCGCAGCGGCAGGAATACGGAGGGCAGCGGGTACCC mutant GCTGGGGCAGTGCCGCAGCGGCAGGAATACGGAG neurons SEQID CACCAGGGAAATGAGCGTGCGGGCAGAAGGCGGAAGC MeCP2 NO:27 AACCATGGTTACGATATGTATTTGTTAGGGCAGAAGGC mutant GGAAGCAACCATGGTTACGATATGTATTTGTTA neurons SEQID AGCTGGATCAAATAACAAGCTGGATCAAATAACACGCT MeCP2 NO:28 CTGAAATAGCGCTCTGAAATAGTGGGGGGGGTATGGGG mutant CGGGTATATAAATCAATAAGTATAAATCAATAAG neurons SEQID TCTTGAAGCACTCCCTGGAAGAGGTGGGGGACAAAATG MeCP2 NO:29 GGTGATTGGGGGACAAGTTCGGGCACTGTGGGGGACAA mutant GTTCGGGCACTGTGGGGGACAAGTTCGGGCACTG neurons SEQID AACTGGGGCAAAGGTCAAACTGGGGCAAAGGTCACCCT MeCP2 NO:30 TTGATGTGGCCCTTTGATGTGGAGGGGCGGGGCAGGGG mutant CGGGGCAAAAAATCGATAATAAAAAATCGATAAT neurons SEQID GGGAGATGGGGGAGATGGGGGTGTTAAAGGGTGTTAA MeCP2 NO:31 ATGGGGGACATGGGGGACACTGAGCCGGTACCCTGTTG mutant CCTGTTTCCCCCGCGCTCTGAAATAG neurons SEQID CTTGGCTCCCTGCCAAGCTTGGCTCCCTGCCAAGTTGGC MeCP2 NO:32 ACGGTGCCAATTGGCACGGTGCCAACCCTTTGATGTGG mutant CCCTTTGATGTGGAGGTGTGAAAAGGTGTGAAA neurons SEQID AAAAGAGGAAGTGAAAGTAAGAGCAGGAAGTGAGCGT MeCP2 NO:33 TGCCATGGCAACGAGGGGGATCGATGGGAGCAGGAAG mutant TGAGCGTTGCCATGGCAACGAGGGGGATCGATGG neurons SEQID TGGGGGACATGGGGGACATGAGTGATCCGTGAGTGATC MeCP2 NO:34 CGCGCTCTGAAATAGCGCTCTGAAATAGTGAGTGATCC mutant GCGCTCTGAAATAGTGGGGGACATGGGGGACA neurons SEQID GTTGCCTGTTTCCCCCGGTTGCCTGTTTCCCCCGCTGAG MeCP2 NO:35 CCGGTACCCTCTGAGCCGGTACCCTCGCTCTGAAATAGC mutant GCTCTGAAATAGGGGTGTTAAAGGGTGTTAAA neurons SEQID TCAGGGAAGGCTTCCTGGAGGAGGTCAAGGTCAAATTA MeCP2 NO:36 GGTCACTCAAGGTCAAACTAGGTCAGGGTCAAGGTCAA mutant ACTAGGTCAGGGTCAAGGTCAAACTAGGTCAGGG neurons SEQID TACAAGCTTTGTCACCGGTGTTGCCTGTTTCCCCCGGCA MeCP2 NO:37 ACCCCCTCCTGGGGGACACGCTCTGAAATAGGCAACCC mutant CCTCCTGGGGGACACGCTCTGAAATAG neurons SEQID GCCGACGGAGGGGGCAGAGGAGACCCGCTCCGGCATT MeCP2 NO:38 GCCGCAGCGCGTGCAATAAGGAGGGCAGAGGAGACCC mutant GCTCCGGCATTGCCGCAGCGCGTGCAATAAGGAG neurons SEQID AACAGATGGAACAGATGGAGGTGTGAAAAGGTGTGAA MeCP2 NO:39 ATCAAGGTCATCAAGGTCATTGGCACGGTGCCAACTTG mutant GCTCCCTGCCAAGCCCTTTGATGTGG neurons SEQID AGGGAAGTGGGTCAGAAGGCTTGGCTCCCTGCCAAGGC MeCP2 NO:40 GACCACCGAATCAAGGTCACCCTTTGATGTGGGCGACC mutant ACCGAATCAAGGTCACCCTTTGATGTGG neurons SEQID TCAAGGTCATCAAGGTCATGATTGACAGGTGATTGACA MeCP2 NO:41 GGCCCTTTGATGTGGCCCTTTGATGTGGTGATTGACAGG mutant CCCTTTGATGTGGTCAAGGTCATCAAGGTCA neurons
[0079] The transcription factor binding sequences (e.g., the transcription factor binding sequences provided in TABLE 3 or a transcription factor binding sequence comprising a one or more transcription motifs described herein) may be combined with a core promoter and a payload sequence to form a polynucleotide (e.g., a recombinant polynucleotide) construct for cell type- and/or cell state-specific expression of the payload sequence.
Core Promoters
[0080] The promoter of a polynucleotide may comprise a core promoter that facilitates recruitment of transcription machinery and initiation of transcription. The promoter sequence of a polynucleotide may comprise a core promoter sequence that facilitates recruitment of transcription machinery and initiation of transcription. In some embodiments, the core promoter sequence may be positioned downstream (i.e., 3) of the transcription factor binding polynucleotide sequence. In some embodiments, the core promoter sequence may be positioned upstream (i.e., 5) of a payload sequence. The core promoter may recruit polymerases, co-factors, or proteins that bind to polymerases to initiate transcription of a sequence downstream of the core promoter. For example, the core promoter sequence may recruit an RNA polymerase (e.g., RNA polymerase II) or a TATA binding protein (TBP) that recruits an RNA polymerase when in combination with a response element (e.g., a transcription factor binding sequence) bound to cognate ligands (e.g., transcription factors), coactivators, or corepressors. The ability of the core promoter sequence to recruit transcription machinery (e.g., an RNA polymerase) or the affinity of the core promoter sequence for the transcription machinery may affect transcription levels. In some embodiments, the core promoter sequence may be altered to tune transcription levels by altering recruitment of or affinity for transcription machinery.
[0081] Core promoter sequences may be engineered for one or more desired transcriptional properties, such as transcription level, cell type specificity, and/or cell genotype specificity. For example, a core promoter sequence may be engineered to promote a moderate level of transcription in neurons with a genetic mutation and little to no transcription in non-neuronal cell types and neurons lacking the genetic mutation. Engineering a core promoter sequence may comprise screening variants of a core promoter sequence for transcription level, cell type specificity, or cell genotype specificity.
[0082] In some embodiments, a core promoter sequence may comprise a TATA box (e.g., TATAAA), an RNA polymerase binding sequence, a B recognition element (BRE, e.g., G/C,G/C,G/A,CGCC), a CCAAT box or CAT box (e.g., GGCCAATCT), or a Pribnow box (e.g., TATAAT). Examples of core promoter sequences are provided in in
TABLE-US-00004 TABLE4 ExemplaryCorePromoterSequences CorePromoter SEQIDNO Sequence TATA SEQID TATAAAAG NO:1 CMV53 SEQID CAACAAAATGTCGTAACAAGGGCGGTAGGCGTGTACGGTG NO:2 GGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCG minSV40 SEQID TGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACT NO:3 CCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCT CCGCCCCATCGCTGACTAATTTTTTTTATTTATGCAGAGGCC GAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGG AGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTT miniTK SEQID TTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGC NO:4 GACCCTGCAGCGACCCGCTTAA MLP SEQID GGGGGGCTATAAAAGGGGGTGGGGGCGTTCGTCCTCACTCT NO:5 pJB42CA SEQID CTGACAAATTCAGTATAAAAGCTTGGGGCTGGGGCCGAGCA T5 NO:6 CTGGGGACTTTGAGGGTGGCCAGGCCAGCGTAGGAGGCCA GCGTAGGATCCTGCTGGGAGCGGGGAACTGAGGGAAGCGA CGCCGAGAAAGCAGGCGTACCACGGAGGGAGAGAAAAGCT CCGGAAGCCCAGCAGCG pGL4min SEQID AGACACTAGAGGGTATATAATGGAAGCTCGACTTCCAGCTT P NO:7 GGCAAT YBTAT SEQID TCTAGAGGGTTTATAATGGGGGCCACTAGTCTACTACTCAG Ainr11 NO:8 AAA TCT SEQID TCTTTCTTTTCGGTTGTCAAAATTTCGAGCGGAGCGGTCGC NO:9 YBTAT SEQID TCTAGAGGGTAGATAATGGGGGCCACTAGTCTACTACGAGA Ainr9 NO:10 AAG YBTAT SEQID TCTAGAGGGTATATAATAATAACCACTAGTCTACTACCAGA Ainr12 NO:11 AAG YBTAT SEQID TCTAGAGGGTATATAATGGGGGCCA A NO:12 YBTAT SEQID TCTAGAGGGTATAAAAGGCGGGCCACTAGTCTACTATGTGG Ainr7 NO:13 AAG YBTAT SEQID TCTAGAGGGTATATAATGGGGGCCACTAGTCTACTACGGGA Ainr8 NO:14 AAG YBTAT SEQID TCTAGAGGGTATATAATGGGGGCCACTAGTCTAACTATCAG Ainr4 NO:15 TCAG YBTAT SEQID TCTAGAGGGTATATAATGGGGGCCACTAGTCTACTATCAGT Ainr3 NO:16 CAG YBTAT SEQID TCTAGAGGGTATAAAAGGCGGGCCACTAGTCTACTACCAGA Ainr6 NO:17 AAG YBTAT SEQID TCTAGAGGGTATATAATGGGGGCCAAAGACTAGTCTACTAC Ainr2 NO:18 CAG YBTAT SEQID CTAGAGGGTATATAATGGGGGCCACTAGTCTACTCCGTCAG Ainr13 NO:19 ATC YBTAT SEQID TCTAGAGGGTATAAAAGGCGGGCCACTAGTCTACTATCAGT Ainr5 NO:20 CAG YBTAT SEQID TCTAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGA Ainr NO:21 AAG YBTAT SEQID TCTAGAGGGCTTAAAATGGGGGCCACTAGTCTACTACCAGA Ainr10 NO:22 AAG minCMV SEQID GTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGT NO:23 TTAGTGAACCGTCAGATC minP SEQID ACTAGAGGGTATATAATGGAAGCTCGACTTCCAGCTTGGCA NO:24 ATCCGGTACTGTTATGGC YBTAT SEQID ATGCTCTAGAGGGTATATAATGGGGGCCACTAGTCTACTAC Afull NO:25 CAGAAAGCTTGGTACCGA YBTAT SEQID CATATGCTCTAGAGGGTATATAATGGGGGCCACTAGTCTAC Afull NO:42 TACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCA minP SEQID GAGATCCAGTTTGGACACTAGAGGGTATATAATGGAAGCTC NO:43 GACTTCCAGCTTGGCAATCCGGTACTGTTATGGCCCAGTCC AA
[0083] In some embodiments, the core promoter may be cell type and/or cell state generic. A cell type and/or cell state generic core promoter may have low basal activity alone (e.g., low levels of transcriptional activation in the absence of a transcription factor binding sequence) and high activity (e.g., high levels of transcriptional activation) when paired with a transcription factor binding sequence in the presence of cell type and/or cell state specific transcription factors. For example, a cell type generic core promoter may have low transcriptional activation in the absence of a transcription factor binding sequence, independent of cell type and/or cell state. The cell type and/or cell state generic core promoter may have high transcriptional activation when paired with a cell state-specific transcription factor binding sequence in a cell type and/or cell state of interest (e.g., in the presence of, or at high levels of, transcription factors that bind to the transcription factor binding sequence). A cell type generic core promoter may have low transcriptional activation when paired with a cell type-specific transcription factor binding sequence not in a cell type of interest (e.g., in the absence of, or at low levels of, transcription factors that bind to the transcription factor binding sequence). For example, a cell type generic core promoter paired with a cell type-specific transcription factor binding sequence may be inactive in the absence of cell type-specific transcription factors and may be active in the presence of cell type-specific transcription factors. A cell state generic core promoter may have low transcriptional activation when paired with a cell state-specific transcription factor binding sequence not in a cell state of interest (e.g., in the absence of, or at low levels of, transcription factors that bind to the transcription factor binding sequence). For example, a cell state generic core promoter paired with a cell state-specific transcription factor binding sequence may be inactive in the absence of cell state-specific transcription factors (e.g., cell genotype-specific transcription factors and/or cell phenotype-specific transcription factors) and may be active in the presence of cell state-specific transcription factors. In some embodiments, a core promoter sequence may be engineered to have low basal transcriptional activation and high transcriptional activation when paired with a cell state- and/or cell type-specific transcription factor binding sequence in a cell state and/or cell type of interest.
[0084] The sequence of the core promoter may be varied to tune the transcription level, cell type specificity, cell genotype specificity, or cell phenotype specificity. In some embodiments, a core promoter sequence may comprise an endogenous core promoter sequence (e.g., TATA, CMV, EF1a, CAG, PGK, TRE, U6, or UAS). In some embodiments, a core promoter sequence may comprise a variant core promoter sequence. In some embodiments, a variant core promoter sequence may comprise at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 98% sequence identity to an endogenous core promoter sequence. In some embodiments, a variant core promoter sequence may comprise no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, no more than about 95%, no more than about 98% sequence identity to endogenous core promoter sequence. In some embodiments, a core promoter may comprise a synthetic core promoter (e.g., minimal CMV, minimal SV40, or YB_TATA). In some embodiments, the core promoter sequence may comprise at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 98% sequence identity to a synthetic core promoter sequence. In some embodiments, a core promoter may comprise a core promoter sequence provided in TABLE 4. In some embodiments, the core promoter sequence may comprise at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 98% sequence identity to a core promoter sequence provided in TABLE 4. In some embodiments, the core promoter sequence may comprise at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 98% sequence identity to any one of SEQ ID NO: 8, SEQ ID NO: 10-SEQ ID NO: 22, SEQ ID NO: 25, or SEQ ID NO: 42. In some embodiments, the core promoter sequence may comprise any one of SEQ ID NO: 8, SEQ ID NO: 10-SEQ ID NO: 22, SEQ ID NO: 25, or SEQ ID NO: 42. In some embodiments, the core promoter sequence may consist of any one of SEQ ID NO: 8, SEQ ID NO: 10-SEQ ID NO: 22, SEQ ID NO: 25, or SEQ ID NO: 42.
[0085] A workflow for tuning the transcription level and cell state specificity (e.g., cell genotype specificity or cell phenotype specificity) of a core promoter sequence may comprise generating candidate core promoter sequences comprising variants of core promoter sequences that facilitate transcription initiation, and screening the candidate core promoter sequences for transcription level and cell state specificity. In some embodiments, a library of polynucleotides comprising different core promoter sequences may be screened for transcription level and cell state specificity. In some embodiments, core promoter sequences may be screened in combination with transcription factor binding sequences for tuning the transcription level and cell state specificity of the promoter.
[0086] A workflow for tuning the transcription level and cell type specificity (e.g., neuron specificity, hepatocyte, or muscle cell specificity) of a core promoter sequence may comprise generating candidate core promoter sequences comprising variants of core promoter sequences that facilitate transcription initiation, and screening the candidate core promoter sequences for transcription level and cell type specificity. In some embodiments, a library of polynucleotides comprising different core promoter sequences may be screened for transcription level and cell type specificity. In some embodiments, core promoter sequences may be screened in combination with transcription factor binding sequences for tuning the transcription level and cell type specificity of the promoter.
[0087] A workflow for tuning the transcription level and cell state and cell type specificity of a core promoter sequence may comprise generating candidate core promoter sequences comprising variants of core promoter sequences that facilitate transcription initiation, and screening the candidate core promoter sequences for transcription level, cell state specificity, and cell type specificity. In some embodiments, a library of polynucleotides comprising different core promoter sequences may be screened for transcription level, cell state specificity, and cell type specificity. In some embodiments, core promoter sequences may be screened in combination with transcription factor binding sequences for tuning the transcription level, cell state specificity, and cell type specificity of the promoter.
