Recombinant MVA or MVADELE3L expressing human FLT3L and use thereof as immuno-therapeutic agents against solid tumors
12036279 ยท 2024-07-16
Assignee
Inventors
- Liang Deng (New York, NY)
- Stewart Shuman (New York, NY)
- Jedd Wolchok (New York, NY)
- Taha Merghoub (New York, NY)
- Weiyi Wang (New York, NY)
- Peihong Dai (New York, NY)
- Ning Yang (New York, NY)
Cpc classification
C12N2710/24132
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
A61K39/3955
HUMAN NECESSITIES
A61K9/0019
HUMAN NECESSITIES
A61K39/3955
HUMAN NECESSITIES
C07K2317/76
CHEMISTRY; METALLURGY
C12N2710/24032
CHEMISTRY; METALLURGY
A61K35/768
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
C12N2710/24121
CHEMISTRY; METALLURGY
A61K2300/00
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
C12N15/86
CHEMISTRY; METALLURGY
A61K35/768
HUMAN NECESSITIES
A61K39/00
HUMAN NECESSITIES
A61K39/395
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
Abstract
The present disclosure relates generally to the fields of oncology, virology and immunotherapy. It concerns poxviruses, specifically the highly attenuated modified vaccinia virus Ankara (MVA), and a recombinant modified vaccinia Ankara virus with deletion of vaccinia virulence factor E3 (MVA?E3L), each further modified to express human Fms-like tyrosine kinase 3 ligand (Flt3L) or GM-CSF. The disclosure relates to use of the foregoing recombinant viruses as cancer immunotherapeutic agents. The foregoing recombinant poxviruses can also be used in combination with immune checkpoint blockade therapy.
Claims
1. A method for treating a breast carcinoma or prostate carcinoma in a subject in need thereof, comprising administering to the subject an effective amount of a recombinant modified vaccinia Ankara (MVA) virus comprising MVA?E3L harboring hFlt3L (MVA?E3L-hFtl3L).
2. The method of claim 1, wherein the recombinant MVA is not harboring nucleic acid encoding or expressing a tumor antigen.
3. The method of claim 1, wherein the method further comprises one or more pharmaceutically acceptable excipients.
4. The method of claim 1, wherein the method further comprises a second amount of a replication competent recombinant attenuated vaccinia virus with deletion of thymidine kinase encoding and expressing human Flt3L, wherein the second amount contributes to augmenting the induced or enhanced or promoted immune response; and/or the method further comprising a third amount of inactivated MVA wherein the third amount contributes to augmenting the induced or enhanced or promoted immune response.
5. The method of claim 1, wherein the recombinant MVA is administered by intratumoral or intravenous injection or a simultaneous or sequential combination of intratumoral and intravenous injection.
6. The method of claim 5, wherein the recombinant MVA is administered for several weeks, months or years or indefinitely, as long as benefits persist or a maximum tolerated dose is reached.
7. The method of claim 5, wherein the recombinant MVA is to be delivered at a dosage per administration within the range of about 10.sup.6-10.sup.10 plaque-forming units (pfu); and/or wherein the recombinant MVA is to be delivered at an amount sufficient to infect all tumor cells; and/or wherein the recombinant MVA is to be repeatedly delivered with a frequency within the range from once per month to two times per week.
8. The method of claim 1, further comprising conjointly administering to the subject an immune checkpoint blocking agent or an immune checkpoint agonist effective to block immune suppressive mechanisms within the tumor.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
DETAILED DESCRIPTION
Definitions
(24) As used herein the following terms shall have the meanings ascribed to them below unless the context clearly indicates otherwise:
(25) Cancer refers to a class of diseases of humans and animals characterized by uncontrolled cellular growth. Unless otherwise explicitly indicated, the term cancer may be used herein interchangeably with the terms tumor, malignancy, hyperproliferation and neoplasm(s); the term cancer cell(s) is interchangeable with the terms tumor cell(s), malignant cell(s), hyperproliferative cell(s), and neoplastic cell(s).
(26) Melanoma refers to a malignant neoplasm originating from cells that are capable of producing melanin. The term melanoma is synonymous with malignant melanoma. Melanoma metastasizes widely, involving a patient's lymph nodes, skin, liver, lungs and brain tissues.
(27) Solid tumor refers to all neoplastic cell growth and proliferation, and all pre-cancerous and cancerous cells and tissues, except for hematologic cancers such as lymphomas, leukemias and multiple myeloma. Examples of solid tumors include, but are not limited to: soft tissue sarcoma, such as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor and other bone tumors (e.g., osteosarcoma, malignant fibrous histiocytoma), leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, testicular tumor, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, brain/CNS tumors (e.g., astrocytoma, glioma, glioblastoma, childhood tumors, such as atypical teratoid/rhabdoid tumor, germ cell tumor, embryonal tumor, ependymoma) medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, and retinoblastoma. Some of the most common solid tumors for which the compositions and methods of the present disclosure would be useful include: head-and-neck cancer, rectal adenocarcinoma, glioma, medulloblastoma, urothelial carcinoma, pancreatic adenocarcinoma, uterine (e.g., endometrial cancer, fallopian tube cancer,) ovarian cancer, cervical cancer prostate adenocarcinoma, non-small cell lung cancer (squamous and adenocarcinoma), small cell lung cancer, melanoma, breast carcinoma, ductal carcinoma in situ, renal cell carcinoma, and hepatocellular carcinoma. adrenal tumors (e.g., adrenocortical carcinoma), esophageal, eye (e.g., melanoma, retinoblastoma), gallbladder, gastrointestinal, Wilms' tumor, heart, head and neck, laryngeal and hypopharyngeal, oral (e.g., lip, mouth, salivary gland), nasopharyngeal, neuroblastoma, peritoneal, pituitary, Kaposi's sarcoma, small intestine, stomach, testicular, thymus, thyroid, parathyroid, vaginal tumor and the metastases of any of the foregoing.
(28) Metastasis refers to the spread of cancer from its primary site to neighboring tissues or distal locations in the body. Cancer cells (including cancer stem cells) can break away from a primary tumor, penetrate lymphatic and blood vessels, circulate through the bloodstream, and grow in in normal tissues elsewhere in the body. Metastasis is a sequential process, contingent on tumor cells (or cancer stem cells) breaking off from the primary tumor, traveling through the bloodstream or lymphatics, and stopping at a distant site. Once at another site, cancer cells re-penetrate through the blood vessels or lymphatic walls, continue to multiply, and eventually form a new tumor (metastatic tumor). In some embodiments, this new tumor is referred to as a metastatic (or secondary) tumor.
(29) Immune response refers to the action of one or more of lymphocytes, antigen presenting cells, phagocytic cells, granulocytes, and soluble macromolecules produced by the above cells or the liver (including antibodies, cytokines, and complement) that results in selective damage to, destruction of, or elimination from the human body of cancerous cells, metastatic tumor cells, etc. An immune response may include a cellular response, such as a T cell response that is an alteration (modulation, e.g., significant enhancement, stimulation, activation, impairment, or inhibition) of cellular, i.e., T cell function. A T cell response may include generation, proliferation or expansion, or stimulation of a particular type of T cell, or subset of T cells, for example, effector CD4.sup.+, CD4.sup.+ helper, effector CD8.sup.+, CD8.sup.+ cytotoxic, or natural killer (NK) cells. Such T cell subsets may be identified by detecting one or more cell receptors or cell surface molecules (e.g., CD or cluster of differentiation molecules). A T cell response may also include altered expression (statistically significant increase or decrease) of a cellular factor, such as a soluble mediator (e.g., a cytokine, lymphokine, cytokine binding protein, or interleukin) that influences the differentiation or proliferation of other cells. For example, Type I interferon (IFN-?/?) is a critical regulator of the innate immunity (52)(Huber et al. Immunology 132(4):466-474 (2011)). Animal and human studies have shown a role for IFN-?/? in directly influencing the fate of both CD4.sup.+ and CD8.sup.+ T cells during the initial phases of antigen recognition and anti-tumor immune response. IFN Type I is induced in response to activation of dendritic cells, in turn a sentinel of the innate immune system. An immune response may also include humoral (antibody) response.
(30) Tumor immunity refers to one or more processes by which tumors evade recognition and clearance by the immune system. Thus, as a therapeutic concept, tumor immunity is treated when such evasion is attenuated or eliminated, and the tumors are recognized and attacked by the immune system (the latter being termed herein anti-tumor immunity). An example of tumor recognition is tumor binding, and examples of tumor attack are tumor reduction (in number, size or both) and tumor clearance.
(31) T cell refers to a thymus derived lymphocyte that participates in a variety of cell-mediated adaptive immune reactions.
(32) Helper T cell refers to a CD4.sup.+ T cell; helper T cells recognize antigen bound to MHC Class II molecules. There are at least two types of helper T cells, Th1 and Th2, which produce different cytokines.
(33) Cytotoxic T cell refers to a T cell that usually bears CD8 molecular markers on its surface (CD8.sup.+) and that functions in cell-mediated immunity by destroying a target cell having a specific antigenic molecule on its surface. Cytotoxic T cells also release Granzyme, a serine protease that can enter target cells via the perforin-formed pore and induce apoptosis (cell death). Granzyme serves as a marker of cytotoxic phenotype. Other names for cytotoxic T cell include CTL, cytolytic T cell, cytolytic T lymphocyte, killer T cell, or killer T lymphocyte. Targets of cytotoxic T cells may include virus-infected cells, cells infected with bacterial or protozoal parasites, or cancer cells. Most cytotoxic T cells have the protein CD8 present on their cell surfaces. CD8 is attracted to portions of the Class I MHC molecule. Typically, a cytotoxic T cell is a CD8.sup.+ cell.
(34) Tumor-infiltrating leukocytes refers to white blood cells of a subject afflicted with a cancer (such as melanoma), that are resident in or otherwise have left the circulation (blood or lymphatic fluid) and have migrated into a tumor.
(35) Immune checkpoint inhibitor or immune checkpoint blocking agent or immune checkpoint blockade inhibitor refers to molecules that completely or partially reduce, inhibit, interfere with or modulate the activity of one or more checkpoint proteins. Checkpoint proteins regulate T-cell activation or function. Checkpoint proteins include, but are not limited to, CD28 receptor family members, CTLA-4 and its ligands CD80 and CD86; PD-1 and its ligands PDL1 and PDL2; LAG3, B7-H3, B7-H4, TIM3, ICOS, II DLBCL, BTLA or any combination of two or more of the foregoing (53). Nonlimiting examples contemplated for use herein include ipilimumab, nivolumab, pembrolizumab, pidilizumab, AMP-224, MPDL3280A, BMS-936559, MEDI4736, MSB 00107180, or any combination thereof.
(36) Parenteral when used in the context of administration of a therapeutic substance or composition includes any route of administration other than administration through the alimentary tract. Particularly relevant for the methods disclosed herein are intravenous (including for example through the hepatic portal vein for hepatic delivery), intratumoral or intrathecal administration.
(37) Antibody refers to an immunoglobulin molecule which specifically binds to an antigen or to an antigen-binding fragment of such a molecule. Thus, antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive (antigen-binding) fragments or portions of intact immunoglobulins. The antibodies may exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab)2, as well as single chain antibodies (scFv) humanized antibodies, chimeric antibodies, human recombinant antibodies and bi- and tri-specific antibodies.
(38) Oncolytic virus refers to a virus that preferentially infects cancer cells, replicates in such cells, and induces lysis of the cancer cells through its replication process.
(39) Nonlimiting examples of naturally occurring oncolytic viruses include vesicular stomatitis virus, reovirus, as well as viruses engineered to be oncoselective such as adenovirus, Newcastle disease virus and herpes simplex virus (See, e.g., Nemunaitis, J. Invest New Drugs. 17(4):375-86 (1999); Kirn, D H et al. Nat Rev Cancer. 9(1):64-71(2009); Kirn et al. Nat. Med. 7:781 (2001); Coffey et al. Science 282:1332 (1998)) (8, 54-56). Vaccinia virus infects many types of cells but replicates preferentially in tumor cells due to the fact that tumor cells have a metabolism that favors replication, exhibit activation of certain pathways that also favor replication and create an environment that evades the innate immune system, which also favors viral replication. In the context of the present disclosure, MVA and MVA?F3L do not fit the definition of oncolytic viruses as they do not produce an antitumor effect primarily by replicating inside tumor cells and causing apoptosis. (Nor do they fit the classic definition of vaccines as these viruses do not express tumor antigens. It can be said however, that they act as immunostimulatory molecules, akin to adjuvants, as they serve to promote and enhance the host's immune response against the tumor.)
(40) MVA means modified vaccinia Ankara and refers to a highly attenuated strain of vaccinia derived from the Ankara strain and developed for use as a vaccine and vaccine adjuvant. The original MVA was isolated from the wild-type Ankara strain by successive passage through chicken embryonic cells, Treated thus, it lost about 15% of the genome of wild-type vaccinia including its ability to replicate efficiently in primate (including human) cells. (57) (Mayr et al., Zentralbl Bakteriol B 167, 375-390 (1978)). The smallpox vaccination strain MVA: marker, genetic structure, experience gained with the parenteral vaccination and behavior in organisms with a debilitated defense mechanism. MVA is considered an appropriate candidate for development as a recombinant vector for gene or vaccination delivery against infectious diseases or tumors. (58)(Verheust et al., Vaccine 30(16), 2623-2632 (2012)). MVA has a genome of 178 kb in length and a sequence first disclosed in (59)(Antoine et al., Virol. 244(2): 365-396 (1998)). Sequences are also disclosed in Genbank U94848.1. Clinical grade MVA is commercially and publicly available from Bavarian Nordic A/S Kvistgaard, Denmark. Additionally, MVA is available from ATCC, Rockville, MD and from CMCN (Institut Pasteur Collection Nationale des Microorganismes) Paris, France.
(41) MVA?E3L means a deletion mutant of MVA which lacks a functional E3L gene and is infective but non replicative and it is further impaired in its ability to evade the host's immune system. It has been used as a vaccine vector (by others) to transfer tumor or viral antigens. This mutant MVA E3L knockout and its preparation have been described for example in U.S. Pat. No. 7,049,145.
