Production of human milk oligosaccharides in microbial hosts with engineered import / export

Abstract

The present invention relates to methods for the production of oligosaccharides in genetically modified bacterial host cells, as well as to the genetically modified host cells used in the methods. The genetically modified host cell comprises at least one recombinant glycosyltransferase, and at least one nucleic acid sequence coding for a protein enabling the export of the oligosaccharide.

Claims

1. A method for the production of lacto-N-triose II by a genetically modified microbial host cell, comprising providing a genetically modified microbial host cell that comprises: at least one recombinant ?-1,3-N-acetylglucosaminyltransferase, wherein the at least one recombinant ?-1,3-N-acetylglucosaminyltransferase belongs to the class of lgtA of Neisseria meningitidis, and increased expression of at least one sugar export protein capable of exporting the lacto-N-triose II, wherein the at least one sugar export protein is SetA from Cedecea neteri; cultivating the microbial host cell in a medium under conditions permissive for the production of the lacto-N-triose II, whereby the lacto-N-triose II is exported into the medium at an increased level compared to the unmodified microbial host cell, and obtaining the lacto-N-triose II from the medium.

2. A genetically modified microbial host cell for the production of lacto-N-triose II, wherein the microbial host cell comprises: at least one recombinant ?-1,3-N-acetylglucosaminyltransferase, wherein the at least one recombinant ?-1,3-N-acetylglucosaminyltransferase belongs to the class of lgtA of Neisseria meningitidis, and increased expression of at least one sugar export protein capable of exporting the lacto-N-triose II, wherein the at least one sugar export protein is SetA from Cedecea neteri.

Description

(1) The invention will be described in more detail in the examples and the attached figures, in which

(2) FIG. 1 shows a schematic illustration for the production of either lacto-N-triose II or lacto-N-tetraose in a host cell cultivated in a medium;

(3) FIG. 2 shows the results of the TLC analysis of culture extracts of lacto-N-triose II (LNT II) producing E. coli BL21(DE3) strains overexpressing the ?-1,3-N-acetyl glucosaminyltransferase gene PmnagT(13, 14);

(4) FIG. 3 shows the results of the TLC analysis of culture extracts of lacto-N-tetraose (LNT) producing E. coli BL21(DE3) strains overexpressing the ?-1,4-galactosyltransferase encoding genes BfgalT2 (1), PmgalT7(3), MsgalT8 (6), gatD (7), lex1 (9), IgtB (11) or IsgD (13);

(5) FIG. 4 shows the results of the TLC analysis of culture extracts of lacto-N-tetraose (LNT) producing E. coli BL21(DE3) strains overexpressing the ?-1,4-galactosyltransferase encoding genes KdgalT10 (1), cpsl14J (7), cpslaJ (8, 9), HpgalT (12);

(6) FIG. 5 shows the results of the TLC analysis of culture extracts of lacto-N-tetraose producing E. coli BL21(DE3) strains overexpressing the ?-1,4-galactosyltransferase encoding gene waaX (5);

(7) FIG. 6 shows the results of the TLC analysis of culture extracts of lacto-N-tetraose producing E. coli BL21(DE3) strains overexpressing the ?-1,3-galactosyltransferase encoding genes wbdO or furA;

(8) FIG. 7 shows the results of HPLC analyses of the culture supernatant of lacto-N-tetraose producing E. coli BL21 (DE3) strain. (A) Supernatant of E. coli BL21(DE3) 1353 and 1431 grown in the presence of glucose and lactose after 24 h of incubation. (B) Supernatant of E. coli BL21(DE3) 1353 and 1431 grown in the presence of glucose and lactose after 48 h of incubation;

(9) FIG. 8 shows a diagram depicting the relative concentration of lacto-N-tetraose in the supernatant of E. coli BL21 (DE3) strains overexpressing sugar efflux transporters compared to the control strain 1353; and

(10) FIG. 9 shows a diagram depicting concentrations of lacto-N-triose II in the supernatant of E. coli BL21 (DE3) strains overexpressing the sugar efflux transporters TP11 (2), YjhB (3) or TP70 (4).

EXAMPLES

(11) FIG. 1 shows a schematic drawing of an exemplary host cell 10 according to the invention, importing lactose and synthesizing lacto-N-triose II (LNT II) and lacto-N-tetraose (LNT). Lactose is imported from the medium the host cell is cultivated in into the cell via transporter 1. The enzyme N-acetylglucosaminyltransferase NacGlcT ligates N-acetylglucosamine to the acceptor substrate lactose, thus generating LNT-II. LNT-II is exported from the cell via exporter protein 20. Since LNT-II is a precursor of LNT or LNnT, the exporter exporting LNT-II represents an exporter protein exporting precursors of the latter oligosaccharides. As can further be seen from FIG. 1, the cell comprises a protein having ?-1,3-galactosyltransferase activity enabling the galactosylation of LNT-II to intracellularly generate LNT; the cell may also and/or alternatively comprise or ?-1,4-galactosyltransferase activity enabling the galactosylation of LNT-II to intracellularly generate lacto-N-neotetraose LNnt. LNTor as the case may be LNntis then exported, via a oligosaccharide exporter from the cell into the culture medium the cell is cultivated in.

(12) The exporters are membrane-bound, and their expression can be either overexpressed, whichin case of overexpression of the LNT-II exporter leads to an increased LNT-II export and to a decreased LNT export, whereas when the LNT-II exporting exporter protein is deleted or otherwise inactivated, this leads to an improved LNT-export. The LNT-II exporter preferably is an endogenous exporter protein, whereas the LNT-exporter protein preferably is a heterologous exporter protein.

Example 1

Development of an E. coli Lacto-N-Triose II Production Strain

(13) Escherichia coli BL21(DE3) was used to construct a lacto-N-triose II (LNT-2) producing strain. Metabolic engineering included mutagenesis and deletions of specific genes, respectively, and genomic integrations of heterologous genes. The genes lacZ and araA were inactivated by mutagenesis using mismatch-oligonucleotides as described by Ellis et al., High efficiency mutagenesis, repair, and engineering of chromosomal DNA using single-stranded oligonucleotides, Proc. Natl. Acad. Sci. USA 98: 6742-6746 (2001).

