Lactic acid bacteria and use thereof
12036253 ยท 2024-07-16
Assignee
- UNIVERSITY-INDUSTRY COOPERATION GROUP OF KYUNG HEE UNIVERSITY (Gyeonggi-do, KR)
- NAVIPHARM CO., LTD. (Gyeonggi-Do, KR)
Inventors
Cpc classification
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A23L33/135
HUMAN NECESSITIES
C12R2001/01
CHEMISTRY; METALLURGY
International classification
A61K35/00
HUMAN NECESSITIES
Abstract
The present invention relates to Lactobacillus plantarum NK3 and Bifidobacterium longum NK49, which are novel lactic acid bacteria and, more particularly, to a composition comprising novel lactic acid bacteria useful for prevention and treatment of inflammatory diseases.
Claims
1. A method of treating an inflammatory disease comprising administering to a mammalian subject having a symptom of the disease an effective amount of Lactobacillus plantarum NK3 having the accession number KCCM12089P, wherein said inflammatory disease is colitis or vaginitis.
2. The method of claim 1, wherein the Lactobacillus plantarum NK3 having the accession number KCCM12089P comprises the 16S rDNA sequence of SEQ ID NO: 1.
3. The method of claim 1, wherein the Lactobacillus plantarum NK3 having the accession number KCCM12089P is a live bacterial cell thereof or a dead bacterial cell thereof.
4. The method of claim 1, wherein the said inflammatory disease is colitis and said administering is oral administering.
5. The method of claim 1, wherein the said inflammatory disease is vaginitis and said administering is oral or intravaginal administering.
6. The method of claim 1, wherein the effective amount is 1?10.sup.2 to 1?10.sup.11 CFU/kg a day.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6) G: Group treated with Gardnerella vaginalis only; GL5, GL6, GL7: Group treated with Gardnerella vaginalis and then treated with Lactobacillus plantarum at 1?10.sup.6 CFU/mL, 1?10.sup.7 CFU/mL and 1?10.sup.8 CFU/mL respectively; and GB5, GB6, GB7: Group treated with Gardnerella vaginalis and then treated with Bifidobacterium longum at 1?10.sup.6 CFU/mL, 1?10.sup.7 CFU/mL and 1?10.sup.8 CFU/mL respectively.
(7)
(8) N: Normal group; GC: Group infected with Gardnerella vaginalis only; oGL, oGB, oGM: Group of experimental animals infected with Gardnerella vaginalis, orally dosed with respective Lactobacillus plantarum, Bifidobacterium longum or a mixture thereof; and vGL, vGB, vGM: Group of experimental animals infected with Gardnerella vaginalis, intravaginally dosed with respective Lactobacillus plantarum, Bifidobacterium longum or a mixture thereof. Hereinafter the same.
(9)
(10)
(11)
(12)
(13)
MODE FOR INVENTION
(14) Hereinafter, the present invention will be described in detail through preferred Examples for better understanding of the present invention. However, the following Examples are provided only for the purpose of illustrating the present invention, and thus the present invention is not limited thereto.
EXAMPLE 1
Isolation and Identification of Lactic Acid Bacteria
(15) (1) Isolation of Lactic Acid Bacteria from Human Feces
(16) Human feces were inserted and suspended in GAM liquid medium (GAM broth; Nissui Pharmaceutical, Japan). After that, the supernatant was taken and transplanted into BL agar medium (Nissui Pharmaceutical, Japan), and then anaerobically cultured at 37? C. for about 48 hours, so as to isolate colony-forming strains therefrom.
(17) (2) Isolation of Lactic Acid Bacteria from Kimchi
(18) Cabbage kimchi, radish kimchi or green onion kimchi was crushed respectively, after which crushed supernatant was taken and transplanted into MRS agar medium (Difco, USA), and then anaerobically cultured at 37? C. for about 48 hours, so as to isolate colony-forming strains therefrom.
(19) (3) Identification of Isolated Lactic Acid Bacteria
(20) Physiological characteristics and 16S rDNA sequences of the strains isolated from human feces or kimchi were analyzed to identify species of the strains, and then names were given to the strains. Strain names given to lactic acid bacteria are the same as shown in the following table 1. Particularly, the lactic acid bacteria isolated from kimchi were five species of Lactobacillus plantarum (management nos. 1 to 5 of Table 1), five species of Lactobacillus brevis (management nos. 6 to 10 of Table 1), five species of Lactobacillus sakei (management nos. 11 to 15 of Table 1), and five species of Lactobacillus curvatus (management nos. 16 to 20 of Table 1). The lactic acid bacteria isolated from human feces were five species of Lactobacillus rhamnosus (management nos. 21 to 25 of Table 1), five species of Lactobacillus plantarum (management nos. 26 to 30 of Table 1), five species of Lactobacillus reuteri (management nos. 31 to 35 of Table 1), four species of Lactobacillus johnsonii (management nos. 36 to 39 of Table 1), three species of Lactobacillus mucosae (management nos. 40 to 42 of Table 1), three species of Bifidobacterium adolescentis (management nos. 43 to 45 of Table 1), and five species of Bifidobacterium longum (management nos. 46 to 50 of Table 1).