(42) Subject means any animal (mammalian, human or other) patient that can be afflicted with cancer and when thus afflicted is in need of treatment.
(43) Pharmaceutically acceptable excipient as used herein refers to substances and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal or a human. As used herein, the term includes all inert, non-toxic, liquid or solid fillers or diluents, as long as they do not react with the therapeutic substance of the invention in an inappropriate negative manner, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, preservatives and the like, for example liquid pharmaceutical carriers e.g., sterile water, saline, sugar solutions, Tris buffer, ethanol and/or certain oils.
(44) Therapeutically effective amount or effective amount refers to a sufficient amount of an agent when administered at one or more dosages and for a period of time sufficient to provide a desired biological result in alleviating, curing or palliating a disease. In the present disclosure, an effective amount respectively of the MVA or MVA?F3L is an amount that (administered for a suitable period of time and at a suitable frequency) reduces the number of cancer cells; or reduces the tumor size or eradicates the tumor; or inhibits (i.e., slows down or stops) cancer cell infiltration into peripheral organs; inhibits (i.e., slows down or stops) metastatic growth; inhibits (stabilizes or arrests) tumor growth; allows for treatment of the tumor, and/or induces and promotes an immune response against the tumor. An appropriate therapeutic amount in any individual case may be determined by one of ordinary skill in the art using routine experimentation in light of the present disclosure. Such determination will begin with amounts found effective in vitro and amounts found effective in animals. The therapeutically effective amount will be initially determined based on the concentration or concentrations found to confer a benefit to cells in culture. Effective amounts can be extrapolated from data within the cell culture and can be adjusted up or down based on factors such as detailed herein. Effective amounts of the viral constructs are generally within the range of about 10.sup.5 to about 10.sup.10 plaque forming units (pfu), although a lower or higher dose may be administered. In a preferred embodiment, the dosage is about 10.sup.6-10.sup.9 pfu. Typically, a unit dosage is administered in a volume within the range from 1 to 10 ml. The equivalence of pfu to virus particles can differ according to the specific pfu titration method used. Generally, pfu is equal to about 5 to 100 virus particles. A therapeutically effective amount the hFlt3L transgene bearing viruses can be administered in one or more divided doses for a prescribed period of time and at a prescribed frequency of administration. For example, therapeutically effective amount of hFlt3L bearing viruses in accordance with the present disclosure may vary according to factors such as the disease state, age, sex, weight, and general condition of the subject, and the potency of the viral constructs to elicit a desired immunological response in the particular subject for the particular cancer.
(45) With particular reference to the viral-based immunostimulatory agents disclosed herein, therapeutically effective amount or effective amount refers to an amount of a composition comprising MVA-hFlt3L or MVA?E3L-hFlt3L sufficient to reduce, inhibit, or abrogate tumor cell growth, thereby reducing or eradicating the tumor, or sufficient to inhibit, reduce or abrogate metastatic spread either in vitro, ex vivo or in a subject or to elicit and promote an immune response against the tumor that will eventually result in one or more of metastatic spread reduction, inhibition and/or abrogation as the case may be. The reduction, inhibition, or eradication of tumor cell growth may be the result of necrosis, apoptosis, or an immune response or a combination of two or more of the foregoing (however, the precipitation of apoptosis for example may not be due to the same factors as observed with oncolytic viruses). The amount that is therapeutically effective may vary depending on such factors as the particular virus used in the composition, the age and condition of the subject being treated, the extent of tumor formation, the presence or absence of other therapeutic modalities, and the like. Similarly, the dosage of the composition to be administered and the frequency of its administration will depend on a variety of factors, such as the potency of the active ingredient, the duration of its activity once administered, the route of administration, the size, age, sex and physical condition of the subject, the risk of adverse reactions and the judgment of the medical practitioner. The compositions are administered in a variety of dosage forms, such as injectable solutions.
(46) With particular reference to combination therapy with an immune checkpoint inhibitor, therapeutically effective amount for an immune checkpoint blocking agent shall mean an amount of an immune checkpoint blocking agent sufficient to reverse or reduce immune suppression in the tumor microenvironment and to activate or enhance host immunity in the subject being treated. There are several immune checkpoint blocking agents approved, in clinical trials or still otherwise under development including inhibitory antibodies against CD28 inhibitor such as CTLA-4 (cytotoxic T lymphocyte antigen 4) (e.g., ipilimumab), anti-PD-1 (programmed Death 1) inhibitory antibodies (e.g., nivolumab, pembrolizumab, pidilizumab, lambrolizumab), and anti-PD-L1 (Programmed death ligand 1) inhibitory antibodies (MPDL3280A, BMS-936559, MEDI4736, MSB 00107180), as well as inhibitory antibodies against LAG-3 (lymphocyte activation gene 3), TIM3 (T cell Immunoglobulin and Mucin-3), B7-H3, and TIGIT (T-cell immunoreceptor with Ig and ITIM domains). Dosage ranges of the foregoing are known or readily within the skill in the art as several dosing clinical trials have been completed, making extrapolation to other agents possible.
(47) Preferably, the tumor expresses the particular checkpoint but in the context of the present invention this is not strictly necessary as immune checkpoint blocking agents block more generally immune suppressive mechanisms within the tumors, elicited by tumor cells, stromal cells, and tumor-infiltrating immune cells.
(48) For example, the CTLA4 inhibitor ipilimumab, when administered as adjuvant therapy after surgery in melanoma is administered at 1-2 mg/mL over 90 minutes for a total infusion amount of 3 mg/kg every three weeks for a total of 4 doses. This therapy is often accompanied by severe even life-threatening immune-mediated adverse reactions, which limits the tolerated dose as well as the cumulative amount that can be administered. It is anticipated that it will be possible to reduce the dose and/or cumulative amount of ipilimumab when it is administered conjointly with MVA-hFlt3L or MVA?F3L-hFlt3L. In particular, in light of the experimental results set forth below, it is anticipated that it will be further possible to reduce the CTLA4 inhibitor's dose if it is administered directly to the tumor conjointly with one or both the foregoing MVA viruses. Accordingly, the amounts provided above for ipilimumab will be a starting point for determining the particular dosage and cumulative amount to be given to a patient in conjoint administration but dosing studies will be required to determine optimum amounts.
(49) Pembrolizumab is prescribed for administration as adjuvant therapy in melanoma diluted to 25 mg/mL. It is administered at a dosage of 2 mg/kg over 30 minutes every three weeks. Again, this would be a starting point for determining dosage and administration in the conjoint administration with MVA-hFlt3L or MVA?E3L-hFlt3L.
(50) Nivolumab is prescribed for administration at 3 mg/kg as an intravenous infusion over 60 minutes every two weeks, providing a similar starting point in determining dosage and administration regimen of this and other checkpoint inhibitors conjointly with MVA-hFlt3L or MVA?F3L-hFlt3L described herein or conjointly with Heat-MVA (inactivated MVA which inactivation can be heat-induced or UV radiation-induced) in amounts generally within the same range as the viruses and vital constructs of MVA and MVA ?E3L.
(51) Immune stimulating agents such as agonist antibodies have also been explored as immunotherapy for cancers. For example, anti-ICOS antibody binds to the extracellular domain of ICOS leading to the activation of ICOS signaling and T cell activation. Anti-OX40 antibody can bind to OX40 and potentiate T cell receptor signaling leading to T cell activation, proliferation and survival. Other examples include agonist antibodies against 4-1BB (CD137), GITR. All of these agents are at various stages of clinical trials.
(52) The immune stimulating agonist antibodies can be used systemically in combination with intratumoral injection of MVA-hFlt3L or MVA?E3L-hFlt3L (or inactivated MVA). Alternatively, the immune stimulating agonist antibodies can be used conjointly with MVA-hFlt3L or MVA?F3L-hFlt3L via intratumoral delivery either simultaneously or sequentially.
(53) Pharmaceutically acceptable carrier and/or diluent or pharmaceutically acceptable excipient includes without limitation any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for biologically active substances is well known in the art. Further details of excipients are provided below. Supplementary active ingredients, such as antimicrobials, for example antifungal agents, can also be incorporated into the compositions.
(54) Delivering used in connection with depositing the MVA-hFlt3L or MVA?F3L-hFlt3L (or Heat-MVA in conjoint administration with immune checkpoint blockade inhibitors, especially for large established tumors) of the present disclosure in the tumor microenvironment whether this is done by local administration to the tumor (intratumoral) or by for example intravenous route. The term focuses on MVA-hFlt3L or MVA?F3L-hFlt3L that reaches the tumor itself.
(55) Conjoint administration herein refers to administration of a second therapeutic modality in combination with MVA-hFlt3L or MVA?E3L-hFlt3L for example an immune checkpoint blocking agent administered in close temporal proximity with MVA-hFlt3L or MVA?E3L-hFlt3L. For example, a PD-1/PDL-1 inhibitor and/or a CTLA4 inhibitor (in more specific embodiments, an antibody) can be administered simultaneously with MVA-hFlt3L or MVA?E3L-hFlt3L (by intravenous or intratumoral injection when the MVA-hFlt3L or MVA?E3L-hFlt3L is administered intratumorally or systemically as stated above) or before or after the MVA-hFlt3L or MVA?E3L-hFlt3L administration. If the MVA-hFlt3L or MVA?E3L-hFlt3L administration and the immune checkpoint blocking agent are administered 1-7 days apart or even up to three weeks apart, this would still be within close temporal proximity as stated herein, therefore such administration will qualify as conjoint.
(56) Vector includes any genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, artificial chromosome, virus, virion, etc., which is capable of replication when associated with the proper control elements and which can transfer gene sequences between cells. Thus, the term includes cloning and expression vehicles, as well as viral vectors. In some embodiments, useful vectors are contemplated to be those vectors in which the nucleic acid segment to be transcribed is positioned under the transcriptional control of a promoter. A promoter refers to a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a gene. The phrases operatively positioned, operatively linked, under control, or under transcriptional control means that the promoter is in the correct location and orientation in relation to the nucleic acid to control RNA polymerase initiation and expression of the gene. The term expression vector or construct means any type of genetic construct containing a nucleic acid in which part or all of the nucleic acid encoding sequence is capable of being transcribed. In some embodiments, expression includes transcription of the nucleic acid, for example, to generate a biologically-active polypeptide product or inhibitory RNA (e.g., shRNA, miRNA) from a transcribed gene.
(57) In the present disclosure, the inventors generated recombinant MVA and MVA?F3L viruses expressing human Flt3L, with the goal of delivering Flt3L to the tumor microenvironment to facilitate recruitment, differentiation and function of immune cells, including CD103.sup.+/CD8a dendritic cells (DCs). Although in the particular experiments described below the transgene was inserted into the TK locus, splitting the TK gene and obliterating it, in the case of non replicative viruses this is not strictly necessary and another suitable integration locus could be chosen which is within the skill of the art. Thus, the label TK.sup.? has been omitted.
(58) Jennerex has previously developed JX-594, in which vaccinia virus is engineered to express a transgene encoding granulocyte-macrophage colony stimulating factor (GM-CSF) with the deletion of vaccinia TK gene to increase tumor selectivity. GM-CSF is another important growth factor for DC homeostasis at the peripheral non-lymphoid tissues (King et al., 2010; Greter et al., 2012). Melanoma vaccine (GVAX) comprised of lethally irradiated allogeneic melanoma cells secreting GM-CSF has shown some clinical benefit (Dranoff et al., 2003). For Example, Curran and Allison showed that the combination of the melanoma cell line-based vaccine B16-GMCSF (GVAX) or the vaccine B16-F1t3L (F13VAX) with CTLA-4 blocking agent eradicated established melanoma in about 60% of the mice if the vaccines were administered at distal sites from the tumors (Curran and Allison, 2009). However, when the vaccines were administered to the tumors in combination with CTLA-4 blocking agent, GVAX was ineffective in tumor eradication in humans, whereas F13 VAX treatment resulted in 75% of tumor-free mice (no human data). One potential explanation is that GM-CSF administration to the tumors might induce myeloid suppressor cell generation within the tumor (Serafini et al., 2004). With the concern that administration of GM-CSF to the tumors might induce immune tolerance, inventors of the present disclosure performed head-to-head comparisons of three recombinant viruses: MVA?E3L, MVA?F3L-mGM-CSF, and MVA?F3L-hFlt3L for eradication of established B16 melanoma using a bilateral B10-F10 melanoma model (Example 2,
(59) The inventors of the present disclosure have also shown that intratumoral injection of MVA?F3L-hFlt3L leads to systemic immunity against a different tumor type upon rechallenge (Example 3). Using the surviving animals initially afflicted with melanoma (Example 2), the inventors rechallenged the animals with a different tumor type (colon cancer cells, Example 3). While the animals that have never been exposed to colon cancer cells or viruses developed tumors and died, animals that were previously treated with MVA?E3L-hFlt3L rejected injected colon cancer cells.
(60) The effects of intratumoral injection of MVA?F3L, MVA?F3L-mGM-CSF, MVA?E3L-hFlt3L, or Heat-MVA in B16-F10 melanomas were assessed, and it was found that the comprise immunological changes in the tumor microenvironment, including activation and proliferation of cytotoxic CD8.sup.+ and CD4.sup.+ T cells, as well as reduction of immune suppressive regulatory T cells (Example 4).
(61) Tumor-associated macrophages (TAMs) facilitate neoplastic transformation, tumor immune evasion and the subsequent metastatic cascade. In the present disclosure, the inventors have shown that MVA?E3L-hFlt3L is effective in depleting TAMs (Example 5). To further study the mechanism of TAM reduction, the inventors have used Batf3-deficient mice. Batf3 is a transcription factor that is critical for the development of CD103.sup.+/CD8?.sup.+ lineage DCs, which play an important role in cross-presentation of viral and tumor antigens. As shown in Example 5, the number of TAMs in tumors of Batf3.sup.?/? mice was significantly reduced, which suggest that the generation of TAMs might be linked to the CD8.sup.+ T cell infiltration within the tumors.
(62) Additionally, the inventors monitored changes in tumor dendritic cell populations in response to MVA?F3L-hFlt3L (Example 6). As shown in Example 6, intratumoral injection of MVA?F3L-hFlt3L led to dynamic changes in the dendritic cell populations as evident by the reduction in CD24.sup.+ DCs, CD103.sup.+ DCs, as well as a decrease in CD11b.sup.+ DCs.