(14) Genomic deletions were performed according to the method of Datsenko and Warner (Proc. Natl. Acad. Sci. USA 97:6640-6645 (2000)). To prevent intracellular degradation of N-acetylglucosamine, genes encoding N-acetylglucosamine-6-phosphate deacetylase (nagA) and glucosamine-6-phosphate deaminase (nagB) were deleted from the genome of the E. coli strain BL21 (DE3) strain. Also genes wzxC-wcaJ were deleted. WcaJ encodes an UDP-glucose:undecaprenyl phosphate glucose-1-phosphate transferase catalysing the first step in colanic acid synthesis (Stevenson et al., J. Bacteriol. 1996, 178:4885-4893). In addition the genes fucI and fucK, coding for L-fucose isomerase and L-fuculose kinase, respectively, were removed.

(15) Genomic integration of heterologous genes was performed by transposition. Either the EZ-Tn5? transposase (Epicentre, USA) was used to integrate linear DNA-fragments or the hyperactive C9-mutant of the mariner transposase Himar1 (Lampe et al., Proc. Natl. Acad. Sci. 1999, USA 96:11428-11433) was employed for transposition. To produce EZ-Tn5 transposomes the gene of interest together with a FRT-site flanked antibiotic resistance marker was amplified with primer 1119 and 1120 (all primer used are listed in table 3 below); the resulting PCR-product carried on both sites the 19-bp Mosaic End recognition sites for the EZ-Tn5 transposase. For integration using Himar1 transposase expression constructs (operons) of interest were similarly cloned together with a FRT-site flanked antibiotic resistance marker into the pEcomar vector. The pEcomar vector encodes the hyperactive C9-mutant of the mariner transposase Himar1 under the control of the arabinose inducible promoter P.sub.araB. The expression fragment <P.sub.tet-lacY-FRT-aadA-FRT>(SeqID1) was integrated by using the EZ-Tn5 transposase. After successful integration of the gene for the lactose importer LacY from E. coli K12 TG1 (acc. no. ABN72583) the resistance gene was eliminated from streptomycin resistant clones by the FLP recombinase encoded on plasmid pCP20 (Datsenko and Warner, Proc. Natl. Acad. Sci. 2000, USA 97:6640-6645). The N-acetylglucosaminyltransferase gene lgtA from Neisseria meningitidis MC58 (acc. no. NP_274923) was codon-optimized for expression in E. coli and prepared synthetically by gene synthesis. Together with the gene galT, encoding a galactose-1-phosphate uridylyltransferase from E. coli K-12 substr. MG1655 (acc. no. NP_415279) that was similarly obtained by gene synthesis, lgtA was inserted by transposition (SeqID2) using plasmid pEcomar-lgtA-galT. To enhance de novo synthesis of UDP-N-acetylglucosamine, genes encoding L-glutamine:D-fuctose-6-phosphate aminotransferase (glmS), phosphoglucosamine mutase from E. coli K-12 substr. MG1655 (glmM) and N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase (glmU) from E. coli K-12 substr. MG1655 (acc. no. NP_418185, NP_417643, NP_418186, respectively) were codon-optimized and obtained by gene synthesis. The operon glmUM was cloned under the control of constitutive tetracyclin promoter P.sub.tet while glmS was cloned under the constitutive P.sub.T5 promoter. The transposon cassette <P.sub.tet-glmUM-P.sub.T5-glmS-FRT-dhfr-FRT>(SeqID3), flanked by the inverted terminal repeats specifically recognized by the mariner-like element Himar1 transposase was inserted from pEcomar-glmUM-glmS revealing a lacto-N-triose II production strain. Additionally, the expression fragment <P.sub.tet-lacY(6H/S)-FRT-aadA-FRT>(SeqID4) was integrated by using the EZ-Tn5 transposase.

(16) The gal-operon (galETKM) was amplified from E. coli K12 TG1 (SeqID6) using primer 605 and 606 and inserted into the galM ybhJ locus of E. coli BL21 (DE3) strain by homologous recombination facilitated by using the red recombinase helper plasmid pKD46 (Datsenko and Warner, Proc. Natl. Acad. Sci. 2000, USA 97:6640-6645). Sequences of the heterologous genes and gene clusters are deposit in appendix 1.

Example 2

Batch Fermentation of E. coli BL21 (DE3) 707 Screening Various ?-1,3-N-acetyl-glycosaminyl Transferases

(17) The gene for the ?-1,3-N-acetyl-glucosaminyltransferase PmnagT from Pasteurella multocida subsp. multocida str. HN06 (acc. no. PMCN06_0022) was codon-optimized and synthetically synthesized by GenScript Cooperation (Piscataway, USA). Cloning of the gene occurred by sequence and ligation-independent cloning into the plasmid pET-DUET (Merck KGaA, Darmstadt, Germany). All primer used for cloning are listed in table 3 below.

(18) E. coli BL21(DE3) 707 (table 2 below) harbouring plasmid pET-PmnagT coding for a ?-1,3-N-acetyl glucosaminyltransferase was grown at 30? C. in mineral salts medium (Samain et al., J. Biotech. 1999, 72:33-47) supplemented with 2% (wt/vol) glucose and ampicillin 100 ?g ml.sup.?1. When the cultures reached an OD660 nm of 0.1, gene expression was induced by addition of 0.3 mM IPTG. After four hours of incubation 1.5 mM lactose was added. After an additional incubation for 24 hours at 30C in shaking flasks cells were harvested. LNT-2 was detected by thin layer chromatography. Therefore, cells were mechanically disrupted in a defined volume using glass beads. Subsequently, samples were applied on TLC Silica Gel 60 F.sub.254 (Merck KGaA, Darmstadt, Germany). The mobile phase was composed of acetone:butanol:acetic acid:water (35:35:7:23).

(19) The result of the TLC analysis is shown in FIG. 2. The formation of a compound showing the same migration rate as the trisaccharide standard LNT-II could be observed when the gene PmnagT was overexpressed. The LNT-II production strain 724 served as a control (19). Standards for lactose (1) and LNT-II (2) are depicted. LNT-II product formation in the samples is marked by asterisks.

