COMPOSITION FOR PREVENTING, TREATING, OR IMPROVING GASTROINTESTINAL DISEASES COMPRISING STRAIN OF GENUS CORYNEBACTERIUM AND CULTURE THEREOF

Abstract

The present application relates to a composition for preventing, improving, or treating gastrointestinal diseases comprising a strain of the genus Corynebacterium, a culture thereof, and threonine. As the composition according to the present application is confirmed to have excellent anti-Helicobacter pylori efficacy in cell experiments, efficacy in improving gastrointestinal diseases in animal experiments, and efficacy in gastric mucus synthesis, the composition can be applied as a pharmaceutical composition for preventing or treating gastrointestinal diseases, as food for preventing or improving gastric ulcers, or as a composition for feed.

Claims

1-13. (canceled)

14. A method of preventing, improving or treating a gastric disorder, comprising administering an effective amount of a composition comprising a Corynebacterium sp. strain, its cultured product, and threonine, to a subject in need of preventing, improving or treating the gastric disorder.

15. The method to claim 14, wherein the Corynebacterium sp. strain is at least one selected from the group consisting of Corynebacterium glutamicum, Corynebacterium ammoniagenes, and Corynebacterium efficiens.

16. The method to claim 14, wherein the Corynebacterium sp. strain is a heat killed bacteria.

17. The method to claim 14, wherein the cultured product is a fermented product that the Corynebacterium sp. strain is cultured in a medium.

18. The method to claim 17, wherein the medium is a medium for producing threonine.

19. The method to claim 14, wherein the composition comprises threonine in an amount of 60 to 80% by weight.

20. The method to claim 14, wherein the Corynebacterium sp. strain and its cultured product are comprised in a dried form.

21. The method to claim 14, wherein the gastric disorder is caused by Helicobacter pylori infection.

22. The method to claim 14, wherein the gastric disorder is at least one selected from the group consisting of gastritis, gastric ulcer, duodenal ulcer, peptic ulcer, and gastric cancer.

23. The method to claim 14, wherein the threonine is (1) comprised in the Corynebacterium sp. strain, its cultured product, or both of them; or (2) added separately; or (3) comprised in the Corynebacterium sp. strain, its cultured product, or both of them, and is further added thereto.

24. A method of inhibiting Helicobacter pylori, comprising administering an effective amount of a composition comprising a Corynebacterium sp. strain, its cultured product, and threonine.

25. The method to claim 24, wherein the Corynebacterium sp. strain is at least one selected from the group consisting of Corynebacterium glutamicum, Corynebacterium ammoniagenes, and Corynebacterium efficiens.

26. The method to claim 24, wherein the Corynebacterium sp. strain is a heat killed bacteria.

27. The method to claim 24, wherein the cultured product is a fermented product that the Corynebacterium sp. strain is cultured in a medium.

28. The method to claim 27, wherein the medium is a medium for producing threonine.

29. The method to claim 24, wherein the composition comprises threonine in an amount of 60 to 80% by weight.

30. The method to claim 24, wherein the Corynebacterium sp. strain and its cultured product are comprised in a dried form.

31. The method to claim 24, wherein the threonine is (1) comprised in the Corynebacterium sp. strain, its cultured product, or both of them; or (2) added separately; or (3) comprised in the Corynebacterium sp. strain, its cultured product, or both of them, and is further added thereto.

32. A method of preparation of a feed, a medicament, or a food for prevention, improvement, or treatment of a gastric disorder, comprising mixing a Corynebacterium sp. strain, its cultured product, and threonine.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0131] FIG. 1 shows the antimicrobial activity against H. pylori of Groups 1 to 8.

[0132] FIG. 2a to FIG. 2c show the result of measuring the expression of inflammation mediators when treating Groups 1 to 8 to RGM1 cells infected with 100 MOI for 6 hours using H. pylori strain. Specifically, FIG. 2a shows the Cox-2 mRNA expression change according to the treatment of Groups 1 to 8 in the RGM1 cells infected with H. pylori strain, and FIG. 2b shows the protein expression change of iNOS according to the treatment of Groups 1 to 8 in the RGM1 cells infected with H. pylori strain, and FIG. 2c shows the phosphorylated NF-κB p65 protein expression change according to the treatment of Groups 1 to 8 in the RGM1 cells infected with H. pylori strain. GAPDH and β-actin are used as internal controls of mRNA and protein, respectively.

[0133] In FIG. 2a to FIG. 6b, N (first line from left) represents the negative control group (H. pylori-untreated RGM1 cell), and H.p (second line from left) represents the positive control group (H. pylori-infected RGM1 cell), and Groups 1 to 8 represent the result in the cell in which the composition of Groups 1 to 8 is treated to the H. pylori-infected RGM1 cell.

[0134] FIG. 3a shows the expression change of the oxidation stress-related protein (HIF-1a) according to the treatment of Groups 1 to 8 in the H. pylori-infected RGM1 cell. β-actin is used as the internal control group. FIG. 3b shows the result of measuring the concentration change of intracellular active oxygen according to the treatment of Groups 1 to 8 in the H. pylori-infected RGM1 cell (DCF increase and decrease result).

[0135] FIG. 4a shows the expression change of HO-1 mRNA according to the treatment of Groups 1 to 8 in the H. pylori-infected RGM1 cell, and FIG. 4b shows the GST(pi) and HO-1 protein expression change according to the treatment of Groups 1 to 8 in the H. pylori-infected RGM1 cell. GAPDH and β-actin are used as the internal control group.

