APPLICATION OF BRANCHED-CHAIN A-KETOACID DEHYDROGENASE COMPLEX IN PREPARATION OF MALONYL COENZYME A
20220380822 · 2022-12-01
Inventors
Cpc classification
C12N9/1029
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
C12Y102/01075
CHEMISTRY; METALLURGY
C12P19/32
CHEMISTRY; METALLURGY
International classification
C12P19/32
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
Abstract
An application of a branched-chain α-ketoacid dehydrogenase complex in preparation of malonyl coenzyme A. A method for preparing malonyl-CoA using a branched-chain α-ketoacid dehydrogenase complex, the method comprising introducing a gene encoding a branched-chain α-ketoacid dehydrogenase complex into a biological cell strain to obtain a recombinant cell strain capable of expressing the gene encoding the branched-chain α-ketoacid dehydrogenase complex; culturing the recombinant cell strain to prepare malonyl-CoA; the branched-chain α-ketoacid dehydrogenase complex is the following M1) or M2): M1) a set of proteins consisting of a bkdF protein, a bkdG protein, a bkdH protein and a lpdA1 protein; M2) a set of proteins consisting of a bkdA protein, a bkdB protein, a bkdC protein and the lpdA1 protein. Experimental results show that by using the branched-chain α-ketoacid dehydrogenase complex, not only malonyl-CoA can be prepared, but also a target product using malonyl-CoA as an intermediate product can further be prepared.
Claims
1-22. (canceled)
23. A method for preparing malonyl-CoA, comprising the following steps 11) and 12): 11) introducing a gene encoding a branched-chain α-ketoacid dehydrogenase complex into a biological cell strain to obtain a recombinant cell strain capable of expressing the gene encoding the branched-chain α-ketoacid dehydrogenase complex, which was named recombinant cell strain A; 12) culturing the recombinant cell strain A to prepare malonyl-CoA.
24. The method according to claim 23, wherein the branched-chain α-ketoacid dehydrogenase complex is the following M1) or M2): M1) a set of proteins consisting of a bkdF protein, a bkdG protein, a bkdH protein and a lpdA1 protein; M2) a set of proteins consisting of a bkdA protein, a bkdB protein, a bkdC protein and the lpdA1 protein; the gene encoding the branched-chain α-ketoacid dehydrogenase complex is the following L1) or L2): L1) a set of genes consisting of a gene encoding the bkdF protein, a gene encoding the bkdG protein, a gene encoding the bkdH protein and a gene encoding the lpdA1 protein; L2) a set of genes consisting of a gene encoding the bkdA protein, a gene encoding the bkdB protein, a gene encoding the bkdC protein and a gene encoding the lpdA1 protein.
25. The method according to claim 24, wherein the bkdF protein, the bkdG protein, the bkdH protein, the lpdA1 protein, the bkdA protein, the bkdB protein and the bkdC protein and their encoding genes are derived from Streptomyces avermitilis.
26. The method according to claim 24, wherein the bkdF protein is the following a1) or a2) protein: a1) a protein having the amino acid sequence shown in SEQ ID NO: 10 in the sequence listing; a2) a protein having 75% or more identity with and the same function as the amino acid sequence shown in SEQ ID NO: 10, which is obtained by performing substitution and/or deletion and/or addition of one or more amino acid residues on the amino acid sequence shown in SEQ ID NO: 10 in the sequence listing; the bkdG protein is the following a3) or a4) protein: a3) a protein having the amino acid sequence shown in SEQ ID NO: 11 in the sequence listing; a4) a protein having 75% or more identity with and the same function as the amino acid sequence shown in SEQ ID NO: 11, which is obtained by performing substitution and/or deletion and/or addition of one or more amino acid residues on the amino acid sequence shown in SEQ ID NO: 11 in the sequence listing; the bkdH protein is the following a5) or a6) protein: a5) a protein having the amino acid sequence shown in SEQ ID NO: 12 in the sequence listing; a6) a protein having 75% or more identity with and the same function as the amino acid sequence shown in SEQ ID NO: 12, which is obtained by performing substitution and/or deletion and/or addition of one or more amino acid residues on the amino acid sequence shown in SEQ ID NO: 12 in the sequence listing; the lpdA1 protein is the following a7) or a8) protein: a7) a protein having the amino acid sequence shown in SEQ ID NO: 13 in the sequence listing; a8) a protein having 75% or more identity with and the same function as the amino acid sequence shown in SEQ ID NO: 13, which is obtained by performing substitution and/or deletion and/or addition of one or more amino acid residues on the amino acid sequence shown in SEQ ID NO: 13 in the sequence listing; the bkdA protein is the following a9) or a10) protein: a9) a protein having the amino acid sequence shown in SEQ ID NO: 7 in the sequence listing; a10) a protein having 75% or more identity with and the same function as the amino acid sequence shown in SEQ ID NO: 7, which is obtained by performing substitution and/or deletion and/or addition of one or more amino acid residues on the amino acid sequence shown in SEQ ID NO: 7 in the sequence listing; the bkdB protein is the following a11) or a12) protein: a11) a protein having the amino acid sequence shown in SEQ ID NO: 8 in the sequence listing; a12) a protein having 75% or more identity with and the same function as the amino acid sequence shown in SEQ ID NO: 8, which is obtained by performing substitution and/or deletion and/or addition of one or more amino acid residues on the amino acid sequence shown in SEQ ID NO: 8 in the sequence listing; the bkdC protein is the following a13) or a14) protein: a13) a protein having the amino acid sequence shown in SEQ ID NO: 9 in the sequence listing; a14) a protein having 75% or more identity with and the same function as the amino acid sequence shown in SEQ ID NO: 9, which is obtained by performing substitution and/or deletion and/or addition of one or more amino acid residues on the amino acid sequence shown in SEQ ID NO: 9 in the sequence listing.
27. The method according to claim 24, wherein: the gene encoding the bkdF protein is the following b1) or b2): b1) a DNA molecule having the nucleotide sequence shown in positions 1-1221 of SEQ ID NO: 2 in the sequence listing; b2) a DNA molecule having 75% or more identity with and the same function as the nucleotide sequence defined in b1); the gene encoding the bkdG protein is the following b3) or b4): b3) a DNA molecule having the nucleotide sequence shown in positions 1223-2200 of SEQ ID NO: 2 in the sequence listing; b4) a DNA molecule having 75% or more identity with and the same function as the nucleotide sequence defined in b3); the gene encoding the bkdH protein is the following b5) or b6) or b7): b5) a DNA molecule having the nucleotide sequence shown in SEQ ID NO: 3 in the sequence listing; b6) a DNA molecule having the nucleotide sequence shown in positions 2220-3608 of SEQ ID NO: 2 in the sequence listing; b7) a DNA molecule having 75% or more identity with and the same function as the nucleotide sequence defined in b5) or b6); the gene encoding the lpdA1 protein is the following b8) or b9) or b10): b8) a DNA molecule having the nucleotide sequence shown in SEQ ID NO: 5 in the sequence listing; b9) a DNA molecule having the nucleotide sequence shown in SEQ ID NO: 4 in the sequence listing; b10) a DNA molecule having 75% or more identity with and the same function as the nucleotide sequence defined in b8) or b9); the gene encoding the bkdA protein is the following b11) or b12): b11) a DNA molecule having the nucleotide sequence shown in positions 1-1146 of SEQ ID NO: 1 in the sequence listing; b12) a DNA molecule having 75% or more identity with and the same function as the nucleotide sequence defined in b11); the gene encoding the bkdB protein is the following b13) or b14): b13) a DNA molecule having the nucleotide sequence shown in positions 1220-2224 of SEQ ID NO: 1 in the sequence listing; b14) a DNA molecule having 75% or more identity with and the same function as the nucleotide sequence defined in b13); the gene encoding the bkdC protein is the following b15) or b16): b15) a DNA molecule having the nucleotide sequence shown in positions 2224-3591 of SEQ ID NO: 1 in the sequence listing; b16) a DNA molecule having 75% or more identity with and the same function as the nucleotide sequence defined in b15).