(63) Ly6C.sup.hiCD11b.sup.+ cells are CC chemokine receptor (CCR2) expressing inflammatory monocytes that are recruited to site of injury or infection. The inventors of the present disclosure observed that intratumoral injection of MVA?F3L-hFlt3L results in the influx of Ly6C.sup.hiCD11b.sup.+ and Ly6C.sup.+CD11b.sup.? cells (Example 7).
(64) In addition to testing therapeutic effects of MVA?F3L-hFlt3L in melanoma and delineating the immunological changes that occur due to MVA?E3L-hFlt3L injection, the inventors sought out to determine whether MVA?F3L-hFlt3L exhibits superior efficacy compared to MVA?F3L in other tumor types. As shown in Example 8 (
(65) The inventors of the present disclosure have also shown that intratumoral injection of MVA-hFlt3L is effective in eradicating or delaying melanoma tumor growth, as well as in generation of systemic anti-tumor immunity (Example 9). Therefore, the inventors observed comparable patterns of therapeutic performance for both MVA-hFlt3L and MVA?F3L-hFlt3 L.
(66) Additionally, the inventors have shown that intratumoral delivery of compositions and methods of the present disclosure overcomes resistance to immune checkpoint blocking agents. As shown in the Example 10, the combination of intratumoral delivery of MVA?F3L-hFlt3L with systemic delivery of anti-CTLA-4, anti-PD1, or anti-PD-L1 antibody lead to synergistic antitumor effects in a bilateral B16-F10 melanoma implantation model. Furthermore, the inventors have demonstrated that the surviving mice treated with intratumoral injection of MVA?E3L-hFlt3L with systemic delivery of immune checkpoint inhibitor (anti-CTLA-4, anti-PD1, or anti-PD-L1 antibody) developed immunity against rechallenge of a different tumor type (Example 11). Taken together, these results indicate for the first time that MVA?F3L-hFlt3L may provide a successful and indeed a superior option for the treatment of solid tumor patients (including but not limited to colon cancer and melanoma), alone or in combination with immune checkpoint blocking agents.
(67) In the present disclosure, the inventors explored whether MVA-hFlt3L or MVA?F3L-hFlt3L strain can be used as cancer immunotherapeutic agent. In fact, they observed that intratumoral delivery of MVA?E3L-hFlt3L is more efficacious in eradiating tumors and generating antitumoral immunity than MVA?F3L. Similarly, intratumoral delivery of MVA-hFlt3L is more efficacious in eradiating tumors and generating antitumoral immunity than MVA. Thus, as a treatment option, patients can be treated with MVA-hFlt3L or MVA?E3L-hFlt3L or both in order to achieve improved treatment results.
(68) In one embodiment, the present disclosure relates to a method for eliciting and promoting an antitumor immune response in subjects with tumors comprising delivering to the tumor an effective amount of MVA-hFlt3L or MVA?F3L-hFlt3L or both. Stimulation of the immune system may be manifested by one or more of the following immunological effects.
(69) FACS data generated by the present inventors show that treatment with the present recombinant viruses harboring hFlt3 has qualitatively the same immunological effects as previously reported for inactivated MVA or for MVA or MVA?E3L without hFLT3L: increase in CD8.sup.+ T cells, increase in CD4.sup.+ T cells, reduction in regulatory T cells. Based on these results, it is anticipated that the mechanism of immune response activation will be very similar to that shown in the prior experiments; induction of type I IFN and other proinflammatory cytokines, induction of maturation of dendritic cells, reduction of tumor-associated macrophages).
(70) The foregoing one or more immunological effects may serve as early indicators of response of the subject to the treatment and may serve as monitors of the continued effectiveness of same.
(71) In view of similarities shown between MVA-hFlt3L and MVA?F3L-hFlt3L (Examples 2 and 9), it is anticipated that properties and advantages observed for MVA?E3L-hFlt3L compared to MVA?E3L that lacks hFlt3L, are also exhibited by MVA-hFlt3L compared to MVA alone.
(72) In one embodiment, the present disclosure relates to a method for eliciting and promoting an antitumor immune response in subjects afflicted with tumors comprising delivering to the tumor an effective amount of MVA-hFlt3L or MVA?F3L-hFlt3L. Stimulation of the immune system may be manifest by one or more of the following immunological effects: an increase in antitumor cytotoxic CD8.sup.+ (likely Type I interferon-related) and effector CD4.sup.+ T cells within the tumor; induction of maturation of dendritic cells infiltrating said tumor (this is also likely to be due to induction of Type I IFN as observed in prior work with inactivated MVA and with MVA and MVA?E3L bearing no transgene); induction of activated antitumor effector T cells in the subject; reduction of immune suppressive (regulatory) CD4.sup.+ T cells within the tumor; increase of the ratio of cytotoxic CD8.sup.+ T cells to regulatory T cells and the ratio of conventional T cells to regulatory T cells; reduction of immune suppressive tumor-associated macrophages (TAMs) reduction of CD24.sup.+, CD103.sup.+ and CD11b.sup.+, and influx of inflammatory Ly6.sup.hiCD11b.sup.+ monocytes and Ly6.sup.hiCD11b.sup.? myeloid cells into the tumor.
(73) The foregoing one or more immunological effects may serve as early indicators of response of the subject to the treatment and may serve as monitors of the continued effectiveness of same.
(74) Observation of these effects illustrates that the manner in which the present viruses treat tumor is different from that of vaccine vectors harboring tumor antigens (which are not delivered intratumorally but by intramuscular, subcutaneous or, rarely, intravenous route) and also different from that of oncolytic viruses (which cause cytopathy primarily due to viral replication in tumor cells). If apoptosis results pursuant to the present treatment, it is not due to the same mechanism as apoptosis that results or may result from these different modes of action.
(75) In one embodiment, the present disclosure provides a method of treating a subject diagnosed with a solid tumor comprising delivering to the tumor a therapeutic effective amount of the MVA-hFlt3L or MVA?F3L-hFlt3L and compositions containing either or both.
(76) In one embodiment, the present disclosure provides a method for inducing anti-tumor immunity in a subject diagnosed with cancer comprising administering to the subject a therapeutically effective amount of MVA-hFlt3L or MVA?E3L-hFlt3L. The methods of the present disclosure include induction of anti-tumor immunity that can reduce the size of the tumor, eradicate the tumor, inhibit growth of the tumor, inhibit metastasis or reduce metastatic growth of the tumor or eradicate metastatic growth of the tumor, induce apoptosis of tumor cells or prolong survival of the subject (compared to untreated or conventionally treated subjects).
(77) In another embodiment, the present disclosure provides a method for enhancing, stimulating, or eliciting, in a subject diagnosed with a solid malignant tumor, an anti-tumor immune response that may include an innate immune response and/or an adaptive immune response such as a T cell response by exposing the tumor to MVA-hFlt3L or MVA?F3L-hFlt3L in a therapeutically effective amount.
(78) In specific embodiments, the present disclosure provides methods of eliciting an immune response that mediates adaptive immune responses both in terms of T-cell cytotoxicity directed against tumor cells and in terms of eliciting effector T cells also directed against tumor cells. The methods comprise administering to a subject afflicted with a solid tumor intratumorally or (as the present inventors anticipate) intravenously a composition comprising MVA-hFlt3L or MVA?E3L-hFlt3L wherein administration of said composition results in a tumor-specific immune response against the tumor and, eventually, in reduction, inhibition or eradication of tumor growth, inhibition of metastatic growth, apoptosis of tumor cells and/or prolongation of the subject's survival. Indeed the present inventors have shown that cancer cells are being killed and that the immune response can migrate to remote locations, as would be the case with metastases.
(79) In some embodiments, the present disclosure provides methods of eliciting an immune response that mediates adaptive immune responses both in terms of T-cell cytotoxicity directed against tumor cells and in terms of eliciting effector T cells also directed against tumor cells. The methods comprise administering to a subject parenterally a composition comprising MVA-hFlt3L or MVA?F3L-hFlt3L wherein administration of said composition results in a tumor-specific immune response against the tumor and, eventually, in reduction, inhibition or eradication of tumor growth and/or in inhibition reduction or elimination of metastatic growth, apoptosis of tumor cells and/or prolongation of survival of the treated subject compared to conventional therapy or no treatment. For intraperitoneal metastases, the virus can be injected intraperitoneally.
(80) Indeed the present inventors have shown that cancer cells are being killed and that the immune response can migrate to remote locations, as would be the case with metastases, and still exert an anti-tumor effect.
(81) Because MVA-hFlt3L and MVA?F3L-hFlt3L are substantially not replication competent in most mammalian cells, it does not exert its effect on the immune system the same way as replication competent vaccines or vectors. Thus, while it is believed that stimulation of the immune system is a barrier to efficacy for oncolysis (8)(Kirn et al., Nat Rev Cancer. (1), 64-71 (2009)), MVA-hFlt3L or MVA?E3L-hFlt3L is able to harness the innate immune system to stimulate adaptive immunity, both in terms of cytotoxicity and more broadly in terms of effector T cell activation against the tumor.
(82) The present disclosure thus provides a method for treating a solid malignant tumor, comprising delivering to a tumor of the subject an amount of MVA-hFlt3L or MVA?E3L-hFlt3L effective to induce an immune response against the tumor in a subject diagnosed with solid tumor.
(83) The present disclosure also provides a method for generating antitumor systemic immunity in a subject afflicted with a solid malignant tumor, comprising delivering to a tumor of the subject an amount of MVA-hFlt3L or MVA?F3L-hFlt3L effective to bring about one or both of rejection of non-injected tumors in said subject and inhibition of tumor metastasis (which the present inventors test by tumor rechallenge).
(84) In order to increase the effectiveness of a treatment with the compositions of the present disclosure, the compositions and methods of the present disclosure may be used in combination with replication competent oncolytic viruses. Suitable examples of oncolytic viruses include vaccinia virus, vesicular stomatitis virus, reovirus, adenovirus, Newcastle disease virus and herpes simplex virus. Vaccinia virus infects many types of cells but replicates preferentially in tumor cells due to the fact that tumor cells have a metabolism that favors replication, exhibit activation of certain pathways that also favor replication and create an environment that evades the innate immune system, which also favors viral replication. Specific examples of replication competent viruses that can be used in combination with compositions and methods of the present disclosure include TK deficient vaccinia-based viruses with or without transgene E3L?83N-TK, E3L?83N-TK-mGM-CSF, and E3L?83N-TK-hFlt3 L.
(85) In prior work by the present inventors, MVA induced type I IFN induction in conventional dendritic cells (cDCs) via a cytosolic DNA-sensing pathway mediated by cGAS/STING. Intravenous delivery of MVA in C57B/6 mice induced type I IFN in wild-type mice, but not in mice lacking STING or IRF3. They also showed that MVA?E3L induces higher levels of type I IFN gene expression and phosphorylation of IRF3 than MVA in cDCs. MVA?E3L is detected by both the cytosolic DNA-sensing pathway mediated by cGAS/STING, and the dsRNA-sensing pathway mediated by MDA5/MAVS. In addition, MVA?F3L infection of B16 melanoma cells and MC38 colon adenocarcinoma cells induced type I IFN and proinflammatory cytokines and chemokines, as well as activation of phosphorylation of IRF3. Both MVA and MVA?E3L induce apoptosis in B16 and MC38 cells as demonstrated by the cleavage of PARP and Caspase-3. The present inventors used this work, MVA or MVA?F3L virus as direct anti-cancer therapy. Intratumoral injection of MVA or MVA?F3L in a murine B16 melanoma model lead to apoptosis, prolonged survival and tumor eradication, as well as the generation of systemic anti-tumor immunity. Given the findings described here, including dynamic changes in cellular immune responses both within the tumor and systemically (Examples 4-7), the mechanisms associated with previous findings of the present inventors concerning MVA and MVA?F3L viruses, are believed to be at work here too.
(86) Thus, based on current literature, and without wishing to be bound by theory, the following mechanisms are believed to contribute to anti-tumor effects of MVA-hFlt3L or MVA?E3L-hFlt3L: (i) induction of type I IFN responses in immune cells including conventional dendritic cells and macrophages; (ii) induction of type I IFN and proinflammatory cytokines and chemokines in cancer cells; (iii) induction of apoptosis in cancer cells; and (iv) alteration of tumor immune suppressive environment to an immune activating one.
(87) The present disclosure further comprises compositions comprising MVA and a MVA?E3L, each further modified to express human Flt3L. As shown in Example 1, the inventors have generated recombinant MVA and MVA?F3L expressing human Flt3L using a strategy depicted in
(88) Modified Vaccinia Ankara (MVA)
(89) Modified Vaccinia Ankara (MVA) virus is a member of the genera Orthopoxvirus in the family of Poxviridae. MVA was generated by approximately 570 serial passages on chicken embryo fibroblasts (CEF) of the Ankara strain of vaccinia virus (CVA) (60)(Mayr et al., Infection 3, 6-14 (1975)). As a consequence of these long-term passages, the resulting MVA virus contains extensive genome deletions and is highly host cell restricted to avian cells (6/)(Meyer et al., J. Gen. Virol. 72, 1031-1038 (1991)). It was shown in a variety of animal models that the resulting MVA is significantly avirulent (57) (Mayr et al., Dev. Biol. Stand. 41, 225-34 (1978)).
(90) The safety and immunogenicity of MVA has been extensively tested and documented in clinical trials, particularly against the human smallpox disease. These studies included over 120,000 individuals and have demonstrated excellent efficacy and safety in humans. Moreover, compared to other vaccinia based vaccines, MVA has weakened virulence (infectiousness) while it triggers a good specific immune response. Thus, MVA has been established as a safe vaccine vector, with the ability to induce a specific immune response.
(91) Due to the above mentioned characteristics, MVA became an attractive candidate for the development of engineered MVA vectors, used for recombinant gene expression and vaccines. As a vaccine vector, MVA has been investigated against numerous pathological conditions, including HIV, tuberculosis and malaria, as well as cancer (20, 21)(Sutter et al., Curr Drug Targets Infect Disord 3: 263-271(2003); Gomez et al., Curr Gene Ther 8: 97-120 (2008)).
