IGG ANTIBODY COMPOSITIONS AND METHODS OF MAKING THE SAME

20220380457 · 2022-12-01

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided herein are antibodies, recombinant proteins, and methods of use thereof including, for example, immunoglobulin G (IgG) antibodies and recombinant proteins including a Fab region and an Fc region connected through a hinge region, where the hinge region is resistant to cleavage by a protease. Also, provided herein, inter alia, are immunoglobulin G (IgG) antibodies and recombinant proteins including a Fab region and an Fc region connected through a hinge region, and where the Fc region has higher affinity for a ligand compared to a wildtype Fc.

    Claims

    1. An immunoglobulin G (IgG) antibody comprising a Fab region and an Fc region connected through a hinge region, wherein: (a) the hinge region is resistant to cleavage by a protease, (b) the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI), or (c) the hinge region is resistant to cleavage by a protease and the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

    2. The IgG antibody of claim 1, wherein the IgG antibody is an IgG1 antibody, an IgG2 antibody, an IgG3 antibody, or an IgG4 antibody.

    3. The IgG antibody of claim 1, wherein the hinge region is resistant to cleavage by a protease.

    4-6. (canceled)

    7. The IgG antibody of claim 1, wherein the hinge region comprises a protease resistant sequence between amino acid positions 246-252 according to Kabat numbering.

    8-11. (canceled)

    12. The IgG antibody of claim 7, wherein the protease resistant sequence comprises the amino acid sequence of SEQ ID NO:545, SEQ ID NO:546, or SEQ ID NO:547.

    13. The IgG antibody of claim 7, wherein the protease resistant sequence comprises the amino acid sequence selected from the group consisting of DW, YD, QW, QE, PW, QD, DD, CWDW, ETCWDW, DSCWDW, YDCWDW, DDCWDW, DMCWDW, EHCWDW, IICWDW, DVCWDW, EFCWDW, FNCWDW, EETCWDW (SEQ ID NO: 545), EDSCWDW (SEQ ID NO: 546), EETCWDD, EETCWSW (SEQ ID NO: 547), and EETQWDD.

    14. The IgG antibody of claim 7, wherein the protease resistant sequence comprises the amino acid sequence of SEQ ID NO:545.

    15. The IgG antibody of claim 1, wherein the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

    16-22. (canceled)

    23. The IgG antibody of claim 1, wherein the protease is selected from the group consisting of IdeS, IdeZ, pepsin, matrix metalloproteinase 7, matrix metalloproteinase 3, matrix metalloproteinase, cathepsin G, and glutamyl endopeptidase V8.

    24-25. (canceled)

    26. The IgG antibody of claim 1, wherein the Fc region comprises an amino acid substitution selected from S252D, I351E, and A349L according to the EU numbering of Kabat and wherein the substitution confers higher binding affinity for CD16 (FcγRIII) compared to wild type IgG antibody.

    27-45. (canceled)

    46. A recombinant protein comprising: (i) a Type I transmembrane domain; and (ii) the immunoglobulin G (IgG) antibody of claim 1; wherein the Type I transmembrane domain is fused to the C-terminus of the IgG antibody; and wherein the recombinant protein is resistant to cleavage by a protease.

    47. The recombinant protein of claim 46, wherein the Type I transmembrane domain is capable of dimerization.

    48. The recombinant protein of any one of claim 46, wherein the Type I transmembrane domain is selected from the group consisting of an EGFR, a PDGFR-alpha, a PDGFR-beta, a HER2, a HER3, a HER4, a FGFR1, a FGFR2, a FGFR3, a FGFR4, a VEGFR1, a VEGFR2, a VEGFR3, a Trk-A, a Trk-B, a Trk-C, and an insulin receptor transmembrane domain.

    49. The recombinant protein of claim 46, wherein the Type I transmembrane domain is an EGFR transmembrane domain.

    50-98. (canceled)

    99. An isolated nucleic acid capable of encoding the recombinant protein of claim 46.

    100. An expression vector comprising a nucleic acid capable of encoding the recombinant protein of claim 46.

    101. A cell comprising the expression vector of claim 100.

    102-104. (canceled)

    105. An anti-CD20 antibody comprising a complementarity determining region (CDR) as encoded by a nucleic acid sequence of any one of SEQ ID NOS:551-588.