Promoter Constructs
[0088] The transcription factor binding polynucleotide and the core promoter described herein may be combined to generate a promoter construct. The transcription factor binding sequences and the core promoter sequences described herein may be combined to generate a sequence of a promoter construct. The core promoter may recruit transcriptional machinery to initiate transcription of the sequence downstream of the core promoter when in combination with a transcription factor binding sequence that is bound to cognate ligands, coactivators, or corepressors. The promoter construct may be engineered to bind cell type- and/or cell state-specific transcription factors via the transcription factor binding sequence and initiate transcription by binding of transcriptional machinery to the core promoter sequence. In some embodiments, a promoter construct may comprise a transcription factor binding sequence (e.g., a transcription factor binding sequence provided in TABLE 3) or one or more transcription factor binding motifs (e.g., a transcription factor binding motif provided in TABLE 2 or that binds to a transcription factor provided in TABLE 1) and a core promoter sequence (e.g., a core promoter sequence provided in TABLE 4).
[0089] Examples of promoter constructs that promote cell type- and/or cell state-specific transcription are provided in TABLE 5. The promoters provided in TABLE 5 contain a transcription factor binding sequence of SEQ ID NO: 26. However, the transcription factor binding motif of any of the promoter constructs provided in TABLE 5 may be replaced with any of the transcription factor binding sequences provided in TABLE 3 or with one or more of the transcription factor binding motifs provided in TABLE 2. In some embodiments, a promoter sequence may comprise at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 87%, at least about 90%, at least about 93%, at least about 95%, or at least about 98%, or about 100% sequence identity to a promoter sequence provided in TABLE 5.
TABLE-US-00005 TABLE5 ExemplaryPromoterConstructsandCorrespondingCellStateorCellType Cell SEQIDNO Sequence Type/State SEQID AAGGTAGCTTCCAACCGACGGACGGGGCAGCGGGTAC MeCP2 NO:113 CCGCTGGGGCAGTGCCGCAGCGGCAGGAATACGGAGG mutant GCAGCGGGTACCCGCTGGGGCAGTGCCGCAGCGGCAG neurons GAATACGGAGCAGACACTAGAGGGTATATAATGGAAG CTCGACTTCCAGCTTGGCAATC SEQID AAGGTAGCTTCCAGTAACCGACGGACGGGGCAGCGGG MeCP2 NO:114 TACCCGCTGGGGCAGTGCCGCAGCGGCAGGAATACGG mutant AGGGCAGCGGGTACCCGCTGGGGCAGTGCCGCAGCGG neurons CAGGAATACGGAGTTCTAGAGGGTTTATAATGGGGGC CACTAGTCTACTACTCAGAAAC SEQID AAGGTAGCTTCCAGTACGCACCGACGGACGGGGCAGC MeCP2 NO:115 GGGTACCCGCTGGGGCAGTGCCGCAGCGGCAGGAATA mutant CGGAGGGCAGCGGGTACCCGCTGGGGCAGTGCCGCAG neurons CGGCAGGAATACGGAGTTCTTTCTTTTCGGTTGTCAAA ATTTCGAGCGGAGCGGTCGCC SEQID AAGGTAGCTTCCAGTAACCGACGGACGGGGCAGCGGG MeCP2 NO:116 TACCCGCTGGGGCAGTGCCGCAGCGGCAGGAATACGG mutant AGGGCAGCGGGTACCCGCTGGGGCAGTGCCGCAGCGG neurons CAGGAATACGGAGTTCTAGAGGGTAGATAATGGGGGC CACTAGTCTACTACGAGAAAGC SEQID AAGGTAGCTTCCAGTAACCGACGGACGGGGCAGCGGG MeCP2 NO:117 TACCCGCTGGGGCAGTGCCGCAGCGGCAGGAATACGG mutant AGGGCAGCGGGTACCCGCTGGGGCAGTGCCGCAGCGG neurons CAGGAATACGGAGTTCTAGAGGGTATATAATAATAAC CACTAGTCTACTACCAGAAAGC SEQID AAGGTAGCTTCCAGTACGCCTCGTTACTTCGGAGTACC MeCP2 NO:118 GACGGACGGGGCAGCGGGTACCCGCTGGGGCAGTGCC mutant GCAGCGGCAGGAATACGGAGGGCAGCGGGTACCCGCT neurons GGGGCAGTGCCGCAGCGGCAGGAATACGGAGTTCTAG AGGGTATATAATGGGGGCCAC SEQID AAGGTAGCTTCCAGTAACCGACGGACGGGGCAGCGGG MeCP2 NO:119 TACCCGCTGGGGCAGTGCCGCAGCGGCAGGAATACGG mutant AGGGCAGCGGGTACCCGCTGGGGCAGTGCCGCAGCGG neurons CAGGAATACGGAGTTCTAGAGGGTATAAAAGGCGGGC CACTAGTCTACTATGTGGAAGC SEQID AAGGTAGCTTCCAGTAACCGACGGACGGGGCAGCGGG MeCP2 NO:120 TACCCGCTGGGGCAGTGCCGCAGCGGCAGGAATACGG mutant AGGGCAGCGGGTACCCGCTGGGGCAGTGCCGCAGCGG neurons CAGGAATACGGAGTTCTAGAGGGTATATAATGGGGGC CACTAGTCTACTACGGGAAAGC SEQID AAGGTAGCTTCCAGTACCGACGGACGGGGCAGCGGGT MeCP2 NO:121 ACCCGCTGGGGCAGTGCCGCAGCGGCAGGAATACGGA mutant GGGCAGCGGGTACCCGCTGGGGCAGTGCCGCAGCGGC neurons AGGAATACGGAGATCTAGAGGGTATATAATGGGGGCC ACTAGTCTAACTATCAGTCAGC SEQID AAGGTAGCTTCCAGTAACCGACGGACGGGGCAGCGGG MeCP2 NO:122 TACCCGCTGGGGCAGTGCCGCAGCGGCAGGAATACGG mutant AGGGCAGCGGGTACCCGCTGGGGCAGTGCCGCAGCGG neurons CAGGAATACGGAGTTCTAGAGGGTATATAATGGGGGC CACTAGTCTACTATCAGTCAGC SEQID AAGGTAGCTTCCAGTAACCGACGGACGGGGCAGCGGG MeCP2 NO:123 TACCCGCTGGGGCAGTGCCGCAGCGGCAGGAATACGG mutant AGGGCAGCGGGTACCCGCTGGGGCAGTGCCGCAGCGG neurons CAGGAATACGGAGTTCTAGAGGGTATAAAAGGCGGGC CACTAGTCTACTACCAGAAAGC SEQID AAGGTAGCTTCCAGTAACCGACGGACGGGGCAGCGGG MeCP2 NO:124 TACCCGCTGGGGCAGTGCCGCAGCGGCAGGAATACGG mutant AGGGCAGCGGGTACCCGCTGGGGCAGTGCCGCAGCGG neurons CAGGAATACGGAGTTCTAGAGGGTATATAATGGGGGC CAAAGACTAGTCTACTACCAGC SEQID AAGGTAGCTTCCAGTAACCGACGGACGGGGCAGCGGG MeCP2 NO:125 TACCCGCTGGGGCAGTGCCGCAGCGGCAGGAATACGG mutant AGGGCAGCGGGTACCCGCTGGGGCAGTGCCGCAGCGG neurons CAGGAATACGGAGTCTAGAGGGTATATAATGGGGGCC ACTAGTCTACTCCGTCAGATCC SEQID AAGGTAGCTTCCAGTAACCGACGGACGGGGCAGCGGG MeCP2 NO:126 TACCCGCTGGGGCAGTGCCGCAGCGGCAGGAATACGG mutant AGGGCAGCGGGTACCCGCTGGGGCAGTGCCGCAGCGG neurons CAGGAATACGGAGTTCTAGAGGGTATAAAAGGCGGGC CACTAGTCTACTATCAGTCAGC SEQID AAGGTAGCTTCCAGTAACCGACGGACGGGGCAGCGGG MeCP2 NO:127 TACCCGCTGGGGCAGTGCCGCAGCGGCAGGAATACGG mutant AGGGCAGCGGGTACCCGCTGGGGCAGTGCCGCAGCGG neurons CAGGAATACGGAGTTCTAGAGGGTATATAATGGGGGC CACTAGTCTACTACCAGAAAGC SEQID AAGGTAGCTTCCAGTAACCGACGGACGGGGCAGCGGG MeCP2 NO:128 TACCCGCTGGGGCAGTGCCGCAGCGGCAGGAATACGG mutant AGGGCAGCGGGTACCCGCTGGGGCAGTGCCGCAGCGG neurons CAGGAATACGGAGTTCTAGAGGGCTTAAAATGGGGGC CACTAGTCTACTACCAGAAAGC SEQID AACCGACGGACGGGGCAGCGGGTACCCGCTGGGGCAG MeCP2 NO:129 TGCCGCAGCGGCAGGAATACGGAGGGCAGCGGGTACC mutant CGCTGGGGCAGTGCCGCAGCGGCAGGAATACGGAGGG neurons TAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCT CGTTTAGTGAACCGTCAGATCC SEQID AACCGACGGACGGGGCAGCGGGTACCCGCTGGGGCAG MeCP2 NO:130 TGCCGCAGCGGCAGGAATACGGAGGGCAGCGGGTACC mutant CGCTGGGGCAGTGCCGCAGCGGCAGGAATACGGAGGA neurons CTAGAGGGTATATAATGGAAGCTCGACTTCCAGCTTGG CAATCCGGTACTGTTATGGCC SEQID AACCGACGGACGGGGCAGCGGGTACCCGCTGGGGCAG MeCP2 NO:131 TGCCGCAGCGGCAGGAATACGGAGGGCAGCGGGTACC mutant CGCTGGGGCAGTGCCGCAGCGGCAGGAATACGGAGGA neurons TGCTCTAGAGGGTATATAATGGGGGCCACTAGTCTACT ACCAGAAAGCTTGGTACCGAC SEQID AGGACCGGATCAACTAAGGTAGCTTCCAGTACGCCTCG MeCP2 NO:132 TTACTTCGGAGTTACGTATACTCACGCGTAAGTTGCCG mutant AATAGGTGCACTATGACTGGAGTGCTTAGCGCGTGATT neurons ACTGATGGACACGTCACCTTGGCGATTCTAGAGGGTAT ATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGT ACCGAGCTCG SEQID AGGACCGGATCAACTAGAAGAACAACCGTACGCCACT MeCP2 NO:133 AACGATCGAAGCTTGATCAATTGAAGAATAATAGTGG mutant ACCAGCCGGTATCCACAGTCTCAAGACCCTTTCCAAGA neurons AGGTATCTGCTTTCCAGGAAGGACCTACTCTAGAGGGT ATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTG GTACCGAGCTCG SEQID AGGACCGGATCAACTAAGGTAGCTTCCAGTACGCCTCG MeCP2 NO:134 TTACTTCGGAGTTACGTATACTCACGCGTAAGTTGCCG mutant AATAGGTGTGGCACGTGCCAAGTGCTCGGCACGTGCC neurons GACTGCTCGGCACGTGCCATTGGCGATTCTAGAGGGTA TATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGG TACCGAGCTCG SEQID AGGACCGGATCAACTAAGGTAGCTTCCAGTACGCCTCG MeCP2 NO:135 AGGGAAGTGGGTCAGAAGGACTCACGGAAATTTGGGA mutant CAGAAGATGCACTAAGCAAGTGGGTCAGAAGGCGTGA neurons TAGGGAAGTGGGTCAGAAGGTTGGCGATTCTAGAGGG TATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTT GGTACCGAGCTCG SEQID AGGACCGGATCAACTAAGGTAGCTTCCAGTACGCCTCG MeCP2 NO:136 TTACTTCGGAGTTACGTATACTCACCCTTTGATGTGGG mutant AATAGTCCTTTGATGACGGGAGTGCCCTTTGATGTTGT neurons ACTGCCCCTTTGATGTGGTTGGCGATTCTAGAGGGTAT ATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGT ACCGAGCTCG SEQID AGGACCGGATCAACTAAGGTAGCTTCCAGTACGCCTCG MeCP2 NO:137 TTACTTCGGAGTTACGTATACTCATCAAGGTCATGCCG mutant ACTTGGTTCCGTTCCACTGGAGTGTCAAGGTCATGATT neurons ACTTGGTTCCGTTCCACTTTGGCGATTCTAGAGGGTAT ATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGT ACCGAGCTCG SEQID AGGACCGGATCAACTAAGGTAGCTTCCAGTACGCCTCG MeCP2 NO:138 TTACTTCGGAGTGGAAATTTGGGACAGAAGAGTTGCCT mutant CCTTTGATGACGATGACTGGAAATTTGGGACAGAAGAT neurons ACTGCTCCTTTGATGACGTTGGCGATTCTAGAGGGTAT ATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGT ACCGAGCTCG SEQID AGGACCGGATCAACTAGAAGAACAACCGTACGCCACT MeCP2 NO:139 AACGATCGAAGCTTGATCAATTGAAGAATAATAGTGG mutant ACCAGCCGGTATCTCAAGCTCGAAGAGACACAGATGG neurons CCGGTAAACAATTGCATTGTTGGACCTACTCTAGAGGG TATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTT GGTACCGAGCTCG SEQID AGGACCGGATCAACTAGAAGAACAACCGTACGCCACT MeCP2 NO:140 AACGATCGAAGCTTGATCAATTGAAGAATAATAGTGG mutant ACCAGCCGGTATCCACAGTCTCAAGAGAGAGGACAGG neurons CCGGTATCGACTCAAGCGACAGGACCTACTTATCTTTC TTTTCGGTTGTCAAAATTTCGAGCGGAGCGGTCGCCTT GGTACCGAGCTCG
[0090] In some embodiments, a promoter may comprise a core promoter sequence and a transcription factor binding sequence having at least 90% sequence identity to SEQ ID NO: 26. In some embodiments, a promoter may comprise a core promoter sequence and a transcription factor binding sequence having at least 93% sequence identity to SEQ ID NO: 26. In some embodiments, a promoter may comprise a core promoter sequence and a transcription factor binding sequence having at least 95% sequence identity to SEQ ID NO: 26. In some embodiments, a promoter may comprise a core promoter sequence and a transcription factor binding sequence having at least 98% sequence identity to SEQ ID NO: 26. In some embodiments, a promoter may comprise a core promoter sequence and a transcription factor binding sequence that is SEQ ID NO: 26. In some embodiments, the core promoter is any core promoter provided in TABLE 4. In some embodiments, the core promoter sequence may comprise at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 98% sequence identity to a core promoter sequence provided in TABLE 4.
[0091] A promoter may be combined with a payload sequence to form a polynucleotide construct that promotes cell type- and/or cell state-specific transcription of the payload sequence. In some embodiments, the payload sequence is transcribed in a target cell (e.g., a target cell type or a target cell state) at a level at is at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 1.6-fold, at least about 1.7-fold, at least about 1.8-fold, at least about 1.9-fold, at least about 2-fold, at least about 2.1-fold, at least about 2.2-fold, at least about 2.3-fold, at least about 2.4-fold, at least about 2.5-fold, at least about 2.6-fold, at least about 2.7-fold, at least about 2.8-fold, at least about 2.9-fold, at least about 3-fold, at least about 3.5-fold, at least about 4-fold, at least about 4.5-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold the level in a non-target cell (e.g., a non-target cell type or a non-target cell state). For example, a payload sequence may be transcribed in a MeCP2 mutant cell (e.g., a cell expressing a mutant MeCP2 protein) at a level that is at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 1.6-fold, at least about 1.7-fold, at least about 1.8-fold, at least about 1.9-fold, at least about 2-fold, at least about 2.1-fold, at least about 2.2-fold, at least about 2.3-fold, at least about 2.4-fold, at least about 2.5-fold, at least about 2.6-fold, at least about 2.7-fold, at least about 2.8-fold, at least about 2.9-fold, at least about 3-fold, at least about 3.5-fold, at least about 4-fold, at least about 4.5-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold the level in a MeCP2 wild type cell (e.g., a cell expressing a wild type MeCP2 protein). In some embodiments, a MeCP2 mutant cell is a cell expressing a mutant MeCP2 protein. In some embodiments, a MeCP2 mutant cell is a cell expressing a mutant MeCP2 protein associated with disease phenotype, such as Rett syndrome. In some embodiments, a MeCP2 mutant cell is a diseased cell having a diseased phenotype associated with the expression of a protein from a MECP2 mutant gene and comprising the MECP2 mutant gene. In some embodiments, a MeCP2 wild type cell is a cell expressing a wild type MeCP2 protein. In some embodiments, a MeCP2 wild type cell is a cell expressing a wild type MeCP2 protein associated with wild type phenotype. In some embodiments, a MeCP2 wild type cell is a healthy cell having a wild type phenotype associated with the expression of a protein from a wild type MECP2 gene and comprising the wild type MECP2 gene.