Example 3

Generation of an E. coli Lacto-N-Triose II Production Strain Overexpressing a Homologous Sugar Efflux Transporter

(20) The export of oligosaccharides produced in E. coli was proven to be a limiting factor during the fermentation process. However, trisaccharides like 2-fucosyllactose and LNT-2 are translocated into the culture supernatant to some extent, thus probably encoding a working sugar efflux transporter. In order to improve the efflux of lacto-N-triose II (LNT-II; GluNAc(1-3)Gal(?1-4)Glc), the E. coli BL21 (DE3) strain 1326 (table 2 below) was used for the screening of a library of sugar efflux transporters (SET). Putative SET proteins from E. coli were amplified from genomic DNA of E. coli BL21 (DE3) and integrated into vector pINT by sequence and ligation-independent cloning. Using the example of the gene yjhB, the primer 2567, 2568, 2526 and 2443 were used, generating the plasmid pINT-yjhB. The primer sequences used for cloning are listed in table 3 below.

(21) E. coli BL21(DE3) 1326 harbouring plasmids encoding for 20 different E. coli transporters were grown at 30? C. in mineral salts medium (Samain et al., J. Biotech. 1999, 72:33-47) supplemented with 2% (wt/vol) glucose, ampicillin 100 ?g ml.sup.?1 and zeocin 40 ?g ml.sup.?1. When the cultures reached an OD660 nm of 0.1, gene expression of the genes was induced by addition of 200 ng/ml anhydrotetracycline. After four hours of incubation 2.5 mM lactose was added. After an additional incubation for 24 and 48 hours at 30? C. in shaking flasks the LNT-II concentration in the supernatant was determined by LC-MS.

(22) Mass analysis was performed by characteristic fragment ion detection using an LC Triple-Quadrupole MS detection system. Precursor ions are selected and analyzed in quadrupole 1, fragmentation takes place in the collision cell using nitrogen as CID gas, selection of fragment ions is performed in quadrupole 3.

(23) Lacto-N-tetraose (LNT (Gal(?1-3)GlcNAc(?1-3)Gal(?1-4)Glc)), LNT-II and Maltotriose (internal standard for quantification) were analyzed in ESI positive ionization mode. LNT forms an ion of m/z 708.3 [M+H.sup.+], LNT-II an ion of m/z 546.1 [M+H.sup.+] and Maltotriose an ion of m/z 522.0 [M+NH.sub.4.sup.+]. Adduct formation of this carbohydrate [m/z 504.0] takes place with an ammonium ion (NH4.sup.+), resulting in mass shift of +18. Thus for Maltotriose a precursor ion of m/z 522.0 was selected. The precursor ion was further fragmented in the collision cell into the characteristic fragment ions m/z 487.1, m/z 325.0 and m/z 163.2. The molecular ion of LNT (m/z 708.3) was fragmented into m/z 546.3, m/z 528.3, m/z 366.2 and m/z 204.0. LNT-II (m/z 546.1) was fragmented into m/z 204.2, 186.0, 138.0 and 126.0 (see method description).

(24) Chromatographic separation of LNT and LNT-II was performed on a Luna NH.sub.2 HPLC column (Phenomenex, Aschaffenburg, Germany). This was necessary due to partial fragmentation of LNT during ionization resulting in LNT-II signals affecting quantification results of the individual carbohydrates.

(25) Only for the strain expressing the gene yjhB, an increased amount of LNT-2 in the culture supernatant was observed (see table 1 below).

(26) TABLE-US-00001 TABLE 1 Calculated concentrations of LNT-II in the culture supernatant of an E. coli BL21 (DE3) strain overexpressing yjhB and the reference strain. Calc. conc. Calc. conc. after 24 h of after 48 h of incubation incubation Analyte Sample [?M] [?M] RT 1326 751 1265 0.616 1326 pINT-yjhB 413 1975 0.609

Example 4

Batch Fermentations of E. coli BL21(DE3) 724 Screening Various ?-1,4-Galactosyltransferases

(27) The genes for the ?-1,4-galactosyltransferases lex1 from Aggregatibacter aphrophilus NJ8700 (acc. no. YP_003008647), PmgalT7 from Pasteurella multocida subsp. multocida str. HN06 (acc. No. PMCN06_0021), MsgalT8 from Myxococcus stipitatus DSM14675 (acc. no. MYSTI_04346), KdgalT10 from Kingella denitrificans ATCC 33394 (acc. no. HMPREF9098_2407), gatD from Pasteurella multocida M1404 (acc. no. GQ444331), BfgalT2 from Bacterioidis fragilis NCTC9343 (acc. no. BF9343_0585), IsgD from Haemophilus influenza (acc. no. AAA24981) and HpgalT from Helicobacter pylori (acc. no. AB035971) were codon-optimized and synthetically synthesized by GenScript Cooperation (Piscataway, USA). Cloning of the genes occurred by sequence and ligation-independent cloning (Li and Elledge, Nat Methods. 2007 March; 4(3):251-6.). Therefore, the plasmid pINT, harbouring the malE gene under control of an anhydrotetracyline-inducible promoter, was used, enabling the generation of a N-terminal fusion of the ?-1,4-galactosyltransferase genes with malE. Solely, the ?-1,4-galactosyltransferase encoding gene waaX from Pectobacterium atrosepticum JG10-08 (acc. no. ECA0154) was cloned into plasmid pACYC-Duet (Merck KGaA, Darmstadt, Germany). All primer used for cloning are listed in table 3 below.

(28) E. coli BL21(DE3) 724 (table 2 below) harbouring plasmid pCDF-galE and a plasmid coding for the gene fusion of malE with a ?-1,4-galactosyltransferase was grown at 30? C. in mineral salts medium (Samain et al., J. Biotech. 1999, 72:33-47) supplemented with 2% (wt/vol) glucose, ampicillin 100 ?g ml.sup.?1 and zeocin 40 ?g ml.sup.?1. When the cultures reached an OD660 nm of 0.1, gene expression of the galE gene and the ?-1,4-galactosyltransferase was induced by addition of 0.3 mM IPTG and 200 ng/ml anhydrotetracycline. E. coli BL21(DE3) 534 (table 2 below) harbouring plasmids pET-lgtA, pCOLA-glmUM-glmS, pCDF-galT-galE and pACYC-waaX was grown at 30? C. in mineral salts medium supplemented with 2% (wt/vol) glucose, ampicillin 100 ?g ml.sup.?1, chloramphenicol 34 ?g ml.sup.?1, streptomycin 50 ?g ml.sup.?1 and kanamycin 30 ?g ml.sup.?1. When the cultures reached an OD660 nm of 0.1, gene expression was induced by addition of 0.3 mM IPTG. Four hours after induction of gene expression 2 mM lactose were added. After an additional incubation for 48 hours at 30? C. in shaking flasks, cells were harvested and mechanically disrupted. Lacto-N-neotetraose (LNnT (Gal(?1-4)GlcNAc(?1-3)Gal(?1-4)Glc)) was detected by thin layer chromatography. Therefore, cells were mechanically disrupted using glass beads. Subsequently, samples were applied on TLC Silica Gel 60 F.sub.254 (Merck KGaA, Darmstadt, Germany). The mobile phase was composed of acetone:butanol:acetic acid:water (35:35:7:23).