    106. A method of binding a ligand to a CHO cell surface recombinant protein, the method comprising contacting a ligand with a CHO cell surface recombinant protein, wherein the CHO cell surface recombinant protein comprises: (i) an EGFR-transmembrane domain; and (ii) the immunoglobulin G (IgG) antibody of claim 1; wherein the EGFR-transmembrane domain is fused to the C-terminus of the IgG antibody; wherein the IgG antibody is capable of binding a ligand; and wherein the CHO cell surface protein is resistant to cleavage by an IgG-specific protease or has higher binding affinity for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

    107. A method of treating cancer in a patient in need thereof, the method comprising administering to the patient an effective amount of the IgG antibody of claim 1 and an IgG specific protease.

    108. (canceled)

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0018] FIG. 1 schematically illustrates that human immune cells are naturally coated with endogenous IgG, which prevents interactions between a therapeutic mAb and FcγRs expressed on the surface of the human immune cells. This thereby limits the binding of therapeutic mAb to FcγRs thus limits the efficacy of the therapeutic mAb.

    [0019] FIG. 2 provides flow cytometric data demonstrating that human NK cells are naturally coated with IgG molecules, which can be removed by incubation with the IdeS enzyme. Human peripheral blood mononuclear cells (PBMCs) were digested with IdeS for 30 minutes at 37° C. and stained with antibodies against linage markers or against human IgG Fc. Note CD3+ T cells do not express FcγRs and therefore do not bind human IgG under any condition.

    [0020] FIG. 3 schematically illustrates the strategy for enhancing therapeutic efficiency of mAbs. Panel (a) shows FcγRs on immune cells are normally occupied by endogenous IgG; Panel (b) and (c) show IdeS digestion can remove endogenous IgG and free-up FcγR binding sites for infused therapeutic mAb, which are engineered to be resistant to IdeS and retain FcγR binding function; (Panels (c) and (d)); Infused therapeutic mAb may first bind onto unoccupied FcγR as shown in Panel (c) or may first bind tumor-associated antigen expressed on the cancer cell as shown in Panel (d). Regardless, once the antigen-mAb-FcγR crosslink, the FcγR+ cell undergoes immune activation as shown in Panel (f). The flow chart illustrates that the more FcγRs that are unoccupied and therefore available for binding the therapeutic mAb, the more tumor cells are eliminated (Panel (e)).

    [0021] FIGS. 4A-4E illustrate flow cytometry density plots of display of various functional IgG proteins on GFP+ Chinese hamster ovary (CHO) cells in the absence or presence of IgG specific protease (IdeS or IdeZ peptidase). The gray dots represent CHO cells treated with control, and black dots represent CHO cells treated with IdeS or IdeZ peptidase, the IgG specific proteases that cleave the IgG hinge region preventing the IgG molecule from binding to Fc-gamma receptors. FIG. 4A quantifies the ability of an mAb recognizing the Fab portion of IgG to bind to IgG1Fc-EGFR, which does not have a Fab portion (top) or rituximab-EGFR (bottom). FIG. 4B quantifies the ability of an mAb recognizing the Fc portion of IgG to bind to IgG1Fc-EGFR (top) or rituximab-EGFR (bottom); Importantly, this particular multi-clonal mAb recognizes regions that are not cleaved by IdeS or IdeZ, thus no cleavage is observed. FIG. 4C quantifies the ability of soluble CD64 (FcγRI) to bind to IgG1Fc-EGFR (top) or rituximab-EGFR (bottom); FIG. 4D quantifies the ability of soluble CD32a (FcγRIIa) to bind to IgG1Fc-EGFR (top) or rituximab-EGFR (bottom); FIG. 4E quantifies the ability of soluble CD16a (FcγRIIIa) to bind to IgG1Fc-EGFR (top) or rituximab-EGFR (bottom).

    [0022] FIGS. 5 illustrates the generation of new lower hinge for IgG1Fc with enhanced binding affinity to CD16α and resistance to cleavage by IdeS and IdeZ. Amino acids (AAs) were added in a stepwise fashion to the N-terminus of IgG1 Δ16 (SEQ ID NO: 16), which does not bind CD16α. Clones acquiring CD16α binding were selected for by sequentially attaching more amino acids step by step to increase binding affinity.

    [0023] FIGS. 6A-B illustrate the stepwise acquisition of CD16α binding by sequentially adding amino acids (AAs) to IgG1FcΔ16 at its N-terminus. FIG. 6A show binding affinity of various contracts of human IgG1FcΔ16 was fused with EGFR transmembrane helix domain and displayed as a type 1 membrane protein on the CHO cell surface. FIG. 6B shows individual panels of all the positive clones as more AAs were added.