Payloads
[0092] A payload of the present disclosure may comprise a sequence encoding a protein under transcriptional control of a promoter (e.g., a promoter comprising a transcription factor binding polynucleotide and a core promoter). The payload may comprise a transgene for delivery to a cell (e.g., a cell of a human or non-human subject). In some embodiments, the transgene may comprise a coding sequence encoding a protein (e.g., a protein without a mutation associated with a disease or condition). Upon delivery of the payload to a cell, the protein encoded by the coding sequence may be expressed in the cell. In some embodiments, expression of a protein encoded by the coding sequence may treat, prevent, or alleviate symptoms of a disease or disorder. In some embodiments, the transgene may encode a wild type copy of a protein that is mutated or dysregulated in the disease or condition. Alternatively or in addition, the payload sequence may encode a therapeutic polynucleotide (e.g., a gRNA or tRNA) for delivery to a cell (e.g., a cell of a human or non-human subject). In some embodiments, the therapeutic polynucleotide may target a gene (e.g., for gene editing). Upon delivery of the payload to a cell, the therapeutic polynucleotide encoded by the payload sequence may be expressed in the cell. In some embodiments, expression of the therapeutic polynucleotide may treat, prevent, or alleviate symptoms of a disease or disorder. In some embodiments, the therapeutic polynucleotide may target a mutated gene sequence associated with the disease or disorder.
[0093] In some embodiments, cell state specific transcription of a payload sequence (e.g., a transgene or therapeutic polynucleotide) is desired. For example, a transgene lacking a mutation may be specifically transcribed in neurons having a gene comprising the mutation or having a phenotype associated with the mutation. In another example, a transgene lacking a mutation may be specifically transcribed in retinal tissue having gene comprising the mutation or having a phenotype associated with the mutation. In another example, a transgene lacking a genetic variation may be specifically transcribed in cells having the genetic variation or having a phenotype associated with the genetic variation. In another example, a transgene encoding a protein or polynucleotide may be specifically transcribed in cells having altered expression (e.g., elevated expression or decreased expression) of the protein or polynucleotide. Alternatively or in addition, a therapeutic polynucleotide targeting a mutated gene sequence may be specifically transcribed in neurons having a gene comprising the mutation or having a phenotype associated with the mutation. In another example, a therapeutic polynucleotide targeting a mutated gene sequence may be specifically transcribed in retinal tissue having gene comprising the mutation or having a phenotype associated with the mutation. In another example, a therapeutic polynucleotide targeting a mutated gene sequence may be specifically transcribed in cells having the genetic variation or having a phenotype associated with the genetic variation. In another example, a therapeutic polynucleotide targeting a gene sequence may be specifically transcribed in cells having altered expression of a protein or polynucleotide encoded by the gene sequence.
[0094] Examples of genes that may be encoded in the payload sequence (e.g., a transgene) or may be targeted by a therapeutic polynucleotide encoded by the payload sequence (e.g., a gRNA or tRNA) are provided in TABLE 6. In some embodiments, the genes may be delivered as transgenes to a cell of a subject to treat a disease or condition in the subject. In some embodiments, the transgene may encode a wild type copy of a gene provided in TABLE 6. Alternatively or in addition, a therapeutic polynucleotide encoded by the payload sequence may target a mutated version of a gene provided in TABLE 6.
TABLE-US-00006 TABLE 6 Exemplary Transgene Payloads or Gene Targets and Indications Transgene or Gene Target Indication MECP2 Rett syndrome; MECP2 duplication syndrome GRN Frontotemporal dementia; neuronal ceroid lipofuscinosis PRPH2 Retinitis Pigmentosa 7; macular degeneration RHO Retinitis Pigmentosa 4 UBE3A Angelman Syndrome DYRK1A DYRK1A haploinsufficiency MEF2C MEF2C haploinsufficiency syndrome NSD1 Sotos syndrome; Reverse Sotos syndrome ATRX Alpha-thalassemia X-linked intellectual disability syndrome RPS6KA3 Xp22.12 duplication; Coffin-Lowry syndrome TCF4 Pitt Hopkins syndrome ZEB2 Mowat-Wilson Syndrome FOXG1 FOXG1 syndrome CDKL5 CDKL5 deficiency disorder; West Syndrome Partial piece 2q23.1 microdeletion syndrome of Chromo- some 2 SLC6A1 Doose Syndrome; SLC6A1 epileptic encephalopathy DMD Duchenne's muscular dystrophy; Becker muscular dystrophy SERPINA1 Alpha-1 antitrypsin deficiency (AATD) ABCA4 Macular Degeneration/Stargardt disease CFTR Cystic Fibrosis HEXA Tay-Sachs RAB7A Charcot-Marie-Tooth neuropathy ATP7B Wilson's disease HFE Hereditary Hemochromatosis LIPA Wolman disease; cholesteryl ester storage disease SCNN1A Psueodhypoaldosteronism type 1 PKD1 Polycystic Kidney, Autosomal Dominant PKD2 Polycystic Kidney, Autosomal Dominant PKHD1 Autosomal Recessive Polycystic Kidney Disease ACE Kidney Failure, Chronic ALB Kidney Failure, Chronic VHL Malignant neoplasm of kidney EPO Kidney Failure, Chronic PKD2 Polycystic kidney disease, type 2 FH Malignant neoplasm of kidney ACE Kidney Failure TNF Kidney Failure, Chronic SPP1 Kidney Calculi IL6 Kidney Failure, Chronic MYH9 Kidney Failure, Chronic PKD1 Autosomal Recessive Polycystic Kidney Disease TSC2 Kidney Neoplasm ADIPOQ Kidney Failure, Chronic IL2 Malignant neoplasm of kidney CCL2 Kidney Failure, Chronic TGFB1 Kidney Failure, Chronic VHL Kidney Neoplasm UMOD Medullary Cystic Kidney Disease Type 2 BCOR Clear cell sarcoma of kidney FLCN Kidney Neoplasm FLCN Malignant neoplasm of kidney PKD1 Polycystic kidney disease, type 2 TP53 Malignant neoplasm of kidney CRP Kidney Failure, Chronic PTEN Malignant neoplasm of kidney IFT88 Autosomal Recessive Polycystic Kidney Disease CLDN14 Kidney Calculi FH Kidney Neoplasm VHL Collecting Duct Carcinoma of the Kidney AGT Kidney Failure MET Malignant neoplasm of kidney MYH9 Kidney Failure YWHAE Clear cell sarcoma of kidney PKD1 Polycystic Kidney - body part HAMP Kidney Failure, Chronic EPO Kidney Failure MUC1 Medullary cystic kidney disease 1 BAP1 Malignant neoplasm of kidney APOE Kidney Failure CYBA Kidney Failure, Chronic GSTT1 Malignant neoplasm of kidney IFNG Kidney Failure IGF1 Kidney Failure, Chronic IL2 Kidney Neoplasm ABCB1 Malignant neoplasm of kidney SDHB Malignant neoplasm of kidney TP53 Collecting Duct Carcinoma of the Kidney TSC2 Malignant neoplasm of kidney BRAF Kidney Neoplasm CDKN1B Malignant neoplasm of kidney GLA Kidney Failure; Chronic kidney disease/disorder with a monogenetic origin KRT7 Collecting Duct Carcinoma of the Kidney PPARG Polycystic Kidney, Autosomal Dominant RET Congenital absence of kidneys syndrome TRPC6 Kidney Failure, Chronic kidney disease/disorder with a monogenetic origin NDRG1 Malignant neoplasm of kidney GANAB Polycystic Kidney, Autosomal Dominant NOX4 Kidney Failure, Chronic ADIPOR1 Kidney Failure, Chronic GREB1L Congenital absence of kidneys syndrome ANKS6 Cystic kidney NUTM2B Clear cell sarcoma of kidney CAT Kidney Failure, Chronic CYBA Kidney Failure CYBB Kidney Failure, Chronic EGFR Autosomal Recessive Polycystic Kidney Disease HMOX1 Kidney Failure, Chronic LRP2 Kidney Failure, Chronic SERPINE1 Kidney Failure, Chronic PAX2 Kidney Failure, Chronic; Chronic kidney disease/disorder with a monogenetic origin ABCB1 Kidney Neoplasm PPARA Kidney Failure, Chronic PPARG Kidney Failure PTGS2 Kidney Failure, Chronic RELA Kidney Failure, Chronic RET Unilateral agenesis of kidney TLR4 Kidney Failure UMOD Glomerulocystic Kidney Disease with Hyperuricemia and Isosthenuria BAP1 Kidney Neoplasm RETN Kidney Failure, Chronic GREB1L Unilateral agenesis of kidney FRAS1 Unilateral agenesis of kidney CRB2 Cystic Kidney Disease with Ventriculomegaly APRT Kidney Failure, Chronic AXL Malignant neoplasm of kidney CCND1 Malignant neoplasm of kidney BRAF Malignant neoplasm of kidney CBR1 Kidney Failure, Chronic CPT1A Kidney Failure, Chronic CYP1A1 Malignant neoplasm of kidney CYP2B6 Kidney Failure, Chronic EDN1 Kidney Failure ERBB2 Collecting Duct Carcinoma of the Kidney HMGCR Kidney Failure, Chronic MME Kidney Failure NFKB1 Kidney Failure, Chronic NGF Kidney Failure, Chronic MAPK1 Malignant neoplasm of kidney MAPK3 Malignant neoplasm of kidney PTGS2 Kidney Neoplasm PTGS2 Malignant neoplasm of kidney HLTF Kidney Neoplasm SOD1 Kidney Calculi SOD2 Malignant neoplasm of kidney SREBF2 Kidney Failure, Chronic HNF1B Unilateral Multicystic Dysplastic Kidney TERT Clear cell sarcoma of kidney TNFSF10 Malignant neoplasm of kidney NDRG1 Kidney Neoplasm MBTPS2 Brain Anomalies, Retardation, Ectodermal Dysplasia, Skeletal Malformations, Hirschsprung Disease, Ear-Eye Anomalies, Cleft Palate-Cryptorchidism, And Kidney Dysplasia-Hypoplasia WNT4 Sex Reversal, Female, With Dysgenesis Of Kidneys, Adrenals, And Lungs BCOR Kidney Neoplasm INF2 Kidney Failure; Chronic kidney disease/disorder with a monogenetic origin ALG9 Polycystic Kidney Disease, Potter Type I, with Microbrachycephaly, Hypertelorism, and Brachymelia BICC1 Polycystic Kidney, Autosomal Dominant TMEM67 Cystic kidney IRX2 Clear cell sarcoma of kidney FREM1 Congenital absence of kidneys syndrome ANKS6 Polycystic Kidney, Autosomal Dominant FREM2 Unilateral agenesis of kidney CD46 Chronic kidney disease/disorder with a monogenetic origin COL4A3 Chronic kidney disease/disorder with a monogenetic origin COL4A4 Chronic kidney disease/disorder with a monogenetic origin COL4A5 Chronic kidney disease/disorder with a monogenetic origin TTC21B Chronic kidney disease/disorder with a monogenetic origin NPHP4 Chronic kidney disease/disorder with a monogenetic origin CD2AP Chronic kidney disease/disorder with a monogenetic origin CFI Chronic kidney disease/disorder with a monogenetic origin LAMB2 Chronic kidney disease/disorder with a monogenetic origin LMX1B Chronic kidney disease/disorder with a monogenetic origin MYH9 Chronic kidney disease/disorder with a monogenetic origin CNGA3 Achromatopsia CNGB3 Achromatopsia ABCD1 Adrenomyeloneuropathy Tafazzin Barth Syndrome CLN1 Batten Disease CLN2 Batten Disease CLN3 Batten Disease CLN4 Batten Disease CLN5 Batten Disease CLN6 Batten Disease ASPA Canavan Disease CYP21A2 Congenital Adrenal Hyperplasia PMM2 Congenital Disorder of Glycosylation 1a LAMP2 Danon Disease GLA Fabry Disease GBA Gaucher Disease GLB1 GM1 Gangliosidosis G6PC Glycogen SD 1a F9 Hemophilia Serping1 Hereditary Angioedema GALC Krabbe Disease GUCY2D Leber's Disease ND1 Leber's Disease ND6 Leber's Disease ND4 Leber's Disease RPE65 Leber's Disease AIPL1 Leber's Disease MTM1 Myotubular Myopathy MSP I Mucopolysaccharidosis MSP II Mucopolysaccharidosis MSP IIA Mucopolysaccharidosis MSP IIC Mucopolysaccharidosis MSP IIID Mucopolysaccharidosis MSP IVA Mucopolysaccharidosis MSP VI Mucopolysaccharidosis MSP VII Mucopolysaccharidosis MSP IXA Mucopolysaccharidosis OTC Ornithine Transcarbamylase Deficiency GAA Pompe Disease HEXB Sandhoff Disease SMN1 Spinal Muscular Atrophy USH2D- Usher Syndrome WHRN USH3A- Usher Syndrome CLN1 SOD1 ALS HBB Beta-thalassemia or Sickle Cell disease BEST1 Bestrophinopathy CHM Chorioderemia FXN Freidreich's Ataxia SLC37A4 GSD1b IGF1 Osteoporosis RPGR Retinitis Pigmentosa USH1C Usher 1C, 1F CIB2 Usher 1C, 1F SERPINA1 Alpha-1 Antitrypsin Deficiency AC6 Heart Failure Serca2 Heart Failure VEGF-B Heart Failure PP1 Heart Failure GAD Parkinson's Disease AADC AADC deficiency CLN2 Batten disease (CLN2) CLN6 Batten disease (CLN6) NAGLU MPS-IIIB GRN Frontotemporal dementia with GRN mutations (FTD-GRN) GBA1 Parkinson's Disease with GBA1 mutations (PD-GBA) and neuronopathic Gaucher's disease GBA1 + Synucleinopathies alpha- synuclein ASPA Canavan disease AADC Parkinson disease GDNF Parkinson disease Neurturin Parkinson disease hFOXG1 FOXG1 syndrome hKCNQ2 KCNQ2 Encephalopathy hFMR1 Fragile X syndrome anti-Tau Alzheimer's disease miRNA EPM2A or Lafora disease EPM2B SMN SMA GAN Giant axonal neuropathy CNGB3 Achromatopsia REP1 Choroideraemia RPE65 LCA ND4 LHON RLBP1 RP (RLBP1) Anti-VEGF Wet AMD antibody RPGR X-linked RP RS1 X-linked retinoschisis HEXB and (Nervous system) HEXA human (Nervous system) codon- optimized CLN1 comple- mentary DNA SURF1 (Nervous system) MECP2 Rett Syndrome (Nervous system) anti-UBE3A- (Nervous system) ATS shRNA anti-EHMT2 (possibly germ-line cells) shRNA hSLC6A1 (Nervous system) TMC1 (Associated with hearing loss) UBE3A Angelman syndrome (nervous system) AADC AADC deficiency Multiple, in- Alzheimer's Disease cluding APP, SNCA, MAPT, ApoE, NGF, TERT MAPT Tauopathies SNCA Synucleinopathies CLN2 Batten disease (CLN2) CLN3 Batten disease (CLN3) CLN6 Batten disease (CLN6) NAGLU MPS-IIIB GRN Frontotemporal dementia with GRN mutations (FTD-GRN) GBA1 Parkinson's Disease with GBA1 mutations (PD-GBA) and neuronopathic Gaucher's disease MAPT Corticobasal Degeneration (CBD) MAPT Progressive Supranuclear Palsy (PSP) MAPT Chronic Traumatic Encephalopathy (CTE) GBA1 + Synucleinopathies alpha- synuclein GBA Gaucher disease type 2 ASPA Canavan Disease AADC Parkinson disease GDNF Parkinson disease Neurturin Parkinson disease (NRTN) GAD Parkinson disease NTN Parkinson disease hFOXG1 Parkinson disease hKCNQ2 Parkinson disease hFMR1 Parkinson disease anti-Tau/ Parkinson disease miRNA EPM2A or Parkinson disease EPM2B LRRK2 Parkinson disease LRRK2 Parkinson's Disease SNCA Parkinson's Disease HEXA Tay-Sachs Disease IT15 Huntington's disease CYP46A1 Huntington's disease HTT Huntington's disease IT15 Potocki-Lupski Syndrome C9orf72 Amyotrophic lateral sclerosis SOD1 Amyotrophic lateral sclerosis DYRK1A Down syndrome SGSH Sanfilippo disease type A hNAGLU Sanfilippo disease type B HEXB and (Nervous system) HEXA human (Nervous system) codon- optimized CLN1 comple- mentary DNA SURF1 (Nervous system) anti-UBE3A- (Nervous system) ATS shRNA hSLC6A1 (Nervous system) MECP2 Rett syndrome NTF3 Charcot-Marie-Tooth disease type 1A (CMT1A) Micro- Duchenne muscular dystrophy (DMD) dystrophin Mini- Duchenne muscular dystrophy (DMD) dystrophin DUX4 Facioscapulohumeral muscular dystrophy-1 (FSHD) DYSF Dysferlinopathy GAA Pompe disease FKRP Limb-girdle muscular dystrophies (LGMD) (2i/R9) DMD Duchenne muscular dystrophy (DMD) DUX4 Facioscapulohumeral Dystrophy DMPK Myotonic Dystrophy anti-GYS1 Glycogen storage disorders miRNA MTM1 X-linked myotubular myopathy (X-linked MTM) anti-EHMT2 euchromatic histone-lysine N-methyltransferase 2 shRNA
[0095] Examples of genes that may be encoded by a payload sequence (e.g., the transgene) or may be targeted by a polynucleotide (e.g., a gRNA or tRNA) encoded by the payload sequence and delivered to a cell of a subject to treat, prevent, or alleviate symptoms of a disease or condition include MECP2, GRN, PRPH2, RHO, UBE3A, DYRK1A, MEF2C, NSD1, ATRX, RPS6KA3, TCF4, ZEB2, FOXG1, CDKL5, a partial piece of chromosome 2, SLC6A1, DMD, SERPINA1, ABCA4, CFTR, HEXA, RAB7A, ATP7B, HFE, LIPA, SCNN1A, PKD1, PKD2, PKHD1, ACE, ALB, VHL, EPO, PKD2, FH, ACE, TNF, SPP1, IL6, MYH9, PKD1, TSC2, ADIPOQ, IL2, CCL2, TGFB1, VHL, UMOD, BCOR, FLCN, FLCN, PKD1, TP53, CRP, PTEN, IFT88, CLDN14, FH, VHL, AGT, MET, MYH9, YWHAE, PKD1, HAMP, EPO, MUC1, BAP1, APOE, CYBA, GSTT1, IFNG, IGF1, IL2, ABCB1, SDHB, TP53, TSC2, BRAF, CDKN1B, GLA, KRT7, PPARG, RET, TRPC6, NDRG1, GANAB, NOX4, ADIPOR1, GREB1L, ANKS6, NUTM2B, CAT, CYBA, CYBB, EGFR, HMOX1, LRP2, SERPINE1, PAX2, ABCB1, PPARA, PPARG, PTGS2, RELA, RET, TLR4, UMOD, BAP1, RETN, GREB1L, FRAS1, CRB2, APRT, AXL, CCND1, BRAF, CBR1, CPT1A, CYP1A1, CYP2B6, EDN1, ERBB2, HMGCR, MME, NFKB1, NGF, MAPK1, MAPK3, PTGS2, PTGS2, HLTF, SOD1, SOD2, SREBF2, HNF1B, TERT, TNFSF10, NDRG1, MBTPS2, WNT4, BCOR, INF2, ALG9, BICC1, TMEM67, IRX2, FREM1, ANKS6, FREM2, CD46, COL4A3, COL4A4, COL4A5, TTC21B, NPHP4, CD2AP, CFI, LAMB2, LMX1B, or MYH9.