(21) TABLE-US-00001 TABLE 1 Management no. Strain name 1 Lactobacillus plantarum NK1 2 Lactobacillus plantarum NK2 3 Lactobacillus plantarum NK3 4 Lactobacillus plantarum NK4 5 Lactobacillus plantarum NK5 6 Lactobacillus brevis NK6 7 Lactobacillus brevis NK7 8 Lactobacillus brevis NK8 9 Lactobacillus brevis NK9 10 Lactobacillus brevis NK10 11 Lactobacillus sakei NK11 12 Lactobacillus sakei NK12 13 Lactobacillus sakei NK13 14 Lactobacillus sakei NK14 15 Lactobacillus sakei NK15 16 Lactobacillus curvatus NK16 17 Lactobacillus curvatus NK17 18 Lactobacillus curvatus NK18 19 Lactobacillus curvatus NK19 20 Lactobacillus curvatus NK20 21 Lactobacillus rhamnosus NK21 22 Lactobacillus rhamnosus NK22 23 Lactobacillus rhamnosus NK23 24 Lactobacillus rhamnosus NK24 25 Lactobacillus rhamnosus NK25 26 Lactobacillus plantarum NK26 27 Lactobacillus plantarum NK27 28 Lactobacillus plantarum NK28 29 Lactobacillus plantarum NK29 30 Lactobacillus plantarum NK30 31 Lactobacillus reuteri NK31 32 Lactobacillus reuteri NK32 33 Lactobacillus reuteri NK33 34 Lactobacillus reuteri NK34 35 Lactobacillus reuteri NK35 36 Lactobacillus johnsonii NK36 37 Lactobacillus johnsonii NK37 38 Lactobacillus johnsonii NK38 39 Lactobacillus johnsonii NK39 40 Lactobacillus mucosae NK40 41 Lactobacillus mucosae NK41 42 Lactobacillus mucosae NK42 43 Bifidobacterium adolescentis NK43 44 Bifidobacterium adolescentis NK44 45 Bifidobacterium adolescentis NK45 46 Bifidobacterium longum NK46 47 Bifidobacterium longum NK47 48 Bifidobacterium longum NK48 49 Bifidobacterium longum NK49 50 Bifidobacterium longum NK50
(22) (4) Physiological Characteristics of Novel Lactic Acid Bacterium Lactobacillus Plantarum NK3
(23) Out of strains described in Table 1 above, it was identified that Lactobacillus plantarum NK3 (accession number KCCM12089P) is a gram-positive bacillus. Also, it was shown that 16S rDNA of Lactobacillus plantarum NK3 has a sequence of SEQ ID NO: 1. As a result of comparing the 16S rDNA sequence of Lactobacillus plantarum NK3 through BLAST search, it was shown that a Lactobacillus plantarum strain having the same 16S rDNA sequence is not searched at all, and the sequence was 99% homologous to the 16S rDNA sequence of a generally known Lactobacillus plantarum strain.
(24) Out of physiological characteristics of Lactobacillus plantarum NK3, availability of carbon source was analyzed with a sugar fermentation test using API 50 CHL kit. The results thereof are the same as shown in a following table 2. In Table 2 below, + indicates that the availability of carbon source is positive and ? indicates that the availability of carbon source is negative.
(25) TABLE-US-00002 TABLE 2 Carbon source NK3 Carbon source NK3 CONTROL ? Esculin + Glycerol ? Salicin + Erythritol ? Cellobiose + D-arabinose ? Maltose + L-arabinose + Lactose + D-ribose + Melibiose + D-xylose ? Sucrose + L-xylose ? Trehalose + D-adonitol ? Inulin ? Methyl-BD-xylopyranoside ? Melezitose + D-galactose + Raffinose ? D-glucose + Starch ? D-fructose + Glycogen ? D-mannose + Xylitol ? L-sorbose ? Gentiobiose + Rhamnosus ? D-furanose + Dulcitol ? D-lyxose ? Inositol ? D-tagatose ? Mannitol + D-fucose ? Solbitol + L-fucose ? ?-methyl-D-mannoside ? D-arabitol ? ?-methyl-D-glucoside ? L-arabitol ? N-acetyl-glucosamine + Gluconate ? Amygdalin + 2-keto-gluconate ? Arbutin + 5-keto-gluconate ?