28. The method according to claim 23, wherein the biological cell strain contains a branched-chain α-ketoacid synthesis pathway, and step 11) can further comprise the step of inhibiting the synthesis of branched-chain α-ketoacids in the biological cell strain.
29. The method according to claim 28, wherein the step of “inhibiting the synthesis of branched-chain α-ketoacids” is achieved by “knocking out at least one gene in the branched-chain α-ketoacid synthesis pathway in the biological cell strain, or reducing the content or the activity of at least one protein encoded by the genes in the branched-chain α-ketoacid synthesis pathway”.
30. The method according to claim 28, wherein the step of “inhibiting the synthesis of branched-chain α-ketoacids” is achieved by “knocking out the ilvA gene or/and the ilvE gene in the biological cell strain, or reducing the content or the activity of the proteins encoded by the ilvA gene or/and the ilvE gene in the biological cell strain”.
31. The method according to claim 30, wherein the ilvA gene encodes the following a15) or a16) protein: a15) a protein having the amino acid sequence shown in SEQ ID NO: 15 in the sequence listing; a16) a protein having 75% or more identity with and the same function as the amino acid sequence shown in SEQ ID NO: 15, which is obtained by performing substitution and/or deletion and/or addition of one or more amino acid residues on the amino acid sequence shown in SEQ ID NO: 15 in the sequence listing; the ilvE gene encodes the following a17) or a18) protein: a17) a protein having the amino acid sequence shown in SEQ ID NO: 17 in the sequence listing; a18) a protein having 75% or more identity with and the same function as the amino acid sequence shown in SEQ ID NO: 17, which is obtained by performing substitution and/or deletion and/or addition of one or more amino acid residues on the amino acid sequence shown in SEQ ID NO: 17 in the sequence listing; further, the ilvA gene is the following b17) or b18): b17) a DNA molecule having the nucleotide sequence shown in SEQ ID NO: 14 in the sequence listing; b18) a DNA molecule having 75% or more identity with and the same function as the nucleotide sequence defined in b17); the ilvE gene is the following b19) or b20): b19) a DNA molecule having the nucleotide sequence shown in SEQ ID NO: 16 in the sequence listing; b20) a DNA molecule having 75% or more identity with and the same function as the nucleotide sequence defined in b19).
32. The method according to claim 23, wherein step 11) further comprises the step of introducing a gene encoding a ppc protein into the biological cell strain and expressing the encoding gene, or increasing the content of the ppc protein or enhancing the activity of the ppc protein in the biological cell strain; further, the ppc protein and its encoding gene are derived from Corynebacterium glutamicum; still further, the ppc protein is the following a19) or a20): a19) a protein having the amino acid sequence shown in SEQ ID NO: 19 in the sequence listing; a20) a protein having 75% or more identity with and the same function as the amino acid sequence shown in SEQ ID NO: 19, which is obtained by performing substitution and/or deletion and/or addition of one or more amino acid residues on the amino acid sequence shown in SEQ ID NO: 19 in the sequence listing; the gene encoding the ppc protein is the following b21) or b22): b21) a DNA molecule having the nucleotide sequence shown in SEQ ID No: 18 in the sequence listing; b22) a DNA molecule having 75% or more identity with and the same function as the nucleotide sequence defined in b21).
33. The method according to claim 23, wherein the biological cell strain can express outer membrane protease VII, and step 11) further comprises the step of knocking out the gene encoding the outer membrane protease VII in the biological cell strain or reducing the content or the activity of the outer membrane protease VII in the biological cell strain; further, the outer membrane protease VII is an ompT protein; still further, the ompT protein is the following a21) or a22): a21) a protein having the amino acid sequence shown in SEQ ID NO: 28 in the sequence listing; a22) a protein having 75% or more identity with and the same function as the amino acid sequence shown in SEQ ID NO: 28, which is obtained by performing substitution and/or deletion and/or addition of one or more amino acid residues on the amino acid sequence shown in SEQ ID NO: 28 in the sequence listing; the gene encoding the ompT protein is the following b23) or b24): b23) a DNA molecule having the nucleotide sequence shown in SEQ ID NO: 27 in the sequence listing; b24) a DNA molecule having 75% or more identity with and the same function as the nucleotide sequence defined in b23).
34. The method according to claim 23, wherein the biological cell strain contains oxaloacetate synthesis pathway and can synthesize oxaloacetate; further, the biological cell strain is a microbial cell strain, an animal cell strain or a plant cell strain; still further, the microbial cell strain is N1) or N2) or N3): N1) bacteria or fungi; N2) Escherichia coli; N3) Escherichia coli BW25113.
35. Any of the following methods: ( ). A method for preparing malonyl-CoA, comprising: using the branched-chain α-ketoacid dehydrogenase complex in claim 23 to carry out a catalytic reaction to obtain malonyl-CoA from the substrate oxaloacetate; or ( ). A method for producing a target product with malonyl-CoA as an intermediate product, comprising: culturing the recombinant cell strain A to prepare the target product.
36. The method according to claim 35, wherein the catalytic reaction is carried out in buffer F; the buffer F is composed of a solvent and solutes, and the solvent is 50 mM Tris-HCl buffer (pH=7.0), and the solutes and their concentrations in the buffer F are as follows: 0.1 mM coenzyme A, 0.2 mM dithiothreitol, 0.2 mM triphenyl phosphate, 1 mM MgSO.sub.4, and 2 mM NAD.sup.+; or/and, the catalytic reaction is carried out at 30-37° C.; further, the catalytic reaction is carried out at 30° C.
37. The method according to claim 35, wherein the target product is 3-hydroxypropionic acid, and the method comprises the steps of: introducing into the recombinant cell strain A a gene encoding a mcr protein and expressing the encoding gene or increasing the content of the mcr protein or enhancing the activity of the mcr protein in the recombinant cell strain A, to obtain a recombinant cell strain, which is recorded as recombinant cell strain-mcr; culturing the recombinant cell strain-mcr to prepare the target product; further, the mcr protein and its encoding gene are derived from Chloroflexus aurantiacus; still further, the mcr protein is composed of an mcr N-terminal domain and an mcr C-terminal domain, and the mcr N-terminal domain is the following a23) or a24): a23) a protein having the amino acid sequence shown in SEQ ID NO: 22 in the sequence listing; a24) a protein having 75% or more identity with and the same function as the amino acid sequence shown in SEQ ID NO: 22, which is obtained by performing substitution and/or deletion and/or addition of one or more amino acid residues on the amino acid sequence shown in SEQ ID NO: 22 in the sequence listing; the mcr C-terminal domain is the following a25) or a26): a25) a protein having the amino acid sequence shown in SEQ ID NO: 23 in the sequence listing; a26) a protein having 75% or more identity with and the same function as the amino acid sequence shown in SEQ ID NO: 23, which is obtained by performing substitution and/or deletion and/or addition of one or more amino acid residues on the amino acid sequence shown in SEQ ID NO: 23 in the sequence listing; the gene encoding the mcr protein is composed of the gene encoding the mcr N-terminal domain and the gene encoding the mcr C-terminal domain, and the gene encoding the mcr N-terminal domain is the following b25) or b26): b25) a DNA molecule having the nucleotide sequence shown in positions 1-1689 of SEQ ID NO: 21 in the sequence listing; b26) a DNA molecule having 75% or more identity with and the same function as the nucleotide sequence defined in b25); the gene encoding the mcr C-terminal domain is the following b27) or b28): b27) a DNA molecule having the nucleotide sequence shown in positions 1704-3749 of SEQ ID NO: 21 in the sequence listing; b28) a DNA molecule having 75% or more identity with and the same function as the nucleotide sequence defined in b27); still further, the gene encoding the mcr protein is the following b29) or b30): b29) a DNA molecule having the nucleotide sequence shown in SEQ ID NO: 21 in the sequence listing; b30) a DNA molecule having 75% or more identity with and the same function as the nucleotide sequence defined in b29).