    [0024] FIG. 7 shows data collected from CHO cells transfected with rituximab-EGFR. The hinge region of the rituximab is composed of either the wild type (WT) hinge (ELLGGPS; SEQ ID NO: 544), or one of two de novo IdeS/IdeZ-resistant hinges: EETCWDW, which has higher affinity for FcγR CD16α than the WT or EDSCWDW, which has lower affinity for FcγR CD16α than the WT.

    [0025] FIG. 8 shows binding affinity of various FcγRs to CHO cells expressing rituximab whose hinge moiety is either WT (ELLGGPS; SEQ ID NO: 544) or has been engineered with novel de novo hinge regions variants (EETCWDW, SEQ ID NO: 545; or EDSCWDW. SEQ ID NO: 546) using the methodology described herein and shown in FIG. 7. The resulting surface IgG expression and binding affinities of various FcγRs were quantified using fluorescent labeled FcγRs ectodomain as indicated on the Y axis, and fluorescent labeled anti-human Fc antibody on the X axis. The FcγRs binding affinity to each hinge moiety is indicated in the upper left quadrant of each histogram.

    [0026] FIG. 9 provides a representative example illustrating the resistance of the novel hinge region (EETCWDW) to cleavage by IdeS/IdeZ. The WT rituximab pre-incubated with IdeZ can no longer be detected on the surface of the CD20(+) Daudi lymphoma cells when stained with fluorescently-labelled anti human Fc antibody (left histogram, dashed line), while the EETCWDW rituximab can still be detected (right histogram, dashed line).

    [0027] FIG. 10 shows CHO cells transfected with trastuzumab-EGFR. The trastuzumab contains either its wild type (WT) hinge moiety or one of two de novo novel hinge moieties EETCWDW or EDSCWDW that were engineered to replace of the WT hinge region of trastuzumab using the same methodology described herein for rituximab. The resulting surface IgG expression and binding affinities of various FcγRs were quantified using fluorescent labeled FcγRs ectodomain as indicated on the Y axis, and fluorescent labeled anti-human Fc antibody on the X axis. The FcγRs binding affinity to each hinge moiety is indicated in the upper left quadrant of each histogram.

    [0028] FIGS. 11A-C demonstrate activity of a rituximab variant. FIGS. 11A-B show representative data comparing WT rituximab and “EETCWDW ritmixmab” in natural killer (NK) cell activation, and FIG. 11C shows representative data comparing WT rituximab and “EETCWDW rituximab” in NK cell depletion of B cells. These experiments were conducted in vitro in whole human blood over the course of 10 hours, without (“control”) or with IdeZ (“IdeZ”). IdeZ removes endogenous IgG binding to FcγRs such as CD16α on innate immune cells such as NK cells, monocytes and granulocytes.

    [0029] FIG. 12 demonstrates how increasing concentrations of AB serum (and therefore increasing the concentration of endogenous IgG) in blood out competes EETCWDW rituximab for binding to NK cell FcγRIIIA (CD16α), thereby diminishing NK cell activation.

    [0030] FIG. 13 is data demonstrating rituximab expressed on the surface of CHO cells as rituximab-EGFR fusion protein. The X axis shows a fluorescently labeled anti-Fc mAb that can bind to CHO cells expressing IgG1-EGFR or rituximab-EGFR. The Y axis shows a fluorescently labeled CD20 molecule that can bind to rituximab-EGFR. In the left histogram, the CHO cells express IgG1 Fc-EGFR, thus binding on the X axis but no binding on the Y axis. The middle histogram expresses rituximab-EGFR and quantifies the affinity rituximab has for CD20. The histogram to the right shows the binding of the fluorescently labeled CD20 molecule to rituximab (Line A), or to a hypothetical variant of rituximab with higher affinity for CD20 compared to the actual rituximab (Line B), or to a hypothetical variant of rituximab with lower affinity for CD20 compared to the actual rituximab (Line C). Right panels show the expression of the CH2-CH3 fragment of Fc on the surface of CHO cells, so no binding by the human fluorescently labeled CD20 molecule.

    [0031] FIG. 14 illustrates flow cytometry density plots of sequence-dependent rituximab target selection and corresponding sequences. The representative example shows multiple clones from the rituximab library consisting of CD20 binding variants and flow cytometric measurement of binding affinity for each variant to a fluorescently labeled CD20 molecule, as demonstrated in FIG. 13.