(26) (5) Physiological Characteristics of Novel Lactic Acid Bacterium Bifidobacterium Longum NK49
(27) Out of strains described in Table 1 above, it was identified that Bifidobacterium longum NK49 (accession number KCCM12088P) is a gram-positive bacillus. Also, it was shown that 16S rDNA of Bifidobacterium longum NK49 has a sequence of SEQ ID NO: 2. As a result of comparing the 16S rDNA sequence of Bifidobacterium longum NK49 through BLAST search, it was shown that a Bifidobacterium longum strain having the same 16S rDNA sequence is not searched at all, and 99% homologous to the 16S rDNA sequence of a generally known Bifidobacterium longum strain.
(28) Out of physiological characteristics of Bifidobacterium longum NK49, availability of carbon source was analyzed with a sugar fermentation test using API 50 CHL kit. The results thereof are the same as shown in a following table 3. In Table 3 below, + indicates that the availability of carbon source is positive and ? indicates that the availability of carbon source is negative.
(29) TABLE-US-00003 TABLE 3 Carbon source NK49 Carbon source NK49 CONTROL ? Esculin + Glycerol ? Salicin + Erythritol ? Cellobiose ? D-arabinose ? Maltose + L-arabinose + Lactose + D-ribose + Melibiose + D-xylose ? Sucrose + L-xylose ? Trehalose ? D-adonitol ? Inulin ? Methyl-BD-xylopyranoside ? Melezitose ? D-galactose + Raffinose + D-glucose + Starch ? D-fructose + Glycogen ? D-mannose ? Xylitol ? L-sorbose ? Gentiobiose ? Rhamnosus ? D-turanose ? Dulcitol ? D-lyxose ? Inositol ? D-tagatose ? Mannitol + D-fucose ? Sorbitol + L-fucose ? ?-methyl-D-mannoside ? D-arabitol ? ?-methyl-D-glucoside ? L-arabitol ? N-acetyl-glucosamine ? Gluconate ? Amygdalin ? 2-keto-gluconate ? Arbutin ? 5-keto-gluconate ?
EXAMPLE 2
Comparison of Activity of Isolated Lactic Acid Bacteria
(30) (1) Antioxidant Activity (In Vitro)
(31) DPPH (2,2-Diphenyl-1-picrylhydrazyl) was dissolved in ethanol to reach a 0.2 mM concentration, such that a DPPH solution was prepared. A suspension of lactic acid bacteria (1?10.sup.6 CFU/ml) or a vitamin C solution (1 g/ml) was inserted into 0.1 ml of said DPPH solution, and then cultured at 37? C. for 20 minutes. A culture fluid was centrifuged at 3000 rpm for five minutes, such that supernatant was obtained. After that, an absorbance of the supernatant was measured at 517 nm, and then antioxidant activity of isolated lactic acid bacteria was calculated accordingly. Antioxidant activity for each lactic acid bacterium is the same as shown in a following table 4.
(32) (2) Measurement of Inflammatory Indicators in Macrophage
(33) 2 ml of sterilized 4% Thioglycolate was intraperitoneally administered into a C57BL/6 mouse (male, 6 weeks old and 20-23 g). In 96 hours later, the mouse was anesthetized, and then 8 ml of RPMI 1640 medium was intraperitoneally administered to the mouse. In 5 to 10 minutes later, the RPMI medium (macrophage) was intraperitoneally extracted from the mouse, then centrifuged at 1000 g for 10 minutes, and then washed twice again with RPMI 1640 medium. Said macrophage was plated in a 24-well plate at 0.5?10.sup.6 per well, and then treated with the isolated lactic acid bacteria (final treatment concentration: 1?10.sup.4 cfu/ml, hereinafter the same) and lipopolysaccharide (LPS), which is an inflammatory reaction inducer, for 2 or 24 hours, such that supernatant and cells were obtained therefrom. The obtained cells were inserted into an RIPA buffer (Gibco) and homogenized. An expression level of cytokines such as TNF-?, IL-10, etc. was measured from a culture supernatant treated for 24 hours and expression levels of p65 (NF-?B), p-p65 (phosphor-NF-?B) and (?-actin were measured from the cells obtained with treatment for two hours through an immunoblotting method. Expression levels of inflammation indicators for each lactic acid bacterium are the same as shown in a following table 4.
