SINGLE DOMAIN ANTIBODIES SPECIFICALLY BINDING GLOBO - SERIES GLYCANS

20220380485 · 2022-12-01

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to the field of single-domain antibodies (sdAb) directed towards the glycans of the globo series, and in particular Globo H. More in detail, the present invention relates to sdAbs specifically binding one or more glycans selected from Globo H, Gb3, Gb4, and Gb5. The invention also provides polypeptides comprising multimeric single domain antibodies, as well as T cell chimeric antigen receptors comprising said anti-glycan sdAbs. Thus, the present invention provides polypeptides that can be used for targeting and/or treating several types of cancers associated with cells over-expressing said Globo H and/or Gb3, Gb4, Gb5. The present invention also relates to recombinant nucleic acid sequences encoding said polypeptides, and expression vectors and host cells comprising the same.

    Claims

    1. A polypeptide specifically binding a globo-series glycan comprising at least one single domain antibody, wherein said single domain antibody is a variable domain of a heavy chain antibody naturally devoid of a light chain and naturally devoid of the constant region 1, or a variant of said variable domain, and wherein said single domain antibody binds at least one globo-series glycan selected from Globo H, Gb3, Gb4, and Gb5.

    2. The polypeptide according to claim 1, wherein said at least one single domain antibody has at least 90% sequence identity with a sequence selected from the group consisting of SEQ ID NO 1, SEQ ID NO 3, SEQ ID NO 5, SEQ ID NO 7, SEQ ID NO 9, SEQ ID NO 11, SEQ ID NO 13, SEQ ID NO 15, SEQ ID NO 17, SEQ ID NO 136, SEQ ID NO 137, and SEQ ID NO 138.

    3. The polypeptide according to claim 1, further comprising at least one extracellular hinge region, at least one transmembrane domain, at least one costimulatory domain, and at least one intracellular activation domain, wherein the single domain antibody is linked to the extracellular hingeregion.

    4. The polypeptide according to claim 1, wherein said at least one single domain antibody is a humanized single domain antibody.

    5. The polypeptide according to claim 4, wherein said single domain antibody is humanized by replacing one or more amino acid residues located at positions 1, 5, 11, 28 and 30 in FR1, 44 and 45 in FR2, 74, 75, 76, 83, 84, 93 and 94 in FR3; 104 and 108 in FR4, according to the Kabat numbering.

    6. A recombinant nucleic acid molecule encoding a polypeptide according to claim 1.

    7. A vector comprising the recombinant nucleic acid molecule according to claim 6.

    8. A host cell comprising the recombinant nucleic acid molecule according to claim 6.

    9. A pharmaceutical composition comprising a polypeptide according to claim 1 together with at least one pharmaceutically acceptable vehicle, excipient and/or diluent.

    10. A method for treating a subject having a cancer, wherein the cancer cells of said cancer express on their surface at least one globo-series glycan selected from Globo H, Gb3, Gb4, and Gb5, comprising administering to the subject having said cancer a chimeric antigen receptor T-cell (CAR T cell) specifically recognizing at least one globo-series glycan selected from Globo H, Gb3, Gb4, and Gb5, wherein said CAR T cell expresses a functional CAR polypeptide comprising a single domain antibody binding at least one globo-series glycan selected from Globo H, Gb3, Gb4, and Gb5 as disclosed herein, at least one extracellular hinge region, at least one transmembrane domain, at least one costimulatory domain, and at least one intracellular activation domain, in an effective amount to treat the subject having said cancer.

    11. The method according to claim 10, wherein the cancer is selected from brain cancer, liver cancer, bile duct cancer, kidney cancer, breast cancer, prostate cancer, lung cancer, small cell lung cancer, ovarian cancer, cervix cancer, esophagus cancer, stomach cancer, pancreatic cancer and colorectal cancer.

    12. A diagnostic kit comprising a polypeptide according to claim 1 for screening for a cancer characterised by cells expressing on their surface at least one globo-series glycan selected from Globo H, Gb3, Gb4, and Gb5.

    13. The polypeptide according to claim 1 wherein the number of single domain antibodies that bind at least one globo-series glycan selected from Globo H, Gb3, Gb4, and Gb5 is at least two.

    14. The polypeptide according to claim 13, wherein the two or more single domain antibodies are different in sequence.

    15. The polypeptide according to claim 13, wherein the two or more single domain antibodies are identical in sequence.

    16. The polypeptide according to claim 13, wherein the number of single domain antibodies that bind at least one globo-series glycan selected from Globo H, Gb3, Gb4, and Gb5 is three.

    17. The polypeptide according to claim 16, wherein said single domain antibody has at least 90% sequence identity with SEQ ID NO 5.

    Description

    DESCRIPTION OF THE FIGURES

    [0260] FIG. 1: Scheme of the procedure used for the development of the inventive alpaca sdAbs specifically binding globo-series glycans.

    [0261] FIG. 2: Structure of globo-series glycans GloboH, Gb3, Gb4, Gb5, SSEA3, and SSEA4.

    [0262] FIG. 3: Electrophoresis blot to assess the load of the CRM197 carrier protein on GloboH.

    [0263] FIG. 4: Binding of serum antibodies to native globo-series glycans. Flow cytometry results of immunized Alpaca serum from weeks 0 (red) and 7 (blue, final week) demonstrate the generation of antibodies capable of binding to breast cancer cells (MCF-7) expressing globo-series glycans.

    [0264] FIG. 5: Printing pattern for glycan arrays. Glycans were printed on epoxy-coated slides in triplicates. Each color shows one specific glycan type. Controls and oligosaccharides are indicated next to the grid and include galactose, 6×His-tagged sdAb, Globo H and different types of glycosylphosphatidylinositol (GPIs). Legend: Controls; PB, Buffer; FS8, galactose; C6, rhamnose; 2His Tag, sdAb control for 6×His specific antibody (Atto 6479); 297,Fuc(a1-2)Gal(b1-3)GalNAc(b1-3)Gal(a1-4)Gal(b1-4)Glc(b1-1) aminopentanol-Globo H; 221, Glc(a1-4)GalNac(b1-4)[Man-6-PEtN(a1-2)Man(a1-6)Man(a1-4)GlcN(a1-6)Ino(1-P) phosphothiohexanol-GPI; 222, GalNac(b1-4)[Man-6-PEtN(a1-2)Man(a1-6)]Man(a1-4)GlcN(a1-6)Ino(1-P)phosphothiohexanol-GPI (T. gondii); 223, GalNac(b1-4)[Man-6-PEtN(a1-2)Man(a1-6)]Man-2-PEtN(a1-4)GlcN(a1-6)Ino(1-P)phosphothiohexanol-GPI 32 (mammalian); 224, GalNac(b1-4)[Man(a1-2)Man(a1-6)]Man(a1-4)GlcN(a1-6)Ino(1-P)phosphothiohexanol-GPI 37 (unnatural); 228, GlcN(a1-6)Ino(1-P)phosphothiohexanol-GPI Pseudodisaccharide; 225, Glc(a1-4)GalNAc(b1-4)Man(a1-1)aminopentanol-GPI substructure; 226, Glc(a1-4)GalNAc(b1-4)[Man(a1-2)Man(a1-1)aminopentanol-GPI substructure; 227, Glc(a1-4)GalNAc(b1-4) [Man-6-PEtN(a1-2)Man(a1-6)]Man(a1-1) aminopentanol-GPI substructure; 172, Gal(b1-3)GalNAc(b1-3)Gal(a1-4)Gal(b1-4)Glc(b1-1)aminopentanol-GB5(Aminolinker); 174, Gal(a1-4)Gal(b1-4)Glc(b1-1)aminopentanol—GB3(Aminolinker); 371, GlcNAc(b1-3)Gal(a1-4)Gal(b1-4)Glc(b1-1)aminopentanol; 11, Gal(b1-4)Glc(b1-1)aminohexanol-Lactose(Aminolinker); positions D2-D10, E3, F4-F6 indicate the position of the stock compound on the 96 plate, which are used by the printing robot to individuate the position of each sample.

    [0265] FIG. 6: Quantification of glycan array results showing a gradual increase by weeks in immune response of immunized Alpaca to synthetic Globo H and Gb5.

    [0266] FIG. 7: Glycan array image of week 7 (final week) for serum inspection showing specific binding of serum antibodies to the different globo family synthetic glycans (illustrated structures). Black asterisks represent control glycan structures.

    [0267] FIG. 8: Analysis of the Globo HGlobo H binding of affinity eluted antibodies by glycan array. Graph bars represent mean fluorescence intensity of eluted antibodies from empty (red) and Globo H coated beads (blue). Results show specificity of affinity purified antibodies which were then taken to gel electrophoresis in order to separate the sdAbs.

    [0268] FIG. 9: Gel electrophoresis separation of affinity purified antibodies. Green arrows indicate 13 kDa sdAbs (VHH) that were extracted from gels for further tryptic digestion and mass spectrometry analysis.