(92) It has been demonstrated that MVA infection of human monocyte-derived dendritic cells (DC) causes DC activation, characterized by the upregulation of co-stimulatory molecules and secretion of proinflammatory cytokines (18)(Drillien et al., J Gen Virol 85: 2167-2175 (2004)). In this respect, MVA differs from standard wild type Vaccinia virus (WT-VAC), which fails to activate DCs. Dendritic cells can be classified into two main subtypes: conventional dendritic cells (cDCs) and plasmacytoid dendritic cells (pDCs). The former, especially the CD103.sup.+/CD8?.sup.+ subtype, are particularly adapted to cross-presenting antigens to T cells; the latter are strong producers of Type I IFN.
(93) Viral infection of human cells results in activation of an innate immune response (the first line of defense) mediated by type I interferons, notably interferon-alpha (a). This normally leads to activation of an immunological cascade, with recruitment and proliferation of activated T cells (both CTL and helper) and eventually with antibody production. However viruses express factors that dampen immune responses of the host. MVA is a better immunogen than WT-VAC and replicates poorly in mammalian cells. (See, e.g., Brandler et al., J. Virol. 84, 5314-5328 (2010)) (62).
(94) However, MVA is not entirely nonreplicative and as the present inventors show contains some residual immunosuppressive activity. Nevertheless, as shown herein MVA significantly prolonged survival of treated subjects. An implication of these findings is that by injecting a tumor with or systemically delivering MVA (or MVA?E3L) it is possible to enhance a host's innate and adaptive immune responses and thereby overcome the tumor's ability to evade immune responses and to restore the ability of the host to mount an immune response against the tumor whether the response is native or induced or enhanced by another immunotherapeutic agent, such as a checkpoint inhibitor.
(95) Modified Vaccinia Ankara with Deletion of E3 (MVA?E3L)
(96) The antitumor effects of MVA described in the immediately preceding section are also observed with MVA?E3L. The latter is less immunosuppressive than MVA and even less replicative in most mammalian cells, and from that point of view preferred. In addition, the effects of MVA?E3L have generally been qualitatively better than those with MVA as seen in the experiments described herein.
(97) Immune Response
(98) In addition to induction of the immune response by up-regulation of particular immune system activities (such as antibody and/or cytokine production, or activation of cell mediated immunity), immune responses may also include suppression, attenuation, or any other downregulation of detectable immunity, so as to reestablish homeostasis and prevent excessive damage to the host's own organs and tissues. In some embodiments, an immune response that is induced according to the methods of the present disclosure generates effector CD8.sup.+ (antitumor cytotoxic CD8.sup.+) T cells or activated T helper cells or both that can bring about directly or indirectly the death, or loss of the ability to propagate, of a tumor cell.
(99) Induction of an immune response by the compositions and methods of the present disclosure may be determined by detecting any of a variety of well-known immunological parameters (63, 64)(Takaoka et al., Cancer Sci. 94:405-11 (2003); Nagorsen et al., Crit. Rev. Immunol. 22:449-62 (2002)). Induction of an immune response may therefore be established by any of a number of well-known assays, including immunological assays, Such assays include, but need not be limited to, in vivo, ex vivo, or in vitro determination of soluble immunoglobulins or antibodies; soluble mediators such as cytokines, chemokines, hormones, growth factors and the like as well as other soluble small peptide, carbohydrate, nucleotide and/or lipid mediators; cellular activation state changes as determined by altered functional or structural properties of cells of the immune system, for example cell proliferation, altered motility, altered intracellular cation gradient or concentration (such as calcium); phosphorylation or dephosphorylation of cellular polypeptides; induction of specialized activities such as specific gene expression or cytolytic behavior; cellular differentiation by cells of the immune system, including altered surface antigen expression profiles, or the onset of apoptosis (programmed cell death); or any other criterion by which the presence of an immune response may be detected. For example, cell surface markers that distinguish immune cell types may be detected by specific antibodies that bind to CD4.sup.+, CD8.sup.+, or NK cells. Other markers and cellular components that can be detected include but are not limited to interferon ? (IFN-?), tumor necrosis factor (TNF), IFN-?, IFN-0, IL-6, and CCLS. Common methods for detecting the immune response include, but are not limited to flow cytometry, ELISA, immunohistochemistry. Procedures for performing these and similar assays are widely known and may be found, for example in Letkovits (Immunology Methods Manual: The Comprehensive Sourcebook of Techniques, Current Protocols in Immunology, 1998).
(100) Pharmaceutical Compositions and Preparations
(101) Pharmaceutical compositions comprising MVA-hFlt3L or MVA?F3L-hFlt3L may contain a carrier or diluent, which can be a solvent or dispersion medium containing, for example, water, saline, Tris buffer, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be effected by various antibacterial and antifungal agents and preservatives, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride, and buffering agents. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin or carrier molecules. Other excipients may include wetting or emulsifying agents. In general, excipients suitable for injectable preparations can be included as apparent to those skilled in the art.
(102) Pharmaceutical compositions and preparations comprising MVA-hFlt3L or MVA?E3L-hFlt3L may be manufactured by means of conventional mixing, dissolving, granulating, emulsifying, encapsulating, entrapping or lyophilizing processes. Pharmaceutical viral compositions may be formulated in conventional manner using one or more physiologically acceptable carriers, diluents, excipients or auxiliaries that facilitate formulating virus preparations suitable for in vitro, in vivo, or ex vivo use. The compositions can be combined with one or more additional biologically active agents (for example parallel administration of GM-CSF) and may be formulated with a pharmaceutically acceptable carrier, diluent or excipient to generate pharmaceutical (including biologic) or veterinary compositions of the instant disclosure suitable for parenteral or intra-tumoral administration.
(103) Many types of formulation are possible as is appreciated by those skilled in the art. The particular type chosen is dependent upon the route of administration chosen, as is well-recognized in the art. For example, systemic formulations will generally be designed for administration by injection, e.g., intravenous, as well as those designed for intratumoral delivery. Preferably, the systemic or intratumoral formulation is sterile.
(104) Sterile injectable solutions are prepared by incorporating MVA-hFlt3L or MVA?F3L-hFlt3L in the required amount of the appropriate solvent with various other ingredients enumerated herein, as required, followed by suitable sterilization means. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle that contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying techniques, which yield a powder of the virus plus any additional desired ingredient from a previously sterile-filtered solution thereof.
(105) In some embodiments, the MVA-hFlt3L or MVA?F3L-hFlt3L compositions of the present disclosure may be formulated in aqueous solutions, or in physiologically compatible solutions or buffers such as Hanks's solution, Ringer's solution, mannitol solutions or physiological saline buffer. In certain embodiments, any of the MVA-hFlt3L or MVA?F3L-hFlt3L compositions may contain formulator agents, such as suspending, stabilizing, penetrating or dispersing agents, buffers, lyoprotectants or preservatives such as polyethylene glycol, polysorbate 80, 1-dodecylhexahydro-2H-azepin-2-one (laurocapran), oleic acid, sodium citrate, Tris HCl, dextrose, propylene glycol, mannitol, polysorbate polyethylenesorbitan monolaurate (Tween?-20), isopropyl myristate, benzyl alcohol, isopropyl alcohol, ethanol sucrose, trehalose and other such generally known in the art may be used in any of the compositions of the instant disclosure. (Pramanick et al., Pharma Times 45(3), 65-76 (2013))(65).
(106) The biologic or pharmaceutical compositions of the present disclosure can be formulated to allow the virus contained therein to be available to infect tumor cells upon administration of the composition to a subject. The level of virus in serum, tumors, and if desired other tissues after administration can be monitored by various well-established techniques, such as antibody-based assays (e.g., ELISA, immunohistochemistry, etc.).
(107) The recombinant viruses of the present invention can be stored at ?80? C. with a titer of 3.5?10.sup.7 PFU/ml formulated in about 10 mM Tris, 140 mM NaCl pH 7.7. For the preparation of vaccine shots, e.g., 10.sup.2-10.sup.8 or 10.sup.2-10.sup.9 viral particles can be lyophilized in 100 ml of phosphate-buffered saline (PBS) in the presence of 2% peptone and 1% human albumin in an ampoule, preferably a glass ampoule. Alternatively, the injectable preparations can be produced by stepwise freeze-drying of the recombinant virus in a formulation. This formulation can contain additional additives such as mannitol, dextran, sugar, glycine, lactose or polyvinylpyrrolidone or other additives such as antioxidants or inert gas, stabilizers or recombinant proteins (e.g., human serum albumin) suitable for in vivo administration. The glass ampoule is then sealed and can be stored between 4? C. and room temperature for several months. However, the ampoule is stored preferably at temperatures below ?20? C.
(108) For therapy, the lyophilisate can be dissolved in an aqueous solution, such as physiological saline or Tris buffer, and administered either systemically or intratumorally. The mode of administration, the dose and the number of administrations can be optimized by those skilled in the art in a known manner and are detailed below.
(109) The pharmaceutical composition according to the present disclosure may comprise an additional adjuvant. As used herein, an adjuvant refers to a substance that enhances, augments or potentiates the host's immune response to tumor antigens. A typical adjuvant may be aluminum salts, such as aluminum hydroxide or aluminum phosphate, Quil A, bacterial cell wall peptidoglycans, virus-like particles, polysaccharides, toll-like receptors, nano-beads, etc. (Aguilar et al. (2007), Vaccine 25: 3752-3762).
(110) Kits Comprising Recombinant MVA Viruses
(111) The present disclosure contemplates the provision of kits comprising one or more compositions comprising one or more of the recombinant MVAs described herein. The kit can comprise one or multiple containers or vials of the recombinant MVA, together with instructions for the administration of the recombinant MVA to a subject to be treated. The instructions may indicate a dosage regimen for administering the composition or compositions as provided below.
(112) In some embodiments, the kit may also comprise an additional composition comprising a checkpoint inhibitor for conjoint administration with the recombinant MVA composition.
(113) Effective Amount and Dosage of MVA-hFlt3L or MVA?F3L-hFlt3L
(114) In general, the subject is administered a dosage of MVA-hFlt3L or MVA?E3L-hFlt3L in the range of about 10.sup.6 to about 10.sup.10 plaque forming units (pfu), although a lower or higher dose may be administered. In a preferred embodiment, dosage is about 10.sup.7-10.sup.9 pfu. The equivalence of pfu to virus particles can differ according to the specific pfu titration method used. Generally, a pfu is equal to about 5 to 100 virus particles and 0.69 PFU is about 1 TCID50. A therapeutically effective amount of MVA-hFlt3L or MVA?E3L-hFlt3L can be administered in one or more divided doses for a prescribed period of time and at a prescribed frequency of administration.
(115) For example, as is apparent to those skilled in the art, a therapeutically effective amount of MVA-hFlt3L or MVA?E3L-hFlt3L in accordance with the present disclosure may vary according to factors such as the disease state, age, sex, weight, and general condition of the subject, and the ability of MVA-hFlt3L or MVA?F3L-hFlt3L to elicit a desired immunological response in the particular subject (the subject's response to therapy). In delivering MVA-hFlt3L or MVA?F3L-hFlt3L to a subject, the dosage will also vary depending upon such factors as the general medical condition, previous medical history, disease type and progression, tumor burden, the presence or absence of tumor infiltrating immune cells in the tumor, and the like.
(116) In some embodiments, it may be advantageous to formulate compositions of the present disclosure in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the mammalian subjects to be treated; each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required pharmaceutically or veterinary acceptable carrier.
(117) Administration and Therapeutic Regimen of MVA-hFlt3L or MVA?E3L-hFlt3L
(118) Administration of MVA-hFlt3L and MVA?F3L-hFlt3L can be achieved using more than one route, including parenteral, for example intratumoral or intravenous, administration. In one embodiment, MVA-hFlt3L or MVA?F3L-hFlt3L is administered directly into the tumor, e.g. by intratumoral injection, where a direct local reaction is desired. Additionally, administration routes of MVA-hFlt3L or MVA?E3L-hFlt3L can vary, e.g., first administration using an intratumoral injection, and subsequent administration via an intravenous injection, or any combination thereof. A therapeutically effective amount of MVA-hFlt3L or MVA?F3L-hFlt3L injection can be administered for a prescribed period of time and at a prescribed frequency of administration. In certain embodiments, MVA-hFlt3L or MVA?E3L-hFlt3L can be used in conjunction with other therapeutic treatments. For example, MVA-hFlt3L or MVA?F3L-hFlt3L can be administered in a neoadjuvant (preoperative) or adjuvant (postoperative) setting for subjects inflicted with bulky primary tumors. It is anticipated that such optimized therapeutic regimen will induce an immune response against the tumor, and reduce the tumor burden in a subject before or after primary therapy, such as surgery. Furthermore, MVA-hFlt3L or MVA?E3L-hFlt3L can be administered in conjunction with other therapeutic treatments such as chemotherapy or radiation.
(119) In certain embodiments, the MVA-hFlt3L or MVA?E3L-hFlt3L virus is administered at least once weekly or monthly but can be administered more often if needed, such as two times weekly for several weeks, months, years or even indefinitely as long as benefits persist. More frequent administrations are contemplated if tolerated and if they result in sustained or increased benefits. Benefits of the present methods include but are not limited to the following: reduction of the number of cancer cells, reduction of the tumor size, eradication of tumor, inhibition of cancer cell infiltration into peripheral organs, inhibition or stabilization or eradication of metastatic growth, inhibition or stabilization of tumor growth, and stabilization or improvement of quality of life. Furthermore, the benefits may include induction of an immune response against the tumor, activation of effector CD4 T cells, an increase of effector CD8.sup.+ T cells, or reduction of regulatory CD4.sup.+ cells. For example, in the context of melanoma or, a benefit may be a lack of recurrences or metastasis within one, two, three, four, five or more years of the initial diagnosis of melanoma. Similar assessments can be made for colon cancer and other solid tumors.
(120) In certain other embodiments, the tumor mass or tumor cells are treated with MVA-hFlt3L or MVA?F3L-hFlt3L in vivo, ex vivo, or in vitro.