(34) (Criteria when measuring activity in Table 4: +++, >90%, very strong; ++, >60-90%, strong; +, >20-60%, weak; and ?, <20%, insignificant effect, the same as Table 5)
(35) TABLE-US-00004 TABLE 4 TNF-? IL-10 NF-kB Antioxidant inhibitory expression inhibitory Management no. Strain name activity capacity increase capacity 1 Lactobacillus plantarum NK1 + + + + 2 Lactobacillus plantarum NK2 + ++ + + 3 Lactobacillus plantarum NK3 +++ +++ +++ +++ 4 Lactobacillus plantarum NK4 + + + ++ 5 Lactobacillus plantarum NK5 ++ ++ ++ ++ 6 Lactobacillus brevis NK6 + + + + 7 Lactobacillus brevis NK7 + + + + 8 Lactobacillus brevis NK8 + + + + 9 Lactobacillus brevis NK9 + + + + 10 Lactobacillus brevis NK10 ? + + + 11 Lactobacillus sakei NK11 + + + + 12 Lactobacillus sakei NK12 ? ++ + + 13 Lactobacillus sakei NK13 ? ++ ++ + 14 Lactobacillus sakei NK14 ? + + + 15 Lactobacillus sakei NK15 + + + + 16 Lactobacillus curvatus NK16 + + + + 17 Lactobacillus curvatus NK17 + + + + 18 Lactobacillus curvatus NK18 + + + + 19 Lactobacillus curvatus NK19 + + + + 20 Lactobacillus curvatus NK20 + + + + 21 Lactobacillus rhamnosus NK21 + + + + 22 Lactobacillus rhamnosus NK22 + + + + 23 Lactobacillus rhamnosus NK23 + + + + 24 Lactobacillus rhamnosus NK24 ++ + + + 25 Lactobacillus rhamnosus NK25 ++ ++ ++ ++ 26 Lactobacillus plantarum NK26 + + + + 27 Lactobacillus plantarum NK27 + + + + 28 Lactobacillus plantarum NK28 + + + + 29 Lactobacillus plantarum NK29 + + + + 30 Lactobacillus plantarum NK30 + + + + 31 Lactobacillus reuteri NK31 + + + + 32 Lactobacillus reuteri NK32 ++ ++ ++ ++ 33 Lactobacillus reuteri NK33 +++ ++ ++ ++ 34 Lactobacillus reuteri NK34 + + + + 35 Lactobacillus reuteri NK35 + + + + 36 Lactobacillus johnsonii NK36 ++ ++ ++ + 37 Lactobacillus johnsonii NK37 ++ ++ ++ ++ 38 Lactobacillus johnsonii NK38 + + + + 39 Lactobacillus johnsonii NK39 + + + + 40 Lactobacillus mucosae NK40 ++ ++ ++ ++ 41 Lactobacillus mucosae NK41 ++ ++ +++ +++ 42 Lactobacillus mucosae NK42 + + + + 43 Bifidobacterium adolescentis NK43 + + + + 44 Bifidobacterium adolescentis NK44 ++ ++ ++ ++ 45 Bifidobacterium adolescentis NK45 + + + + 46 Bifidobacterium longum NK46 +++ ++ +++ +++ 47 Bifidobacterium longum NK47 ++ ++ ++ ++ 48 Bifidobacterium longum NK48 + + + + 49 Bifidobacterium longum NK49 +++ +++ +++ +++ 50 Bifidobacterium longum NK50 + + + +
(36) (3) Effect on ZO-1 Protein Expression in Caco2 Cells
(37) Caco2 cells, which are colon cancer cells, were purchased from the Korean Cell Line Bank, then cultured in RPMI 1640 medium for 48 hours, and then were seeded in a 12-well plate at 2?10.sup.6 cells per well. Each well was treated with 1 ?g of LPS only, or treated with 1 ?g of LPS and 1?10.sup.4 CFU of lactic acid bacteria together, and then cultured for 24 hours. After that, the cultured cells were collected from each well, and an expression level of ZO-1, which is a tight junction protein, was measured by an immunoblotting method. Expression levels of ZO-1 for each lactic acid bacterium are the same as shown in a following table 5.