    [0269] FIG. 10: Recombinant expression in E. coli of selected single domain antibody sequences. A) Gel electroporation of samples prelevated after different purification and cleaning steps of the cell extracts from ArcticExpress® E. coli engineered to express sdAb46. Pellet (P) and lysate (L) of ArcticExpress® cells, flowthrough (FT), Wash Fractions 1 and 2 (W1 and W2), eluates after Nickel-NTA (E), and the final sdAb product (sdAb). The arrow indicates final cleaning steps and the presence of a high purity sdAb sample. B) Lower panel shows S200 size exclusion chromatography of sdAb46 which indicates expression in high yield (50 mAU) and elution volume that correlates with a 14 kDa protein (arrow).

    [0270] FIGS. 11-13: Binding of purified sdAbs to synthetic Globo H. Synthetic Globo H glycans were immobilized on a C1 surface plasmon resonance chip and different sdAbs were tested for binding. Among the different sdAbs tested, sdAb37 (FIG. 11), sdAb46 (FIG. 12), and sdAb62 (FIG. 13) are shown. SdAb46 showed the highest values with an average of 54 nM affinity.

    [0271] FIG. 14: Binding of purified sdAbs to native globo family glycans expressing cancer cells. Flow cytometry (FACS) assays were performed in order to test binding of different sdAbs to cancer cells (MCF-7) expressing globo family glycans (upper panel). Positive results were further validated using confocal microscopy (lower panel). Commercial available anti Globo H antibody VK9 was used as a positive control, the secondary antibody alone was used to exclude nonspecific binding of secondary antibody (right lowest panel).

    [0272] FIG. 15: Graphical representation of FACS results showing binding levels of the expressed and purified sdAbs to MCF-7 cancer cells.

    [0273] FIG. 16: Binding specificities for different globo-series glycan as tested by by FACS binding assay. The specific binding of sdAbs to different cancer cells differs due to differences in expression levels of globo family glycans on the surface of the analysed cancer cells. Specificity of sdAb62 was tested on cancer cell lines that express different globo-series glycans. Results indicate differences in bound population size (black curve) due to distinct Gb3 expression on HEK293 kidney cells.

    [0274] FIG. 17: Purification of Globo H binding sdAbs. SdAbs were expressed in SHuffle Cells®, extracted by French press cell lysis, and purified by Ni.sup.2+-NTA affinity chromatography and size exclusion chromatography (SEC). a) SDS-PAGE of samples taken during the purification of sdAb46. Gel was stained with PageBlue Protein Staining Solution. M, PageRuler Prestained Protein Ladder 10-180 kDa. FT, flow-through. W1, wash 1 fraction. W2, wash 2 fraction. b) SEC chromatogram shows the UV absorbance at 280 nm detecting the elution of proteins. HiLoad 16/600 Superdex 75 (S75) prep grade column was used with FPLC system. Asterisk (*) indicates the fraction used for SDS-PAGE.

    [0275] FIG. 18: Binding epitope and bound conformation of Globo-H to sdAb46 as analyzed by Saturation transfer difference nuclear magnetic resonance (STD NMR). a) STD NMR experiments reflecting the interaction of sdAb46 with Globo-H. From top to bottom: (1) Reference spectrum of Globo-H. Isolated signals showing magnetization transfer are highlighted in bold. (2) STD spectrum of 4 mM Globo-H in the presence of 60 μM sdAb46. (3) STD spectrum of 4 mM Gb5 in the presence of 110 μM sdAb46. (4) STD spectrum of 4 mM Globo-H. Residual water signal was not suppressed to allow the observation of Fuc and Gal3 anomeric protons. b) Binding epitope of Globo-H bound to sdAb46 from a single saturation time of 4 s. STD amplification factors for not indicated protons have not been available due to signal overlapping. STD NMR experiments were acquired at 600 MHz and 277 K. XXX=100−67%; XX=67−33%; X=33−0%; c) NOE build-up rates of Globo-H with and without sdAb46 vs mixing time (ms) at 600 MHz and 298 K. Curves represent intra- (Fuc-CH.sub.3/Fuc-H5) and inter-pyranose (Fuc-H1/Gal5-H2) moiety connectivities. The sdAb to carbohydrate ratio is 1:16.4. I) Globo-H+sdAb46, Fuc-CH.sub.3/Fuc-H5; II): Globo-H+sdAb46, Fuc-H1/Gal5-H2; III) Globo-H free, Fuc-CH.sub.3/Fuc-H5, IV) Globo-H free, Fuc-H1/Gal5-H2.

    [0276] FIG. 19: Generation and purification of a trivalent sdAb46 fusion protein. a), Schematic representation of the molecular cloning strategy. Mutagenesis PCR was performed to insert a stop codon (*) to exclude the lytic peptide TACHY from being expressed. b) Agarose gel electrophoresis of the PCR product (left) and the products of the restriction enzyme digest (right). L, 1 kb DNA ladder. c) Expression test of the sdAb46 trimer construct in SHuffle cells. SDS-PAGE of the bacteria pellet before (pre) and after (post) IPTG induction is shown. d) Solubility test of the sdAb46 trimer construct. SDS-PAGE of pellet and lysate after cell lysis by sonication. e)-f) Ni.sup.2+-NTA purification of sdAb46 trimer inclusion bodies using FPLC. The chromatogram is shown in e) and the SDS-PAGE gel image of the input, flow-through (FT) and the elution fractions 1-4 is shown in f). M=PageRuler Prestained Protein Ladder 10-180 kDa.

    [0277] FIG. 20: Binding of sdAb46 monomer and sdAb46 trimer to cancer cells. a)-c) IMR5 neuroblastoma cells (negative control) and MCF7 breast cancer cells were stained with sdAb46 monomer, sdAb46 trimer or Globo H-specific commercial antibody VK9 followed by anti-6×His-AF647 or anti-IgG-Atto635 secondary antibodies, respectively. a) Flow cytometry histograms show the frequency of fluorescently labeled IMR5 cells (upper panel) and MCF7 cells (lower panel). Secondary antibody only controls are shown in grey on the left. The graphs on left are obtained with the VK9 antibody, the graphs on right with the sdAb46. Data are representative of three independent experiments performed in duplicates or triplicates, each. b) Frequency of positive cells based on the gates indicated in a). c) Confocal laser scanning microscopy of MCF7 (left) and IMR5 (right). RED: detection of signal generated by anti-6×His-AF647 or anti-IgG-Atto635 secondary antibodies. Cell nuclei were stained with DAPI (BLUE channel). TM light, transmission light. White scale bars, 20 μm.

    [0278] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the scope of the invention.

    [0279] Further modifications and alternative embodiments of various aspects of the invention will be apparent to those skilled in the art in view of this description. Accordingly, this description is to be construed as illustrative only and is for the purpose of teaching those skilled in the art the general manner of carrying out the invention. It is to be understood that the forms of the invention shown and described herein are to be taken as examples of embodiments. Elements and materials may be substituted for those illustrated and described herein, parts and processes may be reversed, and certain features of the invention may be utilized independently, all as would be apparent to one skilled in the art after having the benefit of this description of the invention. Changes may be made in the elements described herein without departing from the scope of the invention as described in the following claims.

    EXAMPLES

    [0280] Methods:

    [0281] Preparation of CRM197-Thiol GloboH Glycoconjugate for Alpaca Immunization.

    [0282] 1 mg of GloboH functionalized with a thiol linker was reduced with 0.6 equivalent (eq.) of resin-bound Tris(2-carboxyethyl)phosphin (TCEP) in 120 μl of water for 1 h at 1500 rpm. The resin was removed by filtration through a 0.22 μm syringe filter and the filter was washed five times with 50 μl water. The last wash was analyzed by thin-layer chromatography and sugar staining to ensure that no GloboH remained on the filter. The filtrate and all wash fractions were combined and lyophilized. 100 eq. of succinimidyl 3-(bromoacetamido)propionate were dissolved in 30 μl of dimethylformamide (DMF) and added dropwise to a solution of 1 mg CRM197 in 750 μl of coupling buffer (0.1 M Na.sub.2HPO.sub.4/NaH.sub.2PO.sub.4 pH 7.4) while stirring. After 1 h, the solution was washed four times with 350 μl of water on an equilibrated 0.5 ml centrifugal filter (Amicon Ultra, MWCO=10 k) at 10,000 rpm for 8 min. Before the last wash, a 10 μl aliquot was collected for mass spectrometric analysis. Subsequently, the solution was washed with 350 μl of conjugation buffer (0.1 M Na.sub.2HPO.sub.4/NaH.sub.2PO.sub.4 at pH 8.0) and collected in a new tube by centrifugation at 1,000 rpm for 2 min with the filter upside down. The lyophilized, reduced GloboH was restored in conjugation buffer (pH 8) and added to the protein solution. The reaction solution was left slowly stirring for 24 h. On the next day, the reaction solution was washed thrice with 350 μl water. Before the last wash, a 10 μl aliquot was collected for mass spectrometric analysis. Subsequently, the solution was washed with 350 μl conjugation buffer (pH 8) and 150 eq. of cysteine were added directly onto the centrifugal filter. After 1 h incubation, the reaction solution was washed thrice with 350 μl water. Before the last wash, a 10 μl aliquot was collected for mass spectrometric analysis. Finally, the solution was washed with 350 μl sterile phosphate buffered saline and collected in a new tube by centrifugation at 1,000 rpm for 2 min with the filter upside down. After mass spectrometric analysis of the samples collected throughout the conjugation, the GloboH loading of CRM197 (shown below) was determined by comparison of the mass peaks before and after conjugation (FIG. 3).