[0096] In some embodiments, the genes targets that may be encoded or targeted by a payload sequence and delivered to a tissue of a subject to treat, prevent, or alleviate symptoms of a disease or condition may be associated with a disease or disorder. For example, CNGA3 or CNGB3 associated with Achromatopsia; ABCD1 associated with Adrenomyeloneuropathy; UBE3A associated with Angelman Syndrome; Tafazzin associated with Barth Syndrome; CLN1, CLN2, CLN3, CLN4, CLN5, or CLN6 associated with Batten Disease; ASPA associated with Canavan Disease; PKD1 or PDK2 associated with Autosomal Dominant Polycistic Kidney Disease; CYP21A2 associated with Congenital Adrenal Hyperplasia; PMM2 associated with Congenital Disorder of Glycosylation 1a; LAMP2 associated with Danon Disease; GLA associated with Fabry Disease; GBA associated with Gaucher Disease; GLB1 associated with GM1 Gangliosidosis; G6PC associated with Glycogen SD 1a; F9 associated with Hemophilia; Serping1 associated with Hereditary Angioedema; GALC associated with Krabbe Disease; GUCY2D, NDI, ND6, ND4, RPE65, or AIPL1 associated with Leber's Disease; MTM1 associated with Myotubular Myopathy; I, II, IIA, IIC, IIID, IVA, VI, VII, and IXA associated with Mucopolysaccharidosis; OTC associated with Ornithine Transcarbamylase Deficiency; GAA associated with Pompe Disease; HEXB associated with Sandhoff Disease; SAM associated with Spinal Muscular Atrophy; HEXA associated with Tay-Sachs; USH2D-WHRN and USH3A-CLN1 associated with Usher Syndrome; SOD1 associated with ALS; HBB associated with Beta-thalassemia or Sickle Cell disease; BEST1 associated with Bestrophinopathy; CHM associated with Choroideremia; FXN associated with Freidreich's Ataxia; SLC37A4 associated with GSD1b; IGF1 associated with Osteoporosis; RPGR or RHO associated with Retinitis Pigmentosa; USH1C or CIB2 associated with Usher 1C, 1F; SERPINA1 associated with Alpha-I Antitrypsin Deficiency; MECP2 associated with Rett Syndrome; AC6, Serca2, VEGF-B, or PP1 associated with Heart Failure; GAD associated with Parkinson's Disease; MBTPS2 associated with Brain Anomalies, Retardation, Ectodermal Dysplasia, Skeletal Malformations, Hirschsprung Disease, Ear-Eye Anomalies, Cleft Palate-Cryptorchidism, And Kidney Dysplasia-Hypoplasia; CD46, COL4A3, COL4A4, COL4A5, TTC21B, NPHP4, CD2AP, CFI, LAMB2, LMX1B, or MYH9 associated with Chronic kidney disease/disorder with a monogenetic origin; TERT or IRX2 associated with Clear cell sarcoma of kidney; ERBB2 associated with Collecting Duct Carcinoma of the Kidney; FREM1 associated with Congenital absence of kidneys syndrome; TMEM67 associated with Cystic kidney; SOD1 associated with Kidney Calculi; EDN1 or MME associated with Kidney Failure; CPT1A, CYP2B6, HMGCR, NFKB1, NGF, or SREBF2 associated with Kidney Failure, Chronic; INF2 associated with Kidney Failure or Chronic kidney disease/disorder with a monogenetic origin; PTGS2, HLTF, NDRG1, or BCOR associated with Kidney Neoplasm; CYP1A1, MAPK1, MAPK3, PTGS2, SOD2, or TNFSF10 associated with Malignant neoplasm of kidney; ALG9 associated with Polycystic Kidney Disease, Potter Type I, with Microbrachycephaly, Hypertelorism, and Brachymelia; BICC1 or ANKS6 associated with Polycystic Kidney, Autosomal Dominant; WNT4 associated with Sex Reversal, Female, With Dysgenesis Of Kidneys, Adrenals, And Lungs; FREM2 associated with Unilateral agenesis of kidney; or HNF1B associated with Unilateral Multicystic Dysplastic Kidney.
[0097] In some embodiments, the payload encodes a therapeutic polynucleotide (e.g., a therapeutic RNA). In some embodiments the therapeutic payload encodes a therapeutic RNA, such as a guide RNA (including an engineered or synthetic guide RNA) for genome editing or for RNA editing. In some embodiments, the therapeutic payload encodes a tRNA or a modified tRNA (engineered or synthetic tRNA).
[0098] In some embodiments, the payload may encode a therapeutic polynucleotide (e.g., a therapeutic RNA or modified tRNA) that can target a gene target listed in TABLE 6. In some embodiments, a payload may comprise an open reading frame encoding a gene target listed in TABLE 6 and may encode a protein expressed by the associated gene. In some embodiments, a payload may encode a protein associated with a disease (e.g., Parkinson's disease, Alzheimer's disease, a Tauopathy, Stargardt disease, alpha-1 antitrypsin deficiency, Duchenne's muscular dystrophy, Rett syndrome, cystic fibrosis, or any genetic disease). In some embodiments, a payload may encode a therapeutic polynucleotide that targets a gene associated with a disease (e.g., Parkinson's disease, Alzheimer's disease, a Tauopathy, Stargardt disease, alpha-1 antitrypsin deficiency, Duchenne's muscular dystrophy, Rett syndrome, cystic fibrosis, or any genetic disease). In some embodiments, the targeted gene may encode ABCA4, AAT, SERPINA1, SERPINA1 E342K, HEXA, LRRK2, SNCA, DMD, APP, Tau, GBA, PINK1, RAB7A, CFTR, ALAS1, ATP7B, ATP7B G1226R, HFE C282Y, LIPA c.894 G>A, PCSK9 start site, or SCNN1A start site, a fragment any of these, or any combination thereof.
[0099] In some embodiments, a gene encoded by or targeted by a payload (e.g., a transgene or polynucleotide) may be transcribed in a target cell type or target cell state at a level that is at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold a transcription level of the payload in a non-target cell type or non-target cell state.
Delivery Vehicle
[0100] A polynucleotide (e.g., a recombinant polynucleotide) of the present disclosure (e.g., a polynucleotide comprising a promoter and a payload) may be delivered via a delivery vehicle. In some embodiments, the delivery vehicle is a vector, such as a viral vector. A vector may facilitate delivery of the polynucleotide into a cell to genetically modify the cell. In some examples, the vector comprises DNA, such as double stranded or single stranded DNA. In some examples, the delivery vector may be a eukaryotic vector, a prokaryotic vector (e.g., a bacterial vector or plasmid), a viral vector, or any combination thereof. In some embodiments, the vector is an expression cassette. In some embodiments, a viral vector comprises a viral capsid, an inverted terminal repeat sequence, and the polynucleotide may be used to deliver the polynucleotide to a cell.
[0101] In some embodiments, the viral vector may be a retroviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, an alphavirus vector, a lentivirus vector (e.g., human or porcine), a Herpes virus vector, an Epstein-Barr virus vector, an SV40 virus vectors, a pox virus vector, or a combination thereof. In some embodiments, the viral vector may be a recombinant vector, a hybrid vector, a chimeric vector, a self-complementary vector, a single-stranded vector, or any combination thereof.
[0102] In some embodiments, the viral vector may be an adeno-associated virus (AAV). In some embodiments, the AAV may be any AAV known in the art. In some embodiments, the viral vector may be of a specific serotype. Adeno-associated virus (AAV) vectors include vectors derived from any AAV serotype, including, but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ/8, AAV-DJ/9, AAV1/2, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh43, AAV.Rh74, AAV.v66, AAV.Oligo001, AAV.SCH9, AAV.r3.45, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PhP.eB, AAV.PhP.V1, AAV.PHP.B, AAV.PhB.C1, AAV.PhB.C2, AAV.PhB.C3, AAV.PhB.C6, AAV.cy5, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17, and AAVhu68. In some embodiments, the viral vector may be a derivative of any of these serotypes, or a combination of serotypes.
[0103] In some embodiments, a polynucleotide is introduced into a subject by non-viral vector systems. In some embodiments, cationic lipids, polymers, hydrodynamic injection and/or ultrasound may be used in delivering a polynucleotide to a subject in the absence of virus.
[0104] In some examples, the vector may be a eukaryotic vector, a prokaryotic vector (e.g., a bacterial vector) a viral vector, or any combination thereof. In some examples, the vector may be a viral vector. In some embodiments, the viral vector may be a retroviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, an alphavirus vector, a lentivirus vector (e.g., human or porcine), a Herpes virus vector, an Epstein-Barr virus vector, an SV40 virus vectors, a pox virus vector, or a combination thereof. In some embodiments, the viral vector may be a recombinant vector, a hybrid vector, a chimeric vector, a self-complementary vector, a single-stranded vector, or any combination thereof.
[0105] In some embodiments, the viral vector may be an adeno-associated virus (AAV). In some embodiments, the AAV may be any AAV known in the art. In some embodiments, the viral vector may be of a specific serotype. In some embodiments, the viral vector may be an AAV1 serotype, AAV2 serotype, AAV3 serotype, AAV4 serotype, AAV5 serotype, AAV6 serotype, AAV7 serotype, AAV8 serotype, AAV9 serotype, AAV10 serotype, AAV11 serotype, AAV 12 serotype, AAV13 serotype, AAV14 serotype, AAV15 serotype, AAV16 serotype, AAV-DJ serotype, AAV-DJ/8 serotype, AAV-DJ/9 serotype, AAV1/2 serotype, AAV.rh8 serotype, AAV.rh10 serotype, AAV.rh20 serotype, AAV.rh39 serotype, AAV.Rh43 serotype, AAV.Rh74 serotype, AAV.v66 serotype, AAV.Oligo001 serotype, AAV.SCH9 serotype, AAV.r3.45 serotype, AAV.RHM4-1 serotype, AAV.hu37 serotype, AAV.Anc80 serotype, AAV.Anc80L65 serotype, AAV.7m8 serotype, AAV.PhP.eB serotype, AAV.PhP.V1 serotype, AAV.PHP.B serotype, AAV.PhB.C1 serotype, AAV.PhB.C2 serotype, AAV.PhB.C3 serotype, AAV.PhB.C6 serotype, AAV.cy5 serotype, AAV2.5 serotype, AAV2tYF serotype, AAV3B serotype, AAV.LK03 serotype, AAV.HSC1 serotype, AAV.HSC2 serotype, AAV.HSC3 serotype, AAV.HSC4 serotype, AAV.HSC5 serotype, AAV.HSC6 serotype, AAV.HSC7 serotype, AAV.HSC8 serotype, AAV.HSC9 serotype, AAV.HSC10 serotype, AAV.HSC11 serotype, AAV.HSC12 serotype, AAV.HSC13 serotype, AAV.HSC14 serotype, AAV.HSC15 serotype, AAV.HSC16 serotype, AAV.HSC17 serotype, or AAVhu68 serotype, a derivative of any of these serotypes, or any combination thereof.
[0106] In some embodiments, the AAV vector may be a recombinant vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, a single-stranded AAV, or any combination thereof.
[0107] In some embodiments, the AAV vector may be a recombinant AAV (rAAV) vector. Methods of producing recombinant AAV vectors may be known in the art and generally involve, in some cases, introducing into a producer cell line: (1) DNA necessary for AAV replication and synthesis of an AAV capsid, (b) one or more helper constructs comprising the viral functions missing from the AAV vector, (c) a helper virus, and (d) the plasmid construct containing the genome of the AAV vector, e.g., ITRs, promoter and transgene sequences, etc. In some examples, the viral vectors described herein may be engineered through synthetic or other suitable means by references to published sequences, such as those that may be available in the literature. For example, the genomic and protein sequences of various serotypes of AAV, as well as the sequences of the native terminal repeats (TRs), Rep proteins, and capsid subunits may be known in the art and may be found in the literature or in public databases such as GenBank or Protein Data Bank (PDB).