38. The method according to claim 37, wherein the target product picric acid or an intermediate product from malonyl-CoA to picric acid in the picric acid synthesis pathway, and the method comprises the steps of: introducing into the recombinant cell strain A a gene encoding a vps protein and expressing the encoding gene, or increasing the content of the vps protein or enhancing the activity of the vps protein in the recombinant cell strain A, to obtain a recombinant cell strain, which is recorded as recombinant cell strain-vps; culturing the recombinant cell strain-vps to prepare the target product. further, the vps protein and its encoding gene are derived from Humulus lupulus; still further, the vps protein is the following a27) or a28): a27) a protein having the amino acid sequence shown in SEQ ID NO: 26 in the sequence listing; a28) a protein having 75% or more identity with and the same function as the amino acid sequence shown in SEQ ID NO: 26, which is obtained by performing substitution and/or deletion and/or addition of one or more amino acid residues on the amino acid sequence shown in SEQ ID NO: 26 in the sequence listing; the gene encoding the vps protein is the following b31) or b32): b31) a DNA molecule having the nucleotide sequence shown in SEQ ID NO: 25 in the sequence listing; b32) a DNA molecule having 75% or more identity with and the same function as the nucleotide sequence defined in b31).
39. A reagent set, which is reagent set A or reagent set B or reagent set C or reagent set D; the reagent set A includes the branched-chain α-ketoacid dehydrogenase complex or the gene encoding the branched-chain α-ketoacid dehydrogenase complex in claim 1; the reagent set B consists of the reagent set A and the mcr protein or the gene encoding the mcr protein; the reagent set C consists of the reagent set A and the vps protein or the gene encoding the vps protein; the reagent set D consists of a recombinant cell strain, which is the recombinant cell strain A, the recombinant cell strain-mcr or the recombinant cell strain-vps.
40. The reagent set according to claim 39, wherein the reagent set A further includes the ppc protein or the gene encoding the ppc protein.
41. The reagent set according to claim 39, wherein the reagent set A also includes a substance that inhibits the synthesis of branched-chain α-ketoacids.
Description
DESCRIPTION OF THE DRAWINGS
[0186]
[0187]
[0188]
[0189]
[0190]
[0191]
DETAILED DESCRIPTION OF THE INVENTION
[0192] The present invention will be further described in detail below with reference to the specific embodiments, and the given examples are only for illustrating the present invention, rather than for limiting the scope of the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. Materials, reagents, instruments, etc. used in the following examples are all commercially available unless otherwise specified. The quantitative tests in the following examples were performed in triplicate, and the results were averaged. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence listing is the 5′-end nucleotide of the corresponding DNA/RNA, and the last position is the 3′-end nucleotide of the corresponding DNA/RNA.
[0193] In the following examples, Escherichia coli BW25113 (Datsenko K A, Wanner B L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 2000; 97(12): 6640-6645.) is a non-pathogenic bacterial strain with clear genetic background, short generation time, easy cultivation and low-cost medium raw materials. This bacterial strain contains oxaloacetate synthesis pathway and can synthesize oxaloacetate. Escherichia coli BW25113 is available to the public from the Institute of Microbiology, Chinese Academy of Sciences. This biological material is only used for repeating the relevant experiments of the present invention, and cannot be used for other purposes.
[0194] The wild-type P1 phage in the following examples (Thomason L C, Costantino N. 2007. E. coli genome manipulation by P1 transduction. Current Protocols in Molecular Biology: 1.17. 1-8) is available to the public from the Institute of Microbiology, Chinese Academy of Sciences. This biological material is only used for repeating the relevant experiments of the present invention, and cannot be used for other purposes.
[0195] Example 1. Branched-chain α-ketoacid dehydrogenase complex can catalyze the synthesis of malonyl-CoA
[0196] It is found in the present invention that the branched-chain α-ketoacid dehydrogenase complex can catalyze the synthesis of malonyl-CoA. In this example, the genes encoding the branched-chain α-ketoacid dehydrogenase complex (bkdA, bkdB, bkdC, lpdA1, bkdF, bkdG, bkdH genes) were prepared, and two genes in the branched-chain α-ketoacid synthesis pathway (threonine deaminase ilvA gene and branched-chain amino acid transaminase ilvE gene) were knocked out. The synthesis of malonyl-CoA catalyzed by the α-ketoacid dehydrogenase complex was detected, and the primers used are shown in Table 1.
[0197] (1) Construction of plasmids expressing the branched-chain α-ketoacid dehydrogenase complex of Streptomyces avermitilis
[0198] (1-a) PCR amplification of bkdA, bkdB, bkdC, lpdA1, bkdF, bkdG and bkdH genes
[0199] A bacterial genome extraction kit (Tiangen Biotech Co., Ltd., item number: DP302) was used to extract the genomic DNA of Streptomyces avermitilis. Using the extracted Streptomyces avermitilis genomic DNA as a template, PCR was performed with primers bkdA-NcoI and bkdC-rbs-R using high-fidelity TransStart FastPfu DNA polymerase (TransGen Biotech, item number: AP221) and the obtained gene fragment was recorded as ABC, which contains the DNA fragment shown in SEQ ID NO: 1 in the sequence listing; PCR was performed with primers bkdF-NcoI and bkdH-rbs-R and the obtained gene fragment was recorded as FGH, which contains the DNA fragment shown in SEQ ID NO: 2 in the sequence listing; PCR was performed with primers bkdF-NcoI and bkdG-rbs-R and the obtained gene fragment was recorded as FG, which contains the sequence shown in positions 1-2200 of SEQ ID NO: 2 in the sequence listing: PCR was performed with primers rbs-lpdA1-F and lpdA1-XhoI, and the obtained gene fragment was recorded as lpd, which contains the lpdA1 gene shown in SEQ ID NO: 4 in the sequence listing.
[0200] Among them, the sequence shown in positions 1-1146 of SEQ ID NO: 1 is the DNA sequence of bkdA gene, which encodes the bkdA protein shown in SEQ ID NO: 7 in the sequence listing; the sequence shown in positions 1220-2224 is the DNA sequence of bkdB gene, which encodes the bkdB protein shown in SEQ ID NO: 8 in the sequence listing; the sequence shown in positions 2224-3591 is the DNA sequence of bkdC gene, which encodes the bkdC protein shown in SEQ ID NO: 9 in the sequence listing;
[0201] the sequence shown in positions 1-1221 of SEQ ID NO: 2 is the DNA sequence of bkdF gene, which encodes the bkdF protein shown in SEQ ID NO: 10 in the sequence listing; the sequence shown in positions 1223-2200 of SEQ ID NO: 2 is the DNA sequence of bkdG gene, which encodes the bkdG protein shown in SEQ ID NO: 11 in the sequence listing; the sequence shown in positions 2220-3608 of SEQ ID NO: 2 is the DNA sequence of bkdH gene, which encodes the bkdH protein shown in SEQ ID NO: 12 in the sequence listing;
[0202] The lpdA1 gene shown in SEQ ID NO: 4 encodes the lpdA1 protein shown in SEQ ID NO: 13 in the sequence listing.
[0203] According to the codon preference in Escherichia coli, the sequences of bkdH and lpdA1 genes were optimized, respectively, and the optimized genes were recorded as opbkdH and oplpdA1 genes, respectively. The sequences of opbkdH and oplpdA1 genes were shown in SEQ ID NO: 3 and SEQ ID NO: 5 in the sequence listing, respectively. SEQ ID NO: 3 and SEQ ID NO: 5 encode the bkdH protein and lpdA1 protein shown in SEQ ID NOs: 12 and 13 in the sequence listing, respectively. The opbkdH and oplpdA1 genes were artificially synthesized; using the opbkdH gene as a template, PCR was performed with rbs-opbkdH-F and rbs-opbkdH-R and the obtained gene fragment was recorded as opH, which contains the opbkdH gene shown in SEQ ID NO: 3; using the oplpdA1 gene as a template, PCR was performed with rbs-oplpdA1-F and oplpdA1-XhoI, and the obtained gene fragment was recorded as oplpd, which contains the oplpdA1 gene shown in SEQ ID NO: 5 in the sequence listing.