    ##STR00003##

    [0283] Alpaca Immunization

    [0284] Adult female alpaca was immunized with CRM197-GloboH glycoconjugates containing 15 μg GloboH/dose in phosphate-buffered saline. The alpaca was injected subcutaneously along the base of the neck using a 22 G needle. A total of 6 weekly immunization rounds included two weeks gap between the thirds and forth injections, so that the vaccination days where: 0/7/14/28/35/42. Whole blood extraction was performed 9 days after the last immunization (day 51).

    [0285] Isolation of Blood Serum and Peripheral Blood Mononuclear Cells (PBMCs)

    [0286] Whole blood for serum isolation (150 ml) was collected into 50 ml tubes and incubated at RT for 1 h followed by centrifugation at 2,000 g/10 minutes/RT. Serum was aliquoted into sterile 15 ml tube (7.5 ml each), and flash frozen using liquid nitrogen for further storage at −80° C.

    [0287] For PBMC isolation, 100 ml whole blood was collected into 10 ml EDTA coated tubes (BD Vacutainer™) and inverted 10 times. PBMCs from undiluted whole blood were isolated using UNI-SEPmaxi U16 (NOVAMED) by centrifugation at 1000 g/30 min/RT without breaks. PBMC layer was separated into a sterile 50 ml tube and washed with PBS by 3 rounds of centrifugation at 400 g/10 min/4c. Final 25 ml were centrifuged and dissolved in 14 ml of RNAlater™. The cells were divided into 1.5 ml RNAse free tubes in 5*10.sup.7/ml PBMC per vial and stored in a slow freezing container (Mr. Frosty™) at −80° C. for 24 h followed by storage at −80° C.

    [0288] Glycan Array to Assay the Binding of Serum Antibodies to Synthetic Globo-Series Glycans.

    [0289] Glycan microarrays were printed in the lab onto epoxy-coated glass slides using 0.2 mM of synthetic glycans and 250 μg/mL His-tagged sdAb as a control. Each slide contained repeated glycan grids with each containing 16 spots of different glycans. The printing pattern is shown in FIG. 5. The slides were blocked in HEPES buffer (10 mM HEPES (pH 7.4), 1 mM CaCl.sub.2, 1 mM MgCl.sub.2) supplemented with 1% BSA for 1 hour at 37° C. At the same time 50 μL of 4, 10 and 20 μg/mL of sdAb solutions in the same buffer were incubated with a 1:5000 dilution of 6×His-specific antibody (Atto647) at 30° C. in the dark. Blocked slides were washed once with HEPES buffer without BSA and once with ddH.sub.2O. To get rid of any liquid, the slides were centrifuged at 300 g for 3 min. The slides were assembled onto microplate holders to allow separate staining of single grids with different sdAbs. The sdAb/antibody mixture was pipetted into the wells and sdAb-glycan binding was allowed for 1 hour at 30° C. in a humidified chamber in the dark. The wells were washed three times with HEPES buffer supplemented with 0.05% Tween, once with ddH.sub.2O, and after drying by centrifugation directly scanned using a Glycan Array Scanner Axon GenePix 4300A. Binding was analyzed using GenePix Pro7.

    [0290] VHH cDNA Library Construction and High Throughput Sequencing

    [0291] RNA was isolated from alpaca PBMC using RNeasy MiniKit (Qiagen). cDNA was created using oligo-dT primers and the SuperScriptII reverse transcriptase kit (Invitrogen). The VHH variable regions were specifically amplified from the cDNA in a two steps nested PCR. In the first step primers CALL001: GTCCTGGCTGCTCTTCTACAAGG (leader sequence specific, SEQ ID NO 132) and CALL002: GGTACGTGCTGTTGAACTGTTCC (CH2 specific, SEQ ID NO 133) where used. After gel purification and size selection of the 600 bp region followed by MinElute cleanup (Qiagen), the second PCR was performed to extract the VHH region using the primers VHH_back:GATGTGCAGCTGCAGGAGTCTGGRGGAGG (SEQ ID NO 134) and VHH_For: GGACTAGTGCGGCCGCTGGAGACGGTGACCTGG (SEQ ID NO 135) followed by gel extraction of the 400 bp band.

    [0292] Illumina sequencing libraries were created following the TruSeq protocol without shearing, i.e. starting with the end repair step. Each library was sequenced with 2×250 bp chemistry on an Illumina MiSeq instrument yielding 6.9/6.6 million read pairs per sample. BBmerge (https://github.com/BiolnfoTools/BBMap/blob/master/sh/bbmerge.sh) was used to overlap forward and reverse reads to reconstruct the original PCR fragments.

    [0293] Affinity Purification of GloboH Specific Canonical and Heavy Chain Only Antibodies to Isolate the GloboH Binding VHH Fragments from Alpaca Serum

    [0294] Preparation of Synthetic GloboH-Coupled Beads.

    [0295] 1 mg of GloboH functionalized with a thiol linker was reduced with 0.6 eq. of resin-bound TCEP in 120 μl water for 1 h at 1500 rpm at RT. The resin was removed by filtration through a 0.22 μm syringe filter and the filter was washed five times with 50 μl water. The last wash was analyzed by thin-layer chromatography and sugar staining to ensure that no GloboH remained on the filter. The filtrate and all wash fractions were combined and lyophilized. Reduced GloboH was conjugated to 1 ml agarose beads SulfoLink® Coupling Resin (Thermo Fisher Scientific) according to manufacturer instructions.

    [0296] Separation of IgGs and Heavy Chain Antibodies Using Protein A/G Beads.

    [0297] For the separation of conventional IgGs and of heavy chain only antibodies, the samples of alpaca serum were thawed and a 7.5 ml aliquot was diluted with 67.5 ml 20 mM Sodium Phosphate at pH=7 and filtered using 0.22 mm filter. 3 ml of Protein NG Magnetic Beads (Pierce) were pre-washed with 20 mM Sodium phosphate at pH=7. Thereafter, these samples were incubated for 1 h at RT with spinning. After collecting the flow through, the beads were washed with 100 ml of 20 mM Sodium Phosphate at pH=7. Bound antibodies were eluted using 39 ml of 100 mM Citric acid at pH=2.75 into 50 ml tubes pre-filled with 11 ml of 1.5M Tris pH=8.8 for neutralization of eluted antibodies. Elution samples were united, concentrated using Amicon 10 kDa at RT and dialyzed over night with 5 L of 20 mM Sodium Phosphate at pH=7.4.

    [0298] Isolation of GloboH Specific Antibodies Using Synthetic Glycan-Coupled Beads.

    [0299] GloboH-coupled beads/empty beads control columns were washed three times with water followed by 20 mM Sodium phosphate pH=7. The sample of dialyzed antibodies obtained using the NG beads was than evenly distributed between empty and GloboH coupled beads columns pre-equilibrated with dialysis buffer and rotated for 1 h at RT. Flow through from each column was then switched between columns for additional 1 h at RT. Elution from both columns was performed using 20 mM Sodium phosphate pH=7 and increased NaCl concentration (100 mM/500 mM/1M/3M), followed by a final washing step of 20 mm NaH.sub.2PO.sub.4 adjusted to pH 5.2. 75 ml volume of each washing steps from both columns were concentrated using Amicon 10 kD and dialyzed overnight at 4° C. against papain digestion buffer (20 mM sodium phosphate/10 mM EDTA pH=7.1).

    [0300] Papain Cleavage of GloboH Specific Antibodies

    [0301] Affinity purified antibodies in 20 mm sodium phosphate/10 mm EDTA buffer were incubated with 10-20 μl of Papain immobilized beads (Thermo Fisher Scientific) 37c/300 rpm for up to 90 min with addition of 5 mM L-Cystein (Sigma-Aldrich). The mixture was then centrifuged and supernatant was loaded on 4-20% acrylamide SDS-PAGE gels for the extraction of the 13 kDa bands corresponding to the VHH domains (FIG. 9).

    [0302] Mass Spectrometry Analysis of Affinity Purified VHH Fragments.

    [0303] VHH fragments from SDS-PAGE separation were excised from the gel and digested with trypsin. The resulting tryptic peptides were extracted from the gel and de-salted using C18 StageTips. LC-MS/MS analysis was performed on an Orbitrap Fusion™ Lumos™ Tribrid™ mass spectrometer (Thermo Fisher Scientific) coupled on-line to Ultimate 3000 RSLCano Systems (Dionex, Thermo Fisher Scientific). The eluted peptides are ionized by an EASY-Spray source (Thermo Fisher Scientific). Mobile phase A consists of water, 0.1% v/v formic acid and mobile phase B consists of 80% v/v acetonitrile and 0.1% v/v formic acid. The MS data is acquired in the data-dependent mode with the top-speed option using Lumos instrument with high resolution for both MS1 and MS2 spectra. HCD was applied for fragmentation. Peak lists of MS data were generated using MS convert. Database search against the high throughput cDNA sequencing library was conducted using a combination of in-lab modified Mascot search engine (Matrix Science) and local installation and default parameters of Llama Magic v1.0. (https://github.com/FenyoLab/llama-magic).

