Helix 73-derived RNA molecules interacting with Erm protein and methods of using the same
12037642 ยท 2024-07-16
Assignee
Inventors
Cpc classification
C12Q2522/101
CHEMISTRY; METALLURGY
C12Q2537/164
CHEMISTRY; METALLURGY
C12Q2537/164
CHEMISTRY; METALLURGY
C12Q2522/101
CHEMISTRY; METALLURGY
C12Q1/6876
CHEMISTRY; METALLURGY
International classification
Abstract
The RNA molecule of the present invention, which is based on a helix 73-derived RNA substrate and Erm interaction sites, may be used for screening candidate substances that inhibit methylation by Erm, developing variants thereof, and identifying the action mechanism, and may be used for suppressing the expression of antibiotic resistance.
Claims
1. A method for screening an antibiotic resistance expression inhibitor, comprising the steps of: contacting a double-stranded RNA molecule or a variant thereof with an Erm protein and a candidate substance, wherein the double-stranded RNA molecule or variant thereof is a substrate for methylation by the Erm protein, and the antibiotic is a macrolide-lincosamide-streptogramin B (MLSB) class antibiotic; and identifying whether the candidate substance inhibits the methylation by the Erm protein, wherein if the candidate substance inhibits the methylation, the candidate substance is selected as an antibiotic resistance expression inhibitor which inhibits expression of antibiotic resistance by inhibiting methylation by the Erm protein, thereby rendering microorganism expressing Erm protein sensitive to antibiotics, wherein the double-stranded RNA molecule or variant thereof is a double-stranded RNA molecule in which: a first strand consisting of the sequence of SEQ ID NO: 1 and a second strand consisting of the sequence of SEQ ID NO: 2 are paired while forming 13 base pairs, the first and second bases of SEQ ID NO: 1 form a 5 overhang, the 19th to 22nd bases of SEQ ID NO: 1 form a 3 overhang, the 11th base of SEQ ID NO: 1 is an unpaired base, the 15th base of SEQ ID NO: 1 and the 3rd and 4th bases of SEQ ID NO: 2 forms an internal loop, and the 18.sup.th base of SEQ ID NO: 1 is adenine to be methylated by an Erm protein, and wherein the variant comprises one of the following mutations in the double-stranded RNA molecule: deletion of all or part of 5 overhang of the first strand; truncation of all or part of base pairs between the 5 end of the first strand and the 11th unpaired base of SEQ ID NO: 1; truncation of all or part of base pairs between the 5 end of the first strand and the 11th unpaired base of SEQ ID NO: 1 and deletion of the first and second bases of SEQ ID NO: 1; truncation of all or part of base pairs between the 5 end of the first strand and the 11th unpaired base of SEQ ID NO: 1 and addition of a tetraloop sequence to cap the remaining end of the base pairs after truncation; truncation of all or part of base pairs between the 5 end of the first strand and the 11th unpaired base of SEQ ID NO: 1, addition of a tetraloop sequence to the side of the truncation, and deletion of the first and second bases of SEQ ID NO: 1; truncation of none or all or part of base pairs between the 5 end of the first strand and the 11th unpaired base of SEQ ID NO: 1 and 11.sup.th unpaired base, addition of a tetraloop sequence to the side of the truncation; addition of a tetraloop sequence to all of base pairs between the 5 end of the first strand and the 11th unpaired base of SEQ ID NO: 1; addition of a tetraloop sequence to all or part or none of base pairs between the 5 end of the first strand and the 11th unpaired base of SEQ ID NO: 1 and truncation of the 11th unpaired base, and deletion of the first and second bases of SEQ ID NO: 1; deletion of the 19.sup.th to 22nd bases or part thereof in the 3 overhang of the first strand; truncation of all or part of base pairs between the 5 end of the first strand and the 11th unpaired base of SEQ ID NO: 1 and addition of a hairpin loop formed by linking the 3 overhang of the first strand to the 5 end of the second strand via the extra CC added; and deletion of 5-overhang of the first strand, truncation of all or part of base pairs between the 5 end of the first strand and the 11th unpaired base of SEQ ID NO: 1 and addition of a hairpin loop formed by linking the 3 overhang of the first strand to the 5 end of the second strand via the extra CC added.
2. The method of claim 1, wherein the contacting step includes contacting a double-stranded RNA molecule or a variant thereof and a candidate substance; and adding an Erm protein to the double-stranded RNA molecule or a variant thereof and the candidate substance; or contacting an Erm protein and a candidate substance and adding a double-stranded RNA molecule or a variant thereof to the Erm protein and the candidate substance; or contacting an Erm protein and a double-stranded RNA molecule or a variant thereof; and adding an candidate substance to the Erm protein and the double-stranded RNA molecule or the variant thereof.
3. The method of claim 1, wherein the inhibition of methylation includes inhibiting the methylation through the interaction of the double-stranded RNA molecule or a variant thereof with inhibitor and/or the Erm protein with inhibitor and/or inhibition of interaction of the Erm protein with the double-stranded RNA molecule and/or the activity of complex between the Erm protein and the double-stranded RNA molecule or a variant thereof.
4. The method of claim 1, wherein the antibiotic resistance expression inhibitor inhibits the antibiotic resistance of bacteria belonging to Firmicutes, Bacteroides, Proteobacteria and Actinobacteria.