(38) TABLE-US-00005 TABLE 5 ZO-1 Expression Management no. Strain name increase 1 Lactobacillus plantarum NK1 + 2 Lactobacillus plantarum NK2 + 3 Lactobacillus plantarum NK3 ++ 4 Lactobacillus plantarum NK4 + 5 Lactobacillus plantarum NK5 ++ 6 Lactobacillus brevis NK6 + 7 Lactobacillus brevis NK7 + 8 Lactobacillus brevis NK8 + 9 Lactobacillus brevis NK9 + 10 Lactobacillus brevis NK10 ? 11 Lactobacillus sakei NK11 + 12 Lactobacillus sakei NK12 ? 13 Lactobacillus sakei NK13 + 14 Lactobacillus sakei NK14 + 15 Lactobacillus sakei NK15 + 16 Lactobacillus curvatus NK16 + 17 Lactobacillus curvatus NK17 + 18 Lactobacillus curvatus NK18 + 19 Lactobacillus curvatus NK19 + 20 Lactobacillus curvatus NK20 + 21 Lactobacillus rhamnosus NK21 + 22 Lactobacillus rhamnosus NK22 + 23 Lactobacillus rhamnosus NK23 + 24 Lactobacillus rhamnosus NK24 ++ 25 Lactobacillus rhamnosus NK25 + 26 Lactobacillus plantarum NK26 + 27 Lactobacillus plantarum NK27 + 28 Lactobacillus plantarum NK28 + 29 Lactobacillus plantarum NK29 + 30 Lactobacillus plantarum NK30 + 31 Lactobacillus reuteri NK31 + 32 Lactobacillus reuteri NK32 ++ 33 Lactobacillus reuteri NK33 ++ 34 Lactobacillus reuteri NK34 + 35 Lactobacillus reuteri NK35 + 36 Lactobacillus johnsonii NK36 + 37 Lactobacillus johnsonii NK37 ++ 38 Lactobacillus johnsonii NK38 + 39 Lactobacillus johnsonii NK39 + 40 Lactobacillus mucosae NK40 ++ 41 Lactobacillus mucosae NK41 ++ 42 Lactobacillus mucosae NK42 + 43 Bifidobacterium adolescentis NK43 + 44 Bifidobacterium adolescentis NK44 ++ 45 Bifidobacterium adolescentis NK45 + 46 Bifidobacterium longum NK46 ++ 47 Bifidobacterium longum NK47 + 48 Bifidobacterium longum NK48 + 49 Bifidobacterium longum NK49 + 50 Bifidobacterium longum NK50 +
(39) (5) Experimental Results
(40) As a result of evaluating an activity of isolated lactic acid bacteria, it was identified that Lactobacillus plantarum NK3 and Bifidobacterium longum NK49, which are novel lactic bacteria out of the isolated lactic acid bacteria, increase an expression level of ZO-1, which is a tight junction protein, thereby showing an excellent antioxidant activity and an excellent effect of inhibiting inflammatory reactions (Tables 4 and 5).
EXAMPLE 3
Measurement of Inhibitory Capacity Against Inflammatory Reactions of Macrophage
(41) In Example 2 above, it was identified that there is an effect of inhibiting inflammatory reactions depending on a concentration of administration of Lactobacillus plantarum NK3 and Bifidobacterium longum NK49, which are novel lactic acid bacteria having excellent antioxidant activity and an excellent effect of inhibiting inflammatory reactions.
(42) Particularly, 2 ml of sterilized 4% Thioglycolate was intraperitoneally administered into a C57BL/6 mouse (male, 20-23 g). In 96 hours later, the mouse was anesthetized, and then 8 ml of RPMI 1640 medium was intraperitoneally administered into the mouse. In 5 to 10 minutes later, the RPMI medium (macrophage) was intraperitoneally extracted from the mouse, then centrifuged at 1000 g for 10 minutes, and then washed twice again with RPMI 1640 medium. After being cultured in a 24-well plate for five hours, attached cells were used as macrophage. The macrophage was plated at 0.5?10.sup.6 per well, and treated with 10.sup.3, 10.sup.4 and 10.sup.5 CFU/mL of Lactobacillus plantarum NK3 and Bifidobacterium longum NK49, which are novel lactic acid bacteria, as well as lipopolysaccharide (LPS), which is an inflammatory reaction inducer, for 90 minutes or 24 hours, such that supernatant and cells were obtained therefrom. The obtained cells were inserted into an RIPA buffer (Gibco) and homogenized. Expression levels of p65 (NF-?B), p-p65 (phosphor-NF-kB) and (?-actin were measured from the cells obtained with treatment for 90 minutes through an immunoblotting method. An expression level of TNF-? cytokines was measured by ELISA kit (Ebioscience, San Diego, CA, USA) from the culture supernatant obtained after treatment for 24 hours.