    [0304] Expression of Globo-Series Glycan Binding sdAbs

    [0305] Transformation of Bacteria: Plasmid vectors (pET-22(+)b) for transformation contained sdAb sequences fused to a C-terminal Histidin-Tag, an IPTG inducible regulatory system, an ampicillin resistance and a PeIB periplasma signal sequence. The vectors were transformed into ArcticExprese (DE3) E. coli competent cells using heat shock transformation according to the manufacturer's protocol. 20 ng of DNA was added to 20-40 μL of bacteria. After heat shock, followed by 1 hour incubation at 37° C. in SOC medium, the transformed cells were spreaded onto LB agar plates containing gentamicin resistance for ArcticExpress cells and ampicillin resistance for the expression plasmid carrying the desired sdAb sequence. Plates were incubated at 37° C. overnight.

    [0306] Colony PCR: Single colonies of the transformed cells were tested for transformation efficiency in Colony PCR. The PCR reaction mix was prepared using 2×PCR Master Mix, 0.1 μM of the according forward and reverse primers and nuclease-free water in 10 μL reactions in PCR tubes on ice. Three clones of each transformation protocol were picked with a 10 μL pipette tip and directly pipetted and resuspended in the reaction mix. The PCR reaction was performed according to manufacturer's recommended thermal cycling conditions, shown in Table 2. 2 μL of 6×DNA Loading Dye was added to the PCR product and analyzed on 1% agarose gels.

    TABLE-US-00002 TABLE 2 Thermal Cycling Conditions for Colony PCR Step Temperature Time Cycles Initial 95° C.   3 min 1 denaturation Denaturation 95° C. 0.5 min 35 Annealing Cycles 21-41: 51.4° C. 0.5 min Cycles 56-65: 58° C. Extension 72° C.   1 min Final Extension 72° C.  10 min 1

    [0307] Storage of bacteria: Colonies of successfully transformed cells were inoculated and grown in 5 mL LB medium supplemented with 50 μg/mL ampicillin and 20 μg/mL gentamycin over night at 37° C. in a shaking incubator (250 rpm). The next morning, 750 μL of the overnight culture were mixed with 750 μL 50% glycerol and the stocks were stored in −80° C.

    [0308] Expression and purification of GloboH sdAbs from ArcticExpress Cells: Overnight cultures were started either by inoculating positive clones on LB agar plates after transformation or by inoculation from cryostocks in LB medium supplemented with 50 μg/mL ampicillin and 20 μg/mL gentamicin. The starters were incubated in a 37° C. shaker (250 rpm) over night. The next morning, 150 mL or 1 L main cultures were subcultured with 50 μg/mL ampicillin and the overnight culture in a 1:100 dilution. These cultures were incubated at 30° C. with shaking at 250 rpm until the OD600 reached 0.6. 500 μL of each culture was pipetted in a clean microcentrifuge tube for an expression test as a non-induced sample. The cultures were transferred into a 12° C. shaker at 250 rpm, induced with 0.4 mM IPTG and incubated for 24 hours. After the incubation time another 500 μL sample was taken for each culture as an induced sample. Bacteria were harvested by centrifugation for 20 min at 6000 g at 4° C. and pellets were stored in −20° C. To test expression efficiency, the non-induced and induced samples were diluted with LB medium to an OD600 of 0.1 in 1 mL volumes. These suspensions were centrifuged for 5 min at 14000 g. The pellets were dissolved in 20 μL PBS and 5 μL 5×SDS sample buffer and samples were analyzed by SDS-PAGE.

    [0309] Lysis of ArcticExpress® Cells and purification of GloboH sdAbs: The PeIB signal sequence in the sdAb plasmids induced secretion of the expressed sdAbs into the E. coli periplasm. To obtain the periplasmic fraction of E. coli cells, only the outer membrane needs to be disrupted. Pellets from 150 mL cultures were thawed and resuspended in 300 μL PBS supplemented with protease inhibitor mix. After six freeze and thaw cycles using dry ice and a water bath at 37° C., the samples were centrifuged for 1 hour at 3200 g and 4° C. The lysates were directly used for binding assays on MCF-7 cells. Pellets from 1 L cultures were thawed and resuspended in 20 mL sodium phosphate sample buffer containing protease inhibitors. Freeze and thaw cycles were performed as described before and 20 units of DNAse I were added to the samples before centrifugation at 42000 g for 20 min at 4° C. The lysates were directly used for further purification.

    [0310] Nickel-NTA affinity chromatography: For affinity purification, 1 mL of Nickel-NTA beads were loaded into chromatography columns, washed with two column volumes (CV) of ddH.sub.2O and equilibrated with two CV of sample buffer. The lysates obtained from 1 L of E. coli ArcticExpress® cells were added to the beads and incubated for 90 min at RT under rotation. Afterwards, the flowthrough was collected, and the beads were washed with 1 CV of sample buffer, 2 CV of wash buffer 1 and 2 CV of wash buffer 2. The sdAbs were eluted from the Nickel beads with 2 CV of elution buffer. Samples were taken from all purification and washing steps for later SDS-PAGE analysis. The eluates were concentrated in Amicon® Ultra centrifugal filter units with 3 kDa size exclusion limit at 3200 g at 4° C. and concentration was determined during the process by measuring the absorbance at 280 nm with a Nanodrop™. If the concentration did not reach more than 2.5 mg/mL, the eluates were concentrated to a final volume of less than 2 mL and dialyzed in PBS (pH 7.4) at 4° C. overnight using SnakeSkin™ Dialysis Tubing with a 3500 molecular weight cut-off.

    [0311] SDS-PAGE (FIG. 10A) to Validate the Purification Procedure

    [0312] To validate the purification process of sdAbs, following samples were taken during the procedure: Pellet (P) and lysate (L) of ArcticExpress® cells after centrifugation of freeze and thaw samples, flowthrough (FT), Wash Fractions 1 and 2 (W1 and W2) and elution after Nickel-NTA (E), and the final sdAb product (sdAb) and/or other protein peaks which showed up in FPLC chromatograms. Samples were prepared with 5×SDS sample buffer and were denaturated for 5 min at 95° C. Discontinuous SDS-PAGE was performed as described by Laemmli and gels were stained with PageBlue™ Protein Stain Solution for 15 min after quick boiling in the microwave. Destaining was performed with ddH.sub.2O and gels were imaged using a Gel Doc EZ Imager.

    [0313] Size Exclusion Chromatography (FIG. 10B):

    [0314] Size exclusion was performed using FPLC (Fast Protein Liquid Chromatography) with a HiLoad™ Superdex 16/600 75 μg column connected to an AKTA™ Purifier. The dialyzed samples were injected into a 2 mL loading loop and were run in filtered and degassed PBS (pH 7.4) with a flow rate of 0.75 mL/min. Protein peaks were determined with UV280 and 1 mL fractions were collected in 96 deep well plates. SdAbs were expected to elute between 75 to 85 mL, but samples from all protein containing fractions were analyzed in SDS-PAGE. The sdAb containing fractions were combined and concentrated in 3 kDa cut-off Amicone at 4° C. and 3200 g to a final concentration of −1 mg/mL and were either used directly for further assays or aliquoted, frozen in liquid nitrogen and stored at −80° C.

    [0315] Surface Plasmon Resonance (SPR)

    [0316] SPR measurements were performed using a BIAcore T100 instrument (GE Healthcare). 7.5 μg of synthetic GloboH was immobilized on a commercial Cl sensor chip (GE healthcare) by amine-coupling chemistry. The chip was previously activated with 100 mM Glycine-NaOH (pH=12) supplemented with 0.3% Triton X-100. Immobilization was performed with a contact time of 700 s and a flowrate of 15 μL/min in 10 mM sodium acetate buffer (pH 5.5). The chip contains two flow cells, one of them serves as a blank (flow cell 3) and on one of them the glycan was immobilized (flow cell 4). SdAbs were dialyzed in SPR running buffer (HEPES buffer) at 4° C. overnight. Contact, dissociation times, flowrates, and maximum tested concentrations were different for each sdAb and are presented in Table 3. Each sdAb was tested at five different concentrations, where the lower concentrations are serial 1:2 dilutions of the indicated maximum concentration. For regeneration after each association event, the same buffer supplemented with 2 M MgCl.sub.2 was used. Sensorgrams were analyzed using the Biacore T200 control and evaluation software (GE Healthcare) and for data analysis the signal difference between both flow cells was evaluated. Equilibrium dissociation constants (KD) were determined by affinity and kinetic analysis. In affinity analysis, binding response based on steady state binding levels was plotted against sdAb concentrations and equilibrium dissociation constants were determined. Kinetic parameters were obtained by fitting sensorgrams to a 1:1 binding model using the BIAevaluation software. Accuracy of the measurements was evaluated by the software and is presented Chi-square values.