[0108] In some examples, methods of producing delivery vectors herein comprising packaging a polynucleotide of the present disclosure (e.g., a polynucleotide comprising a promoter and a payload) in an AAV vector. In some examples, methods of producing the delivery vectors described herein comprise, (a) introducing into a cell: (i) a polynucleotide comprising a promoter and a payload disclosed herein; and (ii) a viral genome comprising a Replication (Rep) gene and Capsid (Cap) gene that encodes a wild-type AAV capsid protein or modified version thereof; (b) expressing in the cell the wild-type AAV capsid protein or modified version thereof; (c) assembling an AAV particle; and (d) packaging the polynucleotide comprising a promoter and a payload disclosed herein in the AAV particle, thereby generating an AAV delivery vector. In some examples, any polynucleotide comprising a promoter and a payload disclosed herein may be packaged in the AAV vector. In some examples, the recombinant vectors comprise one or more inverted terminal repeats and the inverted terminal repeats comprise a 5 inverted terminal repeat, a 3 inverted terminal repeat, and a mutated inverted terminal repeat. In some examples, the mutated terminal repeat lacks a terminal resolution site, thereby enabling formation of a self-complementary AAV.
[0109] In some examples, a hybrid AAV vector may be produced by transcapsidation, e.g., packaging an inverted terminal repeat (ITR) from a first serotype into a capsid of a second serotype, wherein the first and second serotypes may be not the same. In some examples, the Rep gene and ITR from a first AAV serotype (e.g., AAV2) may be used in a capsid from a second AAV serotype (e.g., AAV5 or AAV9), wherein the first and second AAV serotypes may not be the same. As a non-limiting example, a hybrid AAV serotype comprising the AAV2 ITRs and AAV9 capsid protein may be indicated AAV2/9. In some examples, the hybrid AAV delivery vector comprises an AAV2/1, AAV2/2, AAV 2/4, AAV2/5, AAV2/8, or AAV2/9 vector.
[0110] In some examples, the AAV vector may be a chimeric AAV vector. In some examples, the chimeric AAV vector comprises an exogenous amino acid or an amino acid substitution, or capsid proteins from two or more serotypes. In some examples, a chimeric AAV vector may be genetically engineered to increase transduction efficiency, selectivity, or a combination thereof.
[0111] In some examples, the AAV vector comprises a self-complementary AAV genome. Self-complementary AAV genomes may be generally known in the art and contain both DNA strands which can anneal together to form double-stranded DNA.
[0112] In some examples, the delivery vector may be a retroviral vector. In some examples, the retroviral vector may be a Moloney Murine Leukemia Virus vector, a spleen necrosis virus vector, or a vector derived from the Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, human immunodeficiency virus, myeloproliferative sarcoma virus, or mammary tumor virus, or a combination thereof. In some examples, the retroviral vector may be transfected such that the majority of sequences coding for the structural genes of the virus (e.g., gag, pol, and env) may be deleted and replaced by the gene(s) of interest.
[0113] In some examples, the delivery vehicle may be a non-viral vector. Examples of non-viral vectors may include plasmids, lipid nanoparticles, lipoplexes, polymersomes, polyplexes, dendrimers, nanoparticles, and cell-penetrating peptides. The non-viral vector may comprise a polynucleotide, such as a plasmid, encoding for a promoter (e.g., comprising a cell type- or cell state-specific response element and a switchable core promoter) and a payload sequence. In some examples, the delivery vehicle may be a plasmid. In some examples, the plasmid may be a minicircle plasmid. In some embodiments, a vector may comprise naked DNA (e.g., a naked DNA plasmid). In some embodiments, the non-viral vector comprises DNA. In some embodiments, the non-viral vector comprises RNA. In some examples, the non-viral vector comprises circular double-stranded DNA. In some examples, the non-viral vector may comprise a linear polynucleotide. In some examples, the non-viral vector comprises a polynucleotide encoding one or more genes of interest and one or more regulatory elements. In some examples, the non-viral vector comprises a bacterial backbone containing an origin of replication and an antibiotic resistance gene or other selectable marker for plasmid amplification in bacteria. In some examples, the non-viral vector contains one or more genes that provide a selective marker to induce a target cell to retain a polynucleotide (e.g., a plasmid) of the non-viral vector. In some examples, the non-viral vector may be formulated for delivery through injection by a needle carrying syringe. In some examples, the non-viral vector may be formulated for delivery via electroporation. In some examples, a polynucleotide of the non-viral vector may be engineered through synthetic or other suitable means known in the art. For example, in some cases, the genetic elements may be assembled by restriction digest of the desired genetic sequence from a donor plasmid or organism to produce ends of the DNA which may then be readily ligated to another genetic sequence.
[0114] In some embodiments, the vector containing the polynucleotide is a non-viral vector system. In some embodiments, the non-viral vector system comprises cationic lipids, or polymers. In some embodiments, the polynucleotide or a non-viral vector comprising the polynucleotide is delivered to a cell by hydrodynamic injection or ultrasound.
[0115] In some embodiments, a viral vector may be an engineered for fine-tuned transgene expression utilizing transcriptional control (e.g., using an engineered promoter for cell state specific expression) and translational control (e.g., 5UTR, 3UTR, and coding region of the polynucleotide encoding the transgene), as illustrated in
Methods of Expressing a Payload in a Target Cell
[0116] A polynucleotide (e.g., a recombinant polynucleotide) of the present disclosure may be used in a method of expressing a payload (e.g., a transgene or polynucleotide) in a target cell. A method of expressing a payload in a cell may comprise delivering a polynucleotide encoding the payload to one or more cells, including one or more target cells, and expressing the payload in the target cell. The target cell may be a target cell type (e.g., a neuron, a hepatocyte, a retinal cell, an epithelial cell, a muscle cell, an erythrocyte, a platelet, a bone marrow cell, an endothelial cell, an epidermal cell, a lymphocyte, a glial cell, an interstitial cell, an adipocyte, or a fibroblast). The target cell may comprise a genetic variation of interest. The target cell may express a protein from a genetic variation of interest (e.g., a mutant protein from a gene comprising a mutation associated with a disease). The target cell may comprise a phenotype of interest (e.g., a disease phenotype).
[0117] In some embodiments, the payload is expressed in a cell state-dependent manner. For example, a payload may be transcribed in the target cell type at higher levels than in non-target cell types. In another example, a payload may be transcribed in a cell comprising a genetic variation of interest at higher levels than in cells lacking the genetic variation. In another example, a payload may be transcribed in a cell having a phenotype of interest at higher levels than in cells lacking the phenotype. As described herein, a promoter sequence of the polynucleotide may be engineered for cell state-specific transcription of the encoded payload. For example, the promoter sequence may be engineered to promote increased transcription of the payload in a target cell relative to a non-target cell. In some embodiments, a method of expressing a payload may comprise delivering a polynucleotide to a cell using a vector (e.g., a viral vector), as described herein.
Methods of Treatment
[0118] A polynucleotide (e.g., a recombinant polynucleotide) of the present disclosure may be used in a method of treating a disorder in a subject in need thereof. A disorder may be a disease, a condition, a genotype, a phenotype, or any state associated with an adverse effect. In some embodiments, treating a disorder may comprise preventing, slowing progression of, reversing, or alleviating symptoms of the disorder. A method of treating a disorder may comprise delivering a polynucleotide encoding a payload to a cell of a subject in need thereof and expressing the payload in the cell. In some embodiments, the payload is expressed in a cell state-dependent manner. For example, a payload may be transcribed in a target cell type at higher levels than in non-target cell types. In another example, a payload may be transcribed in a cell comprising a genetic variation of interest at higher levels than in cells lacking the genetic variation. In another example, a payload may be transcribed in a cell expressing a protein from a gene comprising a genetic variation of interest at higher levels than in cells lacking expression of the protein from a gene comprising a genetic variation of interest. In another example, a payload may be transcribed in a cell having a phenotype of interest at higher levels than in cells lacking the phenotype. As described herein, a promoter sequence of the polynucleotide may be engineered for cell state-specific transcription of the encoded payload. In some embodiments, a method of treatment may comprise delivering a polynucleotide to a subject using a vector (e.g., a viral vector), as described herein.
[0119] In some embodiments, a polynucleotide (e.g., a recombinant polynucleotide) of the present disclosure may be used to treat a genetic disorder. For example, a genetic disorder caused by a mutation in or altered expression of a protein may be treated by delivering a polynucleotide encoding a wild type copy of the protein to a cell of the subject and expressing the protein in a target cell state (e.g., a target cell type, a cell having the genetic mutation, a cell expressing a protein from a gene having the genetic mutation, and/or a cell having a phenotype associated with the genetic mutation). The wild type protein encoded by the payload may be expressed in the target cells, thereby treating the genetic disorder. In another example, a genetic disorder caused by a mutation of a gene may be treated by delivering a polynucleotide encoding a gRNA targeting the mutated gene sequence to a cell of a subject comprising the mutated sequence in a target cell state or expressing a protein from the mutated sequence in the target cell state (e.g., a target cell type, a cell having the genetic mutation, a cell expressing a protein from a gene having the genetic mutation, and/or a cell having a phenotype associated with the genetic mutation). The gRNA may be expressed in the target cell and may target the mutated gene for gene editing, thereby treating the genetic disorder. In some embodiments, a polynucleotide of the present disclosure may be used to treat a condition associated with one or more mutations in a subset of cells. For example, a cancer caused by mutations in a subset of cells may be treated by delivering a polynucleotide encoding a pro-apoptotic factor to a cell of a subject and selectively transcribing the pro-apoptotic factor in the cancer cells.
[0120] In some embodiments, a polynucleotide (e.g., a recombinant polynucleotide) of the present disclosure may be used in a method to treat a genetic disorder, a neuronal disorder, cancer, or an eye disorder. Examples of disorders that may be treated using a polynucleotide of the present disclosure are provided in TABLE 6. For example, Rett syndrome may be treated by delivering a polynucleotide encoding a wild type MeCP2 to a subject in need thereof and selectively transcribing the MECP2 gene in neurons expressing a mutant MeCP2 protein and exhibiting the disease phenotype associated with the mutation in MECP2. For example, Rett syndrome may be treated by delivering a polynucleotide encoding a wild type MeCP2 to a subject in need thereof and selectively transcribing the MECP2 gene in neurons expressing a protein from a mutant MECP2 and exhibiting the disease phenotype associated with the mutant MECP2. The transcription level of the MECP2 gene may be tuned to prevent over-expression that may cause seizures. Delivery of the polynucleotide may reduce the symptoms of Rett syndrome in the subject. In another example, frontotemporal dementia may be treated by delivering a polynucleotide encoding a wild type progranulin gene to a subject in need thereof and selectively transcribing the progranulin gene in neurons. Delivery of the polynucleotide may slow progression of or reduce symptoms of frontotemporal dementia.
[0121] In some embodiments, disorders that may be treated by delivering a polynucleotide of the present disclosure to a subject in need thereof include Rett syndrome, MECP2 duplication syndrome, Frontotemporal dementia, neuronal ceroid lipofuscinosis, Retinitis Pigmentosa 7, macular degeneration, Retinitis Pigmentosa 4, Angelman Syndrome, DYRK1A haploinsufficiency, MEF2C haploinsufficiency syndrome, Sotos syndrome, Reverse Sotos syndrome, Alpha-thalassemia X-linked intellectual disability syndrome, Xp22.12 duplication, Coffin-Lowry syndrome, Pitt Hopkins syndrome, Mowat-Wilson Syndrome, FOXG1 syndrome, CDKL5 deficiency disorder, West Syndrome, 2q23.1 microdeletion syndrome, Doose Syndrome, SLC6A1 epileptic encephalopathy, Duchenne's muscular dystrophy, Becker muscular dystrophy, Alpha-1 antitrypsin deficiency (AATD), Macular Degeneration/Stargardt disease, Cystic Fibrosis, Tay-Sachs, Charcot-Marie-Tooth neuropathy, Wilson's disease, Hereditary Hemochromatosis, Wolman disease, cholesteryl ester storage disease, Psueodhypoaldosteronism type 1, Achromatopsia, Adrenomyeloneuropathy, Barth Syndrome, Batten Disease, Canavan Disease; PKDJ or PDK2 associated with Autosomal Dominant Polycistic Kidney Disease, Congenital Adrenal Hyperplasia, Congenital Disorder of Glycosylation 1a, Danon Disease, Fabry Disease, Gaucher Disease, GM1 Gangliosidosis, Glycogen SD 1a, Hemophilia, Hereditary Angioedema, Krabbe Disease, Leber's Disease, Myotubular Myopathy, Mucopolysaccharidosis, Ornithine Transcarbamylase Deficiency, Pompe Disease, Sandhoff Disease, Spinal Muscular Atrophy, Tay-Sachs, Usher Syndrome, ALS, Beta-thalassemia or Sickle Cell disease, Bestrophinopathy, Choroideremia, Freidreich's Ataxia, GSD1b, Osteoporosis, Alpha-1 Antitrypsin Deficiency, Heart Failure, Parkinson's Disease, Brain Anomalies, Retardation, Ectodermal Dysplasia, Skeletal Malformations, Hirschsprung Disease, Ear-Eye Anomalies, Cleft Palate-Cryptorchidissm, And Kidney Dysplasia-Hypoplasia, Chronic kidney disease/disorder with a monogenetic origin, Clear cell sarcoma of kidney, Collecting Duct Carcinoma of the Kidney, Congenital absence of kidneys syndrome, Cystic kidney, Kidney Calculi, Kidney Failure, Kidney Neoplasm, Malignant neoplasm of kidney, Polycystic Kidney Disease, Potter Type I, with Microbrachycephaly, Hypertelorism, and Brachymelia, Polycystic Kidney, Autosomal Dominant, Sex Reversal, Female, With Dysgenesis Of Kidneys, Adrenals, And Lungs, Unilateral agenesis of kidney, or Unilateral Multicystic Dysplastic Kidney.
Pharmaceutical Compositions
[0122] The compositions described herein (e.g., compositions comprising a polynucleotide, such as a recombinant polynucleotide) may be formulated with a pharmaceutically acceptable carrier for administration to a subject (e.g., a human or a non-human animal). A pharmaceutically acceptable carrier may include, but is not limited to, phosphate buffered saline solution, water, emulsions (e.g., an oil/water emulsion or a water/oil emulsions), glycerol, liquid polyethylene glycols, aprotic solvents such (e.g., dimethylsulfoxide, N-methylpyrrolidone, or mixtures thereof), and various types of wetting agents, solubilizing agents, anti-oxidants, bulking agents, protein carriers such as albumins, any and all solvents, dispersion media, coatings, sodium lauryl sulfate, isotonic and absorption delaying agents, disintegrants (e.g., potato starch or sodium starch glycolate), and the like. The compositions also can include stabilizers and preservatives. Additional examples of carriers, stabilizers, and adjuvants consistent with the compositions of the present disclosure may be found in, for example, Remington's Pharmaceutical Sciences, 21st Ed., Mack Publ. Co., Easton, Pa. (2005), incorporated herein by reference in its entirety.
[0123] Pharmaceutical compositions for oral administration can be in tablet, capsule, powder, or liquid form. A tablet can include a solid carrier such as gelatin or an adjuvant. Liquid pharmaceutical compositions generally include a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil, or synthetic oil. Physiological saline solution, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol can be included.
[0124] For intravenous, cutaneous, or subcutaneous injection, or injection at the site of affliction, the active ingredient will be in the form of a parenterally acceptable aqueous solution which is pyrogen-free and has suitable pH, isotonicity and stability. Those of relevant skill in the art are well able to prepare suitable solutions using, for example, isotonic vehicles such as Sodium Chloride Injection, Ringer's Injection, Lactated Ringer's Injection. Preservatives, stabilizers, buffers, antioxidants and/or other additives can be included, as required.
[0125] In some embodiments, the polynucleotide (e.g., a recombinant polynucleotide) of the present disclosure or recombinant polynucleotide cassette of the present disclosure may be administered to cells via a lipid nanoparticle. In some embodiments, the lipid nanoparticle may be administered at the appropriate concentration according to standard methods appropriate for the target cells.