(43) In result, it was identified that an activity of NF-kB is inhibited and an expression level of TNF-? is inhibited in all the groups treated with Lactobacillus plantarum NK3 or Bifidobacterium longum NK49 (
EXAMPLE 4
Antibacterial Activity Against Vaginitis-Causing Bacteria
(44) (1) Antibacterial Test of Lactic Acid Bacteria
(45) Lactobacillus plantarum NK3 and Bifidobacterium longum NK49 (1?10.sup.6, 1?10.sup.7, 1?10.sup.8 CFU/mL), which were the isolated novel lactic acid bacteria, were transplanted into GAM medium along with Gardnerella vaginalis or Atopobium vaginae (1?10.sup.6 CFU/mL). Culture was performed for 24 hours at 37? C. under an anaerobic condition in BHIS medium, in which yeast extract (1%), maltose (0.1%), glucose (0.1%) and horse serum (10%) were added into BHI broth, such that antibacterial activity was measured.
(46) In result, it was identified that both Lactobacillus plantarum NK3 and Bifidobacterium longum NK49 show an effect of inhibiting growth of Gardnerella vaginalis and Atopobium vaginae by 95% or more (
(47) (2) Infection Inhibitory Capacity of Lactic Acid Bacteria
(48) While HeLa cells, which are a human cervical cancer cell line, were cultured in RPMI 1640 medium (containing 10% heat-inactivated fetal calf serum) at 37? C., 5% CO.sub.2 and 95% air conditions, Lactobacillus plantarum NK3 and Bifidobacterium longum NK49 (1?10.sup.4, 1?10.sup.6 CFU/mL), which were the isolated lactic acid bacteria, were transplanted thereinto alone or in combination with said lactic acid bacteria (1?10.sup.5, 1?10.sup.6, 1?10.sup.7 CFU/mL) as well as Gardnerella vaginalis (1?10.sup.5 CFU/mL), such that the number of bacteria attached to the HeLa cells was measured through qPCR in 24 hours later.
(49) In result, it was identified that the number of Gardnerella vaginalis attached is remarkably decreased in the HeLa cells, into which Lactobacillus plantarum NK3 or Bifidobacterium longum NK49 was transplanted together (
(50) From the above experimental results, it can be understood that the novel lactic acid bacteria show not only an effect of inhibiting the growth of vaginitis-inducing bacteria, but also an effect of inhibiting infection with bacteria.
EXAMPLE 5
Effect of Lactic Acid Bacteria on Treating Vaginitis in Animal Model
(51) (1) Preparation of Animal Model with Vaginitis and Administration of Lactic Acid Bacteria
(52) An experiment was performed by using six C57BL/6 mice (female, 19-22 g and 6 weeks old) per group. 0.125 mg of ?-estradiol 17-benzoate (Sigma Inc., MO, USA) was dissolved in olive oil and subcutaneously injected into each of said mice. Three days later, Gardnerella vaginalis (1?10.sup.8 CFU/mouse) was transplanted into the vagina of the mouse. Lactobacillus plantarum NK3, Bifidobacterium longum NK49 or a 1:1 mixture thereof, which was the isolated novel lactic acid bacteria, was administered orally into the mouse or directly into the vagina thereof at 1?10.sup.9 CFU/mouse once every day for 14 days from the 8th day after transplantation. The last administration was performed on the 7th day after the administration of lactic acid bacteria (14th day after transplantation), and an animal model was sacrificed in 24 hours later to perform an experiment.
(53) (2) Identification of Occurrence of Intravaginal Inflammations
(54) As a result of transplanting Gardnerella vaginalis into the vagina of the mouse as above, an inflammation with edema occurred to the vagina and the uterus. However, as a result of orally or intravaginally administering Lactobacillus plantarum NK3, Bifidobacterium longum NK49 or a mixture thereof, which is a novel lactic acid bacterium, it was identified that inflammations are significantly decreased in appearance in the vagina and the uterus (
(55) (3) Quantification of Lactic Acid Bacteria and Gardnerella Vaginalis Strains
(56) After administering the novel lactic acid bacteria as above, the inside of the vagina was washed with 0.5 ml of sterilized saline solution in 24 and 48 hours later. A resultant vaginal wash liquid was isolated with Qaigen DNA purification kit, after which lactic acid bacteria and Gardnerella vaginalis strains were quantified through PCR.
(57) In result, it was identified that the number of infectious Gardnerella vaginalis bacteria is decreased by 99% or more in the group orally or intravaginally dosed with Lactobacillus plantarum NK3, Bifidobacterium longum NK49 or a mixture thereof (
(58) (4) Measurement of Myeloperoxidase Activity
(59) A vaginal wash liquid obtained as above was added into 1 mL of 50 mM phosphate buffer (pH 6.0) and subjected to supersonic treatment. A process of thawing and freezing was performed three times, followed by centrifugation. 398 ?L of o-dianisidine (0.129 mg/mL) was added into 100 ?L of supernatant. A final concentration of H.sub.2O.sub.2 was set to 0.0005%, after which activity of myeloperoxidase (MPO) was measured at 25? C. and at 492 nm during time course.