[0136] FIG. 5 shows the apoptosis inhibitory efficacy according to the treatment of Groups 1 to 8 in the H. pylori-infected RGM1 cell. Specifically, FIG. 5a shows the expression change of Bax, and Bcl-2 protein according to the treatment of Groups 1 to 8 in the H. pylori-infected RGM1 cell, and β-actin is used as the internal control group. FIG. 5b shows the apoptosis change (TUNEL staining result) according to the treatment of Groups 1 to 8 in the H. pylori-infected RGM1 cell.

[0137] FIG. 6 shows the result of the change of angiogenesis and mucosal proliferation growth factors according to the treatment of Groups 1 to 8 in the H. pylori-infected RGM1 cell. FIG. 6a shows the expression change of TGF-β and VEGF protein according to the treatment of Groups 1 to 8 in the H. pylori-infected RGM1 cell, and β-actin is used as the internal control group. FIG. 6b shows the expression change of β-catenin protein according to the treatment of Groups 1 to 8 in the H. pylori-infected RGM1 cell, and Lamin B is used as the internal control group.

[0138] In FIG. 7a to FIG. 10, Groups 1˜4 mean the animal experimental groups 1-4of Table 5.

[0139] FIG. 7 shows the SRMD (stress-related mucosal disease) improvement efficacy by administration of the composition according to one example in the WIRS animal model experimental group. Specifically, FIG. 7a shows pathological photographs for stomach of each experimental group, and photographs in two lines on the right are indicated at ×40 magnification. FIG. 7b shows (A) Gross lesion index (top left graph), (B) Inflammation; pathologic score (top right graph), (C) Ulcer/erosion; pathologic score (bottom left graph), (D) Regeneration; pathologic score (bottom right graph), by administration of the composition according to one example in the WIRS animal model experimental group.

[0140] FIG. 8 shows the change of the inflammation, angiogenesis, and signaling, by administration of the composition according to one example in the WIRS animal model experimental group. (A) FIG. 8a shows the expression change of iNOS, TNF-α, and IFN-γ mRNA in the animal experimental groups 1-4, and FIG. 8b shows the expression change of PDGF mRNA in the animal experimental groups 1-4, and FIG. 8c shows the expression change of p-IκBα protein in the animal experimental groups 1-4, and FIG. 8d shows the change of P-ERK and p-JNK protein in the animal experimental groups 1-4. GAPDH and β-actin are used as the internal control group of mRNA and protein, respectively.

[0141] FIG. 9 is the result showing the change of apoptosis and cell cycle by administration of the composition according to one example in the WIRS animal model experimental group. Specifically, FIG. 9a is the result of TUNEL analysis showing the apoptosis level in the SRMD region of gastric mucosa in the animal experimental groups 1-4, and FIG. 9b shows the protein expression change of PARP-1, Bcl-2, Bax, Cleaved caspase-8, and Cleaved caspase-3, and FIG. 9c shows the protein expression change of CDK4 and Cyclin D1. β-actin is used as the internal control group.

[0142] FIG. 10 shows the mucin content in the stomach tissue of the animal experimental groups 1-4.

[0143] FIG. 11 shows pathological photographs of the stomach of WIRS rats in which samples comprising threonine of various % by weight are administered. The composition and content of Samples 1 to 5 of FIG. 11 are disclosed in Table 4.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0144] Hereinafter, it will be described in detail by examples to help understanding of the present application. However, the following examples illustrate the content of the present application, and the scope of the present application is not limited to the following examples. The examples of the present application are provided to more completely described the present application to those skilled in the art.

Example 1. Corynebacterium sp. Strain-Containing Composition and Cell Infection

Example 1-1. Corynebacterium sp. Strain-Containing Composition Preparation

[0145] To verify the difference of the efficacy of anti-Helicobacter pylori, inhibition of apoptosis, and cell protection of the strain composition containing Corynebacterium sp. strain, and the efficacy between Corynebacterium sp. strains, compositions of Group 1 to Group 8 were prepared.

[0146] Wild type strains of Corynebacterium glutamicum (C. glutamicum), Corynebacterium ammoniagenes (C. ammoniagenes), and Corynebacterium efficiens (C. efficiens) were provided from CJ CheilJedang BIO R&D Center (Blossom park) and used, and the strains were inoculated to broth for producing threonine respectively, and cultured at 35° C. for 48 hours at 200 rpm. The components and contents of the broth for producing threonine are disclosed in the following Table 1.

TABLE-US-00001 TABLE 1 Component Concentration (per liter) Glucose 70 g KH.sub.2PO.sub.4 1 g (NH.sub.4).sub.2SO.sub.4 30 g MgSO.sub.4•7H.sub.2O 1 g FeSO.sub.4•7H.sub.2O 200 mg MnSO.sub.4•4H.sub.2O 100 mg Biotin 1 mg Yeast extract 2.5 g Calcium-pantothenic acid 1 mg Thiamine hydrochloride 1 mg Calcium carbonate 30 g pH 6.8

[0147] Group 1 comprises supernatant of fermented broth in which a microbial cell has been removed by centrifuging the fermented broth prepared by culturing Corynebacterium glutamicum under the above condition, and Group 2 is buffer (Tris-HCl) comprising threonine at a concentration of 100 g/L. Groups 3 to 5 were prepared by centrifuging the fermented broth prepared by culturing the strain under the above condition to collect a microbial cell, and suspending the collected microbial cell in buffer (Tris-HCl). Groups 6 to 8 are fermented broth in which each strain is cultured under the above condition, and comprise each strain and the cultured product in which each strain has been cultured in the medium (disclosed as ‘supernatant of fermented broth’ in Table 2). The compositions of Groups 3 to 8 comprise each strain at a concentration of 30 OD (wave length 562 nm), and comprise the strain as a heat killed bacteria through autoclave.