(121) Vectors
(122) In the experiments detailed below a pCB plasmid-based vector was used to insert the specific gene of interest (SG), in this case, murine GM-CSF (mGM-CSF) or human Flt3L (hFlt3L) under the control of the vaccinia synthetic early and late promoter (Pse/l). The methodology for constructing the vector has been described in M. Puhlmann, C. K. Brown, M. Gnant, J. Huang, S. K. Libutti, H. R. Alexander, D. L. Bartlett. Vaccinia as a vector for tumor-directed gene therapy: Biodistribution of a thymidine kinase-deleted mutant. Cancer Gene Therapy, 7(1), 66-73 (2000). The E. coli xanthine-guanine phosphoribosyl transferase gene (gpt) under the control of vaccinia P7.5 promoter was used as a drug selection marker. These two expression cassettes were flanked by a partial sequence of TK gene on each side. The choice of a TK gene was a matter of convenience and other suitable loci within the virus could have been used. Homologous recombination that occurred at the TK locus of the plasmid DNA and modified vaccinia virus (MVA) or MVA?F3L genomic DNA results in the insertion of SG and gpt expression cassettes into the MVA or MVA?F3L genomic DNA TK locus to generate MVA-mGM-CSF, MVA-hFlt3L, MVA?F3L-mGM-CSF, MVA-AF3L-hFlt3L. The recombinant viruses were enriched in the presence of gpt selection medium including MPA, xanthine and hypoxanthine, and plaque-purified in the presence of the drug selection medium for 4-5 rounds until the appropriate recombinant viruses without contaminating MVA or MVA?F3L were obtained.
(123) It will be appreciated however, that any other expression vector suitable for integration into the MVA or MVA?E3L genome could have been used as well as alternative promoters, regulatory elements, selectable markers, cleavage sites, nonessential insertion regions of MVA. MVA encodes many immune modulatory genes at the ends of the linear genome, including C11, C7, K3, F1, F2, F4, F6, F8, F9, F11, F14.5, J2, A46, C16. These genes can be deleted to potentially enhance immune activating properties of the virus, and allow insertion of transgenes.
EXAMPLES
Materials and Methods Viruses and Cell Lines
(124) MVA and MVA?F3L viruses were kindly provided by Gerd Sutter (University of Munich), and propagated in BHK-21 (baby hamster kidney cell, ATCC CCL-10) cells. MVA is commercially and/or publicly available. The method of generation of MVA?E3L Viruses was described (28)(Hornemann et al., J Virol 77, 8394-8407 (2003)). The viruses were purified through a 36% sucrose cushion. BHK-21 were cultured in Eagle's Minimal Essential Medium (Eagle's MEM, can be purchased from Life Technologies, Cat #11095-080) containing 10% FBS, 0.1 mM nonessential amino acids (NEAA), and 50 mg/ml gentamycin. The murine melanoma cell line B16-F10 was originally obtained from I. Fidler (MD Anderson Cancer Center). B16-F10 cells were maintained in RPMI 1640 medium supplemented with 10% FBS, 100 Units/ml penicillin, 100 ?g/ml streptomycin, 0.1 mM NEAA, 2 mM L-glutamine, 1 mM sodium pyruvate, and 10 mM HEPES buffer. The MC38 colon adenocarcinoma cancer cells were maintained in Dulbecco's modified Eagle medium (DMEM, Invitrogen). Murine triple negative breast cancer cell line 4T1 was cultured in the RPMI medium with 10% FBS. TRAMP-C2 cells are derived from transgenic adenocarcinoma mouse prostate model (TRAMP) in C57BL/6 mice. TRAMP-C2 cells are tumorigenic when grafted into syngenic C57BL/6 mice. TRAMP-C2 cells are available from ATCC. They are cultured in DMEM with 5% of Nu-Serum IV, 5% FBS, bovine insulin, and DHT. All cells were grown at 37? C. in a 5% CO.sub.2 incubator.
(125) Cells and cell lines used herein are commercially or publicly available unless otherwise indicated.
Mice
(126) Female C57BL/6J and BALB/c mice between 6 and 8 weeks of age were purchased from the Jackson Laboratory and were used for in vivo tumor implantation and treatment experiments. These mice were maintained in the animal facility at the Sloan Kettering Institute. All procedures were performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institute of Health. The protocol was approved by the Committee on the Ethics of Animal Experiments of Sloan Kettering Cancer Institute.
(127) Batf3.sup.?/? and STING.sup.Gt/Gt mice were generated in the laboratories Kenneth Murphy (Washington University; Batf3.sup.?/?), and Russell Vance (University of California, Berkeley; STING.sup.Gt/Gt). These mice were bred and maintained in the animal facility at the Sloan Kettering Institute.
Bilateral Tumor Implantation Model and Intratumoral Injection with Recombinant MVA or MVA?E3L Viruses Expressing mGM-CSF or hFlt3L
(128) Briefly, B16-F10 melanoma cells were implanted intradermally to the left and right flanks of C57B/6 mice (5?10.sup.5 to the right flank and 1?10.sup.5 to the left flank). 8 days after tumor implantation, the larger tumors on the right flank were intratumorally injected with 2?10.sup.7 pfu of MVA?E3L-hFlt3L, MVA?E3L-mGM-CSF, MVA?F3L, or Heat-inactivated MVA twice weekly when the mice were under anesthesia. Mice were monitored daily and tumor sizes were measured twice a week. Tumor volumes were calculated according the following formula: l (length)?w (width)?h (height)/2. Mice were euthanized for signs of distress or when the diameter of the tumor reached 10 mm.
(129) In some experiments, MC38 colon adenocarcinoma cells were implanted intradermally to the left and right flanks of C57B/6 mice (5?10.sup.5 to the right flank and 1?10.sup.5 to the left flank). Tumors were allowed to grow for 7-8 days, after which MVA?F3L-hFlt3L or MVA?E3L (2?10.sup.7 pfu) or PBS control were injected into the larger tumors twice a week. Tumor sizes were measured and the survival of mice was monitored.
(130) In some experiments, 4T1 murine triple negative breast cancer (TNBC) cells were implanted intradermally to the left and right flanks of BALB/c mice (2.5?10.sup.5 to the right flank and 5?10.sup.4 to the left flank). 5 days post tumor implantation, the larger tumors on the right flank were injected with either MVA?F3L or MVA?E3L-hFlt3L (2?10.sup.7 pfu) twice weekly. Mice were monitored daily and tumor sizes were measured twice a week. The survival of mice was monitored.
Bilateral Tumor Implantation Model and Intratumoral Injection with Viruses in the Presence or Absence of Systemic or Intratumoral Administration of Immune Checkpoint Blockade
(131) B16-F10 melanoma cells were implanted intradermally to the left and right flanks of C57B/6 mice (5?10.sup.5 to the right flank and 1?10.sup.5 to the left flank). 8 days after tumor implantation, the mice with bilateral tumors were treated with intratumoral injection of MVA?F3L-hFlt3L to the larger tumors on the right flank and intraperitoneal delivery of immune checkpoint blockade antibodies twice weekly, including anti-CTLA-4 (100 ?s per mouse), anti-PD-1 (250 ?g per mouse), anti-PD-L1 (250 ?g per mouse), or isotype control (100 ?g per mouse). The tumor sizes were measured and the tumors were injected twice a week. The survival of mice was monitored.
(132) In some experiments, STING.sup.Gt/Gt, Batf3.sup.?/? mice and WT age-matched controls were used for bilateral B16-F10 melanoma implantation, and treated with PBS or Heat-MVA to the larger tumors on the right flank of the mice.
Unilateral Intradermal Tumor Implantation and Intratumoral Injection with Viruses
(133) B16-F10 melanoma (5?10.sup.5 cells in a volume of 50 ?l) were implanted intradermally into the shaved skin on the right flank of WT C57BL/6J mice. After 8-9 days post implantation, tumor sizes were measured and tumors that are 5-6 mm in diameter were injected with MVA?F3L-hFlt3L (2?10.sup.7 pfu of MVA in a volume of 50 ?l), or Heat-MVA, or poly (I:C) (50 ?g per mouse) or with PBS when the mice were under anesthesia twice weekly. Mice were monitored daily and tumor sizes were measured twice a week. Tumor volumes were calculated according the following formula: l (length)?w (width)?h (height)/2. Mice were euthanized for signs of distress or when the diameter of the tumor reached 15 mm.
(134) In some experiments, B16-F10 melanoma (5?10.sup.5 cells in a volume of 50 ?l) were implanted intradermally into the shaved skin on the right flank of WT C57BL/6J mice. After 8-9 days post implantation, tumor sizes were measured and tumors that are 5-6 mm in diameter were injected with PBS, or MVA?F3L-hFlt3L in the presence of isotype control, anti-CTLA-4, anti-PD-1, or anti-PD-L1 delivered intraperitoneally. The tumor sizes were measured and the tumors were injected twice a week. The survival of mice was monitored. Mice were euthanized for signs of distress or when the diameter of the tumor reached 15 mm.
(135) In some experiments, TRAMP-C2 cells were implanted intradermally to the shaved right flank of STING.sup.Gt/Gt mice and age-matched WT C57B/6 controls (1?10.sup.6 cells in 50 ?l of PBS per mouse). 17 days post tumor implantation, the tumors (around 3-4 mm in diameter) on the right flank were injected with either PBS or MVA?F3L-hFlt3L (2?10.sup.7 pfu) twice weekly. Mice were monitored daily and tumor sizes were measured twice weekly. The survival of mice was monitored.
(136) Preparation of Tumor Cell Suspensions, RNA Isolation, and Real-Time PCR
(137) Briefly, 2.5?10.sup.5 B16-F10 melanoma cells were intradermally implanted to the left flank and 5?10.sup.5 B16-F10 melanoma cells to the right flank of 6-8 weeks old C57B/6 mice. 7 days post-implantation, MVA (2?10.sup.7 pfu) or Heat-MVA, or PBS was injected into the larger tumors on the right flank. The injection was repeated three days later. Both the injected and non-injected tumors were harvested on day 7 after first injection, and cell suspensions were generated.
(138) RNA was extracted from whole-cell lysates with an RNeasy Mini kit (Qiagen) and was reverse transcribed with a First Strand cDNA synthesis kit (Fermentas). Quantitative real-time PCR was performed in triplicate with SYBR Green PCR Mater Mix (Life Technologies) and Applied Biosystems 7500 Real-time PCR Instrument (Life Technologies) using gene-specific primers. Relative expression was normalized to the levels of glyceraldehyde phosphate dehydrogenase (GAPDH).
Flow Cytometry
(139) To analyze immune cell phenotypes and characteristics in the tumors or tumor draining lymph nodes, we generated cell suspensions prior to FACS analysis according to the following protocol (Zamarin et al., Science Translational Medicine 6, 226-232 (2014)). First we isolated tumors using forceps and surgical scissors three days post treatment with MVA or PBS. The tumors were then weighed. Tumors or tumor draining lymph nodes were minced prior to incubation with Liberase (1.67 Wunsch U/ml) and DNase (0.2 mg/ml) for 30 minutes at 37? C. Cell suspensions were generated by repeated pipetting, filtered through a 70-?m nylon filter, and then washed with complete RPMI prior to Ficoll purification to remove dead cells. Cells were processed for surface labeling with anti-CD3, CD45, CD4, and CD8 antibodies. Live cells are distinguished from dead cells by using fixable dye eFluor506 (eBioscience). They were further permeabilized using FoxP3 fixation and permeabilization kit (eBioscience), and stained for Ki-67, FoxP3, and Granzyme B. For the staining of the myeloid cell population, Fluorochromeconjugated antibodies against CD45.2 (104), CD11b (M1/70), Ly-6C (HK1.4), MHC II (M5/114.15.2), CD24 (M1/69), F4/80 (BM8), CD103 (2E7) and CD11c (N418) were purchased from eBioscience. All antibodies were tested with their respective isotype controls. Data were acquired using the LSRII Flow cytometer (BD Biosciences). Data were analyzed with FlowJo software (Treestar).
ELISPOT
(140) Mouse spleens from na?ve or treated mice were harvested and mechanically disrupted, and RBCs were lysed. CD8.sup.+ T cells were positively selected by incubation with magnetic anti-CD8.sup.+ beads (Miltenyi Biotec). BD mouse IFN-? ELISPOT set was used according to manufacturer's instruction. Briefly, ELISPOT plates were coated with 100 ?l anti-mouse IFN-? antibody in PBS and incubated at 4? C. overnight. Plates were washed with PBS to remove unbound antibody and were blocked with RPMI media with 7% fetal bovine serum for 2 hours at room temperate. 1?10.sup.5 Purified CD8.sup.+ T cells were mixed with equal number of irradiated B16 or MC38 cells, and seeded into each well. The plates were incubated at 37? C. for 16 hours. After incubation, plates were extensively washed with PBS plus 0.05% Tween and incubated with 100 ?l/well of biotinylated detection antibody against mouse IFN-?. Enzyme conjugate (Streptavidin-HRP) was added after wash, followed with adding final substrate solution for spot development. Spots were counted with an Automated ELISPOT Reader System with KS software (Carl Zeiss Inc.)
TRP-2 Tetramer Staining
(141) Tumor draining lymph nodes were isolated and minced prior to incubation with Liberase (1.67 Wunsch U/ml) and DNase (0.2 mg/ml) for 30 minutes at 37? C. Cell suspensions were generated by repeated pipetting, filtered through a 70-?m nylon filter, and then washed with complete RPMI. Lymph node cell suspensions were incubated for 30 mins at room temperature with anti-Fc?R II (2.4G2) antibody and 10 ?L of PE-H-2 Kb TRP2 (tyrosinase related protein-2) (SVYDFFVWL) tetramer (MBL), followed by staining at 4? C. for 30 mins with anti-CD3 and anti-CD8 antibodies. Cells were washed in MACS buffer (Miltenyi) and analyzed with a BD LSRII, using FlowJo software (Tree Star).