    TABLE-US-00003 TABLE 3 Parameters for SPR measurements using sdAbs37, sdAbs46 and sdAbs62 on a GloboH immobilized C1 chip. Maximal concentration Contact Time Dissociation Flowrate sdAb [μg/mL] [s] Time [s] [μL/min] 37 250 90 450 25 46 75 60 700 25 62 220 90 500 50

    [0317] Culture of Mammalian Cells

    [0318] All cells were cultivated at 37° C. with 5% CO.sub.2. MCF-7 cells and HEK293T cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS), 1% Penicillin/Streptomycin (P/S), 2 mM glutamine and 1% non-essential amino acids. They were passaged every 2-3 days by washing with PBS (w/o Ca.sup.2+/Mg.sup.2+) and subsequent trypsinization to detach the adherent cells. Trypsinization was stopped with culture media and the cells were centrifuged for 5 min at 300 g to get rid of trypsin. The pellet was resuspended in fresh media and cells were plated in new culture dishes at 1:3/1:4 ratios for MCF-7 and 1:6/1:8 ratios for HEK293T cells. MDA-MB 231 cells were cultured in RPMI 1640 supplemented with 10% FBS and 1% P/S. Medium was refreshed every 2-3 days and cells were passaged once a week as described above at a ratio of 1:4.

    [0319] To prepare frozen aliquots, cells from a confluent 75 cm.sup.2 culture flask were collected as described before and resuspended in 1 mL culture media supplemented with 5% DMSO and frozen in −80° C. in freezing containers for one day. Frozen cells were transferred into liquid nitrogen. Cells were thawed quickly at 37° C. for 2 min, and immediately resuspended in fresh culture media. They were pelleted to get rid of DMSO, resuspended again in fresh media and seeded in 75 cm.sup.2 culture flasks.

    [0320] Flow Cytometry Analysis of sdAb Binding to Cancer Cells

    [0321] Establishment of optimal settings for FACS analysis: to analyze binding of sdAbs to cancer cells in flow cytometry, following parameters needed to be preliminarily determined: concentration of the secondary antibody detecting the sdAbs (anti-6×His-Tag labeled with Atto647), concentration of the anti-GloboH antibody clone VK9 used as positive control, for each cell line tested, voltages during flow cytometry measurements for forward and sideward scatter, and FITC (fluorescein isothiocyanate) and APC (allophycocyanin)detectors. For each flow cytometry assay, cells were harvested at 70-80% confluency as described above under “Culture of mammalian cells”. The cell pellet was resuspended in PBS+1% BSA and 0.5×10.sup.6 cells per condition were transferred into 1.5 mL eppendorf tubes. After pelleting these again at 250 g for 5 min, one cell pellet was diluted in PBS as blank cells and one was resuspended in 250 μL FACS buffer (PBS+1% BSA+SYBR™ Safe (emetting in FITC channel). For adjusting the dilution of the anti-His antibody, the dilutions 1:100, 1:500, 1:1000 and 1:5000 in PBS+1% BSA were tested. The pellets were resuspended in 50 μL of the corresponding solution and incubated for 45 min at RT. At the same time, three pellets were incubated in 50 μL of 5, 10 or 20 μg/mL VK9 in PBS+1% BSA. Afterwards the cells were washed twice by centrifugation and resuspension in 500 μL PBS+1% BSA. The VK9 treated samples were stained for another 45 minutes with an anti-mouse secondary antibody (Alexa Fluor 635) at RT and washed afterwards as described before. After the last centrifugation step, the stained cell pellets were resuspended in 250 μL FACS buffer. All samples were transferred into FACS tubes and data acquisition was performed at a FACSCanto™ II device (BD).

    [0322] Screening for Antibodies Binding to Globo-Series Glycans Using MCF-7 Cells

    [0323] The E. coli lysates obtained from 150 mL cultures as described above were directly tested on MCF-7 cells. To this aim, cells were harvested as described above and 0.5×10.sup.6 cells per sample were transferred into 1.5 mL tubes. After centrifugation for 5 min at 300 g the cell pellet was resuspended in 50 μL of the corresponding lysate and was incubated on a shaker for 45 min at RT. Additionally, a negative control with only PBS and a positive control with 5 μg/mL VK9 was included in all runs. Afterwards the cells were washed twice and after the last washing step, all pellets except the VK9 control were resuspended in the anti-His antibody solution determined in the previous step (1:1000 in PBS+1% BSA) and incubated for another 45 min on a shaker at RT. VK9 stained cells were resuspended in 50 μl of a 1:400 dilution of the corresponding fluorescent anti-mouse antibody (AlexaFluor 635). After another two washes, cells were fixed in 100 μL 4% paraformaldehyde (PFA) in PBS and after centrifugation the pellet was resuspended in 250 μL FACS buffer. Data was recorded using the settings as determined in the previous step and analysed using FlowJe software. The recorded events were gated to select only the single, intact cells for analysis. The gates were applied to all samples and by overlapping the APC histograms of sdAb stained cells with that of the negative control cells, binding could be observed by shifts of the peaks. To quantify the shift and to rank for the strongest potential binders, an additional gate was created on the single cell selection which defines a positive gate for binders. The frequency of APC.sup.+ cells on parent gate (single cells) was determined for all sdAbs using the FlowJo® software.

    [0324] Flow cytometry binding assay of purified sdAbs on different cell lines After testing the binding of the E. coli lysates as described above, sdAbs were purified from the identified positive binders and further tested for binding on MCF-7 cells. The procedure was the same as described in the screening, with the difference that the cell pellet was resuspended in 50 μL of 0.4 mg/mL purified sdAb solution in PBS instead of E. coli lysates. By using the same concentration, binding intensity of the different sdAbs was compared. Additionally, the same binding assay was performed on MDA-MB 231 cells, which express all Globo family glycans and HEK293T cells, which do not express GloboH.

    [0325] Confocal Laser Scanning Microscopy (LSM)

    [0326] To validate binding of sdAbs to MCF-7 cells using confocal microscopy, 20,000 cells were seeded on 12 mm cover slips in 24-well cell culture plates two days before the assay to be 50-60% confluent for staining. The medium was aspired and cells were rinsed twice with PBS, before fixing them for 10 min at RT in 4% PFA. To get rid of PFA, the wells were washed 3×5 min in PBS and were then blocked for 1 hour in PBS+1% BSA. A drop of 50 μL of 1 μg/μL purified sdAb was placed on a piece of parafilm and the coverslip with the adherent cells was placed on top. One coverslip stayed in the wells as a negative control, and 5 μg/mL VK9 in PBS was used as a positive control. The coverslips were incubated for 1 hour with the sdAbs at RT in a humidified chamber. Afterwards, they were placed back into the wells and washed 3×5 min in PBS. 200 μL of Atto 647 anti-6×His antibody (1:5000 in PBS+1% BSA) was added to the cells and incubated for 1 hour at RT, slightly shaking. The VK9 positive control was stained with a 1:400 dilution of mouse-IgG specific (AlexaFluor635) secondary antibody in PBS+1% BSA. After three more washes with PBS, 10 μL of mounting medium were pipetted on a microscopy slide and the coverslips with the stained cells was placed on top. The slides were dried overnight and microscopy was performed the following day using an Axio Imager.M2 confocal LSM 800 (Zeiss). Parameters for the assay were set up based on negative control and VK9 staining as a positive control.