[0148] Groups 1 to 8 comprise threonine all, and there is a group comprising threonine in each strain (comprised in a heat killed bacteria form) or cultured product, and therefore, threonine (threonine produced through CJ BIO strains; purity >99%) were further added so that the final threonine concentration in Groups 1 to 8 was 100 g/L by measuring the threonine content in the strain and/or cultured product.

[0149] The components of each group were disclosed in the following Table 2. In Table 2, ‘supernatant of fermented broth’ of Group 1 and Group 6 means that a microbial cell is removed in the cultured product prepared by culturing ‘C. glutamicum strain’ under the above condition, and the supernatant of fermented broth of Groups 7 and 8 means that a microbial cell is removed in the cultured product prepared by culturing ‘C. ammoniagenes strain’ and ‘C. efficiens strain’ under the above condition.

TABLE-US-00002 TABLE 2 Group Components in compositions Group 1 Threonine + Supernatant of fermented broth Group 2 Threonine Group 3 Threonine + C. glutamicum Group 4 Threonine + C. ammoniagenes Group 5 Threonine + C. efficiens Group 6 Threonine + C. glutamicum + Supernatant of fermented broth Group 7 Threonine + C. ammoniagenes + Supernatant of fermented broth Group 8 Threonine + C. efficiens + Supernatant of fermented broth

[0150] Groups 1-8 disclosed in the following Examples 2 to 7 and FIG. 1 to FIG. 6b mean the Groups 1-8 of Table 2.

Example 1-2. Rat Gastric Mucosa Cell Line Culturing

[0151] The gastric mucosa cell line of a normal rat, RGM1 cell was cultured in Ham F12 mixed medium and DMEM (Dulbecco's modified essential medium) comprising 10% fetal bovine serum with a 37° C. cell incubator (95% air, 5% CO.sub.2). The RGM1 cell line was established by Professor Matsui of Japan Tsukuba University, and used after consent.

Example 1-3. H. pylori Strain and Cell Infection

[0152] Helicobacter pylori (H. pylori) strain (cytotoxin-associated gene A [CagA]+strain, NCTC 11637) was purchased from ATCC (American Type Culture Collection, Rockville, Md.). The H. pylori strain was cultured with shaking under the condition of 10% CO.sub.2 until it was 1×10.sup.8 CFU/ml (OD 600=1) in Brucella broth in which 5% bovine calf serum and an antibiotic were added.

[0153] The RGM1 cell was infected with the H.pylori strain for 6 hours at the multiplicity of infection (MOI) of 100:1 (hereinafter, 100 MOI).

Example 2. Test of Anti-Helicobacter Efficacy of the Composition Containing Corynebacterium sp. Strain In Vitro

[0154] The growth inhibitory efficacy of H. pylori, that is anti-Helicobacter efficacy, was measured in a blood agar plate using disc diffusion assay. Specifically, TSA (Trypticase™ Soy Agar) 40 g/L was dissolved in purified water and then autoclaved (121° C., 20 min). After cooling to about 50° C., 5% sheep blood was added, and then an antibiotic {trimethoprim (5 mg/L), polymyxin B (2500 U/L), vancomycin (10 mg/L)} was added. The medium was aliquoted by 20 to 25 ml, in the sterilized plate, and then was stored at 4° C.

[0155] H. pylori strain solution 200 μl was aliquoted and spreaded on the prepared blood agar plate, and 40 μl of each composition of Groups 1 to 8 prepared in Example 1-1 was absorbed to each disc paper, and was cultured in a CO.sub.2 incubator of 37° C. for 48 hours, and then the diameter of the clear zone around the disc was measured and shown in FIG. 1 (the result of Group 1 was not represented in the graph). In FIG. 1, ‘Non-treated’ means the RGM1 cell uninfected by H.pylori.

[0156] As shown in FIG. 1, it was confirmed that Groups 6 and 7 had the significant anti-Helicobacter activity, as the numerical value of the diameter of the clear zone was significantly high in Groups 6 and 7 compared to the untreated group.

[0157] In addition, the appropriate concentration of Groups 1-8 to be used in the following experiments was to be derived.

[0158] The diluted solutions in which the compositions of Groups 1 to 8 prepared in Example 1-1 were diluted by ¼, 1/40, or 1/100 were treated to H.pylori by 40 μl, respectively, and the cell viability was measured. As at the dilution concentration of ¼, the viability of 0.5 or less was shown in many groups, and at the dilution concentration of 1/100, there was no clear result difference between groups, the diluted solution of 1/40 in which the significant result difference was shown compared to Group 1 was used in the following experiments.

Example 3. Test of Change of Inflammation Mediator and NF-κB Transcribing the Same by the Composition Containing Corynebacterium sp. Strain

[0159] As the method of Example 1-3, the RGM1 cell infected by H. pylori (100 MOI) was treated with the compositions of Groups 1 to 8, diluted by 1/40, of 40 μl, respectively for 6 hours. Then, in the RGM1 cell in which the compositions were treated, the expression level of the inflammation mediator, Cox-2 mRNA was confirmed through RT-PCT (Reverse transcription PCR) analysis, and the result was shown in FIG. 2a.

[0160] Specifically, RNA was extracted using TRIzol (Gibco BRL, Rockville, Md.), and the extracted RNA was synthesized into cDNA using moloney murine leukemia virus reverse transcriptase (Perkin Elmer, Morrisville, N.C.). The nucleic sequence of each primer used for PCR analysis was shown in the following Table 3, and as an internal standard, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used.