Reagents
(142) The commercial sources for reagents were as follows: Therapeutic anti-CTLA4 (clone 9H10 and 9D9), anti-PD1 (clone RMP1-14), anti-PD-L1 (clone 10F.9G2) were purchased from BioXcell; Antibodies used for flow cytometry were purchased from eBioscience (CD45.2 Alexa Fluor 700, CD3 PE-Cy7, CD4 APC-efluor780, CD8 PerCP-efluor710), Invitrogen (CD4 QDot 605, Granzyme B PE-Texas Red, Granzyme B APC). Fluorochromeconjugated antibodies against CD45.2 (104), CD11b (M1/70), Ly-6C (HK1.4), MHC II (M5/114.15.2), CD24 (M1/69), F4/80 (BM8), CD103 (2E7) and CD11c (N418) were purchased from eBioscience.
(143) Statistics
(144) Two-tailed unpaired Student's t test was used for comparisons of two groups in the studies. Survival data were analyzed by log-rank (Mantel-Cox) test. The p values deemed significant are indicated in the figures as follows: *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001. The numbers of animals included in the study are discussed in each figure legend.
Example 1
Generation of Recombinant MVA or MVA?E3L Viruses Expressing mGM-CSF or hFlt3L
(145) In the present disclosure, the inventors generated recombinant MVA or MVA?F3L viruses comprising a TK-deletion with and without expressing human Flt3L or murine GM-CSF under the vaccinia synthetic early/late promoter (Pse/l) using standard recombinant virus technology. First, the inventors constructed a plasmid containing specific gene of interest (SG) under the control of the vaccinia Pse/1 as well as the E. coli xanthine-guanine phosphoribosyl transferase gene (gpt) under the control of vaccinia P7.5 promoter flanked by the thymidine kinase (TK) gene on either side (
(146) BHK21 cells were infected with MVA or MVA?E3L at a MOI of 0.05 for 1 h, and then were transfected with the plasmid DNAs described above. The infected cells were collected at 48 h. Recombinant viruses were selected through further culturing in gpt selection medium including MPA, xanthine and hypoxanthine, and plaque purified (Lorenzo et al., 2004). PCR analysis was performed to identify recombinant viruses with loss of part of the TK gene and with and without murine GM-CSF, or human Flt3L, (
(147) PCR was used to verify the correct insertions in the recombinant viruses MVA-mGM-CSF, MVA?F3L-mGM-CSF, MVA-hFlt3L, and MVA?F3L-hFlt3L. Primer pair mGM-CSF-F1/RI was used to amplify a 310 bp DNA fragment from mGM-CSF gene inserted in recombinant viruses MVA-mGM-CSF or MVA?F3L-mGM-CSF. hFlt3L gene insertion in MVA-hFlt3L and MVA?E3L-hFlt3L was verified with primer pair hFlt3L-F4/R4, which can amplify a 316 bp DNA fragment. Primer pair TK-F4/TK-R4 was used to verify the specific gene insertions in the TK locus. TK-F4/R4 can amplify a 304 bp DNA fragment from MVA or MVA?E3L, but not in MVA-mGM-CSF, MVA?E3L-mGM-CSF, MVA-hFlt3L, or MVA?F3L-hFlt3L viruses due to the deletion of TK-R4 primer locus.
(148) TABLE-US-00001 Primersequences: TK-F2(SEQIDNO:1): TGTGAAGACGATAAATTAATGATC; TK-F4(SEQIDNO:2): TTGTCATCATGAACGGCGGA; TK-R4(SEQIDNO:3): TCCTTCGTTTGCCATACGCT; TK-F5(SEQIDNO:4): GAACGGGACTATGGACGCAT; TK-R5(SEQIDNO:5): TCGGTTTCCTCACCCAATCG; pCB-R3(SEQIDNO:6): ACCTGATGGATAAAAAGGCG; mGMCSF-F1(SEQIDNO:7): GGCATTGTGGTCTACAGCCT; mGMCSF-R1(SEQIDNO:8): GTGTTTCACAGTCCGTTTCCG; hFlt3L-F1(SEQIDNO:9): AACGACCTATCTCCTCCTGC; hFlt3L-R1(SEQIDNO:10): GGGCTGAAAGGCACATTTGG.
Example 2
Intratumoral Injection of MVA?E3L-hFlt3L is More Effective than MVA?E3L-mGM-CSF or MVA?E3L in Eradicating or Delaying the Growth of Both Injected and Non-Injected Tumors in a Bilateral B10-F10 Melanoma Model
(149) The inventors investigated the effects of intratumoral injection of MVA?F3L-hFlt3L, MVA?F3L-mGM-CSF, and MVA?F3L on metastatic growth using a murine B16-F10 melanoma bilateral implantation model. Briefly, B16-F10 melanoma cells were implanted intradermally to the left and right flanks of C57B/6 mice (5?10.sup.5 to the right flank and 1?10.sup.5 to the left flank). 7-8 days after tumor implantation, the inventors intratumorally injected MVA?F3L-hFlt3L, MVA?F3L-mGM-CSF, and MVA?F3L (2?10.sup.7 pfu) or PBS to the larger tumors on the right flank twice weekly. The tumor sizes were measured and the survival of mice was monitored (
Example 3
Intratumoral Injection of MVA?E3L-hFlt3L Leads to Systemic Immunity Against a Different Tumor Type Upon Rechallenge
(150) To assess whether the surviving mice (n=4) post intratumoral injection of MVA?F3L-hFlt3L have developed immunity against a different tumor type, we rechallenged them with a lethal dose of MC38 (1?10.sup.5) implanted intradermally. Na?ve mice (n=5) that have never exposed to the said tumors or viruses were used as a control. Whereas all of the na?ve mice developed tumors and died at 26-31 days post tumor implantation with a median survival of 29 days, all of the MVA?F3L-hFlt3L-treated surviving mice rejected MC38 tumor challenge (
Example 4
Intratumoral Injection of MVA?E3L-hFlt3L is Effective in the Proliferation and Activation of CD8.SUP.+ and CD4.SUP.+ T Cells and Reduction of Regulatory T Cells in Both Injected and Non-Injected Tumors
(151) To assess whether intratumoral injection of MVA?E3L, MVA?E3L-mGM-CSF, MVA?F3L-hFlt3L, or Heat-MVA in B16-F10 melanomas leads to activation and proliferation of CD8.sup.+ and CD4.sup.+ T cells, 2.5?10.sup.5 B16-F10 melanoma cells were intradermally implanted to the left flank and 5?10.sup.5 B16-F10 melanoma cells to the right flank of 6-8 weeks old C57B/6 mice. 7 days post-implantation, MVA?F3L, MVA?E3L-mGM-CSF, MVA?E3L-hFlt3L, or Heat-MVA or PBS was injected into the larger tumors on the right flank. The injection was repeated three days later. Both the injected and non-injected tumors were harvested on day 7 after first injection, and cell suspensions were generated. The live immune cell infiltrates in the injected and non-injected tumors were analyzed by FACS. There was a dramatic increase in CD8.sup.+ T cells expressing Granzyme B in the injected tumors, from 58.9% in PBS-treated tumors to 97% in MVA?F3L-hFlt3L-treated tumors (p<0.0001;
(152) In the injected tumors, Ki-67.sup.+CD8.sup.+ T cells increased from 58.3% in PBS-treated tumors to 83.2% in MVA?E3L-hFlt3L-treated tumors (p<0.01;
(153) Similar changes were observed for CD4.sup.+ T cells in the injected and non-injected tumors from mice treated with virus compared with those treated with PBS; Granzyme B.sup.+CD4.sup.+ T cells rose from 20% in PBS-treated tumors to 98.4% in MVA?F3L-hFlt3L-treated tumors (P=0.0002;
(154) In addition, there was an increase Ki-67.sup.+CD4.sup.+ T cells from 40% in PBS-treated tumors to 59.6% in MVA?F3L-treated tumors and 66.6% in MVA?F3L-hFlt3L-treated tumors (p<0.001; PBS vs. MVA?E3L-hFlt3L, p<0.01; PBS vs. MVA?F3L, p<0.05; MVA?E3L-hFlt3L vs. MVA?E3L,
(155) In the injected tumors, CD4.sup.+Foxp3.sup.+ T cells decreased from 45.1% in PBS-treated tumors to 26.6% in MVA?F3L-hFlt3L-treated tumors (p<0.001;
(156) The inventors determined the absolute numbers of CD45.sup.+ cells, CD8.sup.+ cells in both injected and non-injected tumors after virus treatment. It was found that in the injected tumors, intratumoral injection of MVA?E3L-hFlt3L or MVA?E3L increased the CD45.sup.+ cells from 3.8?10.sup.6/g to 1.6?10.sup.7/g or 1.3?10.sup.7/g, respectively (P<0.01, MVA?F3L-hFlt3L vs. PBS; P<0.01, MVA?E3L vs. PBS;
(157) The inventors also found that in the injected tumors, intratumoral injection of MVA?E3L-hFlt3L or MVA?F3L increased the CD8.sup.+ cells from 2.9?10.sup.5/g to 2.9?10.sup.6/g or 2.0?10.sup.6/g, respectively (P<0.01, MVA?F3L vs. PBS; P<0.001, MVA?E3L-hFlt3L vs. PBS;
(158) The ratios of CD8.sup.+ T cells over regulatory T cells (Tregs, defined as CD4.sup.+FoxP3.sup.+ cells) and Tconv (CD4.sup.+Foxp3.sup.? cells) over Tregs was also assessed. It was observed that in the injected tumors, intratumoral injection of MVA?F3L-hFlt3L or MVA?F3L increased the ratios of CD8.sup.+/Treg from 2.8 to 18.6 or 12.5 (P<0.01, MVA?E3L vs. PBS; P<0.001, MVA?E3L-hFlt3L vs. PBS, P<0.05, MVA?E3L vs. MVA?E3L-hFlt3L;
(159) The inventors observed that in the injected tumors, intratumoral injection of MVA?E3L-hFlt3L or MVA?F3L increased the ratios of effector CD4.sup.+/Treg from 0.65 to 4.1 or 3.2 (P<0.01, MVA?F3L vs. PBS; P<0.01, MVA?F3L-hFlt3L vs. PBS;
(160) These results indicate that intratumoral injection of MVA?F3L-hFlt3L triggered immunological changes in the tumor microenvironment, which manifested as proliferation and activation of cytotoxic CD4.sup.+ and CD8.sup.+ T cells and increasing the ratios of CD8.sup.+/Treg and Tconv/Treg.
Example 5
Intratumoral Injection of MVA?E3L-hFlt3L is Effective in Depleting Tumor-Associated Macrophages in Both Injected and Non-Injected Tumors
(161) Tumor-associated macrophages (TAMs) are tumor infiltrating myeloid cells that express the following surface markers CD45.sup.+MHC-II.sup.+F4/80.sup.hiCD24.sup.lo (Broz, et al. Cancer Cell, 26(5):638-52, 2014). The inventors analyzed the percentage of TAMs among CD45+ cells in both injected and non-injected tumors. They observed that intratumoral injection of MVA?F3L-hFlt3L reduced the percentages of TAMs out of CD45.sup.+ cells from 21.4% to 0.7% in injected tumors (P<0.0001, MVA?E3L-hFlt3L vs. PBS;
Example 6
Intratumoral Injection of MVA?E3L-hFlt3L Results in the Dynamic Changes of Dendritic Cell Populations in Both Injected and Non-Injected Tumors
(162) The inventors next analyzed dendritic cell (DC) populations in both injected and non-injected tumors. Tumor infiltrating DCs are characterized as CD45.sup.+Ly6C-MHC-II.sup.+CD24.sup.hiF4/80.sup.lo cells (Broz et al., Cancer Cell, 2014). Among the CD24.sup.h1 DCs, there are two DC populations, CD11b.sup.+ DC and CD103.sup.+ DC. The percentage of CD24.sup.h1 DCs (CD24.sup.+) out of CD45.sup.+ cells in both injected and non-injected tumors was investigated. It was found that intratumoral injection of MVA?F3L-hFlt3L in WT mice resulted in the reduction of CD24.sup.+ DCs from 3% to 1.3% in non-injected tumors (P=0.001, MVA?E3L-hFlt3L vs. PBS;
(163) The percentages of CD11b.sup.+ DCs out of CD45.sup.+ cells in both injected and non-injected tumors were also investigated. It was found that intratumoral injection of MVA?E3L-hFlt3L in WT mice resulted in the reduction of CD103.sup.+ DCs from 0.9% to 0.06% in injected tumors (P<0.01, MVA?F3L-hFlt3L vs. PBS;
Example 7
Intratumoral Injection of MVA?E3L-hFlt3L Results in the Influx of Ly6C.SUP.hi.CD11b.SUP.+ and Ly6C.SUP.+.CD11b? Cells in Both Injected and Non-Injected Tumors
(164) Ly6C.sup.hiCD11b.sup.+ cells are CC chemokine receptor (CCR2) expressing inflammatory monocytes that are recruited to site of injury or infection due to CC chemokine ligand 2 (CCL2). These cells give rise to TNF and iNOS-producing dendritic cells (TipDCs) and other inflammatory cells subsets, leading to tissue injury or microbial killing. The inventors investigated the percentages of Ly6C.sup.hiCD11b.sup.+ monocytes out of CD45.sup.+ cells in both injected and non-injected tumors. It was found that intratumoral injection of MVA?F3L-hFlt3L in WT mice resulted in the increase of Ly6C.sup.hiCD11b.sup.+ monocytes from 11.7% to 37% in injected tumors (P=0.0011, MVA?E3L-hFlt3L vs. PBS;
(165) The inventors also observed a dramatic increase of Ly6C.sup.hiCD11b.sup.? (cells in both injected tumors and non-injected tumors in virus-treated mice. Intratumoral injection of MVA?F3L-hFlt3L in WT mice resulted in the increase of Ly6C.sup.hiCD11b cells from 16.5% to 32.7% in injected tumors (P=0.0047, MVA?F3L-hFlt3L vs. PBS;
Example 8
Intratumoral Injection of MVA?E3L-hFlt3L is More Effective than MVA?E3L in a Bilateral MC38 Tumor Implantation Model
(166) To compare the antitumor efficacy of MVA?F3L-hFlt3L vs. MVA?F3L in a different solid tumor model, the inventors intradermally implanted 5?10.sup.5 MC38 colon cancer cells into the right flank and 1?10.sup.5 cells into the left flank of C57B/6 mice. Tumors were allowed to grow for 7-8 days, after which MVA?F3L-hFlt3L or MVA?E3L (2?10.sup.7 pfu) or PBS control were injected into the larger tumors twice a week. Whereas all of the PBS control mice died at 7-14 days (with a median survival of 10 days) post PBS-mock treatment due to tumor growth (
(167) Intratumoral injection of MVA?E3L-hFlt3L further extended the median survival to 23 days (**, P<0.003 for MVA?F3L-hFlt3L (n=10) vs. MVA?F3L (n=10)). These results indicate that MVA?F3L-hFlt3L is more efficacious than MVA?F3L in a bilateral MC38 tumor implantation model.