(29) The results of the TLC analyses are shown in FIGS. 3-5. FIG. 3 shows the TLC analysis of culture extracts of lacto-N-tetraose (LNT) producing E. coli BL21(DE3) strains overexpressing the ?-1,4-galactosyltransferase encoding genes BfgalT2 (1), PmgalT7 (3), MsgalT8 (6), gatD (7), lex1 (9), IgtB (11) or IsgD (13). Standards for lactose (15), LNT-II (16) and LNnT (17) are depicted. LNnT product formation in the samples is marked by asterisks.

(30) FIG. 4 shows the TLC analysis of culture extracts of lacto-N-tetraose (LNT) producing E. coli BL21(DE3) strains overexpressing the ?-1,4-galactosyltransferase encoding genes KdgalT10 (1), cpsl14J (7), cpslaJ (8, 9), HpgalT (12). Standards for lactose (3, 15), LNT-II (4, 16) and LNnT (5, 17) are depicted. LNnT product formation in the samples is marked by asterisks.

(31) FIG. 5 shows the TLC analysis of culture extracts of lacto-N-tetraose producing E. coli BL21(DE3) strains overexpressing the ?-1,4-galactosyltransferase encoding gene waaX (5). Standards for lactose (1), LNT-II and LNnT (2) are depicted. Again, LNnT product formation in the samples is marked by asterisks.

(32) The formation of a compound showing the same migration rate as the tetrasaccharide standard LNnT could be observed when the following genes were overexpressed: lex1, PmgalT7, MsgalT8, BfgalT2, gatD, IsgD, KdgalT10, HpgalT, wax.

(33) The ?-1,4-galactosyltransferases cpslaJ and cpsl14J, known from literature to produce LNnT (Watanabe et al., J Biochem. 2002 February; 131(2):183-91; Kolkman et al., J Bacteriol. 1996 July; 178(13):3736-41), were also included in the activity screening and served as positive control. Using the described expression system, the formation of LNnT could be observed by CpslaJ and Cpsl14J (FIG. 3). In total, 11 out of 30 tested genes were observed to produce LNnT from LNT-II and UDP-galactose.

Example 5

Batch Fermentations of E. coli BL21(DE3) 534 Screening Different ?-1,3-Galactosyltransferases

(34) Using genomic DNA of E. coli K12 DH5a as template, galE was amplified using primer 1163 and 1162. The PCR product was purified, restricted with restriction endonucleases NdeI and XhoI and ligated into the second multiple cloning site of vector pCDFDuet (Merck KGaA, Darmstadt, Germany), which was cut with the same enzymes. GalE is expressed from the IPTG inducible T7 promoter. The E. coli K12 gene galT was amplified from genomic DNA and integrated into plasmid pCDF-galE by sequence and ligation-independent cloning using primer 991-994, producing the plasmid pCDF-galT-galE.

(35) Using the codon-optimized gene of lgtA as template, amplification occurred using primer 688 and 689. The PCR product was purified, restricted with restriction endonucleases NdeI and AatII and ligated into the multiple cloning site of vector pETDuet (Merck KGaA, Darmstadt, Germany), which was cut with the same enzymes, producing the plasmid pET-lgtA.

(36) Cloning of the codon-optimized gene construct of glmUM occurred by sequence and ligation-independent cloning into the plasmid pCOLA-Duet (Merck KGaA, Darmstadt, Germany) using primer 848-851. The codon-optimized form of glmS was amplified using primer 852 and 853. The PCR product was purified, restricted with restriction endonucleases NdeI and AatII and ligated into the second multiple cloning site of vector pCOLA-glmUM, which was cut with the same enzymes, producing the plasmid pCOLA-glmUM-glmS.

(37) The genes for the ?-1,3-galactosyltransferases wbdO from Salmonella enterica subsp. salamae serovar Greenside (acc. no. AY730594) and furA from Lutiella nitroferrum 2002 (FuraDRAFT_0419) were also codon-optimized and synthetically synthesized by GenScript Cooperation (Piscataway, USA). Cloning of the genes occurred by sequence and ligation-independent cloning into the plasmid pACYC-Duet (Merck KGaA, Darmstadt, Germany). All primer used for cloning are listed in table 3 below.

(38) E. coli BL21(DE3) 534 harbouring plasmids pET-lgtA, pCOLA-glmUM-glmS, pCDF-galT-galE and a plasmid coding for a ?-1,3-galactosyltransferase pACYC-furA or pACYC-wbdO was grown at 30? C. in mineral salts medium (Samain et al., J. Biotech. 1999, 72:33-47) supplemented with 2% (w/v) glucose, ampicillin 100 ?g ml-1, chloramphenicol 34 ?g ml.sup.?1, streptomycin 50 ?g ml.sup.?1 and kanamycin 30 ?g ml.sup.?1. When the cultures reached an OD660 nm of 0.1, gene expression was induced by addition of 0.3 mM IPTG. After four hours of incubation 2 mM lactose was added. After an additional incubation for 48 hours at 30? C. in shaking flasks, cells were harvested. LNT was detected by thin layer chromatography. Therefore, cells were mechanically disrupted using glass beads. Subsequently, samples were applied on TLC Silica Gel 60 F.sub.254 (Merck KGaA, Darmstadt, Germany). The mobile phase was composed of acetone:butanol:acetic acid:water (35:35:7:23).

(39) The results of the TLC analyses are shown in FIG. 6, showing TLC analysis of culture extracts of lacto-N-tetraose producing E. coli BL21(DE3) strains overexpressing the ?-1,3-galactosyltransferase encoding genes wbdO or furA. LNT product formation in the samples is marked. Out of 12 tested putative ?-1,3-galactosyltransferases, the formation of a compound showing the same migration rate as the tetrasaccharide standard LNT could only be observed when genes wbdO and furA were overexpressed.