[0126] In some embodiments, the polynucleotide (e.g., a recombinant polynucleotide) of the present disclosure or recombinant polynucleotide cassette of the present disclosure may be administered to cells via a viral vector. In some embodiments, the viral vector may be administered at the appropriate multiplicity of infection according to standard transduction methods appropriate for the target cells. Titers of the virus vector or capsid to administer can vary depending on the target cell type or cell state and number and can be determined by those of skill in the art. In some embodiments, at least about 10.sup.2 infections units are administered. In some embodiments, at least about 10.sup.3, 10.sup.4, 10.sup.5, 10.sup.6, 10.sup.7, 10.sup.8, 10.sup.9, 10.sup.10, 10.sup.11, 10.sup.12, or 10.sup.13 infectious units are administered.
[0127] In some embodiments, the polynucleotide (e.g., a recombinant polynucleotide) or recombinant polynucleotide cassette is introduced to cells of any type or state, including, but not limited to neural cells, cells of the eye (including retinal cells, retinal pigment epithelium, and corneal cells), lung cells, epithelial cells, skeletal muscle cells, dendritic cells, hepatic cells, pancreatic cells, bone cells, hematopoietic stem cells, spleen cells, keratinocytes, fibroblasts, endothelial cells, prostate cells, and heart cells.
[0128] In some embodiments, the polynucleotide (e.g., a recombinant polynucleotide) of the disclosure or the recombinant polynucleotide cassette of the disclosure may be introduced to cells in vitro via a viral vector for administration of modified cells to a subject. In some embodiments, a viral vector encoding the polynucleotide of the disclosure or the recombinant polynucleotide cassette of the disclosure is introduced to cells that have been removed from a subject. In some embodiments, the modified cells are placed back in the subject following introduction of the viral vector.
[0129] In some embodiments, a dose of modified cells is administered to a subject according to the age and species of the subject, disease or disorder to be treated, as well as the cell type or state and mode of administration. In some embodiments, at least about 10.sup.2-10.sup.8 cells are administered per dose. In some embodiments, cells transduced with viral vector are administered to a subject in an effective amount.
[0130] In some embodiments, the dose of viral vector administered to a subject will vary according to the age of the subject, the disease or disorder to be treated, and mode of administration. In some embodiments, the dose for achieving a therapeutic effect is a virus titer of at least about 10.sup.2, 10.sup.3, 10.sup.4, 10.sup.5, 10.sup.6, 10.sup.7, 10.sup.8, 10.sup.9, 10.sup.10, 10.sup.11, 10.sup.12, 10.sup.13, 10.sup.14, 10.sup.15, 10.sup.16 or more transducing units.
[0131] Administration of the pharmaceutically useful polynucleotide of the present disclosure or the polynucleotide cassette of the present disclosure is preferably in a therapeutically effective amount or prophylactically effective amount (as the case can be, although prophylaxis can be considered therapy), this being sufficient to show benefit to the individual. The actual amount administered, and rate and time-course of administration, will depend on the nature and severity of protein aggregation disease being treated. Prescription of treatment, e.g., decisions on dosage etc., is within the responsibility of general practitioners and other medical doctors, and typically takes account of the disorder to be treated, the condition of the individual patient, the site of delivery, the method of administration and other factors known to practitioners. Examples of the techniques and protocols mentioned above can be found in Remington's Pharmaceutical Sciences, 16th edition, Osol, A. (ed), 1980.
[0132] A composition can be administered alone or in combination with other treatments, either simultaneously or sequentially dependent upon the condition to be treated.
[0133] As used herein, the singular forms a, an and the include plural referents unless the context clearly dictates otherwise.
[0134] As used herein, the terms about and approximately, in reference to a number, is used herein to include numbers that fall within a range of 10%, 5%, or 1% in either direction (greater than or less than) the number unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
[0135] As used herein, the term percent identity, in the context of two or more nucleic acid or polypeptide sequences, may refer to two or more sequences or subsequences that have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to persons of skill) or by visual inspection. Depending on the application, the percent identity can exist over a region of the sequence being compared, e.g., over a functional domain, or, alternatively, exist over the full length of the two sequences to be compared.
[0136] For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
[0137] For purposes herein, percent identity and sequence similarity may be performed using the BLAST algorithm, which is described in Altschul et al. (J. Mol. Biol. 215:403-410 (1990)). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information.
[0138] As used herein, the term subject broadly refers to any animal, including but not limited to, human and non-human animals (e.g., dogs, cats, cows, horses, sheep, pigs, poultry, fish, crustaceans, etc.).
[0139] As used herein, the term effective amount refers to the amount of a composition (e.g., a synthetic peptide) sufficient to effect beneficial or desired results. An effective amount can be administered in one or more administrations, applications or dosages and is not intended to be limited to a particular formulation or administration route.
[0140] As used herein, the term therapeutically effective amount is an amount that is effective to ameliorate a symptom of a disease. A therapeutically effective amount can be a prophylactically effective amount as prophylaxis can be considered therapy.
[0141] As used herein, the terms administration and administering refer to the act of giving a drug, prodrug, or other agent, or therapeutic treatment (e.g., peptide) to a subject or in vivo, in vitro, or ex vivo cells, tissues, and organs. Exemplary routes of administration to the human body can be through space under the arachnoid membrane of the brain or spinal cord (intrathecal), the eyes (ophthalmic), mouth (oral), skin (topical or transdermal), nose (nasal), lungs (inhalant), oral mucosa (buccal or lingual), ear, rectal, vaginal, by injection (e.g., intravenously, subcutaneously, intratumorally, intraperitoneally, etc.) and the like.
[0142] As used herein, the term treatment means an approach to obtaining a beneficial or intended clinical result. The beneficial or intended clinical result can include alleviation of symptoms, a reduction in the severity of the disease, inhibiting an underlying cause of a disease or condition, steadying diseases in a non-advanced state, delaying the progress of a disease, and/or improvement or alleviation of disease conditions.
[0143] As used herein, the term pharmaceutical composition refers to the combination of an active ingredient with a carrier, inert or active, making the composition especially suitable for therapeutic or diagnostic use in vitro, in vivo or ex vivo.
[0144] The terms pharmaceutically acceptable or pharmacologically acceptable, as used herein, refer to compositions that do not substantially produce adverse reactions, e.g., toxic, allergic, or immunological reactions, when administered to a subject.
[0145] As used herein, the term pharmaceutically acceptable carrier refers to any of the standard pharmaceutical carriers including, but not limited to, phosphate buffered saline solution, water, emulsions (e.g., such as an oil/water or water/oil emulsions), glycerol, liquid polyethylene glycols, aprotic solvents such as dimethylsulfoxide, N-methylpyrrolidone and mixtures thereof, and various types of wetting agents, solubilizing agents, anti-oxidants, bulking agents, protein carriers such as albumins, any and all solvents, dispersion media, coatings, sodium lauryl sulfate, isotonic and absorption delaying agents, disintegrants (e.g., potato starch or sodium starch glycolate), and the like. The compositions also can include stabilizers and preservatives. For examples of carriers, stabilizers and adjuvants, see, e.g., Martin, Remington's Pharmaceutical Sciences, 21th Ed., Mack Publ. Co., Easton, Pa. (2005), incorporated herein by reference in its entirety.
[0146] As used herein, the term therapeutic polynucleotide may refer to a polynucleotide that is introduced into a cell and is capable of being expressed in the cell or to a polynucleotide that may, in itself, have a therapeutic activity, such as a gRNA or a tRNA.
[0147] As used herein, the term polynucleotide may refer to a single or double-stranded polymer of deoxyribonucleotide (DNA) or ribonucleotide (RNA) bases read from the 5 to the 3 end. The term RNA is inclusive of dsRNA (double stranded RNA), snRNA (small nuclear RNA), lncRNA (long non-coding RNA), mRNA (messenger RNA), miRNA (microRNA) RNAi (inhibitory RNA), siRNA (small interfering RNA), shRNA (short hairpin RNA), tRNA (transfer RNA), rRNA (ribosomal RNA), snoRNA (small nucleolar RNA), and cRNA (complementary RNA). The term DNA is inclusive of cDNA, genomic DNA, and DNA-RNA hybrids.
NUMBERED EMBODIMENTS
First Set of Numbered Embodiments
[0148] The following embodiments recite non-limiting permutations of combinations of features disclosed herein. Other permutations of combinations of features are also contemplated. In particular, each of these numbered embodiments is contemplated as depending from or relating to every previous or subsequent numbered embodiment, independent of their order as listed. 1. A recombinant polynucleotide comprising a promoter and a payload, wherein the promoter comprises: a transcription factor binding polynucleotide capable of binding to a transcription factor, and a core promoter capable of binding to or recruiting a polymerase; wherein the payload comprises a coding sequence encoding a protein. 2. The recombinant polynucleotide of embodiment 1, wherein the transcription factor is selected from ESRRG, RORB, NFIC, NFIA, NEUROD2, TBR1, or ZNF436. 3. The recombinant polynucleotide of embodiment 1 or embodiment 2, wherein the transcription factor is any one of the transcription factors provided in TABLE 1. 4. The recombinant polynucleotide of any one of embodiments 1-3, wherein the transcription factor binding polynucleotide comprises a first transcription factor binding motif capable of binding the transcription factor. 5. The recombinant polynucleotide of embodiment 4, wherein the first transcription factor binding motif is a consensus transcription factor binding motif 6. The recombinant polynucleotide of embodiment 4, wherein the first transcription factor binding motif is a variant transcription factor binding motif. 7. The recombinant polynucleotide of any one of embodiments 4-6, further comprising a second transcription factor binding motif capable of binding a second transcription factor. S. The recombinant polynucleotide of embodiment 7, wherein the second transcription factor binding motif is the same as the first transcription factor binding motif. 9. The recombinant polynucleotide of embodiment 7, wherein the second transcription factor binding motif is different than the first transcription factor binding motif. 10. The recombinant polynucleotide of any one of embodiments 4-9, wherein the transcription factor binding polynucleotide further comprises a third transcription factor binding motif capable of binding a third transcription factor. 11. The recombinant polynucleotide of any one of embodiments 1-10, wherein the transcription factor binding polynucleotide comprises 1, 2, 3, 4, 5, or 6 transcription factor binding motifs. 12. The recombinant polynucleotide of any one of embodiments 1-11, wherein the transcription factor binding polynucleotide is capable of binding 1, 2, 3, 4, 5, or 6 transcription factors. 13. The recombinant polynucleotide of any one of embodiments 1-12, wherein the core promoter comprises a TATA box, an RNA polymerase binding sequence, a B recognition element, a CCAAT box, a Pribnow box, or a sequence provided in TABLE 2. 14. The recombinant polynucleotide of any one of embodiments 1-13, wherein the polymerase is an RNA polymerase II. 15. The recombinant polynucleotide of any one of embodiments 1-14, wherein the coding sequence is capable of being transcribed by the polymerase upon binding of the transcription factor to the transcription factor binding polynucleotide and binding or recruitment of the polymerase to the core promoter. 16. The recombinant polynucleotide of any one of embodiments 1-15, wherein the protein is a neuronal protein, a retinal protein, a muscle protein, or an apoptosis-inducing protein. 17. The recombinant polynucleotide of any one of embodiments 1-16, wherein the protein is associated with a genetic disorder, a neuronal disorder, an eye disorder, a muscular disorder, or a cancer. 18. The recombinant polynucleotide of any one of embodiments 1-17, wherein the protein is MeCP2, progranulin, dystrophin, or peripherin 2. 19. The recombinant polynucleotide of any one of embodiments 1-18, wherein the protein is encoded by any one of the genes provided in TABLE 3. 20. The recombinant polynucleotide of any one of embodiments 1-19, wherein the promoter is engineered to control a transcription level of the payload. 21. The recombinant polynucleotide of embodiment 20, wherein the transcription level is cell state specific. 22. The recombinant polynucleotide of embodiment 21, wherein the cell state is a cell type, a cell genotype, a cell phenotype, or any combination thereof. 23. An engineered viral vector comprising the recombinant polynucleotide of any one of embodiments 1-22 in a viral vector. 24. The engineered viral vector of embodiment 23, wherein the viral vector is an adenoviral vector, an adeno-associated viral vector, or a lentivector. 25. The engineered viral vector of embodiment 24, wherein the adeno-associated viral vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, AAV13, AAV 14, AAV 15, AAV 16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16 and AAVhu68. 26. The engineered viral vector of any one of embodiments 23-25, wherein a viral capsid of the viral vector is from a first viral vector and a viral inverted terminal repeat sequence of the viral vector is from a second viral vector. 27. The engineered viral vector of embodiment 26, wherein the first viral vector, the second viral vector, or both is an adeno-associated viral vector. 28. The engineered viral vector of embodiment 26 or embodiment 27, wherein the first viral vector, the second viral vector, or both is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, AAV13, AAV 14, AAV 15, AAV 16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, and AAVhu68. 29. A pharmaceutical composition comprising the recombinant polynucleotide of any one of embodiments 1-22 or the viral vector of any one of embodiments 23-28 and a pharmaceutically acceptable carrier. 30. A method of treating a disorder in a subject in need thereof, the method comprising: administering to the subject a composition comprising the recombinant polynucleotide of any one of embodiments 1-22, the viral vector of any one of embodiments 23-28, or the pharmaceutical composition of embodiment 29; and expressing the protein encoded by the recombinant polynucleotide in a target cell of the subject, thereby treating the disorder. 31. The method of embodiment 30, wherein the coding sequence is transcribed upon binding of the transcription factor to the transcription factor binding site and recruitment of the polymerase to the core promoter. 32. The method of embodiment 30 or embodiment 31, wherein a level of transcription of the coding sequence is higher in the target cell than in a non-target cell of the subject. 33. The method of embodiment 32, wherein the transcription factor is present at a higher level in the target cell than in the non-target cell. 34. The method of embodiment 32 or embodiment 33, wherein the non-target cell is a healthy cell. 35. The method of any one of embodiments 30-34, wherein the target cell is a neuron, a retinal cell, a hepatocyte, an epithelial cell, a muscle cell, an erythrocyte, a platelet, a bone marrow cell, an endothelial cell, an epidermal cell, a lymphocyte, a glial cell, an interstitial cell, an adipocyte, or a fibroblast. 36. The method of any one of embodiments 30-35, wherein the target cell is a diseased cell. 37. The method of embodiment 36, wherein the diseased cell comprises a genetic mutation associated with the disorder and has a disease phenotype associated with the genetic mutation. 38. The method of embodiment 36 or embodiment 37, wherein the diseased cell comprises a mutation in MECP2, GRN, PRPH2, or DMX. 39. The method of any one of embodiments 36-38, wherein the diseased cell comprises a mutation in any one of the genes provided in TABLE 3. 40. The method of embodiment 36 or embodiment 37, wherein the diseased cell is a cancer cell. 41. The method of any one of embodiments 30-40, wherein the disorder is a genetic disorder, a neuronal disorder, an eye disorder, a muscular disorder, or a cancer. 42. The method of embodiment 41, wherein the neuronal disorder is Rett syndrome or frontotemporal dementia. 43. The method of any one of embodiments 30-42, wherein the disorder is any one of the disorders provided in TABLE 3. 44. A method of expressing a protein in a target cell, the method comprising: administering to the subject a composition comprising the recombinant polynucleotide of any one of embodiments 1-22, the viral vector of any one of embodiments 23-28, or the pharmaceutical composition of embodiment 29; transcribing the coding sequence in the target cell; and expressing the protein encoded by the coding sequence in the target cell. 45. The method of embodiment 44, wherein the coding sequence is transcribed upon binding of the transcription factor to the transcription factor binding site and recruitment of the polymerase to the core promoter. 46. The method of embodiment 44 or embodiment 45, wherein a level of transcription of the coding sequence is higher in the target cell than in a non-target cell. 47. The method of embodiment 46, wherein a level of expression of the protein is higher in the target cell than in the non-target cell. 48. The method of embodiment 46 or embodiment 47, wherein the transcription factor is present at a higher level in the target cell than in the non-target cell. 49. The method of any one of embodiments 44-48, wherein the target cell is a neuron, a retinal cell, a hepatocyte, an epithelial cell, a muscle cell, an erythrocyte, a platelet, a bone marrow cell, an endothelial cell, an epidermal cell, a lymphocyte, a glial cell, an interstitial cell, an adipocyte, or a fibroblast.