    [0032] FIG. 15 illustrates the progressive acquisition of IdeS resistance by single amino acid substitution.

    [0033] FIG. 16 illustrates the binding of wild-type, L248E, and L248D hinge mutant rituximab to human FcγRs. Wild-type or the single amino acid mutants of rituximab (L248E and L248E) were expressed on CHO cells as type I membrane proteins and tested for their expression and binding to human FcγRs using fluorescent labeled anti-human Fc and different human FcγR ectodomains.

    DETAILED DESCRIPTION

    I. Definitions

    [0034] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by someone of ordinary skill in the art to which this technology belongs. In this specification and in the claims that follow, reference will be made to a number of terms that shall be defined to have the following meanings:

    [0035] As used herein, the term “antibody” is used in accordance with its plain ordinary meanings and refers to a polypeptide encoded by an immunoglobulin gene or functional fragments thereof that specifically binds and recognizes an antigen. The recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon, and mu constant region genes, as well as the myriad immunoglobulin variable region genes. Light chains are classified as either kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively. The term “antibody” also includes bivalent or bispecific molecules, diabodies, triabodies, and tetrabodies.

    [0036] As used herein, the terms “specifically (or selectively) binds” or “specifically (or selectively) immunoreactive with,” when referring to a protein or peptide, are used in accordance with their plain ordinary meanings and refer to a binding reaction that is determinative of the presence of the protein, often in a heterogeneous population of proteins and other biologics. Thus, under designated immunoassay conditions, the specified antibodies bind to a particular protein at least two times the background and more typically more than 10 to 100 times background. Specific binding to an antibody under such conditions requires an antibody that is selected for its specificity for a particular protein. For example, polyclonal antibodies can be selected to obtain only a subset of antibodies that are specifically immunoreactive with the selected antigen and not with other proteins. This selection may be achieved by subtracting out antibodies that cross-react with other molecules. A variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein. For example, solid-phase ELISA immunoassays are routinely used to select antibodies specifically immunoreactive with a protein (see, e.g., Harlow & Lane, Using Antibodies, A Laboratory Manual (1998) for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity).

    [0037] An example of an immunoglobulin (antibody) structural unit comprises a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one “light” (about 25 kDa) and one “heavy” chain (about 50-70 kDa). The N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The terms “variable heavy chain,” “V.sub.H,” or “VH” refer to the variable region of an immunoglobulin heavy chain, including an Fv, scFv, dsFv or Fab; while the terms “variable light chain,” “V.sub.L” or “VL” refer to the variable region of an immunoglobulin light chain, including of an Fv, scFv , dsFv or Fab.

    [0038] Examples of antibody functional fragments include, but are not limited to, complete antibody molecules, antibody fragments, such as Fv, single chain Fv (scFv), complementarity determining regions (CDRs), V.sub.L (light chain variable region), V.sub.H (heavy chain variable region), Fab, F(ab)2′ and any combination of those or any other functional portion of an immunoglobulin peptide capable of binding to target antigen (see, e.g., FUNDAMENTAL IMMUNOLOGY (Paul ed., 4th ed. 2001). As appreciated by one of skill in the art, various antibody fragments can be obtained by a variety of methods, for example, digestion of an intact antibody with an enzyme, such as pepsin; or de novo synthesis. Antibody fragments are often synthesized de novo either chemically or by using recombinant DNA methodology. Thus, the term antibody, as used herein, includes antibody fragments either produced by the modification of whole antibodies, or those synthesized de novo using recombinant DNA methodologies (e.g., single chain Fv) or those identified using phage display libraries.

    [0039] As used herein, the term “chimeric antibody” is used in accordance with its plain ordinary meaning and refers to an antibody molecule in which (a) the constant region, or a portion thereof, is altered, replaced or exchanged so that the antigen binding site (variable region) is linked to a constant region of a different or altered class, effector function and/or species, or an entirely different molecule which confers new properties to the chimeric antibody, e.g., an enzyme, toxin, hormone, growth factor, drug, etc.; or (b) the variable region, or a portion thereof, is altered, replaced or exchanged with a variable region having a different or altered antigen specificity. The preferred antibodies of, and for use according to the invention include humanized and/or chimeric monoclonal antibodies.