Example 6

Development of an Improved Plasmid-Free E. coli Lacto-N-Tetraose Production Strain

(40) Escherichia coli BL21(DE3) strain 724 was used to construct a lacto-N-tetraose (LNT) producing strain. Metabolic engineering included the genomic integration of the transposon cassettes <P.sub.tet-wbdO-P.sub.T5-galE-FRT-cat-FRT>(SeqID5), flanked by the inverted terminal repeats specifically recognized by the mariner-like element Himar1 transposase, which was inserted from pEcomar-wbdO-galE. The resulting strain 1353 was further metabolically engineered to exhibit an increased intracellular LNT-II pool resulting in the elevated production of LNT. Therefore, the mayor facilitator superfamily transporter yjhB (acc. no. YP_003001824) was deleted from the genome of the E. coli strain, generating strain 1431 (table 2 below).

(41) Batch fermentation of the E. coli BL21(DE3) strains 1353 and 1431 was conducted for 48 hours at 30? C. in mineral salts medium (Samain et al., J. Biotech. 1999, 72:33-47) containing 2% (wt/vol) glucose as sole carbon and energy source. When the cultures reached an OD660 nm of 0.5, 2.5 mM lactose was added. The presence of LNT-II and LNT in the culture supernatant was detected by high performance liquid chromatography (HPLC).

(42) Analysis by HPLC was performed using a refractive index detector (RID-10A) (Shimadzu, Duisburg, Germany) and a ReproSil Carbohydrate, 5 ?m (250 mm?4.6 mm) (Dr. Maisch GmbH, Germany) connected to an HPLC system (Shimadzu, Duisburg, Germany). Elution was performed isocratically with acetonitril:H.sub.2O (68/32 (v/v)) as eluent at 35? C. and a flow rate of 1.4 ml/min. 40 ?l of the sample were applied to the column. Samples were filtered (0.22 ?m pore size) and cleared by solid phase extraction on an ion exchange matrix (Strata ABW, Phenomenex, Aschaffenburg, Germany).

(43) The results of the HPLC analyses are shown in FIG. 7, showing HPLC analyses of the culture supernatant of lacto-N-tetraose producing E. coli BL21 (DE3) strain. (A) Supernatant of E. coli BL21(DE3) 1353 (black graph) and 1431 (pink graph) grown in the presence of glucose and lactose after 24 h of incubation. (B) Supernatant of E. coli BL21(DE3) 1353 (blue graph) and 1431 (brown graph) grown in the presence of glucose and lactose after 48 h of incubation. As can be seen from the HPLC analyses, the deletion of yjhB in a LNT producing strain resulted in an elevated accumulation of LNT in the culture supernatant.

Example 7

Generation of an E. coli Lacto-N-Tetraose Production Strain Overexpressing a Sugar Efflux Transporter

(44) Since an export of lacto-N-tetraose into the medium is only moderate for production strains, a screening of a sugar efflux transporter library was conducted. In accordance to example 3 putative SET proteins were either amplified from E. coli genomic DNA or were codon-optimized and synthetically synthesized by GenScript Cooperation (Piscataway, USA). Following amplification genes were integrated into vector pINT by sequence and ligation-independent cloning. The primer design for the cloning of E. coli genes was in accordance to example 3. Synthetic genes were synthesized with standardized nucleotide overhangs and likewise integrated into the expression vector using the primer 2527, 2444, 2526 and 2443. The primer sequences used for cloning are listed in table 3 below.

(45) E. coli BL21(DE3) 1353 (table 2 below) harbouring plasmids encoding for 66 different transporters were grown at 30? C. in mineral salts medium (Samain et al., J. Biotech. 1999, 72:33-47) supplemented with 3% (w/v) glucose, 5 gl.sup.?1 NH.sub.4Cl.sub.2, ampicillin 100 ?g ml.sup.?1 and kanamycin 15 ?g ml.sup.?1. Precultivation appeared in 96-well plates harbouring a total volume of 200 ?l. After 24 h of incubation at 30? C. by continuous shaking, 50 ?l per well was transferred into 96-well deep well plates harbouring a total volume of 400 ?l mineral salts medium additionally supplemented with 200 ng ml.sup.?1 anhydrotetracycline and 10 mM lactose. After a sustained incubation for 24 to 48 hours the LNT concentrations in the supernatant were determined by LC-MS. Mass analysis was performed as described in example 3.

(46) FIG. 8 shows the relative concentration of lacto-N-tetraose in the supernatant of E. coli BL21 (DE3) strains overexpressing sugar efflux transporters compared to the control strain 1353. The LNT titer of strain 1353 was set to 100%. As shown in FIG. 8, the overexpression of 11 out of 66 genes resulted in a doubled LNT production. Among these, also a protein encoded in the genome of E. coli BL21 (DE3) proved to enhance the LNT export (TP37, yebQ, acc. no. NC_012971). YebQ is a predicted MFS transporter, putatively involved in multi drug efflux, which might represent a responsible transporter protein that realizes the observed basal efflux of LNT during fermentation of strain 1353.

(47) Furthermore, the exporters encoded by the genes spoVB of Bacillus amyloliquefaciens (TP1, acc. no. AFJ60154), yabM of Erwinia pyrilfoliae (TP2, acc. no. CAY73138), bcr of E. coli MG1655 (TP18, acc. no. AAC75243), ydeA of E. coli MG1655 (TP20, acc. no. AAC74601), proP2 of Haemophilus parainfluenzae (TP54, acc. no. EGC72107), setA of Pectobacterium carotovorum (TP55, acc. no. ZP_03829909), fucP of E. coli MG1655 (TP59, acc. no. AIZ90162), mdeA of Staphylococcus aureus Bmb9393 (TP61, acc. no. SABB_01261), ImrA of Lactococcus lactis (TP62, acc. no. L116532), setA of Pseudomonas sp. MT-1 (TP72, acc. no. BAP78849) and setA of Beauveria bassiana D1-5 (TP73, acc. no. KGQ13398) resulted in an increased LNT production when overexpressed in the E. coli production strain 1353.