Example 9
Intratumoral Injections of MVA?E3L or MVA?E3L-hFlt3L are Also Effective in a Murine Triple-Negative Breast Cancer 4T1 Bilateral Implantation Model
(168) In addition to B16-F10 murine melanoma and MC38 colon adenocarcinoma models, the inventors investigated whether intratumoral injection of MVA?E3L or MVA?E3L-hFlt3L has efficacy in the treatment of triple-negative breast cancer (TNBC) 4T1 bilateral tumor implantation model. Briefly, 4T1 murine triple negative breast cancer (TNBC) cells were implanted intradermally to the left and right flanks of BALB/c mice (2.5?10.sup.5 to the right flank and 5?10.sup.4 to the left flank). 5 days post tumor implantation, the larger tumors on the right flank were injected with either MVA?F3L or MVA?E3L-hFlt3L (2?10.sup.7 pfu) twice weekly. Mice were monitored daily and tumor sizes were measured twice weekly. The survival of mice was monitored. It was found that intratumoral injection of MVA?E3L or MVA?F3L-hFlt3L led to dramatic decrease of tumor volumes of the injected tumors compared with PBS-treated tumors (
Example 10
Intratumoral Injections of MVA?E3L-hFlt3L is Effective in a Murine Prostate Cancer TRAMP-C2 Unilateral Tumor Implantation Model, which Requires STING
(169) The inventors investigated whether intratumoral injection of MVA?E3L-hFlt3L has efficacy in the treatment of murine prostate adenocarcinoma TRAMP-C2 unilateral tumor implantation model. Briefly, TRAMP-C2 cells were implanted intradermally to the shaved right flank of STING.sup.Gt/Gt mice and age-matched WT C57B/6 controls (1?10.sup.6 cells in 50 ?l of PBS per mouse). 17 days post tumor implantation, the tumors (around 3-4 mm in diameter) on the right flank were injected with either PBS or MVA?F3L-hFlt3L (2?10.sup.7 pfu) twice weekly. Mice were monitored daily and tumor sizes were measured twice weekly. The survival of mice was monitored. It was found that intratumoral injection of MVA?E3L-hFlt3L led to dramatic decrease of tumor volumes of the injected tumors in the WT mice compared with PBS-treated tumors, but it was less effective in STING-deficient mice (
Example 11
Intratumoral Injection of MVA-hFlt3L is Also Effective in a Bilateral B16-F10 Melanoma Implantation Model
(170) To test whether intratumoral injection of MVA-hFlt3L exerts an antitumor effect in a bilateral B16-F10 implantation model, MVA-hFlt3L or MVA?E3L-hFlt3L or PBS was injected into the larger tumors twice a week and tumor sizes and survival were monitored. The inventors found that intratumoral injection of MVA-hFlt3L eradicated or delayed tumor growth in both injected and non-injected tumors and extended the median survival from 11 days in the PBS group to 28 days in the MVA-hFlt3L group (***, P=0.0008 for MVA-hFlt3L (n=8) vs. PBS (n=5)) (
Example 12
The Combination of Intratumoral Injection of MVA?E3L-hFlt3L and Systemic Delivery of Immune Checkpoint has Synergistic Antitumor Effects in a Bilateral B16-F10 Melanoma Implantation Model
(171) The inventors have previously shown that the combination of intratumoral injection of inactivated MVA and systemic delivery of immune checkpoint blockade results in enhanced efficacy compared to either agent alone in bilateral B16-F10 and MC38 tumor implantation models. In the present disclosure, the inventors tested whether the combination of intratumoral injection of MVA?E3L-hFlt3L and systemic delivery of immune checkpoint blockade would also result in better tumor killing and improved survival than virotherapy alone in a bilateral B16-F10 melanoma implantation model. 8 days after tumor implantation, MVA?F3L-hFlt3L virus was injected into the larger tumors on the right flank twice weekly. Four groups of mice were treated with MVA?E3L-hFlt3L, with each group receiving intraperitoneal delivery of either the isotype control, or anti-CTLA-4, or anti-PD-1, or anti-PD-L1 antibodies (
Example 13
The Surviving Mice Treated with Intratumoral Injection of MVA?E3L-hFlt3L in Combination with Systemic Delivery of Immune Checkpoint Developed Immunity Against Challenge of a Different Tumor Type
(172) To assess whether the surviving mice post intratumoral injection of MVA?E3L-hFlt3L have developed immunity against a different tumor type, we rechallenged them with a lethal dose of MC38 (1?10.sup.5) implanted intradermally. Na?ve mice (n=4) that have never exposed to the said tumors or viruses were used as a control. Whereas all of the na?ve mice developed tumors and died at 34-42 days post tumor implantation with a median survival of 34 days, all of the MVA?E3L-hFlt3L+ immune checkpoint blockade-treated surviving mice rejected MC38 tumor challenge in this experiment (
Example 14
Intratumoral Injection with MVA?E3L-hFlt3L Leads to the Generation of Antitumor CD8.SUP.+ T Cell Immunity, which is Enhanced in the Presence of Anti-CTLA-4 Antibody
(173) The inventors examined whether the surviving mice developed antitumor memory T cell immunity against B16-F10 and MC38 colon cancers after treatment with intratumoral injection of MVA?E3L-hFlt3L alone or in the presence of intraperitoneal delivery of anti-CTLA-4 antibody by using Enzyme-linked ImmunoSpot (ELISpot). Briefly, CD8.sup.+ T cells were isolated from splenocytes and 1?10.sup.5 cells were cultured overnight at 37? C. in anti-IFN-?-coated BD ELISPOT plate microwells. CD8.sup.+ T Cells were stimulated with either B16-F10 or MC38 cells irradiated with an ?-irradiator and cytokine secretion was detected with an anti-IFN-? antibody. Whereas CD8.sup.+ T cells from na?ve mice did not show any reactivity to either B16-F10 or MC38 cells, CD8.sup.+ T cells from MVA?F3L-hFlt3L-treated mice showed reactivity to both B16-F10 and MC38 cells (
(174) It was observed that mice treated with the combination of intratumoral injection of MVA?F3L-hFlt3L and intraperitoneal delivery of anti-CTLA-4 antibody developed a much stronger anti-B16-F10 and anti-MC38 CD8.sup.+ T cell responses than those treated with virus alone (
Example 15
Intratumoral Injection with Heat-Inactivated MVA Induces Type I IFN and Inflammatory Cytokines and Chemokines in Both Injected and Non-Injected Tumorsin a Bilateral B16-F10 Tumor Implantation Model
(175) The inventors have previously shown that either Heat-inactivated MVA (Heat-MVA) or MVA?F3L infection of tumor cells or dendritic cells in vitro leads to the induction of type I IFN and proinflammatory cytokine and chemokine production (See, International Patent Applications WO/2016/144564 and WO2016/168862). To test whether intratumoral injection of Heat-MVA can induce type I IFN and proinflammatory cytokines and chemokines in vivo, the inventors performed the following experiment. Briefly, 2.5?10.sup.5 B16-F10 melanoma cells were intradermally implanted to the left flank and 5?10.sup.5 B16-F10 melanoma cells to the right flank of 6-8 weeks old C57B/6 mice. 7 days post-implantation, MVA (2?10.sup.7 pfu) or Heat-MVA, or PBS was injected into the larger tumors on the right flank. The injection was repeated three days later. Both the injected and non-injected tumors were harvested on day 7 after first injection, and cell suspensions were generated. RNAs were extracted from the cells and quantitative real-time PCR analyses were performed. The results showed that intratumoral injection of Heat-MVA induced much higher levels of induction of genes including Ifnb, Il6, Ccl4, Ccl5, Cxcl9, and Cxcl10 than MVA in both injected tumors and non-injected tumors (
(176) Because E3 is an immune evasion virulence factor, MVA?F3L induces higher levels of type I IFN and proinflammatory cytokines and chemokines than MVA in both immune cells and tumor cells, through the activation of both the cGAS/STING-dependent cytosolic DNA-sensing pathway and MDA5/MAVS-dependent cytosolic dsRNA-sensing pathway. In light of the results herein, we anticipate that intratumoral injection of MVA?F3L or MVA?F3L-hFlt3L would induce higher levels of type I IFN and proinflammatory cytokines and chemokines than MVA in both injected and non-injected tumors in vivo. In the absence of STING or Batf3, the anti-tumor T cell responses induced by intratumoral injection of Heat-MVA are significantly weakened (WO/2016/144564, incorporated by reference in its entirety). In addition, intratumoral injection of MVA?E3L-hFlt3L induced influx of Ly6C.sup.hiCD11b.sup.? cells to the both injected and non-injected tumors in WT mice, but the influx of this cell type was significantly reduced in Batf3?/? mice (Example 7,
Example 16
Intratumoral Injection with Heat-Inactivated MVA Induces Anti-Melanoma CD8.SUP.+ T Cell Responses in the Tumor Draining Lymph Nodes (TDLNs)
(177) It has been shown that intratumoral delivery of Heat-MVA leads to the induction of activated CD8.sup.+ T cells in the TDLNs, it is unclear whether they are anti-tumor T cells or antiviral T cells (WO/2016/144564 incorporated by reference in its entirety). To test whether intratumoral injection of Heat-MVA leads to the induction of activated tumor-specific CD8.sup.+ T cells, the inventors used a TRP-2 tetramer assay to detect CD8+ T cells that react to melanocyte antigen TRP-2 immunogenic peptide. Briefly, WT C57B/6 and Batf3.sup.?/? mice were intradermally implanted with B16-F10. When the tumors were 4 mm in diameter, they were treated with intradermal injections of Heat-MVA twice 3 days apart. 7 days post the initial injection, TDLNs were incubated and cell suspensions were prepared and incubated for 30 mins at room temperature with anti-Fc?R II (2.4G2) antibody and PE-H-2 Kb TRP2 (SVYDFFVWL) tetramer (MBL), followed by staining with anti-CD3 and anti-CD8 antibodies. Cells were analyzed by FACS. It was observed that intratumoral injection of Heat-MVA led to the increase of the percentages of TRP-2 tetramer positive CD8.sup.+ T cells in the TDLNs compared with PBS control (
Example 17
Intratumoral Injection with MVA?E3L-hFlt3L is Effective in the Treatment of Large Established B16-OVA Melanoma in a Unilateral Tumor Implantation Model
(178) The inventors compared the anti-tumor efficacy of intratumoral injection of MVA?F3L-hFlt3L with Heat-inactivated MVA (Heat-MVA) or poly (I:C) in a large established B16-OVA unilateral tumor implantation model. In this experiment, B16-OVA melanoma that constitutively express ovalbumin (OVA) (5?10.sup.5 cells in a volume of 50 ?l) were implanted intradermally into the shaved skin on the right flank of WT C57BL/6J mice. After 9 days post implantation, tumor sizes were measured and tumors that are 5-6 mm in diameter were injected with MVA?F3L-hFlt3L (2?10.sup.7 pfu), or Heat-iMVA (equivalent of 2?10.sup.7 pfu of MVA), or poly (I:C), or with PBS twice weekly. Mice were monitored daily and tumor sizes were measured twice a week (
Example 18
The Combination of Intratumoral Injection with Heat-Inactivated MVA and Systemic Delivery of Immune Checkpoint Antibodies Improves Antitumor Efficacy in a Large Established Melanoma Unilateral Implantation Model
(179) The inventors further tested whether the combination of intratumoral injection of Heat-inactivated MVA (Heat-MVA) and systemic delivery of immune checkpoint blockade such as anti-CTLA-4, anti-PD-1, or anti-PD-L1 antibodies have enhanced potency in eradicating large established B16-F10 in an unilateral tumor implantation model. Briefly, B16-F10 melanoma cells (5?10.sup.5 cells) were implanted intradermally into the shaved skin on the right flank of WT C57BL/6J mice. After 9 days post implantation, tumors that are 5-6 mm in diameter were injected with Heat-MVA (equivalent of 2?10.sup.7 pfu of MVA), or PBS. The mice were also treated with intraperitoneal delivery of anti-CTLA-4 antibody (100 ?g per mouse), anti-PD-1 antibody (250 ?g per mouse), or anti-PD-L1 (200 ?g per mouse) twice weekly. Mice were monitored daily and tumor sizes were measured twice a week (
(180) The above specification, examples and data provide a complete description of the manufacture and use of the composition of the invention. However, these are illustrative and nonlimiting. The breadth of the present invention resides in the claims.
(181) All patent and literature documents cited herein are incorporated by reference in their entirety for all purposes. Any embodiment or claim feature disclosed herein can be disclaimed in Applicant's discretion.