    TABLE-US-00004 TABLE 4 Description of the sequence listing SEQ ID Sequence NO Denomination Type 1 sdAb26 Amino acid 2 sdAb26 Nucleic acid 3 sdAb37 Amino acid 4 sdAb37 Nucleic acid 5 sdAb46 Amino acid 6 sdAb46 Nucleic acid 7 sdAb47 Amino acid 8 sdAb47 Nucleic acid 9 sdAb56 Amino acid 10 sdAb56 Nucleic acid 11 sdAb59 Amino acid 12 sdAb59 Nucleic acid 13 sdAb62 Amino acid 14 sdAb62 Nucleic acid 15 sdAb63 Amino acid 16 sdAb63 Nucleic acid 17 sdAb65 Amino acid 18 sdAb65 Nucleic acid 19 sdAb26 linked to the lytic peptide BMAP28A by a Amino acid GS_linker 20 sdAb26 linked to the lytic peptide BMAP28A by a Amino acid GSAA_linker 21 sdAb26 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a GS_linker 22 sdAb26 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a GSAA_linker 23 sdAb26 linked to the lytic peptide Polybia-MP1 by Amino acid a GSAA_linker 24 sdAb37 linked to the lytic peptide BMAP28A by a Amino acid GS_linker 25 sdAb37 linked to the lytic peptide BMAP28A by a Amino acid GSAA_linker 26 sdAb37 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a GS_linker 27 sdAb37 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a GSAA_linker 28 sdAb37 linked to the lytic peptide Polybia-MP1 by Amino acid a GSAA_linker 29 sdAb46 linked to the lytic peptide BMAP28A by a Amino acid GS_linker 30 sdAb46 linked to the lytic peptide BMAP28A by a Amino acid GSAA_linker 31 sdAb46 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a GS_linker 32 sdAb46 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a GSAA_linker 33 sdAb46 linked to the lytic peptide Polybia-MP1 by Amino acid a GSAA_linker 34 sdAb47 linked to the lytic peptide BMAP28A by a Amino acid GS_linker 35 sdAb47 linked to the lytic peptide BMAP28A by a Amino acid GSAA_linker 36 sdAb47 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a GS_linker 37 sdAb47 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a GSAA_linker 38 sdAb47 linked to the lytic peptide Polybia-MP1 by a Amino acid GSAA_linker 39 sdAb56 linked to the lytic peptide BMAP28A by a Amino acid GS_linker 40 sdAb56 linked to the lytic peptide BMAP28A by a Amino acid GSAA_linker 41 sdAb56 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a GS_linker 42 sdAb56 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a GSAA_linker 43 sdAb56 linked to the lytic peptide Polybia-MP1 by a Amino acid GSAA_linker 44 sdAb59 linked to the lytic peptide BMAP28A by a Amino acid GS_linker 45 sdAb59 linked to the lytic peptide BMAP28A by a Amino acid GSAA_linker 46 sdAb59 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a GS_linker 47 sdAb59 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a GSAA_linker 48 sdAb59 linked to the lytic peptide Polybia-MP1 by a Amino acid GSAA_linker 49 sdAb62 linked to the lytic peptide BMAP28A by a Amino acid GS_linker 50 sdAb62 linked to the lytic peptide BMAP28A by a Amino acid GSAA_linker 51 sdAb62 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a GS_linker 52 sdAb62 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a GSAA_linker 53 sdAb62 linked to the lytic peptide Polybia-MP1 by a Amino acid GSAA_linker 54 sdAb63 linked to the lytic peptide BMAP28A by a Amino acid GS_linker 55 sdAb63 linked to the lytic peptide BMAP28A by a Amino acid GSAA_linker 56 sdAb63 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a GS_linker 57 sdAb63 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a GSAA_linker 58 sdAb63 linked to the lytic peptide Polybia-MP1 by a Amino acid GSAA_linker 59 sdAb65 linked to the lytic peptide BMAP28A by a Amino acid GS_linker 60 sdAb65 linked to the lytic peptide BMAP28A by a Amino acid GSAA_linker 61 sdAb65 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a GS_linker 62 sdAb65 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a GSAA_linker 63 sdAb65 linked to the lytic peptide Polybia-MP1 by a Amino acid GSAA_linker 64 CDR1 of sdAb26 Amino acid 65 CDR1 of sdAb37 Amino acid 66 CDR1 of sdAb46 Amino acid 67 CDR1 of sdAb47 Amino acid 68 CDR1 of sdAb56 Amino acid 69 CDR1 of sdAb59 Amino acid 70 CDR1 of sdAb62 Amino acid 71 CDR1 of sdAb63 Amino acid 72 CDR1 of sdAb65 Amino acid 73 CDR2 of sdAb26 Amino acid 74 CDR2 of sdAb37 Amino acid 75 CDR2 of sdAb46 Amino acid 76 CDR2 of sdAb47 Amino acid 77 CDR2 of sdAb56 Amino acid 78 CDR2 of sdAb59 Amino acid 79 CDR2 of sdAb62 Amino acid 80 CDR2 of sdAb63 Amino acid 81 CDR2 of sdAb65 Amino acid 82 CDR3 of sdAb26 Amino acid 83 CDR3 of sdAb37 Amino acid 84 CDR3 of sdAb46 Amino acid 85 CDR3 of sdAb47 Amino acid 86 CDR3 of sdAb56 Amino acid 87 CDR3 of sdAb59 Amino acid 88 CDR3 of sdAb62 Amino acid 89 CDR3 of sdAb63 Amino acid 90 CDR3 of sdAb65 Amino acid 91 FR1 of sdAb26 Amino acid 92 FR1 of sdAb37 Amino acid 93 FR1 of sdAb46 Amino acid 94 FR1 of sdAb47 Amino acid 95 FR1 of sdAb56 Amino acid 96 FR1 of sdAb59 Amino acid 97 FR1 of sdAb62 Amino acid 98 FR1 of sdAb63 Amino acid 99 FR1 of sdAb65 Amino acid 100 FR2 of sdAb26 Amino acid 101 FR2 of sdAb37 Amino acid 102 FR2 of sdAb46 Amino acid 103 FR2 of sdAb47 Amino acid 104 FR2 of sdAb56 Amino acid 105 FR2 of sdAb59 Amino acid 106 FR2 of sdAb62 Amino acid 107 FR2 of sdAb63 Amino acid 108 FR2 of sdAb65 Amino acid 109 FR3 of sdAb26 Amino acid 110 FR3 of sdAb37 Amino acid 111 FR3 of sdAb46 Amino acid 112 FR3 of sdAb47 Amino acid 113 FR3 of sdAb56 Amino acid 114 FR3 of sdAb59 Amino acid 115 FR3 of sdAb62 Amino acid 116 FR3 of sdAb63 Amino acid 117 FR3 of sdAb65 Amino acid 118 FR4 of sdAb26 Amino acid 119 FR4 of sdAb37 Amino acid 120 FR4 of sdAb46 Amino acid 121 FR4 of sdAb47 Amino acid 122 FR4 of sdAb56 Amino acid 123 FR4 of sdAb59 Amino acid 124 FR4 of sdAb62 Amino acid 125 FR4 of sdAb63 Amino acid 126 FR4 of sdAb65 Amino acid 127 GS_linker used as linker between the sdAb and the Amino acid lytic peptide 128 GSAA_linker used as linker between the sdAb and Amino acid the lytic peptide 129 BMAP28A Amino acid 130 Modified Cysteine deleted Tachyplesin-I Amino acid 131 Polybia-MP1 Amino acid 132 Primer CALL001 used to PCR amplify the VHH Nucleic acid variable regions 133 Primer CALL002 used to PCR amplify the VHH Nucleic acid variable regions 134 Primer VHH_back used to PCR amplify the VHH Nucleic acid variable regions 135 Primer VHH_for used to PCR amplify the VHH Nucleic acid variable regions 136 sdAb14 amino acid sequence Amino acid 137 sdAb60 amino acid sequence Amino acid 138 sdAbS amino acid sequence Amino acid 139 sdAb14 nucleic acid sequence Nucleic acid 140 sdAb60 nucleic acid sequence Nucleic acid 141 sdAbS nucleic acid sequence Nucleic acid 142 sdAb 14 linked to the lytic peptide BMAP28A by a Amino acid GS_linker 143 sdAb 14_linked to the lytic peptide BMAP28A by a Amino acid GSAA_linker 144 sdAb 14 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a GS_linker 145 sdAb 14 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a GSAA_linker 146 sdAb 14_linked to the lytic peptide Polybia-MP1 Amino acid by a GSAA_linker 147 sdAb60 linked to the lytic peptide BMAP28A by a Amino acid GS_linker 148 sdAb60_linked to the lytic peptide BMAP28A by a Amino acid GSAA_linker 149 sdAb60 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a GS_linker 150 sdAb60 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a GSAA_linker 151 sdAb60_linked to the lytic peptide Polybia-MP1 Amino acid by a GSAA_linker 152 sdAbS_linked to the lytic peptide BMAP28A by a Amino acid GS_linker 153 sdAbS_linked to the lytic peptide BMAP28A by a Amino acid GSAA_linker 154 sdAbS linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a GS_linker 155 sdAbS linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a GSAA_linker 156 sdAbS_linked to the lytic peptide Polybia-MP1 by a Amino acid GSAA_linker 157 CDR1 of sdAb14 Amino acid 158 CDR1 of sdAb60 Amino acid 159 CDR1 of sdAbS Amino acid 160 CDR2 of sdAb14 Amino acid 161 CDR2 of sdAb60 Amino acid 162 CDR2 of sdAbS Amino acid 163 CDR3 of sdAb14 Amino acid 164 CDR3 of sdAb60 Amino acid 165 CDR3 of sdAbS Amino acid 166 FR1 of sdAb14 Amino acid 167 FR1 of sdAb60 Amino acid 168 FR1 of sdAbS Amino acid 169 FR2 of sdAb14 Amino acid 170 FR2 of sdAb60 Amino acid 171 FR2 of sdAbS Amino acid 172 FR3 of sdAb14 Amino acid 173 FR3 of sdAb60 Amino acid 174 FR3 of sdAbS Amino acid 175 FR4 of sdAb14 Amino acid 176 FR4 of sdAb60 Amino acid 177 FR4 of sdAbS Amino acid 178 SRGS linker Amino acid 179 sdAb26 linked to the lytic peptide BMAP28A by a Amino acid SRGS_linker 180 sdAb26 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a SRGS_linker 181 sdAb 26 linked to the lytic peptide Polybia-MP1 Amino acid by a GS_linker 182 sdAb 26 linked to the lytic peptide Polybia-MP1 Amino acid by a SRGS_linker 183 sdAb37 linked to the lytic peptide BMAP28A by a Amino acid SRGS_linker 184 sdAb 37 linked to the lytic peptide modified Amino acid cysteine deleted Tachyplesin-I by a SRGS_linker 185 sdAb 37 linked to the lytic peptide Polybia-MP1 Amino acid by a GS_linker 186 sdAb37 linked to the lytic peptide Polybia-MP1 Amino acid by a SRGS_linker 187 sdAb46 linked to the lytic peptide BMAP28A by a Amino acid SRGS_linker 188 sdAb46 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a SRGS_linker 189 sdAb46 linked to the lytic peptide Polybia-MP1 Amino acid by a GS_linker 190 sdAb46 linked to the lytic peptide Polybia-MP1 by a Amino acid SRGS_linker 191 sdAb47 linked to the lytic peptide BMAP28A by a Amino acid SRGS_linker 192 sdAb47 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a SRGS_linker 193 sdAb47 linked to the lytic peptide Polybia-MP1 by a Amino acid GS_linker 194 sdAb47 linked to the lytic peptide Polybia-MP1 by a Amino acid SRGS_linker 195 sdAb56 linked to the lytic peptide BMAP28A by a Amino acid SRGS_linker 196 sdAb56 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a SRGS linker 197 sdAb56 linked to the lytic peptide Polybia-MP1 by a Amino acid GS_linker 198 sdAb56 linked to the lytic peptide Polybia-MP1 by a Amino acid GS_linker 199 sdAb59 linked to the lytic peptide BMAP28A by a Amino acid SRGS_linker 200 sdAb59 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a SRGS_linker 201 sdAb59 linked to the lytic peptide Polybia-MP1 by a Amino acid GS_linker 202 sdAb59 linked to the lytic peptide Polybia-MP1 by a Amino acid SRGS_linker 203 sdAb62 linked to the lytic peptide BMAP28A by a Amino acid SRGS_linker 204 sdAb62 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a SRGS_linker 205 sdAb62 linked to the lytic peptide Polybia-MP1 by a Amino acid GS_linker 206 sdAb62 linked to the lytic peptide Polybia-MP1 by a Amino acid SRGS_linker 207 sdAb63 linked to the lytic peptide BMAP28A by a Amino acid SRGS_linker 208 sdAb63 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a SRGS_linker 209 sdAb63 linked to the lytic peptide Polybia-MP1 by a Amino acid GS_linker 210 sdAb63 linked to the lytic peptide Polybia-MP1 by a Amino acid SRGS_linker 211 sdAb65 linked to the lytic peptide BMAP28A by a Amino acid SRGS_linker 212 sdAb65 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a SRGS_linker 213 sdAb65 linked to the lytic peptide Polybia-MP1 by a Amino acid GS_linker 214 sdAb65 linked to the lytic peptide Polybia-MP1 by a Amino acid SRGS_linker 215 sdAb14 linked to the lytic peptide BMAP28A by a Amino acid SRGS_linker 216 sdAb14 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a SRGS_linker 217 sdAb14 linked to the lytic peptide Polybia-MP1 by a Amino acid GS_linker 218 sdAb14 linked to the lytic peptide Polybia-MP1 by a Amino acid SRGS_linker 219 sdAb60 linked to the lytic peptide BMAP28A by a Amino acid SRGS_linker 220 sdAb60 linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a SRGS_linker 221 sdAb60 linked to the lytic peptide Polybia-MP1 by a Amino acid GS_linker 222 sdAb60 linked to the lytic peptide Polybia-MP1 by a Amino acid SRGS_linker 223 sdAbS linked to the lytic peptide BMAP28A by a Amino acid SRGS_linker 224 sdAbS linked to the lytic peptide modified cysteine Amino acid deleted Tachyplesin-I by a SRGS_linker 225 sdAbS linked to the lytic peptide Polybia-MP1 by a Amino acid GS_linker 226 sdAbS linked to the lytic peptide Polybia-MP1 by a Amino acid SRGS_linker 227 Short connecting sequence Amino Acid 228 GGGGS_linker Amino acid