[0204] (1-b) Construction of recombinant expression vectors containing bkdA, bkdB, bkdC, lpdA1, bkdF, bkdG and bkdH genes
[0205] Each PCR amplified fragment obtained in the above step (1-a) was analyzed by agarose gel electrophoresis and the target fragment was recovered; at the same time, the vector pYB1k (the nucleotide sequence of the vector pYB1k is shown in SEQ ID NO: 6 in the sequence listing) was digested with NcoI and XhoI enzymes and the large vector fragment YB1k-NX fragment (i.e., the vector backbone) was recovered. Using the Gibson assembly method (Gibson D G, Young L, et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat, methods. 2009; 6(5): 343-345), the recovered ABC and lpd fragments were ligated with the YB1k-NX fragment; the recovered FGH, lpd fragments and the YB1k-NX fragment were subjected to Gibson assembly ligation reaction; the recovered FG, opH, oplpd and YB1k-NX fragment were subjected to Gibson assembly ligation reaction. Each ligation product was transformed into Escherichia coli DH5α competent cells (TransGen Biotech, item number: CD201) by the CaCl.sub.2 method, then spread evenly on a LB plate containing kanamycin, and cultured at 37° C. overnight. Clones were picked and the clones from which the target fragment could be amplified with primers F108/R124 were identified and sequenced; positive clones were picked to extract plasmids, and the correct recombinant plasmid obtained by ligating the ABC, lpd fragments with the YB1k-NX fragment was named pYB1k-bkdABC-lpdA1, the correct recombinant plasmid obtained by ligating the FGH, lpd fragments with the YB1k-NX fragment was named pYB1k-bkdFGH-lpdA1, and the correct recombinant plasmid obtained by ligating the FG, opH, oplpd fragments with the YB1k-NX fragment was named pYB1k-bkdFG-opbkdH-oplpdA 1.
[0206] pYB1k-bkdABC-lpdA1 contains the DNA fragments shown in SEQ ID NOs: 1 and 4 in the sequence listing and can express the four proteins shown in SEQ ID NOs: 7, 8, 9 and 13; pYB1k-bkdFGH-lpdA1 contains the DNA fragments shown in SEQ ID NOs: 2 and 4 in the sequence listing and can express the four proteins shown in SEQ ID NOs: 10, 11, 12 and 13; pYB1k-bkdFG-opbkdH-oplpdA1 contains the DNA fragments shown in positions 1-2200 of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 in the sequence listing and can express the four proteins shown in SEQ ID NOs: 10, 11, 12 and 13.
[0207] (2) Knockout of threonine deaminase ilvA gene and branched-chain amino acid transaminase ilvE gene in the engineered strain
[0208] Using Escherichia coli BW251113 as the starting strain, the ilvA gene was knocked out, and the obtained recombinant strain was recorded as M01A, and the ilvE gene was knocked out, and the obtained recombinant strain was recorded as M01E.
[0209] (2-a) Preparation of P1 phages containing E. coli gene fragments with ilvA and ilvE gene knockout traits
[0210] The E. coli gene fragment with the ilvA gene knockout trait and the E. coli gene fragment with the ilvE gene knockout trait are derived from E. coli strains JW3745 and JW5606, respectively, which are W3110 strains containing the ilvA and ilvE knockout traits, respectively. Both the two strains are from the NIG, Japan, and the ilvA gene encoding threonine deaminase and the ilvE gene encoding branched-chain amino acid transaminase in these two strains were both replaced with a kanamycin resistance gene with FRT sites at both ends (about 1300 bp) to knock out the ilvA or ilvE gene (Baba T, Ara T, et al. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2006; 2:2006. 0008.). The preparation of P1 phage is as follows: the JW3745 or JW5606 strain was cultured at 37° C. overnight, then transferred to LB medium containing 5 mmol/L CaCl.sub.2 and 0.1% glucose; the cultivation was continued at 37° C. for 1 h, and then added with wild-type P1 phage to continue the cultivation for 1-3 h; a few drops of chloroform were added and the cultivation was continued for several minutes; the culture solution was centrifuged to obtain the supernatant, i.e., phage P1vir ilvA containing the E. coli gene fragment with the ilvA gene knockout trait and phage P1vir ilvE containing the E. coli gene fragment with the ilvE gene knockout trait.
[0211] (2-b) Construction of E. coli strains M01A-Kan and M01E-Kan using P1 phage transduction technology
[0212] For overnight cultured Escherichia coli BW25113 (recipient bacteria), 1.5 mL of the bacterial solution was centrifuged at 10,000 g for 2 min, and then the BW25113 cells were resuspended with 0.75 mL of P1 salt solution (the solvent was water and the solutes were 10 mM CaCl.sub.2 and 5 mM MgSO.sub.4). One hundred μL of phage P1vir ilvA or P1vir ilvE was mixed with 100 μL of BW25113 cell suspension, incubated at 37° C. for 30 min. One mL of LB medium and 200 μL of 1 mol/L sodium citrate were added, and the incubation was continued at 37° C. for 1 h. The cells were collected by centrifugation, resuspended in 100 μL of LB medium, and spread on a LB plate containing kanamycin (the concentration of kanamycin was 50 μg/ml). The plate was incubated overnight at 37° C. Clones were picked and identified by PCR with primers ilvA-F/ilvA-R or ilvE-F/ilvE-R (a 1700 bp target band was amplified from positive clones), and positive clones were screened. The positive clone obtained from phage P1vir ilvA was named MW01A-Kan, the positive clone obtained from phage P1vir ilvE was named MW01E-Kan.
[0213] (2-c) Elimination of resistance
[0214] The plasmid pCP20 (Clontech company) was transformed into M01A-Kan and M01E-Kan by the calcium chloride transformation method, and clones were picked after overnight cultivation on a LB plate containing ampicillin at 30° C. to obtain recombinant E. coli strains containing plasmid pCP20, i.e., M01A-Kan/pCP20 and M01E-Kan/pCP20. These two strains were cultured in LB medium containing ampicillin at 30° C., respectively, spread on LB plates without antibiotic and cultured overnight at 42° C. Clones were picked and identified by PCR with primers ilvA-F/ilvA-R or ilvE-F/ilvE-R (a 400 bp target band was amplified from positive clones), and positive clones were screened. The positive clone obtained from M01A-Kan was named M01A, i.e., the ilvA gene knockout strain of E. coli BW25113, and the positive clone obtained from M01E-Kan was named M01E, i.e., the ilvE gene knockout strain of E. coli BW25113.
[0215] In Escherichia coli BW25113, the coding sequence of the ilvA gene is shown in SEQ ID NO: 14 in the sequence listing, which encodes the ilvA protein shown in SEQ ID NO: 15 in the sequence listing; the coding sequence of the ilvE gene is shown in SEQ ID NO: 16 in the sequence listing, which encodes the ilvE protein shown in SEQ ID NO: 1-7 in the sequence listing.