(60) In result, in case of the group infected with Gardnerella vaginalis, the activity of myeloperoxidase, which is a representative inflammation indicator of the vagina, was significantly increased. In case of the group orally or intravaginally dosed with Lactobacillus plantarum NK3, Bifidobacterium longum NK49 or a mixture thereof, however, it was identified that the activity of myeloperoxidase is remarkably decreased (
(61) (5) Analysis of Transcription Factors and Cytokines in Vaginal Mucosa
(62) Lysis buffer (20 mM HEPES, 1.5 mM MgCl2, 0.4 mM NaCl, 1 mM EDTA, 1 mM dithiotheitol, 0.5 mM phenyl methyl sulfonyl fluoride, 20 ?g/mL trypsin inhibitor, 1% NONIDET P-40, 20% glycerol) was injected into the colon or vaginal mucosa tissues of the animal model sacrificed above and was homogenized. A specimen was prepared to contain 50 ?g/?L of proteins by quantifying the proteins with Bradford assay. 10 ?g/?L of electrophoretic sample buffer (Laemmli sample buffer 950 ?L+?Me 50 ?L) was added into the specimen and denatured at 100? C. for three minutes to carry out electrophoresis (150 V, 30 mA). The electrophoresed gel was transferred to a membrane at 30 V for two hours. Said membrane was inserted into 5% skim milk/PBS-T (0.05% TWEEN 20/PBS) in an amount of 15 ml and shaken for one hour. 10 mL of 1% skim milk/PBS-T was inserted into 10 ?g/?L of primary antibodies, then subjected to reaction for 12 hours, and then washed with PBS-T solution for five minutes three times. And, 20 mL of 1% skim milk/PBS-T was inserted into 10 ?g/?L of secondary antibodies with regard to each of cytokines and transcription factors, and then subjected to reaction by shaking for one hour. Washing was performed with PBS-T solution for five minutes three times and ECL solution was subjected to luminescence at last.
(63) In result, in case of the group infected with Gardnerella vaginalis, an expression of TNF-? was increased and an expression of IL-10 was decreased in vaginal tissues. However, in case of the group orally or intravaginally dosed with Lactobacillus plantarum NK3, Bifidobacterium longum NK49 or a mixture thereof, it was identified that an expression of TNF-? is inhibited and an expression of IL-10 is increased (
(64) (6) Increase in Intravaginal Lactic Acid Bacteria
(65) The inside of the vagina of the mouse was washed twice with 0.5 ml of sterilized saline solution. A resultant vaginal wash liquid was collected and centrifuged (10,000 g, 10 minutes), and DNA was extracted from precipitates by using a bacterial genomic DNA extraction kit (QIAGEN DNeasy Feces kit; Qiagen, Hilden, Germany). 10 ng of the extracted DNA was inserted into Qiagen thermal cycler and the following primers and SYBER premix were inserted thereinto, after which PCR was performed by carrying out DNA polymerase activation (95? C., 30 seconds), denaturation (95? C., 5 seconds) and amplification (63? C., 30 seconds) 38 times.
(66) TABLE-US-00006 Lactobacilliforward(5-3) (SEQIDNO:3) CTCAAAACTAAACAAAGTTTC; Lactobacillireverse(5-3) (SEQIDNO:4) CTTGTACACACCGCCCGT; Control16SrDNAforward(5-3) (SEQIDNO:5) AGAGTTTGATCCTGGCTCAG; and Control16SrDNAreverse(5-3) (SEQIDNO:6) AAGGAGGTGWTCCARCC.
(67) In result, in case of being infected with Gardnerella vaginalis, it was identified that Lactobacilli are remarkably decreased. On the other hand, in case of being orally or intravaginally dosed with Lactobacillus plantarum NK3, Bifidobacterium longum NK49 or a mixture thereof, it was identified that said Lactobacilli are increased (
(68) From the above experimental results, it was identified that the novel lactic acid bacteria have an effect on preventing and treating vaginitis.