Second Set of Numbered Embodiments
[0149] The following embodiments recite non-limiting permutations of combinations of features disclosed herein. Other permutations of combinations of features are also contemplated. In particular, each of these numbered embodiments is contemplated as depending from or relating to every previous or subsequent numbered embodiment, independent of their order as listed. 1. A recombinant transcription factor binding polynucleotide comprising a sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to any one of SEQ ID NO: 26-SEQ ID NO: 41. 2. The recombinant transcription factor binding polynucleotide of embodiment 1 comprising the sequence of any one of SEQ ID NO: 26-SEQ ID NO: 41. 3. The recombinant transcription factor binding polynucleotide of embodiment 1 or embodiment 2, wherein the recombinant transcription factor binding polynucleotide is capable of binding to a transcription factor. 4. The recombinant transcription factor binding polynucleotide of embodiment 3, wherein the transcription factor is expressed more highly in a target cell than in a non-target cell. 5. The recombinant transcription factor binding polynucleotide of embodiment 4, wherein the target cell is a mutant cell having a disease phenotype associated with a genetic mutation in a gene, and wherein the non-target cell is a wild type cell having a wild type phenotype associated with a wild type allele in the gene. 6. The recombinant transcription factor binding polynucleotide of embodiment 5, wherein the mutant cell expresses a mutant MeCP2 protein, and wherein the wild type cell expresses a wild type MeCP2 protein. 7. The recombinant transcription factor binding polynucleotide of embodiment 5 or embodiment 6, wherein the target cell expresses a mutant MeCP2 protein, and wherein the non-target cell expresses a wild type MeCP2 protein. 8. A recombinant polynucleotide comprising a promoter and a payload, wherein the promoter comprises: a transcription factor binding polynucleotide capable of binding to a transcription factor, wherein the transcription factor binding polynucleotide comprises the recombinant transcription factor binding polynucleotide of any one of embodiments 1-6, and a core promoter capable of recruiting a polymerase; wherein the payload comprises a coding sequence. 9. The recombinant polynucleotide of embodiment 8, wherein the promoter comprises a sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to any one of SEQ ID NO: 113-SEQ ID NO: 140. 10. The recombinant polynucleotide of embodiment 8 or embodiment 9, wherein the promoter comprises a sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to SEQ ID NO: 115. 11. The recombinant polynucleotide of any one of embodiments 8-10, wherein the promoter comprises a sequence of any one of SEQ ID NO: 113-SEQ ID NO: 140. 12. The recombinant polynucleotide of any one of embodiments 8-11, wherein the promoter comprises a sequence of SEQ ID NO: 115. 13. A recombinant polynucleotide comprising a promoter and a payload, wherein the promoter comprises: a transcription factor binding polynucleotide capable of binding to a transcription factor, wherein the transcription factor binding polynucleotide comprises at least three transcription factor binding motifs, and a core promoter capable of recruiting a polymerase; wherein the payload comprises a coding sequence. 14. The recombinant polynucleotide of embodiment 13, wherein the transcription factor is selected from ESRRG, RORB, NFIC, NFIA, NEUROD2, TBR1, or ZNF436. 15. The recombinant polynucleotide of embodiment 13 or embodiment 14, wherein the transcription factor is a transcription factor provided in TABLE 1. 16. The recombinant polynucleotide of any one of embodiments 13-15, wherein the at least three transcription factor binding motifs comprise a first transcription factor binding motif capable of binding the transcription factor. 17. The recombinant polynucleotide of embodiment 16, wherein the first transcription factor binding motif is a consensus transcription factor binding motif. 18. The recombinant polynucleotide of embodiment 16, wherein the first transcription factor binding motif is a variant transcription factor binding motif. 19. The recombinant polynucleotide of any one of embodiments 16-18, wherein the first transcription factor binding motif has at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to a transcription factor binding motif provided in TABLE 2. 20. The recombinant polynucleotide of any one of embodiments 16-19, wherein the first transcription factor binding motif is selected from a transcription factor binding motif provided in TABLE 2. 21. The recombinant polynucleotide of any one of embodiments 16-20, wherein the at least three transcription factor binding motifs comprise a second transcription factor binding motif capable of binding a second transcription factor. 22. The recombinant polynucleotide of embodiment 21, wherein the second transcription factor binding motif is the same as the first transcription factor binding motif. 23. The recombinant polynucleotide of embodiment 21, wherein the second transcription factor binding motif is different than the first transcription factor binding motif. 24. The recombinant polynucleotide of any one of embodiments 21-23, wherein the second transcription factor binding motif has at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to a transcription factor binding motif provided in TABLE 2. 25. The recombinant polynucleotide of any one of embodiments 21-24, wherein the second transcription factor binding motif is selected from a transcription factor binding motif provided in TABLE 2. 26. The recombinant polynucleotide of any one of embodiments 16-25, wherein the at least three transcription factor binding motifs comprise a third transcription factor binding motif capable of binding a third transcription factor. 27. The recombinant polynucleotide of embodiment 26, wherein the third transcription factor binding motif is the same as the first transcription factor binding motif, the second transcription factor binding motif, or both. 28. The recombinant polynucleotide of embodiment 26, wherein the third transcription factor binding motif is different than the first transcription factor binding motif, the second transcription factor binding motif, or both. 29. The recombinant polynucleotide of any one of embodiments 26-28, wherein the third transcription factor binding motif has at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to a transcription factor binding motif provided in TABLE 2. 30. The recombinant polynucleotide of any one of embodiments 26-29, wherein the third transcription factor binding motif is selected from a transcription factor binding motif provided in TABLE 2. 31. The recombinant polynucleotide of any one of embodiments 13-30, wherein the transcription factor binding polynucleotide comprises 3, 4, 5, or 6 transcription factor binding motifs. 32. The recombinant polynucleotide of any one of embodiments 13-31, wherein the transcription factor binding polynucleotide is capable of binding 1, 2, 3, 4, 5, or 6 transcription factors. 33. The recombinant polynucleotide of any one of embodiments 13-32, wherein the transcription factor binding polynucleotide comprises at least four transcription factor binding motifs. 34. The recombinant polynucleotide of embodiment 33, wherein the at least four transcription factor binding motifs comprise a first transcription factor binding motif, a second transcription factor binding motif, a third transcription factor binding motif, and a fourth transcription factor binding motif. 35. The recombinant polynucleotide of embodiment 34, wherein the first transcription factor binding motif is the same as the third transcription factor binding motif 36. The recombinant polynucleotide of embodiment 34 or embodiment 35, wherein the second transcription factor binding motif is the same as the fourth transcription factor binding motif. 37. The recombinant polynucleotide of any one of embodiments 34-36, wherein the first transcription factor binding motif, the second transcription factor binding motif, the third transcription factor binding motif, and the fourth transcription factor binding motif are the same. 38. The recombinant polynucleotide of any one of embodiments 13-37, wherein the transcription factor binding polynucleotide has at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to a transcription factor binding sequence provided in TABLE 3. 39. The recombinant polynucleotide of any one of embodiments 13-38, wherein the transcription factor binding polynucleotide is selected from a transcription factor binding sequence provided in TABLE 3. 40. The recombinant polynucleotide of any one of embodiments 8-39, wherein the core promoter comprises a TATA box, an initiator sequence, an RNA polymerase binding sequence, a B recognition element, a CCAAT box, a Pribnow box, a sequence provided in TABLE 4, or combinations thereof. 41. The recombinant polynucleotide of any one of embodiments 8-40, wherein the polymerase is an RNA polymerase II. 42. The recombinant polynucleotide of any one of embodiments 8-41, wherein the promoter has at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to a promoter sequence provided in TABLE 5. 43. The recombinant polynucleotide of any one of embodiments 8-42, wherein the promoter is selected from a promoter sequence provided in TABLE 5. 44. The recombinant polynucleotide of any one of embodiments 8-43, wherein the coding sequence is capable of being transcribed by the polymerase upon binding of the transcription factor to the transcription factor binding polynucleotide and recruitment of the polymerase to the core promoter. 45. The recombinant polynucleotide of any one of embodiments 8-44, wherein the coding sequence encodes a protein. 46. The recombinant polynucleotide of embodiment 45, wherein the protein is a neuronal protein, a retinal protein, a muscle protein, or an apoptosis-inducing protein. 47. The recombinant polynucleotide of embodiment 45 or embodiment 46, wherein the protein is associated with a genetic disorder, a neuronal disorder, an eye disorder, a muscular disorder, or a cancer. 48. The recombinant polynucleotide of any one of embodiments 45-47, wherein the protein is MeCP2, progranulin, dystrophin, or peripherin 2. 49. The recombinant polynucleotide of any one of embodiments 45-48, wherein the protein is encoded by any one of the genes provided in TABLE 6. 50. The recombinant polynucleotide of any one of embodiments 8-44, wherein the coding sequence encodes a therapeutic polynucleotide. 51. The recombinant polynucleotide of embodiment 50, wherein the therapeutic polynucleotide is a gRNA or a tRNA. 52. The recombinant polynucleotide of embodiment 50 or embodiment 51, wherein the therapeutic polynucleotide targets a gene associated with a genetic disorder, a neuronal disorder, an eye disorder, a muscular disorder, or a cancer. 53. The recombinant polynucleotide of any one of embodiments 50-52, wherein the therapeutic polynucleotide targets a gene provided in TABLE 6. 54. The recombinant polynucleotide of any one of embodiments 8-53, wherein the promoter is engineered to control a transcription level of the payload. 55. The recombinant polynucleotide of embodiment 54, wherein the transcription level is cell state-specific. 56. The recombinant polynucleotide of embodiment 54 or embodiment 55, wherein the transcription level is cell type-specific. 57. The recombinant polynucleotide of any one of embodiments 54-56, wherein the transcription level is cell genotype-specific. 58. The recombinant polynucleotide of any one of embodiments 54-57, wherein a transcriptional level in a target cell is at least 1-fold, at least 1.1-fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, or at least 4-fold a transcriptional level in a non-target cell. 59. An engineered viral vector comprising the recombinant polynucleotide of any one of embodiments 8-58 in a viral vector. 60. The engineered viral vector of embodiment 59, wherein the viral vector is an adenoviral vector, an adeno-associated viral vector, or a lentivector. 61. The engineered viral vector of embodiment 60, wherein the adeno-associated viral vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ/8, AAV-DJ/9, AAV1/2, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh43, AAV.Rh74, AAV.v66, AAV.Oligo001, AAV.SCH9, AAV.r3.45, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PhP.eB, AAV.PhP.V1, AAV.PHP.B, AAV.PhB.C1, AAV.PhB.C2, AAV.PhB.C3, AAV.PhB.C6, AAV.cy5, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17, and AAVhu68. 62. The engineered viral vector of any one of embodiments 59-61, wherein a viral capsid of the viral vector is from a first viral vector and a viral inverted terminal repeat sequence of the viral vector is from a second viral vector. 63. The engineered viral vector of embodiment 62, wherein the first viral vector, the second viral vector, or both is an adeno-associated viral vector. 64. The engineered viral vector of embodiment 62 or embodiment 63, wherein the first viral vector, the second viral vector, or both is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ/8, AAV-DJ/9, AAV1/2, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh43, AAV.Rh74, AAV.v66, AAV.Oligo001, AAV.SCH9, AAV.r3.45, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PhP.eB, AAV.PhP.V1, AAV.PHP.B, AAV.PhB.C1, AAV.PhB.C2, AAV.PhB.C3, AAV.PhB.C6, AAV.cy5, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17, and AAVhu68. 65. A pharmaceutical composition comprising the recombinant polynucleotide of any one of embodiments 16-57, or the viral vector of any one of embodiments 59-64 and a pharmaceutically acceptable carrier. 66. A method of treating a disorder in a subject in need thereof, the method comprising administering to the subject a composition comprising the recombinant polynucleotide of any one of embodiments 16-58, the viral vector of any one of embodiments 59-64, or the pharmaceutical composition of embodiment 65, thereby treating the disorder. 67. The method of embodiment 66, wherein the coding sequence is transcribed upon binding of the transcription factor to the transcription factor binding site and recruitment of the polymerase to the core promoter. 68. The method of embodiment 66 or embodiment 67, wherein a level of transcription of the coding sequence is higher in the target cell than in a non-target cell of the subject. 69. The method of embodiment 68, wherein the target cell is a diseased cell having a disease phenotype associated with expression of a mutant MeCP2 protein, and the non-target cell is a healthy cell having a wild type phenotype associated with expression of a wild type MeCP2 protein. 70. The method of embodiment 68 or embodiment 69, wherein the transcription factor is present at a higher level in the target cell than in the non-target cell. 71. The method of embodiment 70, wherein the transcription factor is more active in the target cell than in the non-target cell. 72. The method of any one of embodiments 68-71, wherein the non-target cell is a healthy cell. 73. The method of any one of embodiments 66-72, wherein the target cell is a neuron, a retinal cell, a hepatocyte, an epithelial cell, a muscle cell, an erythrocyte, a platelet, a bone marrow cell, an endothelial cell, an epidermal cell, a lymphocyte, a glial cell, an interstitial cell, an adipocyte, or a fibroblast. 74. The method of any one of embodiments 66-73, wherein the target cell is a diseased cell. 75. The method of embodiment 74, wherein the diseased cell comprises a genetic mutation associated with the disorder and has a disease phenotype associated with the genetic mutation. 76. The method of embodiment 74 or embodiment 75, wherein the diseased cell comprises a mutation in MECP2, GRN, PRPH2, or DMX. 77. The method of any one of embodiments 74-76, wherein the diseased cell comprises a mutation in any one of the genes provided in TABLE 6. 78. The method of embodiment 74 or embodiment 75, wherein the diseased cell is a cancer cell. 79. The method of any one of embodiments 66-78, wherein the disorder is a genetic disorder, a neuronal disorder, an eye disorder, a muscular disorder, or a cancer. 80. The method of embodiment 79, wherein the neuronal disorder is Rett syndrome or frontotemporal dementia. 81. The method of any one of embodiments 66-80, wherein the disorder is any one of the disorders provided in TABLE 6. 82. The method of any one of embodiments 66-81, further comprising expressing a protein encoded by the coding sequence in the target cell. 83. The method of embodiment 82, wherein the protein is a neuronal protein, a retinal protein, a muscle protein, or an apoptosis-inducing protein. 84. The method of embodiment 82 or embodiment 83, wherein the protein is associated with a genetic disorder, a neuronal disorder, an eye disorder, a muscular disorder, or a cancer. 85. The method of any one of embodiments 82-84, wherein the protein is MeCP2, progranulin, dystrophin, or peripherin 2. 86. The method of any one of embodiments 82-85, wherein the protein is encoded by any one of the genes provided in TABLE 6. 87. The method of any one of embodiments 66-81, further comprising expressing a therapeutic polynucleotide encoded by the coding sequence in the target cell. 88. The method of embodiment 87, wherein the therapeutic polynucleotide is a gRNA or a tRNA. 89. The method of embodiment 87 or embodiment 88, wherein the therapeutic polynucleotide targets a gene associated with a genetic disorder, a neuronal disorder, an eye disorder, a muscular disorder, or a cancer. 90. The method of any one of embodiments 87-89, wherein the therapeutic polynucleotide targets a gene provided in TABLE 6. 91. A method of expressing a coding sequence in a target cell, the method comprising administering to the subject a composition comprising the recombinant polynucleotide of any one of embodiments 16-58, the viral vector of any one of embodiments 59-64, or the pharmaceutical composition of embodiment 65, thereby expressing the coding sequence in the target cell. 92. The method of embodiment 91, wherein the coding sequence is transcribed upon binding of the transcription factor to the transcription factor binding site and recruitment of the polymerase to the core promoter. 93. The method of embodiment 92, wherein the transcription factor is present at a higher level in the target cell than in the non-target cell. 94. The method of embodiment 93, wherein the target cell is a diseased cell having a disease phenotype associated with expression of a mutant MeCP2 protein, and the non-target cell is a healthy cell having a wild type phenotype associated with expression of a wild type MeCP2 protein. 95. The method of any one of embodiments 91-94, wherein the target cell is a neuron, a retinal cell, a hepatocyte, an epithelial cell, a muscle cell, an erythrocyte, a platelet, a bone marrow cell, an endothelial cell, an epidermal cell, a lymphocyte, a glial cell, an interstitial cell, an adipocyte, or a fibroblast. 96. The method of any one of embodiments 91-95, wherein a level of transcription of the coding sequence is higher in the target cell than in a non-target cell. 97. The method of any one of embodiments 91-96, further comprising expressing a protein encoded by the coding sequence in the target cell. 98. The method of embodiment 97, wherein a level of expression of the protein is higher in the target cell than in the non-target cell. 99. The method of embodiment 97 or embodiment 98, wherein the protein is a neuronal protein, a retinal protein, a muscle protein, or an apoptosis-inducing protein. 100. The method of any one of embodiments 97-99, wherein the protein is associated with a genetic disorder, a neuronal disorder, an eye disorder, a muscular disorder, or a cancer. 101. The method of any one of embodiments 97-100, wherein the protein is MeCP2, progranulin, dystrophin, or peripherin 2. 102. The method of any one of embodiments 97-101, wherein the protein is encoded by any one of the genes provided in TABLE 6. 103. The method of any one of embodiments 91-96, further comprising expressing a therapeutic polynucleotide encoded by the coding sequence in the target cell. 104. The method of embodiment 103, wherein a level of expression of the therapeutic polynucleotide is higher in the target cell than in the non-target cell. 105. The method of embodiment 103 or embodiment 104, wherein the therapeutic polynucleotide is a gRNA or a tRNA. 106. The method of any one of embodiments 103-105, wherein the therapeutic polynucleotide targets a gene associated with a genetic disorder, a neuronal disorder, an eye disorder, a muscular disorder, or a cancer. 107. The method of any one of embodiments 103-106, wherein the therapeutic polynucleotide targets a gene provided in TABLE 6. 108. A method of identifying a cell-specific promoter, the method comprising: introducing a promoter library to a population of target cells; wherein the promoter library comprises a plurality of candidate promoter sequences, wherein a candidate promoter sequence of the plurality of candidate promoter sequences comprises one or more transcription factor binding sequences and a core promoter sequence, and wherein the candidate promoter is linked to a unique barcode sequence; introducing the promoter library to a population of non-target cells; and identifying a cell-specific promoter as the candidate promoter sequence that promotes higher transcription of the unique barcode in the population of target cells than in the population of non-target cells. 109. The method of embodiment 108, wherein the population of target cells comprises a target cell type, and wherein the population of non-target cells comprises a non-target cell type. 110. The method of embodiment 109, wherein the cell-specific promoter is a cell-type specific promoter. 111. The method of embodiment 108, wherein the population of target cells comprises a target cell state, and wherein the population of non-target cells comprises a non-target cell state. 112. The method of embodiment 111, wherein the cell-specific promoter is a cell-state specific promoter. 113. The method of embodiment 108, wherein the population of target cells comprises diseased neurons comprising a MECP2 mutant gene and having a disease phenotype associated with protein expression from the MECP2 mutant gene, and wherein the population of non-target cells comprises healthy neurons comprising a wildtype MECP2 gene and having wild type phenotype associated with protein expression from the wild type MECP2 gene. 114. The method of embodiment 113, wherein the cell-specific promoter is specific for neurons expressing mutant MeCP2 protein. 115. The method of any one of embodiments 108-114, wherein the one or more transcription factor binding sequences are selected from endogenous transcription factor binding sequences, variant transcription factor binding sequences, engineered transcription factor binding sequences, and combinations thereof. 116. A recombinant core promoter comprising at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 98% sequence identity to any one of SEQ ID NO: 8, SEQ ID NO: 10-SEQ ID NO: 22, SEQ ID NO: 25, or SEQ ID NO: 42. 117. The recombinant core promoter of embodiment 116 comprising any one of SEQ ID NO: 8, SEQ ID NO: 10-SEQ ID NO: 22, SEQ ID NO: 25, or SEQ ID NO: 42. 118. The recombinant core promoter of embodiment 116 or 117, consisting of any one of SEQ ID NO: 8, SEQ ID NO: 10-SEQ ID NO: 22, SEQ ID NO: 25, or SEQ ID NO: 42. 119. The recombinant core promoter of any of embodiments 116-118, wherein the recombinant core promoter is downstream of a transcription factor binding motif.