TABLE-US-00001 TABLE 1 List of primers used Used Primer Sequence in bkdA-NcoI 5′-TAACAGGAGGAATTAACCAT Step GACGGTCATGGAGCAGCGG-3′ (1) (SEQ ID NO: 29) bkdC-rbs-R 5′-CGGTGCTGGCGTCGTTCGCC Step ATTTAATTCCTCCTGACTAC (1) AGGGTGCGCAGCAGCACCGC CGG-3′ (SEQ ID NO: 30) bkdF-NcoI 5′-GCTAACAGGAGGAATTAACC Step GTGACCGTGGAGAGCACTGC (1) CGC-3′ (SEQ ID NO: 31) bkdH-rbs-R 5′-CGGTGCTGGCGTCGTTCGCC Step ATTTAATTCCTCCTGACTAG (1) GCCCAGGTGATCAGCCGCTT CGGC -3′ (SEQ ID NO: 32) bkdG-rbs-R 5′-TTAATTCCTCCTGATCAGTA Step CGCCAGCGAGCGGTCGACGG (1) CATCG-3′ (SEQ ID NO: 33) rbs-lpdA1-F 5′-TCAGGAGGAATTAAATGGCG Step AACGACGCCAGCACCG-3′ (1) (SEQ ID NO: 34) lpdA1-XhoI 5′-TAGTACCAGATCTACCCTCG Steps AGTCAGTCGTGCGAGTGCAG (1 CGGCTTGCCCGCGAGGG-3′ and (SEQ ID NO: 35) 10) rbs-opbkdH-F 5′-TCGCTGGCGTACTGATCAGG Step AGGAATTAAATGACTGAAGC (1) GTCCGTGCGTG-3′ (SEQ ID NO: 36) rbs-opbkdH-R 5′-TTAATTCCTCCTGATTATGC Step CCAAGTGATGAGACGCTTCG (1) GCT-3′ (SEQ ID NO: 37) rbs-oplpdA1-F 5′-CTCATCACTTGGGCATAATC Step AGGAGGAATTAAATGGCAAA (1) CGACGCATCTACG-3′ (SEQ ID NO: 38) oplpdA1-XhoI 5′-TAGTACCAGATCTACCCTCG Step AGTTAGTCGTGAGAATGCAG (1) CGGCTTGCCAGCCAG-3′ (SEQ ID NO: 39) F108 5′-CGGCGTCACACTTTGCTAT Steps G-3′ (1, 8 (SEQ ID NO: 40) and 10) R124 5′-CGTTTCACTTCTGAGTTCGG Step C-3′ (1) (SEQ ID NO: 41) ilvA-F 5′-GATTGAAGATGGTGACCTGA Step TCGCTATC-3′ (2) (SEQ ID NO: 42) ilvA-R 5′-GCTGTGGCGTGGCATTGTTG Step CCGGAAG-3′ (2) (SEQ ID NO: 43) ilvE-F 5′-TGTATCGGCTCGCTTCAATC Step CAGAAACCT-3′ (2) (SEQ ID NO: 44) ilvE-R 5′-AATTTGTTCGGCGACCAGTT Step TACCGAGA-3′ (2) (SEQ ID NO: 45)
[0216] (3) Exogenous expression of branched-chain α-ketoacid dehydrogenase complex improves the synthesis of malonyl-CoA in engineered strains
[0217] (3-a) Preparation of recombinant strains
[0218] The recombinant vectors pYB1k-bkdABC-lpdA1, pYB1k-bkdFGH-lpdA1 and pYB1k-bkdFG-opbkdH-oplpdA1 of step (1) and the vector pYB1k were introduced into Escherichia coli BW25113, respectively, to obtain recombinant strains, which were recorded as M-ABC, M-FGH, M-opFGH and BW, respectively; the recombinant vector pYB1k-bkdFGH-lpdA1 was introduced into M01 A and M01E of step (1), respectively, to obtain recombinant strains, which were recorded as MA-FGH and ME-FGH, respectively.
[0219] (3-b) Preparation of Culture Medium
[0220] Medium A: a sterile medium composed of a solvent and solutes; solvent: water; solutes and their concentrations in the medium: NaHPO.sub.4 25 mM, KH.sub.2PO.sub.4 25 mM, NH.sub.4Cl 50 mM.
[0221] Medium B: a sterile medium obtained by adding Na.sub.2SO.sub.4, MgSO.sub.4, glycerol, yeast powder and trace elements to medium A; in medium B, Na.sub.2SO.sub.4 concentration: 5 mM, MgSO.sub.4 concentration: 2M, glycerol volume percentage: 0.5%, yeast powder mass percentage: 0.5 mg/100 mL, and each trace element and its concentration: 50 μM FeCl.sub.3, 20 μM CaCl.sub.2, 10 μM MnCl.sub.2, 10 μM ZnSO.sub.4, 2 μM CoCl.sub.2, 2 μM NiCl.sub.2, 2 μM Na.sub.2MO.sub.4, 2 μM Na.sub.2SeO.sub.3 and 2 μM H.sub.3BO.sub.3.
[0222] Medium C: a sterile medium obtained by adding glucose to medium A; glucose concentration in medium C: 20 g/L.
[0223] (3-c) Culture of Cells and Induction of Enzymes
[0224] The overnight cultured engineered strain M-ABC was inoculated into 20 ml of medium B in a shake flask at an inoculum concentration of 1%; after culturing at 37° C. for 6 h, arabinose was added to the culture system to a final mass percentage of 0.2%; the cultivation was continued for 12 h, and the cells (i.e., M-ABC cells) were collected.
[0225] According to the above method, the strain M-ABC was replaced with M-FGH, M-opFGH, BW, MA-FGH and ME-FGH, respectively, to obtain M-FGH, M-opFGH, BW, MA-FGH and ME-FGH cells.
[0226] (3-d) Whole-Cell Catalysis of Malonyl-CoA
[0227] The same amount of cells collected in step (3-c) were taken (the amount of the cells used: 1 mL of cell suspension with an OD600 of 90) to detect the synthetic amount of malonyl-CoA in each strain according to the following method:
[0228] the cells were resuspended in 5 ml of medium C in a shake flask; after culturing at 37° C. for 3 h, the cells were collected by centrifugation, and then the cells were resuspended in 400 μL of 80% (volume percent) methanol aqueous solution pre-cooled at −80° C.; the cells were disrupted by sonication, centrifuged at 12,000 rpm at 4° C. for 20 min, and the supernatant was collected to detect the content of malonyl-CoA in the supernatant. The content of malonyl-CoA in the supernatant was analyzed by LCMS/MS using the standard curve method (external standard method) with malonyl-CoA (Sigma, 63410-10MG-F) as the standard.
[0229] The results are shown in
[0230] The results showed that the synthesis of malonyl-CoA was significantly increased after the gene encoding branched-chain α-ketoacid dehydrogenase complex was introduced into Escherichia coli; compared with the introduction of bkdA, bkdB, bkdC and lpdA1 genes, the introduction of bkdF, bkdG, bkdH and lpdA1 genes results in a higher synthetic amount of malonyl-CoA; while bkdH and lpdA1 genes were optimized according to the codon preference of E. coli, the synthetic amount of malonyl-CoA could be further improved; based on the introduction of bkdF, bkdG, bkdH and lpdA1 genes, the knockout of the ilvA and ilvE genes in the branched-chain α-ketoacid (the substrate of the branched-chain i-ketoacid dehydrogenase complex) synthesis pathway, the synthetic amount of malonyl-CoA could be further improved, and the synthetic amount of malonyl-CoA could be greatly increased after the knockout of the ilvE gene.
[0231] Example 2. Phosphoenolpyruvate carboxylase ppc gene can improve the synthetic amount of malonyl-CoA in the engineered strain M-FGH
[0232] In this example, on the basis of the engineered strain M-FGH of Example 1, phosphoenolpyruvate carboxylase ppc gene was introduced and ompT gene was knocked out (the sequence of the ompT gene is shown in SEQ ID NO: 27 in the sequence listing, which encodes the ompT protein shown in SEQ ID NO: 28) and the synthetic amount of malonyl-CoA was further improved. The primers used are shown in Table 2.
[0233] (4) Construction of an engineered strain expressing phosphoenolpyruvate carboxylase ppc gene
[0234] (4-a) Extraction of Corynebacterium glutamicum and Escherichia coli genomes, and PCR amplification of ppc gene, chloramphenicol resistance fragment and upstream and downstream homologous arms of ompT gene
[0235] ppc-F and ppc-R were used as PCR amplification primers, and the genomic DNA of Corynebacterium glutamicum was used as the template to amplify the fragment tac-ppc. The fragment tac-ppc contains the ppc gene, and the ppc gene has a nucleotide sequence shown in SEQ ID NO: 18 in the sequence listing and encodes the ppc protein shown in SEQ ID NO: 19. Cm-F and Cm-R were used as PCR amplification primers, and lox71-Cm-lox66-tac was used as the template to amplify the fragment Cm. The fragment lox71-Cm-lox66-tac has a nucleotide sequence shown in SEQ ID NO: 20 in the sequence listing. This fragment was obtained by whole gene synthesis (GenScript, Nanjing). ompT-up-F and ompT-up-R were used as PCR amplification primers, and the genomic DNA of Escherichia coli was used as the template to amplify the fragment ompT-up. ompT-down-F and ompT-down-R were used as PCR amplification primers and the genomic DNA of Escherichia coli was used as the template to amplify the fragment ompT-down.