    [0327] Purification of Recombinant Globo H Binding Single Domain Antibodies sdAb46, sdAb56, and sdAb59

    [0328] Previously, Globo H sdAbs were generated by immunizing alpacas with synthetic glycans. The respective gene sequences were identified and obtained as commercially synthesized vectors for protein expression. The strongest Globo H binders were determined in previous screens using MCF7 cancer cells.

    [0329] To validate and further characterize the glycan binding, the most promising sdAbs were now analyzed for their binding to synthetic glycans in vitro. Frozen aliquots of purified sdAb37, sdAb62, and sdAb63 were already available; sdAb46, sdAb56, and sdAb59 had to be purified first. Therefore, pET-28b(+)-sdAb plasmids were transformed into SHuffle E. coli competent Cells® that were expanded to 1 L of bacteria cultures. Protein expression was induced with 0.5 mM IPTG. The recombinant sdAbs were His-tagged and were purified by Ni.sup.2+-NTA affinity chromatography followed by size-exclusion chromatography (SEC) to analyze aggregation or multimerization. Samples of the pellet, lysate, flow-through (FT), wash 1 (W1), wash 2 (W2), the elution from Ni.sup.2+-NTA affinity chromatography, and the protein-containing fraction of the size-exclusion chromatography (SEC) were taken for SDS-PAGE. FIG. 17a shows a representative purification SDS-PAGE image and a chromatogram from SEC. The theoretical molecular weight of sdAb46 is 16.8 kDa, which corresponds to the observed band. While the purified nanobody monomers were partly soluble, large amounts of protein remained in the pellet after lysis. The wash buffer 2 contained 30 mM imidazole, which already led to some nanobody elution and loss of product. However, other protein impurities remained and were still found in the elution. For subsequent size-exclusion chromatography, a HiLoad® 16/600 Superdex® 75 (S75) preparation grade column pre washed with PBS, was used with an FPLC system.

    Example 1: Generation and Selection of sdAbs

    [0330] Immunization of Alpaca

    [0331] For Alpaca immunization, synthetic Globo H was conjugated to the carrier protein CRM197 (Cross-Reactive-Material-197), which is a mutant version of the diphtheria toxin, where the single amino acid exchange of a glycine in position 52 to a glutamic acid renders the protein non-toxic. Alpaca were immunized with the GloboH-CRM197 conjugate (for details see the Method section) for a total of 6 weekly immunization rounds including a two weeks gap between the thirds and forth injections. Whole blood was collected at the 51.sup.th day.

    [0332] Evaluation of the Immune Response in the Immunized Alpaca

    [0333] Serum samples collected before (week 0) and at the end (week 7) of the immunization were used to test the binding to native globo family glycans. Serum samples were directly incubated with MCF-7 cells, which are known to express globo family glycans, and incubated for 45 min at RT. Afterwards the cells were washed twice, resuspended in a solution containing FITC-conjugated anti-llama secondary antibodies, and incubated for another 45 min at RT. After other two washes, cells were fixed, resuspended in FACS buffer, and analysed at the flow cytometer. As shown in FIG. 4, serum of alpaca immunized for 7 weeks contained antibodies capable of binding to breast cancer cells (MCF-7). Moreover serum samples were tested using glycan array as described in the detailed Method section. FIG. 6 shows the gradual weekly increase in immune response of immunized Alpaca to synthetic Globo H up to week 7. FIG. 7 depict the glycan array image obtained with the serum samples of the last week 7 showing specific binding of serum antibodies to the different globo family synthetic glycans indicated in the figure.

    [0334] Library Construction:

    [0335] Isolation of sdAb Domains from Alpaca Serum.

    [0336] Total antibodies were isolated from sera of immunized Alpaca by using Protein NG Magnetic beads. These samples were then used to isolate GloboH specific sdAbs by affinity purification using Globo H-coated beads, and uncoated control beads. These antibodies were then tested for their binding to Globo H by glycan array. FIG. 8 shows that mean fluorescence intensity obtained with antibody samples eluted from empty (black) and GloboH beads (grey) at different concentrations of sodium chloride. The highest fluorescence intensities were obtained with the samples obtained using sodium chloride at 100 mM, 500 mM and 1M, which were then subjected to gel electrophoresis SDS-PAGE after papain cleavage to obtain the single domain antibodies (sdAb) of 13 kDa. FIG. 9 shows that before digestion, samples obtained with NaCl 100 mM, 500 mM and 1M contained conventional IgGs (150 kDa) and heavy chain only Abs (55 kDa). After papain digestion, these samples contained Fc and Fab fragment (both ca 25 kDa), undigested antibody fragments (ca 50 kDa) and single domain antibodies of 13 kDa. The sdAbs were thus extracted from these bands and subjected to Mass Spectrometry analysis after tryptic digestion.

    [0337] Retrieval of sdAb Sequences by Bioinformatic Analysis.

    [0338] The VHH variable regions (sdAb) were specifically amplified by two-step nested PCR using the cDNA of Alpaca PBMCs as described in the Method section, and then subjected to sequencing.