TABLE-US-00003 TABLE 3 Gene Forward Primer(5′.fwdarw.3′) Reverse Primer(5′.fwdarw.3′) IL-1β CAG GCT CCG AGA TGA ACA TGG GGA ACT CTG CAG  ACA AA(SEQ ID NO: 1) ACT CA(SEQ ID NO: 2) IL-8 CAG ACA GTG GCA GGG ATT TTG GGG ACA CCC TTT  CA(SEQ ID NO: 3) AGC AT(SEQ ID NO: 4) Cox-2 GAA ATG GCT GCA GAG TTG TCA TCT AGT CTG GAG  AA(SEQ ID NO: 5) TGG GA(SEQ ID NO: 6) iNOS CTC ACT GGG ACT GCA CAG TGT TGA AGG GTG TCG  AA(SEQ ID NO: 7) TGA AA(SEQ ID NO: 8) HO-1 GAC AGC ATG TCC CAG GAT GGT TCT GCT TGT TTC  TT(SEQ ID NO: 9) GCTC T(SEQ ID NO: 10) HSP70 GAG TTG AGC GGC ATC CCG GTC CTA GAT TCA CC(SEQIDNO: 11) GAG(SEQ ID NO: 12) Gapdh GGT GCT GAG TAT GTC GTG TTC AGC TCT GGG ATG  GA(SEQ ID NO: 13) ACC TT(SEQ ID NO: 14)

[0161] In addition, in the RGM1 cell in which the compositions were treated, the increase and decrease of the expression level of iNOS protein and NF-κB p65 phosphorylation transcribing it was confirmed through western blot analysis, and the result was shown in FIG. 2b and FIG. 2c.

[0162] Specifically, the cell cultured by treating the compositions was washed with PBS (phosphate buffered saline) solution, and then was dissolved with cell lysis buffer (150 mM NaCl, 0.5% Triton X-100, 50 mM tris-HCl, pH 7.4, 25 mM NaF, 20 mM ethyleneglycol-bis(βN′-tetraacetic acid, 1 mM dithiothreitol, 1 mM Na.sub.3VO.sub.4, Protease Inhibitor Cocktail tablet [Boehringer, Manneim, Germany]) to make protein lysate. After electrophoresis of them by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis), unfolded protein was transferred to PVDF membrane (Gelman Sciences, Ann Arbor, Mich.) to react it with a primary antibody and a secondary antibody, respectively, and then it was analyzed using a chemoluminescence system.

[0163] As shown in FIG. 2a, compared to the normal RGM1 cell (N), in the RGM1 cell infected by H. pylori (H.p), Cox-2 mRNA was significantly increased, and the increased mRNA expression of Cox-2 by H. pylori infection was most significantly reduced by addition of the composition of Group 6.

[0164] As shown in FIG. 2b and FIG. 2c, the iNOS protein expression and phosphorylation of NF-κB p65 transcribing it was significantly increased by H. pylori infection, but the iNOS protein expression and phosphorylation of NF-κB p65 transcribing it was most significantly decreased by addition of the composition of Group 6. From the result, it could be seen that the composition according to one example regulated the inflammation mediating pathway by the Helicobacter strain.

Example 4. Test of Efficacy of Weakening Oxidative Stress by the Composition Containing Corynebacterium sp. Strain In Vitro

[0165] As the method of Example 1-3, the RGM1 cell infected by H. pylori (100 MOI) was treated with the compositions of Groups 1 to 8, diluted by 1/40, of 40 μl, respectively for 6 hours. Then, western blot was performed by the similar method to Example 3, and the expression level change of oxidative stress-associated HIF-1α was measured, and the result was shown in FIG. 3a.

[0166] As shown in FIG. 3a, HIF-1a was significantly increased by Helicobacter pylori infection, and the HIF-1a expression was significantly reduced in Groups 6 and 7.

[0167] In addition, to measure the concentration change of intracellular reactive oxygen, DCF enhancement reaction utilizing a DCF-DA probe was analyzed with a confocal imager. A non-fluorescent substance, DCF-DA (2′,7′-dichlorofluorescein diacetate) is oxidized by reactive oxygen species (ROS) when peroxides are present in a cell and exhibits green fluorescence, and therefore the amount of reactive oxygen species may be directly quantified by the fluorescence intensity at a specific wavelength. Specifically, the RGM-1 cell (H. pylori untreated RGM1 cell; or RGM1 cell infected by H. pylori (100 MOI) (Example 1-3)) of 5×10.sup.5 cells/well was aliquoted to a 24 well plate, and was cultured in a 37° C. incubator (95% air, 5% CO.sub.2) overnight, and then the compositions of Groups 1 to 8 were treated for a certain time, respectively. The cell was washed with DMEM, and then 10 μg/ml DCF-DA (2′,7′-dichlorofluorescein diacetate, Sigma-Aldrich Co., St Louis, Mo.) was added to the medium and it was incubated in an incubator for 30 minutes. After incubation, the cell washed with PBS of 4° C. was observed and photographed with a fluorescence microscope, and the result was shown in FIG. 3b.

[0168] As shown in FIG. 3b, it was confirmed that the fluorescence intensity of DCF-DA increased after Helicobacter pylori infection was statistically significantly reduced in Groups 1, 3, 6 and 8 treated groups (P<0.05), and in the Group 6 treated group, the reduction degree was the largest (P<0.01). From the result, it could be seen that the composition according to one example could immediately cope with oxidative stress or hypoxia response by Helicobacter pylori strain.