5. The method of claim 3, wherein the double-stranded RNA molecule or the variant thereof inhibits the interaction between Erm protein and substrate RNA and is selected from the following: (a) a double-stranded RNA molecule consisting of 3 base pairs in which the sequence of SEQ ID NO: 6 and a sequence complementary thereto are paired, or part thereof, (b) a double-stranded RNA molecule consisting of 5 base pairs in which the sequence of SEQ ID NO: 7 and a sequence complementary thereto are paired, or part thereof, (c) a double-stranded RNA molecule consisting of 8 base pairs in which the sequence of SEQ ID NO: 8 and a sequence complementary thereto are paired, or part thereof, (d) a double-stranded RNA molecule in which the sequence of SEQ ID NO: 9 and the sequence of SEQ ID NO: 10 are paired or a variant thereof in which a portion of the double-stranded RNA molecule is deleted; (e) a single-stranded RNA molecule consisting of a sequence of SEQ ID NO: 5 in which the 6th and 7th bases are removed, or a partial sequence thereof, (f) a double-stranded RNA molecule variant in which the sequence of SEQ ID NO: 11 and the sequence of SEQ ID NO: 12 are paired, or a variant thereof in which a portion of the double-stranded RNA molecule is deleted; (g) a double-stranded RNA molecule in which the sequence of SEQ ID NO: 13 and the sequence of SEQ ID NO: 14 are paired, or a variant thereof in which a portion of the double-stranded RNA molecule is deleted; (h) a double-stranded RNA molecule in which the sequence of SEQ ID NO: 1 and the sequence of SEQ ID NO: 2 are paired, or a variant thereof in which a portion of the double-stranded RNA molecule is deleted; (i) a double-stranded RNA molecule in which the sequence of SEQ ID NO: 15 and the sequence of SEQ ID NO: 16 are paired, or a variant thereof in which a portion of the double-stranded RNA molecule is deleted; and (j) a double-stranded RNA molecule in which the sequence of SEQ ID NO: 17 and the sequence of SEQ ID NO: 18 are paired, or a variant thereof in which a portion of the double-stranded RNA molecule is deleted.
6. The method of claim 1, wherein the double-stranded RNA molecule consists of the sequence of SEQ ID NO: 61, and has a stem structure comprising 13 base pairs in which part of 15 consecutive bases at the 5 end region of SEQ ID NO: 61 and part of 15 consecutive bases at the 3 end region thereof are complementarily paired, wherein the ninth base of SEQ ID NO: 61 is an unpaired base and the 13.sup.th base of SEQ ID NO:61 and two bases UA in the opposite strand forms internal loop.
7. The method of claim 1, wherein the double-stranded RNA molecule consists of the sequence of SEQ ID NO: 61, and has a stem structure comprising 13 base pairs in which part of 15 consecutive bases at the 5 end region of SEQ ID NO: 61 and part of 15 consecutive bases at the 3 end region thereof are complementarily paired, wherein the ninth base of SEQ ID NO: 61 is an unpaired base, and a variant of the double-stranded RNA molecule consists of the sequence of SEQ ID NO: 61 in which all or part of 1 to 8 base pairs located between the end of the stem structure and the ninth base of SEQ ID NO: 61 are truncated.
8. The method of claim 1, wherein the Erm is at least one selected from the group consisting of ErmB, ErmE, and ErmS.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The above and other aspects, features, and advantages of certain embodiments of the disclosure will be more apparent from the following description taken in conjunction with the accompanying drawings, in which:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
DETAILED DESCRIPTION
(12) Reference will now be made in detail to embodiments, examples of which are illustrated in the accompanying drawings, wherein like reference numerals refer to like elements throughout. In this regard, the present embodiments may have different forms and should not be construed as being limited to the descriptions set forth herein. Accordingly, the embodiments are merely described below, by referring to the figures, to explain aspects of the present description. As used herein, the term and/or includes any and all combinations of one or more of the associated listed items. Expressions such as at least one of, when preceding a list of elements, modify the entire list of elements and do not modify the individual elements of the list.
(13) Hereinafter, one or more specific embodiments will be described in more detail through examples. However, these examples are for illustrative purposes of one or more embodiments, and the scope of the present invention is not limited to these examples.
(14) Preparation of Experimental Materials
(15) E. coli DH5a (Promega, Madison, WI, USA) and BL21 (DE3) (Novagen, Madison, WI, USA) were used for cloning and expression of His6-tagged Erm protein. Domain V of 23S rRNA was cloned from Bacillus subtilis BD170 and the sequence thereof was compared with the sequence published in the Gutell Lab's Comparative RNA Website and found 3 differences in the sequence, two mutations (C2203G and U2629A) and one nucleotide deletion (?C2473). A GenBank search with the query identified 19 identical sequences, but only two of them exactly corresponded to the one in the Gutell Lab's CRW site. Restriction endonucleases and DNA-modifying enzymes were purchased from New England BioLabs (Beverly, MA, USA) and used according to the manual. LB medium and Bacto Agar for bacterial culture were purchased from Difco Laboratories (Detroit, MI, USA).
(16) Taq polymerase and nucleotides used for PCR were purchased from TaKaRa Shuzo Co. (Otsu, Shiga, Japan). Spermine, Triton X-100 and polyethylene glycol (PEG, molecular weight, 8,000) used for in vitro transcription were purchased from Sigma Chemical Co. (St. Louis, MO, USA) and nucleotides were purchased from TaKaRa Shuzo Co. T7 RNA polymerase in house was used. Chemically synthesized ribooligonucleotides were purchased from Bioneer Co. (Daejeon, Korea). His-Bind Resin used was Novagen's product. Acrylamide, bis-acrylamide, ammonium persulfate and TEMED (N,N,N,N-tetramethylethylenediamine) used for polyacrylamide gel electrophoresis were purchased from Bio-Rad (Hercuyles, CA, USA). Common substances used, such as salts, buffer components, agarose and antibiotics, were Sigama products.