[0236] (4-b) Preparation of Targeting Fragment ompT-Up-Cm-Tac-Ppc-ompT-Down
[0237] The four fragments tac-ppc, Cm, ompT-up and ompT-down were used as the template, and ompT-up-F and ompT-down-R were used as primers to obtain the targeting fragment ompT-up-Cm-tac-ppc-ompT-down by fusion PCR. The targeting fragment was recovered by agarose gel electrophoresis (Tiangen Biotech Co., L td., item number: DP209).
[0238] (4-c) Preparation of Host Strain Containing Plasmid pKD46
[0239] The plasmid pKD46 (Clontech company) was transformed into the engineered strain M-FGH by the calcium chloride transformation method, and clones were picked after overnight cultivation on a LB plate containing ampicillin and kanamycin at 30° C. to obtain the recombinant E. coli strain M-FGH/pKD46 containing plasmid pKD46. After the recombinant E. coli strain M-FGH/pKD46 was induced by arabinose, three recombinant proteins of the phage were expressed, and the host strain acquired the ability of homologous recombination. M-FGH/pKD46 competent cells were then prepared by washing with 10% glycerol.
[0240] (4-d) Homologous Recombination
[0241] The fragment ompT-up-Cm-tac-ppc-ompT-down of step (4-b) was electro-transformed into the M-FGH/pKD46 competent cells prepared in step (4-c), and the cells were cultured on a LB plate containing kanamycin (concentration: 50 μg/ml) and chloramphenicol (concentration: 34 μg/ml) overnight at 37° C. Clones were picked and identified by PCR with ompT-up1k-F and ppc-R primers (a 6000 bp target band was amplified from positive clones), a positive clone was screened and named M-FGH-ppc. M-FGH-ppc contains the ppc gene shown in SEQ ID NO: 18 in the sequence listing, and can express the ppc protein shown in SEQ ID NO: 19. M-FGH-ppc does not contain the ompT gene.
[0242] (5) Detection of synthetic amount of malonyl-CoA in the engineered strain overexpressing phosphoenolpyruvate carboxylase ppc gene and Streptomyces avermitilis branched-chain α-ketoacid dehydrogenase complex gene bkdFGH-lpdA1
[0243] According to the methods of (3-c) and (3-d) of step (3) in Example 1, M-ABC was replaced by M-FGH and M-FGH-ppc, respectively, and other steps were unchanged. The synthetic amounts of malonyl-CoA in the strains were detected,
[0244] The results are shown in
TABLE-US-00002 TABLE 2 List of primers Used Primer Sequence in ppc-F 5′-ATGACTGATTTTTTACGCG Step ATGACATCA-3′ (4) (SEQ ID NO: 46) ppc-R 5′-CCCCGGGGCGATTTTCACC Step TCGGGGAAATTTTAGTTGGCGTTC (4) CTAGCCGGAGTTGCGCAGCGCAG-3′ (SEQ ID NO: 47) Cm-F 5′-ACATATTCAATCATTAAAA Step CGATTGAATGGAGAACTTTTGTCT (4) CGAGAATATCCTCCTTATAACTT-3′ (SEQ ID NO: 48) Cm-R 5′-GATTTGACCGAGGAACCTG Step ATGTCATCGCGTAAAAAATCAGTC (4) ATGGTTAATTCCTCCTTCCACAC-3′ (SEQ ID NO: 49) ompT-up-F 5′-ACTGGAATCTGCGAATTGT Step CGCCAGT-3′ (4) (SEQ ID NO: 50) ompT-up-R 5′-AAAAGTTCTCCATTCAATCGT Step TTTAA-3′(SEQ ID NO: 51) (4) ompT-down- 5′-GAACGCCAACTAAAATTTCC Step F CCGAG-3′ (4) (SEQ ID NO: 52) ompT-down- 5′-AAAAGTTCTCCATTCAATCG Step R TTTTAA-3′ (SEQ ID NO: 53) (4) ompT-uplk- 5′-CCGTACACCGGAAGTGTTCC Step F GGCTA-3′(SEQ ID NO: 54)) (4)
[0245] Example 3. Expression of Streptomyces avermitilis branched-chain α-ketoacid dehydrogenase complex gene bkdFGH-lpdA1 can increase the yield of 3-hydroxypropionic acid (3-HP).
[0246] 3-Hydroxypropionic acid is an important platform compound and a raw material for the synthesis of various chemicals. Malonyl-CoA can be used as a precursor to obtain 3-hydroxypropionic acid through a two-step reduction reaction. In this example, the malonyl-CoA reductase gene, mcr gene, of Chloroflexus aurantiacus was introduced into M-ABC, M-FGH, M-opFGH, MA-FGH, ME-FGH, and M-FGH-ppc obtained in Example 1 and Example 2 to prepare 3-hydroxypropionic acid, and BW of Example 1 was used as a control. The primers used are shown in Table 3.
[0247] (6) Construction of a plasmid expressing the malonyl-CoA reductase gene mcr of Chloroflexus aurantiacus
[0248] (6-a) The nucleotide sequence of the modified Chloroflexus aurantiacus malonyl-CoA reductase gene, mcr gene, is shown in SEQ ID NO: 21 in the sequence listing, wherein the nucleotide sequence of the N-terminal domain of the mcr gene is shown in positions 1-1689 of SEQ ID NO: 21 and encodes the N-terminal domain of mcr shown in SEQ ID NO: 22 in the sequence listing; the nucleotide sequence of the C-terminal domain of the mcr gene is shown in positions 1704-3749 of SEQ ID NO: 21 and encodes the C-terminal domain of mcr shown in SEQ ID NO: 23 in the sequence listing; a RBS site is contained between the N-terminal domain and the C-terminal domain, and has the sequence shown in positions 1691-1696 of SEQ ID NO: 21. The mcr gene fragment shown in SEQ ID NO: 21 was synthesized by whole gene synthesis and ligated to the vector pUC57 to obtain the recombinant vector pUC57-mcr. Using pUC57-mcr as the template, a PCR amplified fragment was obtained by amplifying with the primers mcr-F/mcrR.
[0249] (6-b) The PCR amplified fragment obtained in above step (6-a) was subjected to agarose gel electrophoresis to recover the target fragment; at the same time, the vector pLB1a (the nucleotide sequence of the vector pLB1a is shown in SEQ ID NO: 24 in the sequence listing) was digested with NcoI and XhoI, and the large vector fragment LB1a-NX (i.e., the vector backbone) was recovered. The above recovered target fragment was ligated with the LB1a-NX fragment by the Gibson assembly method, and the ligated product was transformed into Escherichia coli DH5α competent cells (TransGen Biotech, item number: CD201) by the CaCl.sub.2 method. The cells were then spread on a LB plate containing streptomycin, and cultured at 37° C. overnight. Clones were picked and the clones from which the target fragment could be amplified with primers F-105/mcr-R were identified and sequenced. A positive clone was screened and the plasmid was extracted, and the obtained positive plasmid with the correct sequence was named pLB1a-mer.
[0250] pLB1a-mcr contains the mcr gene shown in SEQ ID NO: 21 in the sequence listing, and can express the N-terminal domain and the C-terminal domain of mcr shown in SEQ ID NOs: 22 and 23.
[0251] (7) Construction of a 3-hydroxypropionic acid-producing engineered strain and whole-cell catalysis of 3-hydroxypropionic acid
[0252] (7-a) The vector pLB1a-mcr obtained in step (6) was introduced into M-ABC, M-FGH, M-opFGH, MA-FGH, ME-FGH, M-FGH-ppc and BW respectively, to obtain recombinant strains, which were named M-ABC-HP, M-FGH-HP, M-opFGH-HP, MA-FGH-HP, ME-FGH-HP, M-FGH-ppc-HP and BW-HP. Each recombinant strain was used as the test strain for the production of 3-hydroxypropionic acid.