Example 5. Test of Helicobacter pylori-Associated Anti-Oxidation-Mediated Cell Protection Efficacy by the Composition Containing Corynebacterium sp. Strain In Vitro

[0169] As the method of Example 1-3, the RGM1 cell infected by H. pylori (100 MOI) was treated with the compositions of Groups 1 to 8, diluted by 1/40, of 40 μl, respectively for 6 hours. Then, the mRNA expression change of HO-1 of the anti-oxidation function, a representative cytoprotective factor, was analyzed by the method according to Example 3 (PCR), and was shown in FIG. 4a, and the HO-1 and GST (glutathione-s-transferase(pi)) protein expression change was analyzed similarly to the method according to Example 3 (western blot analysis) and was shown in FIG. 4b.

[0170] As a result, as FIG. 4a and FIG. 4b, in the control group, the significant reduction of HO-1 mRNA and protein was observed after Helicobacter pylori infection, and in the Groups 6 to 8 treated groups, the reduced HO-1 expression was significantly increased, and among them, in the Group 6 treated group, the HO-1 expression was most significantly increased. In addition, as shown in FIG. 4b, in Groups 6 and 7, the GST(pi) expression was significantly reduced, and among them, in the Group 6 treated group, the GST(pi) expression was most significantly reduced.

[0171] From the result, it could be seen that the composition according to one example exhibited the anti-oxidation action and cell protection efficacy mostly based on the HO-1 reaction for Helicobacter pylori strain.

Example 6. Test of Helicobacter pylori-Associated Apoptosis Inhibitory Efficacy by the Composition Containing Corynebacterium sp. Strain In Vitro

[0172] As the method of Example 1-3, the RGM1 cell infected by H. pylori (100 MOI) was treated with the compositions of Groups 1 to 8, diluted by 1/40, of 40 μl, respectively for 6 hours. Then, by the method similar to Example 3, the expression of Bcl-2 and Bax was confirmed by western blot, and the result was shown in FIG. 5a, and apoptosis was analyzed by TUNEL staining, and the result was shown in FIG. 5b. Specifically, TUNEL staining was conducted by aliquoting the cell to Lab-Tek chamber slide by 1×10.sup.5 cells/chamber and then culturing in a 37° C. incubator (95% air, 5% CO.sub.2). Then, after treating each reagent for a certain time, it was performed by the manufacturer's experimental method using an apoptosis detection kit (Oncogene Research Products, Cambridge, Mass.). The cultured solution was removed and washed with PBS solution 3 times, and then 4% PFA (paraformaldehyde) was added and it was fixed at a room temperature for 20 minutes. After washing with PBS twice again, 0.1% Triton X-100 was treated at 4° C. for 5 minutes, and light was blocked and then it was reacted with solution made by mixing TdT (terminal deoxynucleotidyl transferase) and nucleotide mixture at 37° C. for 60 minutes. After washing with PBS, apoptosis was observed with a fluorescence microscope.

[0173] As shown in FIG. 5a, the decrease of expression of Bcl-2 and increase of expression of Bax could be observed in the cell infected by H. pylori (H.p), and it could be confirmed that the Bax expression significantly increased was decreased and the decreased Bcl-2 expression was increased in the Groups 6 to 8 treated groups, and among them, in the Group 6 treated group, the effect was most excellent.

[0174] Helicobacter pylori infection is known to induce mucosa damage and ulcer by significant increase of apoptosis, and as shown in FIG. 5b, in the result of TUNEL staining, the statistically significant increase of apoptosis was observed by Helicobacter pylori infection (P<0.01), but in the Groups 6 to 8 treated groups, apoptosis was significantly reduced, and among them, in the Group 6 treated group, apoptosis was reduced mostly.

Example 7. Test of Change of Helicobacter pylori-Associated Cell Growth, Vascular Growth, and Proliferation Factor by the Composition Containing Corynebacterium sp. Strain In Vitro

[0175] As the method of Example 1-3, the RGM1 cell infected by H. pylori (100 MOI) was treated with the compositions of Groups 1 to 8, diluted by 1/40, of 40 μl, respectively for 6 hours. Then, by the method similar to Example 3, the change of TGF-β and VEGF was analyzed by western blot, and the result was shown in FIG. 6a.

[0176] As a result, as shown in FIG. 6a, TGF-β and VEGF increased by Helicobacter pylori infection promoted indiscriminate mucosa proliferation or cancerous inflammation, but in the Groups 6 to 8 treated groups, the expression of TGF-β and VEGF was significantly reduced, and in particular, in the Group 6 treated group, the expression of TGF-β and VEGF was reduced mostly. From this, the result that the composition according to one example could alleviate all inflammation or canceration by Helicobacter pylori infection was shown.

[0177] In addition, nuclear transfer of β-catenin was confirmed utilizing nuclear fraction in the Helicobacter pylori-infected cell by western blot, and the result was shown in FIG. 6b. As shown in FIG. 6b, it was confirmed that the nuclear transfer of β-catenin increased by Helicobacter pylori infection could be significantly inhibited by treatment of the Group 6.

[0178] All the experimental values of Examples 1 to 7 were statistically verified by the method through T-test, and p<0.05 or more was defined as statistically significant.

Example 8. Preparation of Sample Comprising Threonine

[0179] fermented broth prepared by inoculating C. glutamicum wild type strain (CJ CheilJedang BIO R&D Center (Blossom park)) to broth for producing threonine (Table 1) and culturing it under the condition of 35° C. and 200 rpm for 48 hours was purified and crystallized to prepare Sample 1. Sample 1 comprised 99% by weight or more of purified threonine in a powder form.