(17) Experimental Method
(18) 1. Preparation of Erm Expression Vector
(19) (1) Preparation of ErmS Expression Vector and ErmE Expression Vector
(20) Expression vector (pHJJ105) and transformed E. coli HJJ105 for overexpression of ErmS, and expression vector pHJJ202 and transformed E. coli HJJ202 for overexpression of ErmE were prepared as previously disclosed (Recognition site generated by natural changes in Erm proteins leads to unexpectedly high susceptibility to chymotrypsin. Purification and biochemical characterization of the ErmSF macrolide-lincosamide-streptogramin B resistance factor protein expressed as a hexahistidine-tagged protein in Escherichia coli).
(21) (1) Preparation of ErmB Expression Vector
(22) To construct the ErmB expression vector, pVA838 plasmid DNA (see a cloning vector able to replicate in Escherichia coli and Streptococcus sanguis) was used as a DNA template, and the forward primer consisting of SEQ ID NO: 19 and the reverse primer consisting of SEQ ID NO: 20 were used to amplify the ErmB protein by PCR. The primer sequences were modified to include the restriction site of NdeI (5-CATATG-3) and the restriction site of XhoI (5-CTCGAG-3) overlapped with the Met start codon. The PCR amplification product was digested with NdeI and XhoI restriction enzymes, and the DNA fragment containing an ermB gene was ligated to the pET23b NdeI-Xho1 site. The prepared ErmB plasmid was named pHJJ302. The sequence of the cloned gene was analyzed to confirm whether the gene was correctly inserted in-frame.
(23) The double-stranded RNA molecule of the present invention serves as a substrate for the methylation activity by Erm, and thus can be used to test whether a candidate substance inhibits methylation by Erm, and can be used for development of antibiotic resistance inhibitors.
(24) TABLE-US-00002 TABLE2 DNA SEQIDNO Oligonucleotide Sequence(5>3) SEQIDNO:19 Forwardprimerfor GGAATTCCATATGAACAAAAACATCAAA preparingErmB TACTCTCAAAACTTTTTAACGAAT expressionvector SEQIDNO:20 Reverseprimerfor CCGCTCGAGTTTCCTCCCGTTAAATA preparingErmB ATAG expressionvector SEQIDNO:21 Oligo1:Forward GGAATTCTAATACGACTCACTATAG primerforcloning rRNA SEQIDNO:22 Oligo1-1:Reverse GGAATTCTAATACGACTCACTATA primerforcloning rRNA SEQIDNO:23 Oligo2:Forward CGACTCACTATAGGCCCGCGACAGGACG primerforcloning GAAAGAC gg583ntDNA SEQIDNO:24 Oligo2-1:Forward CGACTCACTATAGGCCCGCGACAGGACG primerforcloning GGAAGAC A2058Ggg583nt DNA SEQIDNO:25 Oligo2-2:Forward CGACTCACTATAGGCCCGCGACAGGACG primerforcloning GCAAGAC A2058Ggg583nt DNA SEQIDNO:26 Oligo2-3:Forward CGACTCACTATAGGCCCGCGACAGGACG primerforcloning GTAAGAC A2058Ugg583nt DNA SEQIDNO:27 Oligo3:Reverse GGGACCATGGCCGGCCCCGCGACGGATA primerforcloning GGGACCG gg583-ntDNA SEQIDNO:28 Oligo4:Reverse CAGCGAGGAGGCTGGGACCATGGCCGGC primerforcloning rRNADNA SEQIDNO:29 Oligo5:Reverse GCTCTAGAGTCCCATTCGCCATTACCGAG primerforcloning GGGACGGTCCCCTCGGAATG rRNADNA SEQIDNO:30 Oligo6:Forward CGACTCACTATAGCGACAGGACGGAAAG primerforcloning ACCCC 577ntDNA SEQIDNO:31 Oligo7:Reverse GGGACCATGGCCGGCGCGACGGATAGGG primerforcloning ACCGAAC 577ntDNA SEQIDNO:32 Oligo8:Forward CGACTCACTATAAGGACGGAAAGACCCC primerforcloning GTGG 577ntDNA SEQIDNO:33 Oligo8-1:Forward CGACTCACTATAAGGACGGGAAGACCCC primerforcloning GTGG 567ntDNA SEQIDNO:34 Oligo8-2:Forward CGACTCACTATAAGGACGGCAAGACCCC primerforcloning GTGG 567ntDNA SEQIDNO:35 Oligo8-3:Forward CGACTCACTATAAGGACGGTAAGACCCC primerforcloning GTGG 567ntDNA SEQIDNO:36 Oligo8-4 CGACTCACTATACGGACGGAAAGACCCC GTGG SEQIDNO:37 Oligo8-5 CGACTCACTATATGGACGGAAAGACCCC GTGG SEQIDNO:38 Oligo9:Forward CGACTCACTATAGGACGGAAAGACCCCG primerforcloning TGGAG 566ntDNA SEQIDNO:39 Oligo10:Reverse GGGACCATGGCCGGCGGATAGGGACCGA primerforcloning AC 567/566ntDNA SEQIDNO:40 Oligo11:Forward CGACTCACTATAGGCCCGCGACAGGACG primerforcloning GAAAGACCCCTATCCGTCGCG gg37ntDNA SEQIDNO:41 Oligo12:Reverse GGGACCATGGCCGGCCCCGCGACGGATA primerforcloning GGGGTCTTTCCG