    [0339] Bioinformatic analysis was performed to retrieve the full length sequences of affinity purified sdAbs, by comparing the two libraries obtained by high-throughput sequencing of the PBMCs (cDNA) and Mass spectrometry (peptides) (procedure depicted in FIG. 1). To this aim were used the “Llama magic software” v1.0. (https://github.com/FenyoLab/llama-magic) and an in-house modified version of Mascot software, which is a search engine for protein identification”. The modified version of the software was able of comparing the very large database of the high throughput sequencing with the very large database of the proteomic analysis, and to run each peptide dissociation spectra from the MS and compare to the open reading frames generated by the high throughput sequencing.

    [0340] This analysis enabled retrieval of 102 different sdAb sequences, and 36 were chosen for further analysis by recombinant expression in E. coli and further binding assays.

    Example 2: Expression of Selected sdAbs in E. coli and Further Analysis

    [0341] Selected sdAbs sequences were expressed in ArctivExpress® cells (E. coli) as described in detail in the Method section. FIG. 10 (panels A and B) demonstrates the validity of the procedure, using sdAb46 as example. The isolated sdAbs were then tested for binding on MCF-7 cells, known to express GloboH Gb4 and Gb5 at low levels, and by surface plasmon resonance (SPR). FIGS. 11-13 show results of the SPR on sdAbs37, sdAbs46, and sdAbs62. SdAb46 showed the highest affinity values, with an average of 54 nM affinity. Moreover the binding of the isolated sdAbs to globo-series glycan expressing cells was tested by flow cytometry (FIG. 14, 15, 16). Also in these experiments sdAb 46 resulted to be the antibody with the highest binding capacity to GloboH.

    [0342] These results demonstrate that the isolated single domain antibodies could bind with relatively high affinity to both native globo family structures expressed on cancer cells, as well as to synthetic and well characterised globo H structures on the SPR chip. For example sdAb62 resulted to bind HEK293 cells (FIG. 16) with more affinity than MCF-7 or MDA-MB-231 cells. This finding suggests that sdAb62 bind the glycans Gb3 and Gb4, expressed by HEK293, with more affinity than GloboH, which is expressed by MCF-7 but not by HEK293 cells.

    Example 3: NMR Characterizes the Binding Epitope and Bound Conformation of Globo-H to sdAb46

    [0343] Saturation transfer difference nuclear magnetic resonance (STD NMR) spectroscopy is a powerful technique for the study of glycan-protein interactions at atomic resolution, examining the carbohydrate part in contact with the protein.

    [0344] To examine the minimum recognition motif required by sdAb46 for binding, we mapped the binding epitope of sdAb46-bound Globo-H by STD NMR. Large saturation times of 4 s were required for a correct magnetization transfer of saturation from the protein to the ligand. Almost all protons from the Fucα(1-2)Galβ—moieties received saturating magnetization transfers from the protein but due to signal overlap, STD amplification factors were obtained only for a subset of protons (FIG. 18a). The corresponding binding epitope suggests that the Fucα(1-2)Galβ-motif makes closer contact with protons located in the protein binding pocket (FIG. 18b). Gb5 did not show significative STD signals in the presence of 110 μM sdAb46, suggesting that fucose is required for ligand recognition.

    [0345] To further support sdAb46 binding to Globo-H, we acquired transferred Nuclear Overhauser effects (trNOEs) from Globo-H in the presence and absence of sdAb46. A significantly faster rate for the NOE build-up was observed for Globo-H in the presence of sdAb46, further confirmed binding of Globo-H to the protein (FIG. 18c).

    [0346] In conclusion, the NMR results demonstrate that the selected single domain antibodies bind specifically to well-defined synthetic structures as well as to cell surfaces containing these epitopes.

    Example 4: Molecular Cloning of sdAb46 Trimer

    [0347] To improve sdAb binding, the next objective was to construct a trivalent version of sdAb46. From a separate project, a commercially obtained expression plasmid was available that encoded for a fusion protein made up of three sdAb46 units joined by GS-linkers, a His-tag at the N-terminus, and a lytic peptide (tachyplesin-I, abbreviated as TACHY) at the C-terminus. A trivalent sdAb46 construct was generated excluding the TACHY peptide by molecular cloning, in which a stop codon was inserted prior to the TACHY-coding sequence (FIG. 19a). A mutagenesis primer was designed, and a PCR reaction was performed to generate the DNA sequence including the additional stop codon. The PCR reaction was verified using agarose gel electrophoresis and a product with the size of ˜1500 bp (expected size: 1448 bp) was observed. The PCR product and the plasmid were both digested with the same restriction enzymes (XbaI, XhoI) and the products were again run on an agarose gel. For the digest of the 6571 bp plasmid, a 5192 bp and 1385 bp large fragment were expected, but slightly larger bands were observed at around 6000 bp and 1500 bp. Nevertheless, the upper band was assumed to represent the backbone and was extracted and ligated with the digested PCR product that served as the insert. Successful cloning was confirmed by DNA sequencing.

    [0348] After transformation, the protein was successfully expressed in SHuffle cells, as shown by SDS-PAGE, where a band with the expected size of 46.2 kDa was observed (FIG. 19b). The cell pellet was then lysed to assess the solubility of the sdAb46 trimer construct, but unfortunately a band corresponding to the trimer construct was observed only in the pellet sample and not the lysate suggesting the formation of inclusion bodies. This was previously observed for the original sdAb46 trimer-TACHY construct as well. Attempts to optimize the expression conditions (different IPTG concentrations, expression temperature, expression duration) could not improve the solubility for the TACHY construct and, therefore, establishing an inclusion body isolation and refolding protocol for the sdAb46 trimer was considered. The isolation was performed based on the protocol by Li Xu et al. (Biotechnol Appl Bioc, 2017). After the washing steps, a colorless pellet was obtained, which almost completely solubilized in 6 M urea. The solubilized inclusion bodies were further purified by Ni.sup.2+-NTA purification using an Fast protein liquid chromatography (FPLC) machine equipped with a HisTrap column and eluted with a 5-step imidazole gradient. The second elution step (˜39 mM imidazole) was already sufficient to elute the sdAb46 trimer, which was observed in the chromatogram and confirmed by SDS-PAGE. The highest absorbance value at 280 nm, ˜170 mAU, was reached with a concentration of ˜97 mM imidazole and higher imidazole concentrations resulted in only marginal elution of the remaining bound protein. SDS-PAGE analysis of the flow-through showed that large parts of the target protein remained unbound. Despite this and although not all of the denatured single domain antibody was refolded, 1.1 mg of folded protein was obtained.

    Example 5: Cell Binding of the Trivalent Globo H Single Domain Antibody

    [0349] In vitro binding assays were performed with the Globo H expressing breast cancer cell line MCF7. The neuroblastoma cell line IMR5, which does not express Globo H, was used as a negative control. These types of assays were performed by flow cytometry and fluorescent microscopy.

    [0350] For flow cytometry, cells were incubated with 0.4 mg/ml of sdAb46 monomer or sdAb46 trimer solution. 5 μg/ml of the anti-Globo H IgG VK9 was used as a positive control. Anti-IgG-Atto635 and anti-6×His-AF647 were used as secondary antibodies. The fluorescence intensities determined by flow cytometry were plotted compared to the secondary antibody-only negative controls. Binding to cells was quantified using a “positive cell” gate that was created based on the fluorescence intensity of the secondary antibody-only controls (FIG. 20a). As expected, VK9 binding was only observed for MCF7 cells (73.47±4.83%) but not for IMR5 cells (0.04±0.13%) confirming Globo H expression on MCF7 cells (FIG. 20b). Consistent with previous data, two MCF7 populations were seen in the histogram indicating different Globo H expression levels. A slight shift was observed for IMR5 cells incubated with sdAb46 monomer (1.17±0.71%) and sdAb46 trimer (4.19±3.92%) but MCF7 cells were more frequently bound by the sdAbs (3.65±0.51% for monomer (curve I) and 50.58±20.82% for trimer (curve II)). A two-sample t-test showed that the increased binding to MCF7 is significant for VK9 and both sdAb constructs. As anticipated, the sdAb46 trimer showed an improved MCF7 binding compared to the sdAb46 monomer.

    [0351] For the assay based on confocal laser scanning microscopy (FIG. 20c), cells were seeded on poly-L-lysine coated coverslips and incubated with 0.4 mg/ml of single domain antibody solution or 0.5 μg/ml of VK9. Anti-IgG-Atto635 and anti-6×His-AF647 were used as secondary antibodies and cell nuclei were stained with DAPI. Secondary antibody controls of MCF7 showed no fluorescence signal for either antibody, but unspecific anti-6×His-AF647 binding to IMR5 cells was observed. As expected, binding of VK9 to MCF7 and not to IMR5 was observed, and the two MCF7 populations detected in the flow cytometry experiments were also distinguishable in microscopy by different fluorescence intensities. sdAb46 binding was also confirmed, but surprisingly no differences in fluorescence intensities were observed for the monomer and the trimer. Interestingly, the staining pattern of the two sdAb46 forms differed from that of the VK9 antibody, as the two form of sdAb46 were mainly observed intracellularly, whereas VK9 was detected more strongly on the cell membrane and rather as patches. While IMR5 cells were unspecifically stained by anti-6×His-AF647, increased fluorescence was observed with sdAb46 monomer and trimer, indicating weak Nb binding which is consistent with flow cytometry results.