[0180] fermented broth (comprising C. glutamicum) obtained by culturing C. glutamicum in a medium for producing threonine was directly dried (hot air drying at 60 to 70° C.) to prepare Sample 2. In addition, calcium lignosulfonate (Aladdin industrial Co., Shanghai, Chana) was added to fermented broth obtained by culturing C. glutamicum under the above condition in various contents, and the fermented broth (comprising C. glutamicum) in which calcium lignosulfonate was added was dried (hot air drying at 60 to 70° C.) to prepare Samples 3 to 5. Samples 2 to 5 comprised C. glutamicum in a form of a heat killed bacteria through hot air drying.

[0181] Samples 2 to 5 were prepared in a granule form having a particle size of about 200 to 1000 μm. The components and contents of Samples 1 to 5 were disclosed in Table 4. In Table 4, Thr (% by weight), calcium lignosulfonate (% by weight), and other components of the fermented product (comprising C. glutamicum microbial cell) (% by weight) mean % by weight in the dry matter prepared by drying the fermented broth, and the fermented product in the dry matter comprises C. glutamicum strain. In addition, the content of C. glutamicum strain comprised in the fermented product was disclosed in Table 4.

TABLE-US-00004 TABLE 4 C. glutamicum in Fermented the fermented Calcium Thr product product lignosulfonate (% by (% by (% by (% by weight) weight) weight).sup.1 weight) Sample 1 100.0 — — — Sample 2 75 25.0 4.0 0.0 Sample 3 70 23.3 3.8 6.7 Sample 4 65 21.7 3.5 13.3 Sample 5 60 20.0 3.2 20.0 .sup.1value converted when the content of the microbial cell in the fermented product is dried

Example 9. WIRS (Water Immersion-Restraint Stress) Model Preparation for SRMD (Stress-Related Mucosal Disease)

[0182] 110 SD rats in total were purchased from Charles River (Osaka, Japan) and stored in an animal facility. The experimental animals were handled in the authorized animal facility according to AAALAC International Animal Care Policies. The animals were fasted 24 hours prior to be exposed to WIRS, and water was freely available. 10 rats of each group were placed in a cage for WIRS and immersed in water for 6 hours.

[0183] Sample 1 to Sample 5 prepared in Example 8 were orally administered to rats 8 hours before WIRS treatment, so that the same amount of threonine was administered (0.15% by weight/diet), and after applying WIRS for 6 hours, the animals were sacrificed and the stomach was extracted and incised and contents were removed, and a picture of the inner surface of the stomach was taken and this was shown in FIG. 11. As shown in FIG. 11, as the result of observing the stomach tissue of rats by naked eyes, it could be confirmed that in the WIRS induced group (the second row in FIG. 11), gastrorrhagia was caused, and the degree of gastrorrhagia was reduced (excellent therapeutic effect of gastric ulcer) in order of Sample 1<Sample 5<Sample 4<Sample 3 or Sample 2.

[0184] On the other hand, the following experiment was conducted by dividing into 4 animal experimental groups as indicated in the following Table 5. They were divided into a untreated group in which nothing was treated after oral administration of saline solution (positive control group, animal experimental group 1), WIRS Group in which WIRS was applied for 6 hours (negative control group, animal experimental group 2), and animal experimental groups in which feed containing Sample 1 (prepared in Example 8) of 0.15% by weight (animal experimental group 3) and feed containing Sample 3 (prepared in Example 8) of 0.21% by weight (animal experimental group 4) were orally treated by 30 mg/kg body, respectively, 8 hours before WIRS treatment. The content of L-Thr (L-threonine) in the feed of the animal experimental groups 3 and 4 was set to 0.15% by weight/diet equally.

TABLE-US-00005 TABLE 5 Animal Administration Number experimental Experimental WIRS Test substance (supplied 8 hours dose (% by of group animal induction before WIRS treatment) weight/diet) animals 1 Rat No Positive control group (No- 0 10 stress, No-Thr) 2 WIRS Negative control group (No-Thr) 0 20 3 induction Sample 1 (Example 8; L-Thr) 0.15 10 4 for 6 hours Sample 3 (Example 8; L-Thr + 0.21 10 C. glutamicum fermented product (comprising a microbial cell))

[0185] All experimental animals (rat) were sacrificed with a high dose of anesthetic (thiopental sodium, 50 mg/kg) after 6 hours of WIRS. The animal experimental groups 1-4 disclosed in the following Examples 10 to 12 mean the animal experimental groups 1-4 of the Table 5, and in FIG. 7a to FIG. 10, Groups 1-4 mean the animal experimental groups 1-4 of Table 5.

Example 10. Test of SRMD (Stress-Related Mucosal Disease) Improving Efficacy

[0186] The stomach of the rat sacrificed in Example 9 was incised and opened along the larger curvature, and then washed with cold PBS solution. After determining the number and size of erosions or ulcers by enlarged photographs, the half was anatomized for anatomical observation. The incised stomach was spread over plastic sheet and fixed in 10% buffer formalin for 4 hours and used for production of a paraffin tissue slide, and the other half was stored in a liquid nitrogen tank for molecular biological observation. In addition, the mucosal homogenate was stored by mixing the same animal experimental groups.