gg37ntDNA SEQIDNO:42 Oligo13:Forward CGACTCACTATAGAGGACGGAAAGACCC primerforcloning CTATCCGCCGGCCATGGTCCC g21ntDNA SEQIDNO:43 Oligo13-1:Forward CGACTCACTATAGAGGACGGGAAGACCC primerforcloning CTATCCGCCGGCCATGGTCCC g21nt(A2058G)DNA SEQIDNO:44 Oligo13-2:Forward CGACTCACTATAGAGGACGGCAAGACCC primerforcloning CTATCCGCCGGCCATGGTCCC g21nt(A2058C)DNA SEQIDNO:45 Oligo13-3:Forward CGACTCACTATAGAGGACGGTAAGACCC primerforcloning CTATCCGCCGGCCATGGTCCC g21nt(A2058U)DNA SEQIDNO:46 Oligo13-4:Forward CGACTCACTATAGCGGACGGAAAGACCC primerforcloning CTATCCGCCGGCCATGGTCCC g21nt(A2051C)DNA SEQIDNO:47 Oligo13-5:Forward CGACTCACTATAGTGGACGGAAAGACCC primerforcloning CTATCCGCCGGCCATGGTCCC g21nt(A2051U)DNA SEQIDNO:48 Oligo14:Forward CGACTCACTATAGGACGGAAAGACCCCT primerforcloning ATCCGCCGGCCATGGTCCC 20nt-IDNA SEQIDNO:49 Oligo15:Forward CGACTCACTATAGGCCTATCCTTCGGGAC primerforcloning GGAAAGAGCCGGCCATGGTCCC 24nt-IDNA SEQIDNO:50 Oligo15-1:Forward CGACTCACTATAGGCCTATCCTTCGGGAC primerforcloning GGGAAGAGCCGGCCATGGTCCC 24nt(A2058G)DNA SEQIDNO:51 Oligo15-2:Forward CGACTCACTATAGGCCTATCCTTCGGGAC primerforcloning GGCAAGAGCCGGCCATGGTCCC 24nt(A2058C)DNA SEQIDNO:52 Oligo15-3:Forward CGACTCACTATAGGCCTATCCTTCGGGAC primerforcloning GGTAAGAGCCGGCCATGGTCCC 24nt(A2058U)DNA SEQIDNO:53 Oligo16:Forward CGACTCACTATAGGCCTATCTTCGGACGG primerforcloning AAAGAGCCGGCCATGGTCCC 22nt-IDNA SEQIDNO:54 Oligo17:Forward CGACTCACTATAGGCCTATCCTTCGGGAC primerforcloning GGAAAGGCCGGCCATGGTCCC 23nt-IDNA SEQIDNO:55 Oligo18:Forward CGACTCACTATAGGCCTATCCTTCGGGAC primerforcloning GGAAAGCCGGCCATGGTCCC 22nt-IIDNA SEQIDNO:56 Oligo19:Forward CGACTCACTATAGGCCTATCCTTCGGGAC primerforcloning GGAAGCCGGCCATGGTCCC 22ntDNA SEQIDNO:57 Oligo20:Forward CGACTCACTATAGGCCTATCCTTCGGGAC primerforcloning GGAGCCGGCCATGGTCCC 20nt-IIDNA SEQIDNO:58 Oligo20-1:Forward CGACTCACTATAGGCCTATCCTTCGGGAC primerforcloning GGGGCCGGCCATGGTCC 20nt-II(A2058G) DNA SEQIDNO:59 Oligo20-2:Forward CGACTCACTATAGGCCTATCCTTCGGGAC primerforcloning GGCGCCGGCCATGGTCC 20nt-II(A2058C) DNA SEQIDNO:60 Oligo20-3:Forward CGACTCACTATAGGCCTATCCTTCGGGAC primerforcloning GGTGCCGGCCATGGTCC 20nt-II(A2058U) DNA
(25) In Table 2, Oligo 15, 16, 17, 18, 19, and 20 include Ttcg for UUCG tetraloop.
(26) 2. Expression and Purification of Erm Protein
(27) Each Erm protein was expressed in E. coli BL21 (DE3) having pHJJ105 (Erm S), pHJJ202 (Erm E) or pHJJ302 (Erm B) plasmid. Protein purification was performed as previously described with slight modifications (Purification and biochemical characterization of the ErmSF macrolide-lincosamide-streptogramin B resistance factor protein expressed as a hexahistidine-tagged protein in Escherichia coli). Briefly, cells were collected by centrifuging 100 ml of a culture and resuspending cell pelletsin buffer A (20 mM Tris-HCl [pH 7.0], 500 mM KCl and 5 mM imidazole). The collected cells were disrupted by sonication on ice. The sonication was performed by GEX-130 ultrasonic processor (130 W, 20 kHz) with a setting of 50% amplitude, 5 second pulse/10 second stop for a total of 5 minutes. The lysate was centrifuged to remove cell debris, such as inclusion bodies, and insoluble matter, and the supernatant was loaded onto a column containing His-Bind resin equilibrated with buffer A. Subsequently, the column was washed with buffer B (20 mM Tris-HCl [pH 7.0], 500 mM KCl and 100 mM imidazole) to remove unbound or misbound proteins, and the protein bound to the column was eluted with buffer C (20 mM Tris-HCl [pH 7.0], 500 mM KCl and 300 mM imidazole). In order to remove imidazole and salts from the eluted protein solution, the eluted protein solution was purified with a PD-10 desalting column according to the instructions of the manufacturer, GE Healthcare (Little Chalfont, Buckinghamshire, UK), and stored in 20 mM Tris-HCl (pH 7.0), 200 mM KCl, 1 mM EDTA and 50% glycerol at 20? C. The protein concentration was determined by bicinchoninic acid (BCA) protein assay.