EXAMPLE 5
Therapeutic Effect of Lactic Acid Bacteria on Colitis in Animal Model (1) Preparation of Animal Model with Colitis and Administration of Lactic Acid Bacteria
(69) An experiment was performed by using six C57BL/6 mice (male, 21-23 g and 6 weeks old) per group after being acclimated in a laboratory for one week. One group was a normal group and the mice in the rest of the groups were induced to develop colitis with 2,4,6-trinitrobenzenesulfonic acid (TNBS). Particularly, the experimental animals were anesthetized with ether, after which 0.1 ml of TNBS solution mixed in 50% ethanol was rectally administered into each colon of animals by using a 1 ml syringe with a round top, and then the animals were vertically lifted and maintained for 30 seconds to induce inflammations therefrom. On the other hand, the normal group was orally dosed with 0.1 ml of saline solution. Lactobacillus plantarum NK3, Bifidobacterium longum NK49 or a 1:1 mixture thereof, which is a novel lactic acid bacterium, was suspended in saline solution and orally administered in an amount of 1?10.sup.9 CFU once daily for three days starting from the following day after administration. On the next day after finishing the administration of lactic acid bacteria, the experimental animals were sacrificed, after which a colon ranging from appendix to a region right before anus was removed from a large intestine and a length thereof was measured. After that, the following various indicators were identified from the above. On the other hand, the experimental animals of the normal group were orally dosed with 1% dextrose solution, which was suspension of lactic acid bacteria, instead of the novel lactic acid bacteria. Also, the experimental animals of the positive control group were orally dosed with 50 mg/kg of Sulfasalazine, which was a therapeutic drug for colitis, instead of the novel lactic acid bacteria.
(70) (2) Measurement of Myeloperoxidase Activity
(71) 200 ?l of 10 mM potassium phosphate buffer (pH 7.0) containing 0.5% hexadecyl trimethyl ammonium bromide was put into 100 mg of colon tissues, and subjected to homogenization. A resulting product was centrifuged at 4? C. and at 10,000 g for 10 minutes, so as to obtain a supernatant therefrom. 50 ?l of the supernatant was put into 0.95 ?l of a reaction solution (containing 1.6 mM tetramethyl benzidine and 0.1 mM H.sub.2O.sub.2), and then subjected to reaction at 37? C. so as to microscopically measure an observance at 650 nm. An activity of said myeloperoxidase was calculated with a resulting reactant H.sub.2O.sub.2 1 ?mol/ml=1 unit.
(72) (3) Measurement of Inflammatory Indicators
(73) Inflammatory reaction indicator materials such as p-p65, p65, COX-2 and ?-actin were measured by using a western blotting method. Particularly, 50 ?g of supernatant, which had been obtained by the same method as shown in an experiment for measuring the activity of said myeloperoxidase (MPO), was taken and subjected to immunoblotting. Also, an expression level of cytokines (IL-17 and TNF-?) was measured by using ELISA kit.
(74) (4) Experimental Results
(75) The experimental results performed as above are the same as shown in a following table 6.
(76) TABLE-US-00007 TABLE 6 Weight Colon MPO NF-kB Experimental change length activity TNF-? IL-17 activity COX-2 group g cm ?U/mg pg/mg pg/mg p-p65/p65 activity Normal 0.9 6.5 0.21 35 17 0.12 0.23 group Induced ?1.9 4.4 1.86 265 89 0.32 0.52 group LP NK3 ?0.9 5.2 1.12 89 45 0.23 0.35 BL NK49 ?0.7 5.4 0.87 95 38 0.22 0.36 Mixture ?0.7 5.5 0.82 88 35 0.19 0.29 Positive ?1.0 5.1 1.26 105 47 0.25 0.42 control group
(77) Particularly, it was identified that there is no great change in weight of the group dosed with Lactobacillus plantarum NK3, Bifidobacterium longum NK49 or a mixture thereof, thereby showing no toxicity. Also, when inducing colitis, a length of colon was decreased. However, in case of the group dosed with lactic acid bacteria, it was identified that there occurs an effect of recovering a length of colon. Furthermore, in case of the group dosed with lactic acid bacteria, it was identified that an activity of myeloperoxidase, which is increased according to induced colitis, is decreased, an expression level of TNF-? and IL-17 cytokines is inhibited, and activities of NF-kB and COX-2 are inhibited.
(78) From the results, it was identified that the novel lactic acid bacteria have an effect of preventing and treating colitis, without showing any toxicity.
(79) Accession Information of Lactic Acid Bacteria
(80) The present inventors deposited Lactobacillus plantarum NK3 for the purpose of patent to the Korean Culture Center of Microorganisms, a certified depository institution (address: Yulim Building, 45, Hongjenae 2ga-gil, Seodaemun-gu, Seoul, South Korea) on Aug. 4, 2017, and received an accession number of KCCM12089P.
(81) Also, the present inventors deposited Bifidobacterium longum NK49 for the purpose of patent to the Korean Culture Center of Microorganisms, a certified depository institution (address: Yulim Building, 45, Hongjenae 2ga-gil, Seodaemun-gu, Seoul, South Korea) on Aug. 4, 2017, and received an accession number of KCCM12088P.