REFERENCES
(182) 1. C. Jochems, J. Schlom, Tumor-infiltrating immune cells and prognosis: the potential link between conventional cancer therapy and immunity. Exp Biol Med (Maywood) 236, 567-579 (2011). 2. B. Mlecnik, G. Bindea, F. Pages, J. Galon, Tumor immunosurveillance in human cancers. Cancer Metastasis Rev 30, 5-12 (2011). 3. H. Angell, J. Galon, From the immune contexture to the Immunoscore: the role of prognostic and predictive immune markers in cancer. Curr Opin Immunol 25, 261-267 (2013). 4. F. Garrido, I. Algarra, A. M. Garcia-Lora, The escape of cancer from T lymphocytes: immunoselection of MHC class I loss variants harboring structural-irreversible hard lesions. Cancer Immunol Immunother 59, 1601-1606 (2010). 5. G. Gerlini et al., Metastatic melanoma secreted IL-10 down-regulates CD1 molecules on dendritic cells in metastatic tumor lesions. Am J Pathol 165, 1853-1863 (2004). 6. P. Sharma, J. P. Allison, The future of immune checkpoint therapy. Science 348, 56-61 (2015). 7. S. L. Topalian, C. G. Drake, D. M. Pardoll, Targeting the PD-1/B7-H1(PD-L1) pathway to activate anti-tumor immunity. Curr Opin Immunol 24, 207-212 (2012). 8. D. H. Kim, S. H. Thorne, Targeted and armed oncolytic poxviruses: a novel multi-mechanistic therapeutic class for cancer. Nature reviews. Cancer 9, 64-71 (2009). 9. B. Moss, Poxviridae: The viruses and their replication. e. D. M. Knipe, Ed., In Fields Virology (Lippincott Williams & Wilkins, 2007), pp. pp. 2905-2946. 10. C. J. Breitbach, S. H. Thorne, J. C. Bell, D. H. Kim, Targeted and armed oncolytic poxviruses for cancer: the lead example of JX-594. Current pharmaceutical biotechnology 13, 1768-1772 (2012). 11. B. H. Park et al., Use of a targeted oncolytic poxvirus, JX-594, in patients with refractory primary or metastatic liver cancer: a phase I trial. Lancet Oncol 9, 533-542 (2008). 12. D. H. Kim, Y. Wang, F. Le Boeuf, J. Bell, S. H. Thorne, Targeting of interferon-beta to produce a specific, multi-mechanistic oncolytic vaccinia virus. PLoS Med 4, e353 (2007). 13. S. H. Thorne et al., Rational strain selection and engineering creates a broad-spectrum, systemically effective oncolytic poxvirus, JX-963. J Clin Invest 117, 3350-3358 (2007). 14. J. Engelmayer et al., Vaccinia virus inhibits the maturation of human dendritic cells: a novel mechanism of immune evasion. J Immunol 163, 6762-6768 (1999). 15. L. Jenne, C. Hauser, J. F. Arrighi, J. H. Saurat, A. W. Hugin, Poxvirus as a vector to transduce human dendritic cells for immunotherapy: abortive infection but reduced APC function. Gene therapy 7, 1575-1583 (2000). 16. P. Li et al., Disruption of MHC class II-restricted antigen presentation by vaccinia virus. J Immunol 175, 6481-6488 (2005). 17. L. Deng, P. Dai, W. Ding, R. D. Granstein, S. Shuman, Vaccinia virus infection attenuates innate immune responses and antigen presentation by epidermal dendritic cells. J Virol 80, 9977-9987 (2006). 18. R. Drillien, D. Spehner, D. Hanau, Modified vaccinia virus Ankara induces moderate activation of human dendritic cells. J Gen Virol 85, 2167-2175 (2004). 19. P. Dai et al., Modified vaccinia virus Ankara triggers type I IFN production in murine conventional dendritic cells via a cGAS/STING-mediated cytosolic DNA-sensing pathway. PLoS Pathog 10, e1003989 (2014). 20. G. Sutter, C. Staib, Vaccinia vectors as candidate vaccines: the development of modified vaccinia virus Ankara for antigen delivery. Current drug targets. Infectious disorders 3, 263-271 (2003). 21. C. E. Gomez, J. L. Najera, M. Krupa, M. Esteban, The poxvirus vectors MVA and NYVAC as gene delivery systems for vaccination against infectious diseases and cancer. Curr Gene Ther 8, 97-120 (2008). 22. C. E. Gomez, J. L. Najera, M. Krupa, B. Perdiguero, M. Esteban, MVA and NYVAC as vaccines against emergent infectious diseases and cancer. Curr Gene Ther 11, 189-217 (2011). 23. P. A. Goepfert et al., Phase 1 safety and immunogenicity testing of DNA and recombinant modified vaccinia Ankara vaccines expressing HIV-1 virus-like particles. J Infect Dis 203, 610-619 (2011). 24. L. S. Wyatt, I. M. Belyakov, P. L. Earl, J. A. Berzofsky, B. Moss, Enhanced cell surface expression, immunogenicity and genetic stability resulting from a spontaneous truncation of HIV Env expressed by a recombinant MVA. Virology 372, 260-272 (2008). 25. F. Garcia et al., Safety and immunogenicity of a modified pox vector-based HIV/AIDS vaccine candidate expressing Env, Gag, Pol and Nef proteins of HIV-1 subtype B (MVA-B) in healthy HIV-1-uninfected volunteers: A phase I clinical trial (RISVAC02). Vaccine 29, 8309-8316 (2011). 26. M. Tagliamonte, A. Petrizzo, M. L. Tornesello, F. M. Buonaguro, L. Buonaguro, Antigen-specific vaccines for cancer treatment. Human vaccines & immunotherapeutics 10, 3332-3346 (2014). 27. P. H. Verardi, A. Titong, C. J. Hagen, A vaccinia virus renaissance: new vaccine and immunotherapeutic uses after smallpox eradication. Human vaccines & immunotherapeutics 8, 961-970 (2012). 28. S. Hornemann et al., Replication of modified vaccinia virus Ankara in primary chicken embryo fibroblasts requires expression of the interferon resistance gene E3L. J Virol 77, 8394-8407 (2003). 29. H. Ludwig et al., Role of viral factor E3L in modified vaccinia virus ankara infection of human HeLa Cells: regulation of the virus life cycle and identification of differentially expressed host genes. J Virol 79, 2584-2596 (2005). 30. S. F. Fischer et al., Modified vaccinia virus Ankara protein F1L is a novel BH3-domain-binding protein and acts together with the early viral protein E3L to block virus-associated apoptosis. Cell Death Differ 13, 109-118 (2006). 31. J. C. Castle et al., Exploiting the mutanome for tumor vaccination. Cancer Res 72, 1081-1091 (2012). 32. T. N. Schumacher, R. D. Schreiber, Neoantigens in cancer immunotherapy. Science 348, 69-74 (2015). 33. I. Mellman, G. Coukos, G. Dranoff, Cancer immunotherapy comes of age. Nature 480, 480-489 (2011). 34. K. S. Peggs, S. A. Quezada, C. A. Chambers, A. J. Korman, J. P. Allison, Blockade of CTLA-4 on both effector and regulatory T cell compartments contributes to the antitumor activity of anti-CTLA-4 antibodies. J Exp Med 206, 1717-1725 (2009). 35. K. Wing et al., CTLA-4 control over Foxp3+ regulatory T cell function. Science 322, 271-275 (2008). 36. D. R. Leach, M. F. Krummel, J. P. Allison, Enhancement of antitumor immunity by CTLA-4 blockade. Science 271, 1734-1736 (1996). 37. F. S. Hodi et al., Improved survival with ipilimumab in patients with metastatic melanoma. The New England journal of medicine 363, 711-723 (2010). 38. C. Robert et al., Ipilimumab plus dacarbazine for previously untreated metastatic melanoma. The New England journal of medicine 364, 2517-2526 (2011). 39. S. L. Topalian, C. G. Drake, D. M. Pardoll, Immune checkpoint blockade: a common denominator approach to cancer therapy. Cancer Cell 27, 450-461 (2015). 40. D. A. Oble, R. Loewe, P. Yu, M. C. Mihm, Jr., Focus on TILs: prognostic significance of tumor infiltrating lymphocytes in human melanoma. Cancer immunity 9, 3 (2009). 41. K. E. Lacy, S. N. Karagiannis, and F. O. Nestle, Immunotherapy for Melanoma. Expert Rev Dermatol 7, 51-68 (2012). 42. J. D. Wolchok et al., Ipilimumab monotherapy in patients with pretreated advanced melanoma: a randomised, double-blind, multicentre, phase 2, dose-ranging study. Lancet Oncol 11, 155-164 (2010). 43. J. D. Wolchok et al., Nivolumab plus ipilimumab in advanced melanoma. The New England journal of medicine 369, 122-133 (2013). 44. O. Hamid et al., Safety and Tumor Responses with Lambrolizumab (Anti-PD-1) in Melanoma. The New England journal of medicine, (2013). 45. P. C. Tumeh et al., PD-1 blockade induces responses by inhibiting adaptive immune resistance. Nature 515, 568-571 (2014). 46. D. Zamarin et al., Localized oncolytic virotherapy overcomes systemic tumor resistance to immune checkpoint blockade immunotherapy. Science translational medicine 6, 226ra232 (2014). 47. M. B. Fuertes, S. R. Woo, B. Burnett, Y. X. Fu, T. F. Gajewski, Type I interferon response and innate immune sensing of cancer. Trends Immunol 34, 67-73 (2013). 48. M. S. Diamond et al., Type I interferon is selectively required by dendritic cells for immune rejection of tumors. J Exp Med 208, 1989-2003 (2011). 49. M. B. Fuertes et al., Host type I IFN signals are required for antitumor CD8.sup.+ T cell responses through CD8{alpha}.sup.+ dendritic cells. J Exp Med 208, 2005-2016 (2011). 50. S. R. Woo et al., STING-dependent cytosolic DNA sensing mediates innate immune recognition of immunogenic tumors. Immunity 41, 830-842 (2014). 51. L. Deng et al., STING-Dependent Cytosolic DNA Sensing Promotes Radiation-Induced Type I Interferon-Dependent Antitumor Immunity in Immunogenic Tumors. Immunity 41, 843-852 (2014). 52. J. P. Huber, J. D. Farrar, Regulation of effector and memory T-cell functions by type I interferon. Immunology 132, 466-474 (2011). 53. D. M. Pardoll, The blockade of immune checkpoints in cancer immunotherapy. Nature reviews. Cancer 12, 252-264 (2012). 54. J. Nemunaitis, Oncolytic viruses. Invest New Drugs 17, 375-386 (1999). 55. D. Kirn, R. L. Martuza, J. Zwiebel, Replication-selective virotherapy for cancer: Biological principles, risk management and future directions. Nat Med 7, 781-787 (2001). 56. M. C. Coffey, J. E. Strong, P. A. Forsyth, P. W. Lee, Reovirus therapy of tumors with activated Ras pathway. Science 282, 1332-1334 (1998). 57. A. Mayr, H. Stickl, H. K. Muller, K. Danner, H. Singer, [The smallpox vaccination strain MVA: marker, genetic structure, experience gained with the parenteral vaccination and behavior in organisms with a debilitated defence mechanism (author's transl)]. Zentralbl Bakteriol B 167, 375-390 (1978). 58. C. Verheust, M. Goossens, K. Pauwels, D. Breyer, Biosafety aspects of modified vaccinia virus Ankara (MVA)-based vectors used for gene therapy or vaccination. Vaccine 30, 2623-2632 (2012). 59. G. Antoine, F. Scheiflinger, F. Dorner, F. G. Falkner, The complete genomic sequence of the modified vaccinia Ankara strain: comparison with other orthopoxviruses. Virology 244, 365-396 (1998). 60. A. Mayr, Hochstein-Mintzel V, Stickl H., Passage history, properties, and applicability of the attenuated vaccinia virus strain MVA [in German]. Infection 3, 6-14 (1975). 61. H. Meyer, G. Sutter, A. Mayr, Mapping of deletions in the genome of the highly attenuated vaccinia virus MVA and their influence on virulence. J Gen Virol 72 (Pt 5), 1031-1038 (1991). 62. S. Brandler et al., Preclinical studies of a modified vaccinia virus Ankara-based HIV candidate vaccine: antigen presentation and antiviral effect. J Virol 84, 5314-5328 (2010). 63. A. Takaoka, T. Taniguchi, New aspects of IFN-alpha/beta signalling in immunity, oncogenesis and bone metabolism. Cancer Sci 94, 405-411 (2003). 64. D. Nagorsen, E. Wang, F. M. Marincola, J. Even, Transcriptional analysis of tumor-specific T-cell responses in cancer patients. Crit Rev Immunol 22, 449-462 (2002). 65. S. Pramanick, Singodia, D., and Chandel, V., Excipient selection in parenteral formulation development. Pharma Times 45, 65-77 (2013). 66. J. R. Weaver et al., The identification and characterization of a monoclonal antibody to the vaccinia virus E3 protein. Virus Res 130, 269-274 (2007). 67. M. Sato et al., Distinct and essential roles of transcription factors IRF-3 and IRF-7 in response to viruses for IFN-alpha/beta gene induction. Immunity 13, 539-548 (2000). 68. H. Ishikawa, G. N. Barber, STING is an endoplasmic reticulum adaptor that facilitates innate immune signalling. Nature 455, 674-678 (2008). 69. G. N. Barber, Innate immune DNA sensing pathways: STING, AIMII and the regulation of interferon production and inflammatory responses. Curr Opin Immunol 23, 10-20 (2011). 70. J. D. Sauer et al., The N-ethyl-N-nitrosourea-induced Goldenticket mouse mutant reveals an essential function of Sting in the in vivo interferon response to Listeria monocytogenes and cyclic dinucleotides. Infection and immunity 79, 688-694 (2011). 71. L. Sun, J. Wu, F. Du, X. Chen, Z. J. Chen, Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science 339, 786-791 (2013). 72. X. D. Li et al., Pivotal roles of cGAS-cGAMP signaling in antiviral defense and immune adjuvant effects. Science 341, 1390-1394 (2013). 73. J. Wu et al., Cyclic GMP-AMP is an endogenous second messenger in innate immune signaling by cytosolic DNA. Science 339, 826-830 (2013). 74. P. Gao et al., Structure-function analysis of STING activation by c[G(2,5)pA(3,5)p] and targeting by antiviral DMXAA. Cell 154, 748-762 (2013). 75. K. V. Kibler et al., Double-stranded RNA is a trigger for apoptosis in vaccinia virus-infected cells. J Virol 71, 1992-2003 (1997). 76. S. B. Lee, M. Esteban, The interferon-induced double-stranded RNA-activated protein kinase induces apoptosis. Virology 199, 491-496 (1994). 77. D. Tormo et al., Targeted activation of innate immunity for therapeutic induction of autophagy and apoptosis in melanoma cells. Cancer Cell. 2009 Aug. 4; 16(2):103-14. doi: 10.1016/j.ccr.2009.07.004. 78. L. Gitlin et al., Essential role of mda-5 in type I IFN responses to polyriboinosinic:polyribocytidylic acid and encephalomyocarditis picornavirus. Proc Natl Acad Sci USA. 2006 May 30; 103(22):8459-64. Epub 2006 May 19.