(28) 3. Cloning for In Vitro Transcription of Various rRNAs
(29) To produce transcripts with a homogeneous 3 end, a hepatitis delta virus (HDV) ribozyme was incorporated at the 3 end of the target RNA. To obtain a DNA fragment that encodes gg583nt, a first PCR amplification was performed with B. subtilis BD170 genomic DNA as a template, and oligo-2 and oligo-3 containing a part of the T7 promoter and 15 nt, a part of the 3 end sequence of HDV as forward and reverse primers. Oligo-2 and Oligo-3 comprise some sequences corresponding to 2043 to 2063 and 2606 to 2625 of B. subtilis 23S rRNA (E. coli coordinates: 2070 to 2090 and B. subtilis coordinates: 2634 to 2653).
(30) A second PCR was performed by using, as Forward and Reverse primers, Oligo 1 and Oligo 4 containing the remaining portion of T7 promoter and EcoRI restriction site, and part of the sequence of HDV ribozyme. In order to make an Xbal restriction site positioned next to the HDV ribozyme, a third PCR was performed by using Oligo 1 and Oligo 5 having an HDV ribozyme sequence and an Xbal sequence as Forward and Reverse primers. After amplifying the DNA via the third PCR, the gg583nt DNA fragment was inserted into pUC19 by using restriction sites EcoRI and XbaI, cloned, and identified by sequencing. 577 nt (nucleotides 2046 to 2622 in E. coli coordinates), 567 nt (2051 to 2617; for each mutant of A2051 and A2058, an appropriate oligo-8 derivative was used) and 566 nt (2052 to 2617) were cloned in the same manner as the above-described method, except for primers. Oligo 1-1 was used in the second and third PCRs for 567nt.
(31) Short DNA fragments for transcription of RNA substrates were obtained via an overlap extension method disclosed in [Wilson V T, Cundliffe E. 1999. Molecular analysis of tlrB, an antibiotic-resistance gene from tylosin-producing Streptomyces fradiae, and discovery of a novel resistance mechanism. J Antibiot (Tokyo) 52:288-296] with slight modification, and splicing. DNA fragments encoding gg37-nt RNA were also obtained with HDV ribozyme incorporated at the 3 end through a series of PCRs. A first PCR was performed by using Oligo 11 and Oligo 12, which are complementary sequences to each other to generate a template containing gg37-nt RNA, and then a second PCR and a third PCR were performed by using Oligo 1 and Oligo 4 as forward and reverse primers, in the same manner as above, thereby generating a gg37-nt DNA construct. By using Oligo 13 to Oligo 20 as forward primers and Oligo 4 as a reverse primer, PCRs were performed to generate g21nt, 20nt-I, 24nt, 22nt-I, 21nt and 20nt-II DNA constructs. In order to introduce genetic modification to A2051 and A2058, 24nt, 21nt and 20nt-II were subjected to a first PCR by using appropriate primers indicated in Table 2 above. To prepare a DNA fragment containing an EcoR1 restriction site and a T7 promoter sequence at the 5 end, and a complete ribozyme sequence and an Xbal restriction site at the 3 end, final PCR was performed by using the 8 different constructs obtained above as templates, Oligo 1 as a forward primer and Oligo 5 as a reverse primer. The resulting constructs were inserted into multiple cloning sites of EcoRI and XbaI of pUC19. In order to identify the inserted constructs, DNA sequencing was conducted, and primers for cloning rRNA-encoding DNA fragments are summarized in Table 2 above.
(32) 4. In Vitro Transcription of Substrate RNAs
(33) RNA was transcribed by using the prepared plasmid as a template and a phage T7 RNA polymerase. For efflux transcription, the plasmid was linearized by using the XbaI restriction site. RNA transcripts were synthesized by using the linearized plasmid as a template. Specifically, transcription of the linearized plasmid as a template was performed in 500 ?l mixed solution including 40 mM Tris-HCl (pH 8.1), 5 mM DTT (dithiothreitol), 1 mM spermine, 0.01% Triton X-100, 80 mg/ml PEG, 25 ?g DNA template, 4 mM rNTPs (ribonucleoside triphosphates), 28 mM MgCl.sub.2 and 10 ?g T7 RNA polymerase (prepared in-house) at 37? C. for 4 hours. After the transcription, the transcripts were extracted by using phenolchloroform. The extracted transcripts were precipitated with ethanol and then resuspended in DEPD (diethyl pyrocarbonate) treated water. Thereafter, the concentration of MgCl.sub.2 was adjusted to 40 mM, and the transcripts were subjected to three cycles of 1 min at 72? C., 5 min at 65? C., and 10 min at 37? C. to allow the transcripts to undergo self-truncation reactions of 3 end HDV ribozyme. After electrophoresis on 5% to 13% 7M urea-polyacrylamide gel, the size and integrity of the produced transcripts were confirmed by using UV. After the electrophoresis, a band of the correct size was extracted with TBE (Tris-borate-EDTA) and precipitated with ethanol. Thereafter, the precipitated RNA was dissolved in a self-folding buffer containing 50 mM HEPES-KOH [pH 7.5], 20 mM magnesium acetate, and 400 mM NH.sub.4Cl by heating at 65? C. for 10 minutes. Then, the dissolved RNA was cooled at 37? C. for 90 minutes or more to allow the RNA transcripts to be self-folded.