EXAMPLES
[0150] The invention is further illustrated by the following non-limiting examples.
Example 1
Identification of Differentially Expressed Transcription Factors in a Rett Syndrome Model
[0151] This example describes identification of differentially expressed transcription factors in a Rett syndrome model, which were used to identify candidate transcription factors for MECP2 mutant cell-specific expression.
[0152] Transcription factor expression was compared in neurons expressing mutant MeCP2 protein and containing a mutation in the MECP2 gene (mutant MeCP2 neurons), a cause of Rett syndrome, and neurons expressing wild type MeCP2 protein and containing wild type MECP2 (WT MeCP2 neurons).
[0153] Eighty-nine candidate transcription factors were identified, representing transcription factors that are both expressed in neurons and are differentially expressed in neurons with mutant versus wild type MeCP2. The 89 candidate transcription factors and corresponding neuron to liver expression ratios are provided in TABLE 1. Of these 89 candidates, 51 were identified from single cell neuron data, 9 from human bulk RNA-seq data, 15 from mouse bulk RNA-seq data, 5 were liver specific, and 9 are brain specific.
[0154] Transcription factor transcript levels were further analyzed in Rett patient induced pluripotent stem cell (iPSC) lines.
Example 2
Engineering Promotors to Tune Payload Expression
[0155] This example describes engineering promoters to tune payload (e.g., transgene) expression. Promoters containing a core promoter and one or more transcription factor binding sites are engineered to alter expression levels of a payload under control of the promoter. Expression levels are tuned for a specific cell state of interest, such as a differentiated cell type, a cell morphology, a cell phenotype, or a cell genotype.
[0156]
[0157] Match strength of a transcription factor binding motif is related to the sequence preference of a transcription factor. A transcription factor binding motif consensus sequence is determined by screening nucleotide sequences for transcription factor binding and identifying the most enriched nucleotides in each position. The consensus sequence represents a sequence preferred by the corresponding transcription factor.
Example 3
Generation of Candidate Promoter Libraries for Massively Parallel Reporting Assay Screens
[0158] This example describes generation of candidate promoter libraries for use in a massively parallel reporting assay (MPRA) to identify cell type- or cell state-specific promoters. A workflow for performing an MPRA to identify cell type- or cell state-specific promoters is shown in
Example 4
Identification of Cell Type- or Cell State-Specific Promoters Using a Massively Parallel Reporting Assay
[0159] This example describes identification of cell type- or cell state-specific promoters using a massively parallel reporting assay (MPRA). To identify mutant MeCP2-specific neuronal promoters, the MPRA was performed with the candidate promoters for the candidate transcription factors identified in EXAMPLE 1 in wild type MeCP2 neurons and in mutant MeCP2 neurons. Briefly, candidate promoter libraries were generated as described in EXAMPLE 3. The library included promoters containing transcription factor binding motifs identified from human and mouse date and promoters containing de novo designed transcription factor binding motifs. Motifs were combined in varying number and combination and combined with core promoters (e.g., core promoters from TABLE 4), for example, as illustrated in
[0160] As illustrated in
Example 5
Effect of Motif Duplication and Pairing on Transcriptional Activation
[0161] This example describes the effect of motif duplication and pairing on transcriptional activation of engineered promoter sequences. To test the effect of motif duplication on transcriptional activation, promoters containing one motif match (such as the Single Motif Match shown in
[0162] To test synergy of different motif pairs on transcriptional activation, promoters containing all possible combinations of duplicated pairs for the top the transcription factor binding motifs (such as the Every Pair of Favorite 10 shown in
[0163] A heatmap showing transcriptional activation of specific transcription factor binding motif pairs is shown in
[0164] One synergistic motif containing a duplicated TCF7L2-binding motif and NR1D1-binding motif pair, indicated with a circle in
Example 6
Screening Rationally and De Novo Designed Promoters for Mutant MeCP2-Specific Activity
[0165] This example describes screening for rationally and de novo designed promoters that exhibit mutant MeCP2-specific transcriptional activation. Candidate transcription factor binding sequences were either rationally designed or designed de novo. Rationally designed candidate transcription factor binding sequences were designed based on the transcription factor binding motif screens described in EXAMPLE 11. Candidate sequences were screened based on their ability to promote differential transcriptional activation in neurons derived from iSPCs with either mutant or wild type MeCP2, as shown in
[0166] De novo sequences were designed based on sequence motifs that were enriched near promoters in genes differentially expressed in patient cells. The de novo sequences were screened for higher transcriptional activity in cells expressing mutated MeCP2 than in cells expressing wild type MeCP2, as shown in
Example 7
[0167] Identification of Promoters with Mutant MeCP2-Specific Activity
[0168] This example describes identification of promoters that exhibit mutant MeCP2-specific transcriptional activation. Twenty core promoter sequences were tested in combination with 18 rationally designed transcription factor binding sequences (SEQ ID NO: 27-SEQ ID NO: 37 and SEQ ID NO: 39-SEQ ID NO: 41) and two de novo designed transcription factor binding sequences (SEQ ID NO: 26 and SEQ ID NO: 38) for mutant MeCP2-specific transcriptional activation. Each combination of a core promoter and a transcription factor binding sequence was tested. As shown in
Example 8
Cell State Specific Transgene Delivery to a Subject
[0169] This example describes cell state specific transgene delivery to a subject. A viral vector containing a polynucleotide encoding a viral inverted terminal repeat sequence, a promoter sequence, and a transgene sequence encapsulated in a viral capsid is generated. The transgene sequence encodes a protein to be expressed in a target cell state. The target cell state is a disease phenotype, disease genotype, and/or a cell type. The promoter sequence comprises a core promoter sequence and one or more transcription factor binding motifs and is engineered to promote transcription of the transgene in a cell state specific manner, as described in EXAMPLE 1, EXAMPLE 2, and EXAMPLE 3. The promoter sequence is engineered to promote increased transcription of the transgene in the target cell state relative to cells not in the target cell state. Additionally, the promoter sequence is engineered to tune the transcription level of the transgene to a desired level, preventing over-expression or under-expression of the protein encoded by the transgene.
[0170] The viral vector is administered to a subject. Cell state specific transcription of the transgene results in increased transcription levels in cells in the target cell state relative to cells not in the target cell state. The protein encoded by the transgene is expressed in cells in the target cell state at the desired level. Tuning the protein expression level in the target cell state reduces adverse effects in the subject relative to systemic expression of the protein.
Example 9
Treating Rett Syndrome in a Subject Using Cell State Specific Transgene Delivery
[0171] This example describes treating Rett syndrome in a subject using cell state specific transgene delivery. Healthy neurons (e.g., neurons expressing wild-type MeCP2) and diseased neurons (e.g., neurons expressing mutant MeCP2) from a subject with Rett syndrome are screened for phenotype-specific transcription factor expression. Briefly, neuronal cell lines are generated from induced pluripotent stem cells collected from the subject with either wild type MeCP2 protein expression from a wild type MECP2 gene expression or mutant MeCP2 protein expression from a mutated MECP2 gene expression. A library of engineered promoters is screened for differential transcription in the mutant versus wild type MeCP2 neurons. Additionally, the promoter library is screened for desired transcription levels in the mutant MeCP2 neurons. Transcription levels are determined using RNA-seq. A promoter that selectively promotes transcription in mutant MeCP2 neurons at desired levels is selected.
[0172] A viral vector containing a polynucleotide encoding a viral inverted terminal repeat sequence, the selected promoter sequence, and a wild type MECP2 sequence encapsulated in a viral capsid is generated. The promoter sequence contains a core promoter sequence and one or more transcription factor binding motifs. The viral vector is administered to the subject. Upon administration, the MECP2 sequence from the viral vector is selectively transcribed in neurons having a disease phenotype associated with expression of mutant MeCP2, resulting in cell state specific expression of MeCP2 protein in diseased neurons. Expression levels of the exogenous MeCP2 protein (e.g., the MeCP2 expressed from the transgene) are tuned to prevent adverse effects due to over-expression of MeCP2, such as seizures, or under-expression of MeCP2, such as neurological impairment. Cell state specific expression of the exogenous MeCP2 protein reduces one or more symptoms of Rett syndrome, thereby treating the Rett syndrome in the subject.
Example 10
Treating Frontotemporal Dementia in a Subject Using Cell Type Specific Transgene Delivery
[0173] This example describes treating frontotemporal dementia (FTD) in a subject using cell type specific transgene delivery. A viral vector containing a polynucleotide encoding a viral inverted terminal repeat sequence, a neuron-specific promoter sequence, and a wild type progranulin sequence encapsulated in a viral capsid is generated. The promoter sequence contains a core promoter sequence and one or more transcription factor binding motifs that bind to neuron-specific transcription factors. The viral vector is administered to the subject. Upon administration, the progranulin sequence from the viral vector is selectively transcribed in neurons, resulting in cell type specific expression of exogenous progranulin protein in neurons. Cell type specific expression of the exogenous progranulin reduces one or more symptoms associated with, prevents, or slows the progression of the frontotemporal dementia, thereby treating the frontotemporal dementia in the subject.
Example 11
Treating Cancer in a Subject Using Cell State Specific Transgene Delivery
[0174] This example describes treating cancer in a subject using cell state specific transgene delivery. Healthy and cancerous cells from a subject with cancer are screened for genotype-specific transcription factor expression. Briefly, healthy and cancerous cell lines are generated from the cells collected from the subject. A library of engineered promoters is screened for differential transcription in the healthy versus cancerous cells. Transcription levels are determined using RNA-seq. A promoter that selectively promotes transcription in the cancer cells is selected.
[0175] A viral vector containing a polynucleotide encoding a viral inverted terminal repeat sequence, the selected promoter sequence, and a pro-apoptotic sequence encapsulated in a viral capsid is generated. The promoter sequence contains a core promoter sequence and one or more transcription factor binding motifs. The viral vector is administered to the subject. Upon administration, the pro-apoptotic sequence from the viral vector is selectively transcribed in cancer cells, resulting in cell state specific expression of a pro-apoptotic protein in cancer cells. Expression of the pro-apoptotic protein in the cancer cells induces apoptosis of the cancer cells. Cell state specific expression of the pro-apoptotic protein kills or slows the progression of the cancer cells, thereby treating the cancer in the subject.
Example 12
Treating Macular Degeneration in a Subject Using Cell Type Specific Transgene Delivery
[0176] This example describes treating macular degeneration in a subject using cell type specific transgene delivery. A viral vector containing a polynucleotide encoding a viral inverted terminal repeat sequence, a retinal-specific promoter sequence, and a wild type PRPH2 sequence encapsulated in a viral capsid is generated. The promoter sequence contains a core promoter sequence and one or more transcription factor binding motifs that bind to retinal-specific transcription factors. The viral vector is administered to the subject. Upon administration, the PRPH2 sequence from the viral vector is selectively transcribed in retinal cells, resulting in cell type specific expression of exogenous peripherin 2 protein in retinal cells. Cell type specific expression of the exogenous peripherin 2 reduces symptoms associated with, prevents, or slows the progression of the macular degeneration, thereby treating the macular degeneration in the subject.
Example 13
Treating Duchenne's Muscular Dystrophy in a Subject Using Cell Type Specific Transgene Delivery
[0177] This example describes treating Duchenne's muscular dystrophy in a subject using cell type specific transgene delivery. A viral vector containing a polynucleotide encoding a viral inverted terminal repeat sequence, a muscle-specific promoter sequence, and a wild type DMD sequence encapsulated in a viral capsid is generated. The promoter sequence contains a core promoter sequence and one or more transcription factor binding motifs that bind to muscle-specific transcription factors. The viral vector is administered to the subject. Upon administration, the DMD sequence from the viral vector is selectively transcribed in muscle cells, resulting in cell type specific expression of exogenous dystrophin protein in muscle cells. Cell type specific expression of the exogenous dystrophin reduces symptoms associated with, prevents, or slows the progression of Duchenne's muscular dystrophy, thereby treating the Duchenne's muscular dystrophy in the subject.
[0178] While preferred embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.