Example 8

Generation of an E. coli Lacto-N-Triose II Production Strain by Overexpression of Heterologous Sugar Efflux Transporters

(48) The LNT exporter screening described in example 6 interestingly disclosed two proteinsTP11 from Mannheimia succiniciproducens MBEL55E (proP, acc. no. AAU37785) and TP70 from Cedecea neteri M006 (setA, acc. no. WP_039290253)whose overexpression resulted in a significantly increased production of LNT-II and consequently in a decreased LNT production (data not shown). This observation was confirmed in an experimental setup as described in example 3. The overexpression of the sugar efflux transporter YjhB served as a positive control. The overexpression of TP11 as well as TP70 resulted in an approximately 4-fold increase in LNT-II production which was even slightly more than for YjhB: FIG. 9 shows a diagram displaying the concentrations of lacto-N-triose II in the supernatant of E. coli BL21 (DE3) strains overexpressing the sugar efflux transporters TP11 (2), YjhB (3) or TP70 (4). Strain 1326 harbouring an empty control plasmid served as a control (1). Thus, 3 sugar efflux transporters were identified which target LNT-II for export and whose overexpression might be useful to engineer a LNT-II production strain.

(49) TABLE-US-00002 TABLE 2 Strains and plasmids Strain Genotype Ref. E. coli BL21(DE3) F-ompT hsdSB(rB-, mB-) gal dcm (DE3) Merck KGaA, Darmstadt, Germany E. coli BL21(DE3) 534 E. coli BL21(DE3) ?lacZ ?ara ?wcaJ This study ?fucIK ?nagAB harbouring genomic integrations of: galETKM, lacy E. coli BL21(DE3) 724 E. coli BL21(DE3) ?lacZ ?ara ?wcaJ This study ?fucIK ?nagAB harbouring genomic integrations of: galETKM, lacY, IgtA-galT- kanR, glmUM-glmS-dhfr E. coli BL21(DE3) 1326 E. coli BL21(DE3) ?lacZ ?ara ?wcaJ This study ?fucIK ?nagAB harbouring genomic integrations of: galETKM, lacY, IgtA-galT- kanR, glmUM-glmS-dhfr, lacy(6HIS)-aadA E. coli BL21(DE3) 707 E. coli BL21(DE3) ?lacZ ?ara ?wcaJ This study ?fucIK ?nagAB harbouring genomic integrations of: galETKM, lacY, glmUM- glmS-dhfr E. coli BL21(DE3) 1353 E. coli BL21(DE3) ?lacZ ?ara ?wcaJ This study ?fucIK ?nagAB harbouring genomic integrations of: galETKM, lacY, IgtA-galT- kanR, glmUM-glmS-dhfr, wbdO-galE-cat E. coli BL21(DE3) 1431 E. coli BL21(DE3) ?lacZ ?ara ?wcaJ This study ?fucIK ?nagAB harbouring genomic integrations of: galETKM, lacY, IgtA-galT- kanR, glmUM-glmS-dhfr, wbdO-galE-cat, ?yjhB-aacC1 pCDF-galE galE of E. coli K12 integrated into vector EP 14 162 869.3 pCDFDuet pET-IgtA (SeqID7) IgtA of Neisseria meningitidis integrated This study into vector pETDuet pCDF-galT-galE (SeqID8) galT and galE of Escherichia coli K12 This study integrated into vector pCDFDuet pCOLA-glmUM-glmS glmU, glmM and glmS of Escherichia coli This study (SeqID9) K12 integrated into vector pCOLADuet pINT-malE-lex1 Gene fusion of malE with lex-1 of EP 14 162 869.3 Aggregatibacter aphrophilus NJ8700 integrated into vector pINT pINT-malE-PmgalT7 Gene fusion of PmgalT7 of Pasteurella This study (SeqID10) multocida subsp. multocida str. HN06 integrated into vector pINT pINT-malE-MsgalT8 Gene fusion of MsgalT8 of Myxococcus This study stipitatus DSM14675 integrated into vector SeqID11) pINT pINT-malE-KdgalT10 Gene fusion of KdgalT10 of Kingella This study (SeqID12) denitrificans ATCC 33394 integrated into vector pINT pINT-malE-gatD (SeqID13) Gene fusion of gatD of Pasteurella This study multocida M1404 integrated into vector pINT pINT-malE-BFgalT2 Gene fusion of BfgalT2 of Bacterioidis This study (SeqID14) fragilis NCTC9343 integrated into vector pINT pINT-malE-IsgD (SeqID15) Gene fusion of IsgD of Haemophilus This study influenza integrated into vector pINT pINT-malE-HPgalT Gene fusion of HpgalT of Helicobacter This study (SeqID16) pylori integrated into vector pINT pACYC-waaX (SeqID17) waaX of Pectobacterium atrosepticum This study JG10-08 integrated into vector pACYCDuet pACYC-wbdO (SeqID18) wbdO of Salmonella enterica subsp. This study salamae serovar Greenside integrated into vector pACYCDuet pACYC-furA (SeqID19) furA of Lutiella nitroferrum 2002 integrated This study into vector pACYCDuet pET-PmnagT (SeqID20) PmnagT of Pasteurella multocida subsp. This study multocida str. HN06 integrated into vector pETDuet pINT-yjhB (SeqID21) yjhB of E. coli BL21 DE3 integrated into This study vector pINT pINT-yebQ (SeqID22) yebQ of E. coli BL21 DE3 integrated into This study vector pINT pINT-proP (SeqID23) proP of Mannheimia succiniciproducens This study MBEL55E integrated into vector pINT pINT-Cn-setA (SeqID24) setA of Cedecea neteri M006 integrated This study into vector pINT pINT-spoVB (SeqID25) spoVB of Bacillus amyloliquefaciens This study integrated into vector pINT pINT-yabM (SeqID26) yabM of Erwinia pyrifoliae integrated into This study vector pINT pINT-ydeA (SeqID27) ydeA of E. coli MG1655 integrated into This study vector pINT pINT-proP2 (SeqID28) proP2 of Haemophilus parainfluenzae This study integrated into vector pINT pINT-Pc-setA (SeqID29) setA of Pectobacterium carotovorum This study integrated into vector pINT pINT-fucP (SeqID30) fucP of Escherichia coli BL21 (DE3) This study integrated into vector pINT pINT-mdeA (SeqID31) mdeA of Staphylococcus aureus Bmb9393 This study integrated into vector pINT pINT-ImrA (SeqID32) ImrA of Lactococcus lactis integrated into This study vector pINT pINT-Ps-setA (SeqID33) setA of Pseudomonas sp. MT-1 integrated This study into vector pINT pINT-Bb-setA (SeqID34) setA of Beauveria bassiana D1-5 This study integrated into vector pINT