(34) 5. In Vitro Methylation Assay and Substrate Activity Measurement
(35) By modifying the methods disclosed in papers: Kovalic D, Giannattasio R B, Jin H J, Weisblum B. 1994. 23S rRNA domain V, a fragment that can be specifically methylated in vitro by the ErmSF (TlrA) methyltransferase. J Bacteriol 176:6992-6998, Zhong P, Pratt S D, Edalji R P, Walter K A, Holzman T F, Shivakumar A G, Katz L. 1995. Substrate requirements for ErmC=methyltransferase activity. J Bacteriol 177:4327-4332, Jin H J, Yang Y D. 2002; Purification and biochemical characterization of the ErmSF macrolide-lincosamide-streptogramin B resistance factor protein expressed as a hexahistidine-tagged protein in Escherichia coli. Protein Expr Purif 25:149-159, Zalacain M, Cundliffe E. 1989; and [Methylation of 23S rRNA caused by tlrA (ermSF), a tylosin resistance determinant from Streptomyces fradiae. J Bacteriol 171:4254-4260, in vitro methylation of an RNA substrate by an Erm protein was performed.
(36) For analysis over time, a reaction was carried out in 300 ?l of a mixture containing 50 mM Tris-HCl (pH 7.5), 4 mM MgCl.sub.2, 40 mM KCl, 10 mM dithiothreitol (DTT), 19.8 pmol S-adenosyl-L-methionine (SAM; specific activity, 80 Ci/mmol; PerkinElmer), 60 pmol rRNA transcript, and 60 pmol purified Erm protein. The volumes and components were sufficient to carry out 6 reactions. Specifically, components other than proteins in the mixture were mixed and incubated by preheating at 37? C. for at least 5 minutes, and then purified Erm proteins were added to a tube to minimize any delay in the start of the reaction. Every 5 minutes or more time points, to stop the reaction, the tube was cooled on ice containing 0.5 ml of 12% trichloroacetic acid, and 50 ?l of the reaction was removed and a fresh 50 ?l was added. To obtain methylated RNA, centrifugation was performed, and the resultant product was washed twice with 1.25 ml of ice-cold 6% trichloroacetic acid. After drying, the precipitate was extracted with 3 ml of scintillation fluid (Ultima Gold; Packard) and transferred to a counting vial. The remaining precipitate was extracted again with 75 ?l of double-distilled water (DDW) heated to 50? C. to 60? C., and extracted again with 25 ?l of preheated DDW. All of the extracts obtained were combined and counted with Tri-Carb 2900TR (Packard, Shelton, CT, USA).
(37) Methylation analysis at a single time point was performed in the same manner as described above, except that the reaction volume was 50 ?l and the incubation time was 1 hour. The experiment was repeated at least 3 times.
(38) Methylation of a chemically synthesized ribonucletide was performed in the following manner. 60 pmol of upper strand (5-AGGACGGA-3) and lower strand (5-CCUAUCC-3) were dissolved in 2 ?l of a self-folding buffer, and annealed by sequential incubation at 50? C. for 5 min and 10? C. for 90 min. The annealed duplex RNA was analyzed for methylation in the same manner as described above, except for the incubation temperature (18? C.) and incubation time (1.5, 3, 6, 9, 12 and 15 hours).
(39) The amounts of all reaction components were doubled in order to confirm the positive substrate activity obtained with a typical methylation experiment. Specifically, the amounts of reaction components were doubled, for example, 120 pmol annealed ribonucleotide, ErmS enzyme and 39.6 pmol SAM, and the methyl group-accepting activity was measured. In both experiments, substrate activity was identified by observing a concomitant increase in radioactivity from the substrate as the incubation time increased. In order to confirm the specific methylation of A2058, the methyl group-accepting activities of A2058C and A2058U were confirmed.
Example 1: Identification of Change in Methylation Activity by Distal Truncation from Target Adenine of Substrate
(40) The minimum substrate that can be methylated by three Erm proteins, ErmS, ErmB, and ErmE commonly include all or part of helix 73, and an inner loop and a loop sequence that links helix 73 and 74.
(41) The present inventors gradually truncated helix 73 from the 5 end of the sense sequence (hereinafter referred to as distal region), and confirmed whether the methyl group of S-adenosyl-L-methionine (SAM) was transferred to the truncated substrate by using the Erm protein, and thus defined a terminal nucleotide of the distal region of helix 73, which can have activity on the Erm protein, in other words, be methylated by the Erm protein. Since there is a possibility that a site other than helix 73 in domain V compensates for the loss of contact of the truncated helix 73, the experiment was performed by including other sites in domain V.
(42)
(43) Table 3 below shows the results of confirming the activities of ErmS, ErmB, and ErmE for each RNA fragment under standard analysis conditions.
(44) TABLE-US-00003 TABLE 3 Control, without RNA ErmS ErmB ErmE protein gg583 nt +, 100, 562 ? 4,909 +, 7,818 ? 459 +, 95, 177 ? 907 ?, 105 ? 33 gg583nt(A2058G) ?, 83 ? 13 ?, 67 ? 14 ?, 95 ? 20 ?, 79 ? 12 gg583nt(A2058C) ?, 76 ? 29 ?, 82 ? 27 ?, 75 ? 26 ?, 82 ? 37 gg583nt(A2058U) ?, 97 ? 12 ?, 91 ? 6 ?, 91 ? 12 ?, 95 ? 22 577 nt +, 82, 899 ? 2,170 +, 1, 283 ? 17 +, 28, 464 ? 610 ?, 108 ? 12 567 nt +, 680 ? 39 ?, 87 ? 31 +, 267 ? 15 ?, 102 ? 12 567 nt(A2058G) ?, 96 ? 8 ND ?, 87 ? 21 ?, 96 ? 8 567 nt(A2058C) ?, 87 ? 15 ND ?, 101 ? 4 ?, 87 ? 29 567 nt(A2058U) ?, 79 ? 16 ND ?, 96 ? 15 ?, 92 ? 28 567 nt(A2051C) ?, 79 ? 2 ND ND ?, 83 ? 14 567 nt(A2051U) ?, 86 ? 20 ND ND ?, 90 ? 16 566 nt ?, 103 ? 16 ND ?, 84 ? 6 ?, 96 ? 8
(45) According to Table 3, ErmS exhibited about 13 times higher methylation activity than ErmB by delivering 36.01% of SAM (3.3 pmol) to gg583nt.