[0187] The stomach sample was observed using a microscope by naked eyes (FIG. 7a), and in the control group and each experimental group (animal experimental groups 1-4), gross lesion index, inflammation; pathologic score, ulcer/erosion; pathologic score, regeneration; pathologic score were calculated and shown in FIG. 7b. As shown in FIG. 7a, significant occurrence of SRMD such as erosions, hemorrhage, and ulcers was shown in all rats of the animal experimental group 2, but SRMD was significantly improved in the animal experimental group 3 and animal experimental group 4. As shown in FIG. 7b, gross lesion index, inflammation; pathologic score, ulcer/erosion; pathologic score, regeneration; pathologic score were significantly (p<0.05) improved in the animal experimental groups 3 and 4, and in particular, the gross lesion index of the animal experimental group 4 was significantly lower than the animal experimental group 3, and the regeneration; pathologic score was significantly improved than the animal experimental group 3.

Example 11. Test of Anti-Inflammatory Efficacy

[0188] Since SRMD was physiologically related to ischemic-reperfusion damage, in the animal experimental groups 1 to 4, mRNA expression of angiogenesis growth factors including PDGF (platelet-derived growth factor) and mRNA expression of inflammation mediators, iNOS, TNF-α, IFN-γ, and PDGF were measured, and the result was shown in FIG. 8a and FIG. 8b.

[0189] Specifically, the total RNA was extracted using RNeasy Mini kit (Qiagen Korea, Seoul, Korea). Primers used for measuring the expression of inflammatory cytokines and mediators were shown in the following Table 6. Amplification was analyzed using 10× reaction buffer (Promega Korea, Seoul, Korea), 1.5 mM/L MgCl.sub.2, 200 mM/L deoxynucleotide triphosphate (dNTP), each primer 1 mM/L, and Taq DNA polymerase (Promega) 2.5 unit, using Perkin-Elmer GeneAmp PCR System 2400. Each cycle was composed of denaturation at 95° C. for 1 minute, annealing at 55° C. for 45 minutes, and amplification at 72° C. for 45 seconds.

TABLE-US-00006 TABLE 6 Gene Forward Primer(5′.fwdarw.3′) Reverse Primer(5′.fwdarw.3′) IL-8 CACTCCCAGCATCGTAGAGC CAGTGTACTTGTGGCGTGGA (SEQ ID NO: 15) (SEQ ID NO: 16) iNos TTTTCCCAGGCAACCAGACG GTAGCGGGGTTCAGAATGG (SEQ ID NO: 17) (SEQ ID NO: 18) IFN-γ ATCCATGAGTGCTACACGCC TCTGTGGGTTGTTCACCTCG (SEQ ID NO: 19) (SEQ ID NO: 20) HIF-1α TATCACTGGACTTCGGCAGC GCTGCCGAAGTCCAGTGATA (SEQ ID NO: 21) (SEQ ID NO: 22) PDGF AGGAAGCCATTCCCGCAGTT CTAACCTCACCTGGACCTCT (SEQ ID NO: 23) (SEQ ID NO: 24) VEGF CAATGATGAAGCCCTGGAGT GATTTCTTGCGCTTTCGTTT (SEQ ID NO: 25) (SEQ ID NO: 26) TNF-α CCCTCACACTCAGATCATCT TCTAAGGTACTTGGGCAGGTT TCTCAA(SEQ ID NO: 29) GACCTC(SEQ ID NO: 30) GAPDH GGTGCTGAGTATGTCGTGGA TTCAGCTCTGGGATGACCTT (SEQ ID NO: 27) (SEQ ID NO: 28)

[0190] In addition, in each of the animal experimental groups 1-4, the protein level of p-IκBα, p-ERK, and p-JNK was measured and shown in FIG. 8c and FIG. 8d. Specifically, to perform western blot for measuring the protein level, the collected gastric mucosa was homogenized in ice-cold 20 mM Tris-HCl buffer (pH 7.5) containing 2 mM EDTA (ethylenediaminetetraacetic acid), 0.5 mM EGTA (ethylene glycol tetraacetic acid), 300 mM sucrose, and 2 mM PMSF (phenylmethylsulfonyl fluoride) with a tissue homogenator. After electrophoresis of protein of 30 μg in 8% SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) gel, it was transferred to PVDF (polyvinylidene fluoride) membrane using a semidry transfer system (Hoefer, Holliston, Mass., USA). Non-specific binding was blocked by incubation with 5% non-fat dry milk. The membrane was thermostatically incubated with a 500-fold diluted solution of a primary antibody at 4° C. overnight, and then incubated with an HRP (horseradish peroxidase) binding-secondary antibody diluted by 1:1000. The immune complex was detected using ECL detection kit (Amersham Biosciences Korea, Seoul, Korea) and X-ray film was automatically irradiated. Antibodies used for western blot were as follows. β-actin, iNOS (nitric oxide synthase), COX-2 (cyclooxygenase), P-JNK (phosphor-JNK), P-ERK (phosphor-ERK), Bcl-2 (B-cell lymphoma 2), Bax (B-cell lymphoma-2-associated X-protein), and cyclin D1 antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, Calif.). p-IκBα (phosphorylated inhibitor of kappa B alpha), p-STAT3 (phosphorylated signal transducer and activator of transcription 3), PARP (poly(ADP-ribose) polymerase), CDK4 (cyclin-dependent kinase 4), and CDK2 (cyclin dependent kinase 2) were purchased from Cell Signaling Technology (Beverly, Mass.). HO-1 (A heme oxygenase-1) antibody was purchased from Enzo life Sciences (Farmingdale, N.Y.).