(50) TABLE-US-00003 TABLE3 OligonucleotidesusedforPCR Primer Sequence5-3 605KIgalfwd TTACTCAGCAATAAACTGATATTCCGTCAGGCTGG(SeqID35) 606KIgalrev TTGTAATCTCGCGCTCTTCACATCAGACTTTCCATATAGAGCGTAATTTC CGTTAACGTCGGTAGTGCTGACCTTGCCGGAGG(SeqID36) 1119ME-for CTGTCTCTTATCACATCTCCTGAAATGGCCAGATGTAATTCCTAATTTTT GTTG(SeqID37) 1120MErev CTGTCTCTTATCACATCTCACATTACATCTGAGCGATTGTTAGG (SeqID38) 1163galE_NdeI-for GATCACATATGAGAGTTCTGGTTACCGGTG(SeqID39) 1164galE_XhoI-rev GATCACTCGAGTCATTAATCGGGATATCCCTGTGGATGGC(SeqID40) 5176lex1pINT-f GTCGATGAAGCCCTGAAAGACGCGCAGACTATGCACTTCATTGAAAAC AAAAACTTCGTC(SeqID41) 5177lex1pINT-r GATGGCCTTTTTGCGTGTCGACGCGGCCGCCTAGATAAACAGGATGAT ATTTTTGCCTIG(SeqID42) 5178pINTlexl-f CAAGGCAAAAATATCATCCTGTTTATCTAGGCGGCCGCGTCGACACGC AAAAAGGCCATC(SeqID43) 5179pINTlexl-r GACGAAGTTTTTGTTTTCAATGAAGTGCATAGTCTGCGCGTCTTTCAGG GCTTCATCGAC(SeqID44) 5192waaXpINTfor GTCGATGAAGCCCTGAAAGACGCGCAGACTATGATTGATAACCTGATTA AGCGTACCCCG(SeqID45) 5193waaXpINTrev ATGGCCTTTTTGCGTGTCGACGCGGCCGCTTAATTCGAGCGGGTAAAG ATCTTCATCAGG(SeqID46) 5194pINTwaaXfor CTGATGAAGATCTTTACCCGCTCGAATTAAGCGGCCGCGTCGACACGC AAAAAGGCCATC(SeqID47) 5195pINTwaaXrev CGGGGTACGCTTAATCAGGTTATCAATCATAGTCTGCGCGTCTTTCAGG GCTTCATCGAC(SeqID48) 5164PmgalT7pINT GTCGATGAAGCCCTGAAAGACGCGCAGACTATGAGCGGTGAACACTAT for GTCATTAGCCTG(SeqID49) 5165PmgalT7pINT GATGGCCTTTTTGCGTGTCGACGCGGCCGCTCATTTAAATTCGATGATC rev ATCTTGTCGTT(SeqID50) 5166pINTPmgalT7 AACGACAAGATGATCATCGAATTTAAATGAGCGGCCGCGTCGACACGC for AAAAAGGCCATC(SeqID51) 5167pINTPmgalT7 CAGGCTAATGACATAGTGTTCACCGCTCATAGTCTGCGCGTCTTTCAGG rev GCTTCATCGAC(SeqID52) 5168MsgalT8pINT GTCGATGAAGCCCTGAAAGACGCGCAGACTATGGATGAAATCAAACTG for TCGGTGGTTATG(SeqID53) 5169MsgalT8pINT GATGGCCTTTTTGCGTGTCGACGCGGCCGCTCATTGGCGACGCCAATC rev GAACGCAACGCG(SeqID54) 5170pINTMsgalT8 CGCGTTGCGTTCGATTGGCGTCGCCAATGAGCGGCCGCGTCGACACG for CAAAAAGGCCATC(SeqID55) 5171pINTMsgalT8 CATAACCACCGACAGTTTGATTTCATCCATAGTCTGCGCGTCTTTCAGG rev GCTTCATCGAC(SeqID56) 5561KdgalT10 GTCGATGAAGCCCTGAAAGACGCGCAGACTATGGAAAACTATGTCGTC pINTfor TCTATCCGCACC(SeqID57) 5562KdgalT10 GATGGCCTTTTTGCGTGTCGACGCGGCCGCTCATTTGAACGGAACAAT pINT-rev CTTTTTGTCATC(SeqID58) 5563pINT- GATGACAAAAAGATTGTTCCGTTCAAATGAGCGGCCGCGTCGACACGC KdgalT10for AAAAAGGCCATC(SeqID59) 5564pINT- GGTGCGGATAGAGACGACATAGTTTTCCATAGTCTGCGCGTCTTTCAG KdgalT10rev GGCTTCATCGAC(SeqID60) 5172gatDpINTfor GTCGATGAAGCCCTGAAAGACGCGCAGACTATGTCCTCAGCTTTCCATT ACGTCATTAGC(SeqID61) 5173gatDpINTrev GATGGCCTTTTTGCGTGTCGACGCGGCCGCTCATTCAAATTCGATAATC ATGGTGATTTT(SeqID62) 5174pINTgatDfor AAAATCACCATGATTATCGAATTTGAATGAGCGGCCGCGTCGACACGCA AAAAGGCCATC(SeqID63) 5175pINTgatDrev GCTAATGACGTAATGGAAAGCTGAGGACATAGTCTGCGCGTCTTTCAG GGCTTCATCGAC(SeqID64) 5160BfglaT2pINT GTCGATGAAGCCCTGAAAGACGCGCAGACTATGAACGTGAATAAGCCG for ACCACCGAAAAG(SeqID65) 5161BfgalT2pINT GATGGCCTTTTTGCGTGTCGACGCGGCCGCTCAGTATTCTTCAATTTTG rev TCCAGTTGATA(SeqID66) 5162pINTBfgalT2 TATCAACTGGACAAAATTGAAGAATACTGAGCGGCCGCGTCGACACGC for AAAAAGGCCATC(SeqID67) 5163pINTBfgalT2 CTTTTCGGTGGTCGGCTTATTCACGTTCATAGTCTGCGCGTCTTTCAGG rev GCTTCATCGAC(SeqID68) 5746 GTGATCAACGCCGCCAGCGGTCGTCAGACTGTCGATGAAGCCCTGAAA