(46) 577nt is an RNA fragment in which 3 base pairs (complementarily paired CCC and GGG) were further truncated from the distal region of gg583nt. The levels of reduction in the Erm activity for 577nt were different among the three types of Erm proteins. According to Table 3, ErmB showed above 84% reduction in the substrate activity by about 84%, ErmE about 70%, while ErmS showed only about 18% reduction.
(47) 567nt is an RNA fragment in which 5 more base pairs are removed from the distal region of 577nt. According to Table 3 and
(48) 566nt is an RNA fragment obtained by removing A2051 from 567nt. According to Table 3 and
(49) As shown in
(50) 567nt (A2051C) and 567nt (A2051U) were prepared by substituting C or U for A2051 in 567nt. 567nt (A2051C) and 567nt (A2051U) also lost activity as a substrate for methylation by Erm. Therefore, it is considered that the reason for loss of the Erm methylation activity for 566nt from which A2051 is removed is not due to the structural change caused by the removal of A2051.
(51) In addition, since the methylation activities of gg583 nt (A2058G), gg583 nt (A2058C), and gg583 nt (A2058U) were significantly reduced, it can be seen that methylation by the Erm protein specifically occurs in A2058.
(52) According to the experimental results, the distal region of helix 73, specifically three terminal base pairs (base pairs between CCC and GGG, see gg583 nt and 577 nt), is expected to affect the target adenine methylation by the Erm protein via an allosteric effect and/or cooperativity with other structures of domain V. This is because the loss of activity is too significant to be considered caused by three terminal base pairs. Additionally, the loss of activity observed by the following removal of 5 base pairs is thought to be attributable to the observed allosteric effect and/or cooperativity along with the loss of essential interaction with the protein, as seen from the increased activity with addition of a tetraloop as an substitute for the 5 base pairs removed in Example 2 below, which is thought to be caused by increased binding with protein by the tetraloop.
Example 2: Identification of Change in Methylation Activity by Hairpin Loop Capping of Substrate
(53)
(54) Table 4 below shows the results of confirming the activities of Erm proteins for the double-stranded RNA molecules in
(55) TABLE-US-00004 TABLE 4 Control, without RNA ErmS ErmB ErmE protein gg37nt +, 41, 083 ? 1.807 +, 259 ? 40 +, 3, 119 ? 395 ?, 74 ? 18 g21nt +, 449 ? 32 ?, 85 ? 19 ?, 91 ? 50 ?, 91 ? 9 g21nt ?, 110 ? 53 ND ND ND A2051C g21nt ?, 73 ? 29 ND ND ND A2051U 20nt-l ?, 69 ? 42 ND ND ND 24nt +, 1,867 ? 144 +, 337 ? 48 +, 783 ? 116 ?, 105 ? 14 22nt-l ?, 99 ? 25 ?, 67 ? 31 ?, 102 ? 8 ND
(56) According to Table 4, all Erm proteins showed methylation activity for gg37 nt including the entire sequence of Helix 73. The g21 nt truncated with 3 base pairs (complementary pair of CCC and GGG) from the distal region were methylated by ErmS, but the methylation activity by ErmB was lost, which was consistent with the results for 567 nt. ErmE exhibited the methylation activity for 567 nt, but lost the activity for g21 nt. However, these observations are considered attributable to the limited conformation of the target adenine present in g21 nt.
(57) Similar to the results observed in Example 1, all Erm proteins did not show any methylation activity for 20 nt-I with A2051 removed. Since substitution of A2051 in g21 nt with C or U lead to loss of any substrate activity, it is considered that the loss of substrate activity by the removal of A2051 is not due to a structural change.
(58) However, when A2051 was removed and the distal side was capped with a UUCG tetraloop to form a hairpin, the methylation activity by all Erm proteins was significantly enhanced. According to Table 4, the activity of ErmS for 24 nt was about 4 times higher than that for g21 nt. Although not shown in the table, when the UUCG tetra-loop was replaced with the GCAA tetra-loop, the substrate activity was increased three times more than that of 24 nt with the UUCG tetra-loop. The activity of ErmE for 24 nt was three times higher than that for 567 nt. The activity of ErmB for 24 nt was much higher than that for gg37 nt. ErmB did not exhibit any methylation activity for g21 nt and 567 nt, but exhibited strong methylation activity for 24 nt capped with UUCG tetraloop, which was 1.3 times higher than the activity for gg37nt having most of the helix 73 sequence. This suggests that the affinities of the Erm protein with A2051 and surrounding bases thereof are important in methylating 23S rRNA.
(59) Despite the increase in the substrate activity by UUCG tetraloop capping, removal of one of the base pairs located between UUCG tetraloop and A2058 resulted in loss of methylation activity (see 22 nt-I in Table 3). This means that the number of base pairs between A2051 and A2058 and distances thereof or base pairs per se have a significant effect on the substrate activity.
(60) According to the experimental results, the cause for the decrease in activity by truncation up to A2051 is considered not only the loss of allosteric effect and cooperativity observed in Example 1 but also the loss of supplementary binding affinity between the enzyme and a region immediately outside the minimum substrate.