[0191] As shown in FIG. 8a, in the animal experimental group 2 (WIRD induced SRMD), mRNA expression of iNOS, TNF-α, and interferon gamma (IFN-γ) was significantly increased, but the increased expression of the inflammation mediators (iNOS, TNF-α, IFN-γ) was significantly reduced in the animal experimental group 3 or animal experimental group 4 (P<0.01 or P<0.05, FIG. 8a), and the expression of TNF-α and iFN-γ was significantly reduced particularly in the animal experimental group 4 than the animal experimental group 3 (P<0.05, FIG. 8a).

[0192] As shown in FIG. 8b, the expression of the angiogenesis growth factor, PDGF was significantly increased in the animal experimental group 2, but it was significantly reduced in the animal experimental group 3 or animal experimental group 4 (P<0.01, FIG. 8b), and in particular, in the animal experimental group 4, the level of reduction was higher.

[0193] As shown in FIG. 8c, as the result of measuring the expression of p-IκBα at the protein level, the expression of p-IκBα was significantly reduced by WIRS in the animal experimental group 2, and the reduction of the p-IκBα expression was related to transcriptional activation of NF-κB. Meanwhile, the expression of p-IκBα reduced was significantly increased (P<0.01, FIG. 8c), and the expression of p-IκBα was significantly increased than the animal experimental group 3 (P<0.01, FIG. 8c) in the animal experimental group 4, and the increase of the expression of p-IκBα induced redox inhibition of NF-κB.

[0194] On the other hand, regarding signaling related to ischemia and inflammation, as shown in FIG. 8d, in the animal experimental group 2, p-ERK and p-JNK activation was shown, and in the animal experimental group 4, the signaling was inactivated all, but in the animal experimental group 3, it was partially inactivated (P<0.01).

Example 12. Test of Gastric Mucosa Protection Efficacy

[0195] Since SRMD causing erosions or ulcers showed apoptosis increased in the corresponding region, apoptosis on the gastric mucosa was measured according to the animal experimental group. Specifically, apoptosis was visualized using TdT FragEL DNA fragmentation detection kit (Oncogene Research Products, Cambridge, Mass.) and TUNEL (Terminal deoxynucleotidyl transferase-mediated nick end labeling) method. To measure AI (apoptotic index) by finding a region in which apoptosis occurs in a large quantity (apoptotic hot spot) in each experimental group, TUNEL-immunostained section (terminal deoxynucleotidyl transferase mediated dUTP nick-end labeling (TUNEL)-immunostained section) was enlarged 100 folds and scanned. Then, the number of TUNEL-positive cells was counted in 400 fields to record AI. The mean coefficient was determined by selection at least 5 hot spots randomly in fragments including corrosive or ulcer lesions, and the result was shown in FIG. 9a, and the result was indicated by the mean percentage of the total cell number. As shown in FIG. 9a, apoptosis was significantly increased in the animal experimental group 2 than the animal experimental group 1, and the increased apoptosis level was significantly reduced in the animal experimental group 3 and animal experimental group 4 than the animal experimental group 2 (P<0.01, FIG. 9a), and it was observed at a significantly lower level in the animal experimental group 4 than the animal experimental group 3 (P<0.01, FIG. 9a).

[0196] To verify the TUNEL result, for the expression of Bcl-2, apoptosis-preventing protein, and cleaved PARP, Bax, cleaved caspase-8, and cleaved caspase-3 inducing apoptosis, the western blot analysis was performed by the method of Example 11, and the result was shown in FIG. 9b.

[0197] As shown in FIG. 9b, PARP division, Bax, cleaved caspase-8, and cleaved caspase-3 expression were significantly increased in the animal experimental group 2, and the increased PARP division, Bax, cleaved caspase-8, and cleaved caspase-3 expression were significantly reduced in the animal experimental groups 3 and 4, and they were observed at a significantly lower level particularly in the animal experimental group 4 than the animal experimental group 3. On the other hand, the expression of Bcl-2, the apoptosis-preventing protein, was significantly increased in the animal experimental group 4 (FIG. 9b).

[0198] The activity of CDK4 and Cyclin D1, cell cycle-related genes, was confirmed at a protein level by the method according to Example 11, and the result was shown in FIG. 9c. As shown in FIG. 9c, the expression of CDK4 and Cyclin D1 was significantly increased in the animal experimental group 2 (P<0.01), and the increased expression of CDK4 and Cyclin D1 was significantly reduced in the animal experimental groups 3 and 4. In particular, the expression of CDK4 and Cyclin D1 was significantly lower in the animal experimental group 4 than the animal experimental group 3 (FIG. 9c, P<0.01˜0.05).

[0199] In the stomach tissue of the animal experimental groups 1 to 4, the mucin content was confirmed by PAS staining, and the result was shown in FIG. 10. As shown in FIG. 10, the gastric mucin was observed at a significantly low level in the animal experimental group 2 (P<0.01), and the expression of gastric mucus was significantly preserved in the animal experimental groups 3 and 4, and the mucus expression was significantly higher in the animal experimental group 4 than 3 (P<0.01).

[0200] From the above result, it could be seen that WIRS threatened the mucosal integrity, but this threat was alleviated by pre-treatment of the composition (sample) according to one example.

[0201] The result of Examples 8 to 11 was represented by mean±SD. The data were analyzed by one-way analysis of variance (ANOVA), and the statistical significance between groups was determined by Duncan's multiple range test. The statistical significance converged to P<0.05.

[0202] From the above description, those skilled in the art to which the present application pertains will understand that the present application may be implemented in other specific forms without changing its technical spirit or essential characteristics. In this regard, it should be understood that the examples described above are illustrative in all aspects and not restrictive. The scope of the present application should be construed as the meaning and scope of the following claims rather than the above detailed description and all modifications or modified forms derived from the equivalent concept are included in the scope of the present application.