GACGCGCAGACT(SeqID69) 5747 GCGGCCGCGTCGACACGCAAAAAGGCCATCCATCCGTCAGGATGGCC TTCTGCTTAATTT(SeqID70) 5748 AAATTAAGCAGAAGGCCATCCTGACGGATGGATGGCCTTTTTGCGTGT CGACGCGGCCGC(SeqID71) 5749 AGTCTGCGCGTCTTTCAGGGCTTCATCGACAGTCTGACGACCGCTGGC GGCGTTGATCAC(SeqID72) 1886SLICwbdO GTTTAACTTTAATAAGGAGATATACCATGCTGACGGAAGTGCGCCCGGT pACYCfor CTCTACGACGAAACCGC(SeqID73) 1887SLICwbdO CGACCTGCAGGCGCGCCGAGCTCGAATTCATTTGATGTATTTGCAATA pACYCrev GAACACAGAAAAGACCGT(SeqID74) 1888SLICpACYC GTGTTCTATTGCAAATACATCAAATGAATTCGAGCTCGGCGCGCCTGCA wbdorev GGTCGACAAGCTTGCGG(SeqID75) 1889SLICpACYC GAGACCGGGCGCACTTCCGTCAGCATGGTATATCTCCTTATTAAAGTTA Wbd0For AACAAAATTATTTCTACAGG(SeqID76) 1890SLICpACYC GTATGGTGACCCTGTGGCGCAAATGAGAATTCGAGCTCGGCGCGCCTG furArev CAGGTCGACAAGCT(SeqID77) 1891SLICpACYC GCGCTGCCCTGTTTGATTTTATCCATGGTATATCTCCTTATTAAAGTTAA furAfor ACAAAATTATTTCT(SeqID78) 1892SLICfurA CCTGCAGGCGCGCCGAGCTCGAATTCTCATTTGCGCCACAGGGTCACC pACYCrev ATACGTGCCGGCAGG(SeqID79) 1893SLICfurA GITTAACTTTAATAAGGAGATATACCATGGATAAAATCAAACAGGGCAG pACYCfor CGCCTCTCTGGTTGTCG(SeqID80) 3055SLICPmnagT CAGACTCGAGGGTACCGACGTCCTAATAAGTAGATGAATATTTATCAGG pETrev ACGAAGAT(SeqID81) 3056SLICpET AACTAAAGGTTTATTTTCCATATGTATATCTCCTTCTTATACTTAACTAAT PmnagTfor ATAC(SeqID82) 3057SLICpET TAAATATTCATCTACTTATTAGGACGTCGGTACCCTCGAGTCTGGTAAA PmnagTrev GAAACCGCTGCTGCG(SeqID83) 3058SLICPmnagT GTATAAGAAGGAGATATACATATGGAAAATAAACCTTTAGTTTCAGTTTT pETfor GATTTGTGC(SeqID84) 2567_SLIC_yjhB-for TAACTTTAAGAAGGAGATATACAAGAGCTCGAGTCGAAGGAGATAGAAC CATGGCAACAGCATGGTATAAACAAG(SeqID85) 2568_SLIC_yjhB- GCGTGTCGACGCGTTTAGAGGCCCCAAGGGGTTATGCTAGTATCGATT rev TATCATTTAGCCACGGATAGTTTATAAATTTTAC(SeqID86) 2526_SLIC_pINT_ GGTTCTATCTCCTTCGACTCGAGCTCTTGTATATCTCCTTCTTAAAGTTA TP-rev AACAAAATTATTTCTAGATTTTTGTCGAAC(SeqID87) 2443_SLIC_pINT_ TAAATCGATACTAGCATAACCCCTTGGGGCCTCTAAACGCGTCGACAC TP-forw GCAAAAAGGCCATCC(SeqID88) 2527_SLIC_TP_pINT- GTTCGACAAAAATCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATAT forw ACAAGAGCTCGAGTCGAAGGAGATAGAACC(SeqID89) 2444_SLIC_TP_pINT- GGATGGCCTTTTTGCGTGTCGACGCGTTTAGAGGCCCCAAGGGGTTAT rev GCTAGTATCGATTTA(SeqID90) 688IgtAAatIIrev ATATGACGTCTCATTAGCGGTTTTTCAGGAGACG(SeqID91) 689IgtANdeIfor ATATCATATGCCGTCCGAAGCATTCCGTCGTCACC(SeqID92) 991galT-pCDFfor TAACTTTAATAAGGAGATATACCATGACGCAATTTAATCCCGTTGATCAT CCACATCGCCGC(SeqID93) 992pCDF-galTfor ATTTTCGCGAATCCGGAGTGTAAAAGCTTGCGGCCGCATAATGCTTAAG TCGAACAGAAAGTAATCG(SeqID94) 993galT-pCDFrev AAGCATTATGCGGCCGCAAGCTTTTACACTCCGGATTCGCGAAAATGG ATATCGCTGACTGCGCGCAAACGC(SeqID95) 994pCDF-galTrev TCAACGGGATTAAATTGCGTCATGGTATATCTCCTTATTAAAGTTAAACA AAATTATTTCTACAGGGG(SeqID96) 848gImMpCOLA ATGGTGATGGCTGCTGCCCATTTAAACCGCTTTGACTGCGTCGGCAATA SLICrev CGGTGCGC(SeqID97) 849glmUpCOLA GTTTAACTTTAATAAGGAGATATACCATGCTGAACAACGCGATGTCTGTT SLICfor GTTATCCTGG(SeqID98) 850pCOLAglmM CGCAGTCAAAGCGGTTTAAATGGGCAGCAGCCATCACCATCATCACCA SLICrev CAGCC(SeqID99) 851pCOLAglmU TCGCGTTGTTCAGCATGGTATATCTCCTTATTAAAGTTAAACAAAATTAT SLICfor TTCTACAGG(SeqID100) 852glmScopCOLA ATATATCATATGTGCGGTATCGTTGGTGCTATCGC(SeqID101) forNdel 853glmScopCOLA ATATATGACGTCTTATTCCACGGTCACGGATTTCGC(SeqID102) revAatII