[0253] (7-b) Cultivation of Engineered Strains and Induction of Enzymes
[0254] Each overnight cultured test strain was inoculated into 20 ml of medium B described in (3-b) in a shake flask at an inoculum concentration of 1%; after culturing at 37° C. for 6 h, arabinose was added to the culture system to a final mass percentage of 0.2%; the cultivation was continued for 12 h, and the cells were collected.
[0255] (7-c) Whole-Cell Catalysis of 3-Hydroxypropionic Acid
[0256] The cells collected above were resuspended in 5 ml of medium C in a shake flask; after culturing at 37° C. for 8 h, the culture was centrifuged and the supernatant was obtained and filtered, and the filtrate was collected. The amount of cells used was 5 mL of cell suspension with an OD600 of 30. Using 3-hydroxypropionic acid (TCI, H0297-10 G) as the standard, the content of 3-hydroxypropionic acid in the filtrate was quantitatively analyzed by HPLC using the standard curve method (external standard method).
[0257] The results are shown in
[0258] The results showed that the yield of 3-hydroxypropionic acid was significantly increased after the gene encoding branched-chain α-ketoacid dehydrogenase complex was introduced into E. coli; compared with the introduction of bkdA, bkdB, bkdC and lpdA1 genes, the introduction of bkdF, bkdG, bkdH and lpdA1 genes results in a higher yield of 3-hydroxypropionic acid; while bkdH and lpdA1 genes were optimized according to the codon preference of E. coli, the yield of 3-hydroxypropionic acid could be further improved; based on the introduction of bkdF, bkdG, bkdH and lpdA1 genes, the knockout of the ilvA and ilvE genes in the branched-chain α-ketoacid (the substrate of the branched-chain α-ketoacid dehydrogenase complex) synthesis pathway, the yield of 3-hydroxypropionic acid could be further improved, and the yield of 3-hydroxypropionic acid could be greatly increased after the knockout of the ilvE gene; based on the introduction of bkdF, bkdG, bkdH and lpdA1 genes, the introduction of ppc gene could further improve the yield of 3-hydroxypropionic acid. The changing trend of the yield of 3-hydroxypropionic acid was the same as the changing trend of the synthetic amount of malonyl-CoA of the corresponding strains in Examples 1 and 2.
TABLE-US-00003 TABLE 3 List of primers Primer Sequence Used in mcr-F 5′-GCTAACAGGAGGAATTAACCATGG Step GCAGCAGCCATCACCATCATC-3′ (5) (SEQ ID NO: 55) mcr-R 5′-ACTAGTACCAGATCTACCCTTTAC Step ACGGTAATCGCCCGTCCGCGA-3′ (4) (SEQ ID NO: 56) F-105 5′-TAGCATTTTTATCCATAAGATT Step AGC-3 ′ (SEQ ID NO: 57) (4)
[0259] Example 4. Expression of Streptomyces avermitilis branched-chain α-ketoacid dehydrogenase complex gene bkdFGH-lpdA1 can increase the yield of Humulus lupulus β acid precursor PIVP
[0260] Heterologous expression of type II polyketide picric acid derived from the plant Humulus lupulus in E. coli
[0261] Picric acid, as a flavor substance of Humulus lupulus (belonging to the genus Humulus, family Cannabaceae), is specifically synthesized and accumulated in the glandular hairs of Humulus lupulus. It is an essential element in the beer brewing industry. It has high medicinal value and health care functions, and is also a precursor substance of many drugs. It has now been reported that its pathway synthesis can be achieved in yeast. The main pathway is branched-chain fatty acyl-CoA and malonyl-CoA under the action of vps (valerophenone synthase) to generate 3-methyl-isobutyrylphloroglucinol (PIVP), and then PIVP and DMAPP under the action of HIPT1 HIPT2 (prenyltransferase) to generate direct precursor Di-Prenyl PIVP. Di-Prenyl PIVP then undergoes an oxidation reaction to generate picric acid (
[0262] (8) Construction of a plasmid expressing Humulus lupulus valerophenone synthase gene vps gene
[0263] (8-a) The nucleotide sequence of the Humulus lupulus valerophenone synthase gene vps gene is shown in SEQ ID NO: 25 in the sequence listing. The vps gene was synthesized by the whole gene synthesis and ligated to the vector pUC57 to obtain the vector pUC57-vps. The vps gene fragment was amplified by PCR using pUC57-vps as the template and vps-F/vps-R as primers.
[0264] (8-b) The PCR amplified fragment obtained in above step (8-a) was subjected to agarose gel electrophoresis to recover the target fragment; at the same time, the vector pLB1a (the nucleotide sequence of the vector pLB1a is shown in SEQ ID NO: 24) was digested with NcoI and XhoI, and the large vector fragment LB1a-NX (i.e., the vector backbone) was recovered. The above recovered target fragment was ligated with the LB1a-NX fragment by the Gibson assembly method, and the ligated product was transformed into Escherichia coli DH5α competent cells (TransGen Biotech, item number: CD201) by the CaCl.sub.2 method. The cells were then spread on a LB plate containing streptomycin, and cultured at 37° C. overnight. Clones were picked and the clones from which the target fragment could be amplified with primers F-105/vps-R were identified and sequenced. A positive clone was screened and the plasmid was extracted, and the obtained positive plasmid with the correct sequence was named pLB1a-vps.
[0265] pLB1a-vps contains the vps gene shown in SEQ ID NO: 25 in the sequence listing, and can express the vps protein shown in SEQ ID NO: 26.
[0266] (9) Construction of PIVP-producing strain and whole-cell catalysis of 3-hydroxypropionic acid
[0267] (9-a) The vector pLB1a-vps obtained in step (8) was introduced into M-ABC, M-FGH, M-opFGH, MA-FGH, ME-FGH, M-FGH-ppc and BW respectively, to obtain recombinant strains, which were named M-ABC-PIVP, M-FGH-PIVP, M-opFGH-PIVP, MA-FGH-PIVP, ME-FGH-PIVP, M-FGH-ppc-PIVP and BW-PIVP. Each recombinant strain was used as the test strain for the production of PIVP.
[0268] (9-b) Cultivation of Engineered Strains and Induction of Enzymes
[0269] Each overnight cultured test strain was inoculated into 20 ml of medium B described in step (3-b) in a shake flask at an inoculum concentration of 1%; after culturing at 37° C. for 6 h, arabinose was added to the culture system to a final mass percentage of 0.2%; the cultivation was continued for 12 h, and the cells were collected.
[0270] (9-c) Whole-Cell Catalysis of PIVP
[0271] The cells collected above were resuspended in 5 ml of medium C in a shake flask; after culturing at 37° C. for 8 h, the cells were collected by centrifugation, and then were resuspended in 400 μL of 80% (volume percent) methanol aqueous solution pre-cooled at −80° C.; the cells were disrupted by sonication, centrifuged at 12,000 rpm at 4° C. for 20 min, and the supernatant was collected to detect the content of PIVP in the supernatant. The amount of the cells used was 5 mL of cell suspension with an OD600 of 30. The content of PIVP in the supernatant was analyzed by LCMS/MS using the standard curve method (external standard method) with PIVP (TRC, P339590-1 g) as the standard.