Example 3: Identification of Change in Methylation Activity by Loop Region Truncation of Substrate
(61) In Example 2, the capping of the 7nt hairpin loop sequence of the RNA fragment did not lead to loss of the methylation activity by Erm. Following the experiment, changes in the methylation activity were examined with gradual truncation of the 7 nt loop sequence from the 3-end adenine.
(62) In an RNA fragment capped with a UUCG tetraloop on the distal side, the hairpin loop sequence on the 3 side of the sense sequence was unleashed to prepare RNA fragments in which nucleotides were truncated one by one from the AAAGA sequence, and a change in methylation activity was examined (see
(63) TABLE-US-00005 TABLE 5 Control, 24nt without RNA ErmS ErmB ErmE protein 24nt + + + ? 23nt + ? ? ? 22nt + ND ND ? 21nt + ND ND ? 20nt-ll + ND ND ?
(64) According to Table 5, the 24nt RNA fragment including the full sequence of AAAGA exhibited methylation activity by all Erm proteins. However, the 23nt RNA fragment containing AAAG (the 3-end adenine residue removed from AAAGA) lost the methylation activity by ErmB and EmrE (see
(65) Based on the above results, it is considered that the loss of activity of ErmB and ErmE is not due to the structural change of RNA caused by truncation because ErmS showed methylation activity.
Example 4: Identification of Methylation Activity for Substrates Made of Two Polynucleotides
(66) In order to more clearly specify the minimum substrate of 23S rRNA that can be methylated by the Erm protein, a construct in which two polynucleotide strands consisting of part of the original Helix 73 sequence without artificial nucleotides are annealed was prepared, and the substrate activity thereof for ErmS was examined. The construct was a combination of the first nucleotide consisting of the sequence of SEQ ID NO: 9 (AGGACGGA) and the second nucleotide consisting of the sequence of SEQ ID NO: 10 (CCUAUCC), and was named 15nt RNA (see
(67) Following annealing the first nucleotide and the second nucleotide at 10? C., the methylation activity was examined with increase in the incubation temperature. The construct did not exhibit any methylation activity at 37? C. and room temperature, even after incubation for 15 hours. It was considered that the construct failed to maintain a duplex state in which the two strands are complementarily paired due to a high temperature.
(68) According to
(69) In order to identify the methylation activity of ErmS for the construct, the amounts of substrate, Erm enzyme, and methyl donor (SAM) required for the reaction were doubled and the methylation activity was determined. Reaction condition was set to be 18? C. for 12 hours.
(70) According to Table 6 and
(71) TABLE-US-00006 TABLE 6 Control without RNA substrate ErmS ErmB ErmE protein 24nt + + + ? 24nt A2058G ? ? ? ? 24nt A2058C ? ? ? ? 24nt A2058U ? ? ? ? g21nt + ? ? ? g21nt A2058G ? ND ND ND (not determine) g21nt A2058C ? ND ND ND g21nt A2058U ? ND ND ND 20nt-ll + ND ND ? 20nt-ll A2058G ? ND ND ND 20nt-ll A2058C ? ND ND ND 20nt-ll A2058U ? ND ND ND Annealed 15nt + (18? C.) ND ND ? Annealed 15nt ? (18? C.) ND ND ND A2058C Annealed 15nt ? (18? C.) ND ND ND A2058U
(72) Although not shown in the table, the substitution of A2058 in 15nt with C or U confirmed the methylation site to be A2058 as in the above experiment.
(73) The double-stranded RNA molecule of the present invention can also be used to improve antibiotic resistance expression inhibitors. Specifically, an inhibitor that binds to a specific site among the first to third Erm interaction sites may be modified to further increase a binding strength thereof, or may be modified to interact with sites other than the original binding site. For example, the double-stranded RNA molecule of the present invention can be used to develop an inhibitor having an increased antibiotic resistance expression inhibitory effect, for example by modifying an inhibitor acting on the first Erm interaction site to further increase the interaction, or by modifying the same to interact with the second Erm interaction site in addition to the first Erm interaction site. In another example, an inhibitor acting on the second Erm interaction site may be modified to further increase the interaction thereof, or may be modified to interact with one or more of the first Erm interaction site and the third Erm interaction site. In another example, an inhibitor acting on a third Erm interaction site may be modified to further increase the interaction thereof, or may be modified to interact with one or more of the first Erm interaction site and the second Erm interaction site. In another example, an inhibitor acting on a minimum substrate site may be modified to further increase the interaction thereof, or may be modified to interact with at least one of the second Erm interaction site and the third Erm interaction site. In addition, an inhibitor acting on the third Erm interaction site may be modified to further increase the interaction thereof, or may be modified to interact further with the minimum substrate site.
(74) The double-stranded RNA molecule of the present invention can be used to inhibit the expression of antibiotic resistance by an Erm protein.
(75) In addition, the double-stranded RNA molecule of the present invention can also be used to determine a structure of a complex in which an Erm protein and an RNA are bound. In view of the above, an inhibitor that mimics the structure of an RNA alone or that combined with Erm protein as obtained above may be developed
(76) A novel antibiotic resistance expression inhibitor may be obtained through a method for screening an antibiotic resistance expression inhibitor by using a double-stranded RNA molecule or a variant thereof according to an embodiment of the present invention, or modification or improvement of existing inhibitors may be pursued in a reasonable manner.
(77) It should be understood that embodiments described herein should be considered in a descriptive sense only and not for purposes of limitation. Descriptions of features or aspects within each embodiment should typically be considered as available for other similar features or aspects in other embodiments. While one or more embodiments have been described with reference to the figures, it will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the disclosure as defined by the following claims.