[0272] The results are shown in
[0273] The results showed that PIVP could be produced after the gene encoding branched-chain α-ketoacid dehydrogenase complex was introduced into E. coli: BW-PIVP did not synthesize PIVP; compared with the introduction of bkdA, bkdB, bkdC and lpdA1 genes, the introduction of bkdF, bkdG, bkdH and lpdA1 genes results in a higher yield of PIVP; while bkdH and lpdA1 genes were optimized according to the codon preference of E. coli, the yield of PIVP could be further improved; based on the introduction of bkdF, bkdG, bkdH and lpdA1 genes, the introduction of ppc gene could greatly improve the yield of PIVP. Based on the introduction of bkdF, bkdG, bkdH and lpdA1 genes, knockout of the ilvA and ilvE genes in the branched-chain α-ketoacid (the substrate of the branched-chain α-ketoacid dehydrogenase complex) synthesis pathway, the yield of PIVP did not further increase as the changing trend of the synthetic amount of malonyl-CoA of the corresponding strain in Example 1. This is because branched-chain α-ketoacids are required in the production process of PIVP, while after the knockout of ilvA and ilvE genes, the content of branched-chain α-ketoacids decreased, which in turn affected the yield of PIVP. Therefore, in the production of target products with malonyl-CoA as an intermediate product, it can be determined whether to knock out genes in the branched-chain α-ketoacid synthesis pathway according to whether branched-chain α-ketoacids are required in the synthetic pathway.
TABLE-US-00004 TABLE 4 List of primers Used Primer Sequence in vps-F 5′-GCTAACAGGAGGAATTAACCAT Step GGCGTCCGTAACTGTAGAGC-3′ (8) (SEQ ID NO: 58) vps-R 5′-TAGTACCAGATCTACCCTCGA Step GTTAGACGTTTGTGGGCACGCTGTG (8) CA-3′ (SEQ ID NO: 59)
[0274] Example 5. Expression and purification of Streptomyces avermitilis branched-chain α-ketoacid dehydrogenase complex gene and detection of its oxaloacetate dehydrogenase complex activity
[0275] (10) Construction of Streptomyces avermitilis branched-chain α-ketoacid dehydrogenase complex protein expression vector
[0276] (10-a) Using the plasmid pYB1k-bkdFGH-lpdA1 described in step (1-b) as the template, YK-BCDH-His DNA fragment was obtained by PCR amplification with primers BCDH-His-F and BCDH-His-R (Table 5).
[0277] (10-b) The YK-BCDH-His DNA fragment obtained by PCR amplification in above step (10-a) was digested with DpnI, and the digested product was transformed into Escherichia coli DH5α competent cells (TransGen Biotech, item number: CD201) by the CaCl.sub.2 method, The cells were then spread on a LB plate containing kanamycin, and cultured at 37° C. overnight. Clones were picked and the clones from which the target fragment could be amplified with primers F-108/lpdA1-XhoI were identified and sequenced. A positive clone was screened and the plasmid was extracted, and the obtained positive plasmid with the correct sequence was named pYB1k-His-BCDH.
[0278] (11) Protein expression and purification of branched-chain α-ketoacid dehydrogenase complex from Streptomyces avermitilis
[0279] (11-a) pYB1k-His-BCDH was introduced into Escherichia coli BW25113 of Example 1, and the obtained recombinant strain was named His-BCDH.
[0280] (11-b) The overnight cultured engineered strain His-BCDH was inoculated into 5 L of medium B described in step (3-a) in a shake flask at an inoculum concentration of 1%; after culturing at 30° C. for 6 h, arabinose was added to the culture system to a final mass percentage of 0.2%; the cultivation was continued for 20 h, and the cells were collected; the cells were washed with buffer D twice, then resuspended in buffer D; the cells were disrupted, and centrifuged at 20,000 rpm for 2 h and the supernatant was collected.
[0281] Buffer D is composed of a solvent and solutes, the solvent is water, and the solutes and their concentrations in buffer D are 50 mM Tris-HCl and 200 mM KCl, pH=8.0.
[0282] (11-c) A nickel column was equilibrated with 10 column volumes of buffer D, and the supernatant obtained by centrifugation in step (11-b) was loaded onto the equilibrated nickel column; the nickel column was washed by 10 column volumes of buffer D, followed by 5 column volumes of mixed buffers with a volume ratio of buffer D to buffer E of 49/1, 45/5 and 4218, and then eluted with a mixed buffer with a volume ratio of D buffer to E buffer of 1/1, to obtain Streptomyces avermitilis branched-chain α-ketoacid dehydrogenase complex protein. The above complex protein was washed and concentrated using a 100 kDa ultrafiltration tube (Amicon Ultra-15) to obtain a desalted protein, which was used for in vitro enzyme activity assay.
[0283] Buffer E is a solution with imidazole concentration of 500 mM obtained by adding imidazole to buffer D.
[0284] (12) Detection of the activity of Streptomyces avermitilis branched-chain α-ketoacid dehydrogenase complex to catalyze the production of malonyl-CoA from oxaloacetate
[0285] In a 96-well plate, 200 μL of buffer F was added to each well, and then the wells were divided into five groups, i.e., OAA group, OAA-EDTA group, KIV group (positive control), KIV-EDTA group and control group, each with 3 replicates.
[0286] Buffer F is composed of a solvent and solutes; the solvent is 50 mM Tris-HCl buffer (pH=7.0), and the solutes and their concentrations in buffer F are 0.1 mM CoA (coenzyme A), 0.2 mM DTT (dithiothreitol), 0.2 mM TPP (thiamine pyrophosphate), 1 mM MgSO.sub.4 and 2 mM NAD.sup.+ (oxidized nicotinamide adenine dinucleotide).
[0287] To each well of the OAA group, oxaloacetate was added, and the concentration of oxaloacetate in the reaction system was 3 mM;
[0288] to each well of the OAA-EDTA group, oxaloacetate and disodium ethylenediaminetetraacetate (EDTA) were added and the concentrations of oxaloacetate and EDTA in the reaction system were 3 mM and 10 mM, respectively;
[0289] to each well of the KIV group, ca-ketoisovaleric acid (3-methyl-2-oxobutanoic acid) was added and the concentration of a-ketoisovaleric acid in the reaction system was 3 mM;
[0290] to each well of the KIV-EDTA group, α-ketoisovaleric acid and EDTA were added, and the concentrations of α-ketoisovaleric acid and EDTA in the reaction system were 3 mM and 10 mM, respectively.
[0291] The control group contained buffer F only.
[0292] After the addition of each reagent in each group, the branched-chain α-ketoacid dehydrogenase complex was added, and 10 μL of 0.054 mg/mL branched-chain α-ketoacid dehydrogenase complex solution was added to each 200 μL reaction system.
[0293] Then, each group of the 96-well plate was placed at 30° C. for 30 min, and the absorbance at 340 nm was detected once per minute with a microplate reader (BioTek).
[0294] The results are shown in
TABLE-US-00005 TABLE 5 List of primers Used Primer Sequence in His-BCDH-F 5′-CTGACATGCATCATCATCATCAT Step CACGCCGAGAAGATGGCGATCGC-3′ (10) (SEQ ID NO: 60) His-BCDH-R 5′-CATGTCAGTTACCCCCCTGTCC-3′ Step (SEQ ID NO: 61) (10)
INDUSTRIAL APPLICATION
[0295] The present invention discovers a new source of malonyl-CoA, that is, malonyl-CoA can be obtained by catalyzing oxaloacetate by a branched-chain α-ketoacid dehydrogenase complex. Through biochemical and genetic tests, the branched-chain α-ketoacid dehydrogenase complex was proved to have oxaloacetate dehydrogenase activity. In addition, the present invention also finds that introducing/improving phosphoenolpyruvate carboxylase can further increase the synthetic amount of malonyl-CoA, and knocking out genes in the branched-chain α-ketoacid synthesis pathway can also increase synthetic amount of malonyl-CoA. The present invention further utilizes the branched-chain α-ketoacid dehydrogenase complex to prepare the target products with malonyl-CoA as an intermediate product, such as 3-hydroxypropionic acid, picric acid or an intermediate from malonyl-CoA to picric acid in the picric acid synthesis pathway. It is shown that the branched-chain α-ketoacid dehydrogenase complex of the present invention can be used to prepare malonyl-CoA and target products with malonyl-CoA as an intermediate product, such as 3-hydroxypropionic acid, picric acid, fatty acids, polyketides and flavonoids, etc., and thus has broad application prospects.