    [0040] As used herein, the term “therapeutic antibody” is used in accordance with its plain ordinary meaning and refers to an antibody useful in treating a disease. A therapeutic antibody can activate, repress, or alter endogenous immune responses to specific cells or molecules. In embodiments, a therapeutic antibody is an antibody useful in treating cancer, inflammatory, and/or autoimmune disease. In embodiments, a therapeutic antibody is an antibody useful in treating cancer. In embodiments, the therapeutic antibody is an IgG antibody and such embodiments may be referred to as a therapeutic IgG or therapeutic IgG antibody. Examples of a therapeutic antibody include Abciximab, Adalimumab, Alemtuzumab, Alemtuzumab, Alirocumab, Arcitumomab, Atezolizumab, Avelumab, Basiliximab, Belimumab, Besilesomab, Bevacizumab, Bezlotoxumab, Brentuximab, Brodalumab, Canakinumab, Capromab, Catumaxomab, Certolizumab pegol, Cetuximab, Daratumumab, Denosumab, Dinutuximab, Dupilumab, Durvalumab, Eculizumab, Efalizumab, Elotuzumab, Fanolesomab, Gemtuzumab ozogamicin, Golimumab, Ibritumomab tiuxetan, Idarucizumab, Imiciromab, Infliximab, Ipilimumab, Mepolizumab, Muromonab-CD3, Natalizumab, Necitumumab, Nivolumab, Nofetumomab, Obiltoxaximab, Obinutuzumab, Ocrelizumab, Ofatumumab, Olaratumab, Omalizumab, Palivizumab, Panitumumab, Pembrolizumab, Pertuzumab, Ramucirumab, Ranibizumab, Raxibacumab, Reslizumab, Rituximab, Satumomab, Secukinumab, Siltuximab, Sulesomab, Tocilizumab, Tositumomab, Trastuzumab, Trastuzumab emtansine, Ustekinumab, Vedolizumab, Volocumab, and Votumumab.

    [0041] As used herein, the term “Rituximab” is used in accordance with its plain ordinary meaning and refers to a monoclonal antibody therapeutic invented by Genentech, Inc. that targets the CD20 antigen expressed on the surface of B-cells. It is also known by the brand names Rituxan (Genentech, Inc.), Rituxan Sc (Hoffman-La Roche, Inc.), and biosimilar Truixma (Celltiron, Cephalon, Inc.). The hinge region is denoted by Kabat numbering as positions 246-252 and alternatively as positions 233-239 by numbering used, for example, in U.S. Pat. No. 7,317,091.

    [0042] As used herein, the term “cancer” is used in accordance with its plain ordinary meaning and refers to all types of cancer, neoplasm or malignant tumors found in mammals (e.g. humans), including leukemias, lymphomas, carcinomas and sarcomas. Examples of cancers that may be treated with a compound, composition, or method provided herein include brain cancer, glioma, glioblastoma, neuroblastoma, prostate cancer, colorectal cancer, pancreatic cancer, Medulloblastoma, melanoma, cervical cancer, gastric cancer, ovarian cancer, lung cancer, cancer of the head, Hodgkin's Disease, and Non-Hodgkin's Lymphomas. Additional examples include, thyroid carcinoma, cholangiocarcinoma, pancreatic adenocarcinoma, skin cutaneous melanoma, colon adenocarcinoma, rectum adenocarcinoma, stomach adenocarcinoma, esophageal carcinoma, head and neck squamous cell carcinoma, breast invasive carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, non-small cell lung carcinoma, mesothelioma, multiple myeloma, neuroblastoma, glioma, glioblastoma multiforme, ovarian cancer, rhabdomyosarcoma, primary thrombocytosis, primary macroglobulinemia, primary brain tumors, malignant pancreatic insulanoma, malignant carcinoid, urinary bladder cancer, premalignant skin lesions, testicular cancer, thyroid cancer, neuroblastoma, esophageal cancer, genitourinary tract cancer, malignant hypercalcemia, endometrial cancer, adrenal cortical cancer, neoplasms of the endocrine or exocrine pancreas, medullary thyroid cancer, medullary thyroid carcinoma, melanoma, colorectal cancer, papillary thyroid cancer, hepatocellular carcinoma, or prostate cancer.

    [0043] The term “leukemia” is used in accordance with its plain ordinary meaning and refers broadly to progressive, malignant diseases of the blood-forming organs and is generally characterized by a distorted proliferation and development of leukocytes and their precursors in the blood and bone marrow. Leukemia is generally clinically classified on the basis of (1) the duration and character of the disease-acute or chronic; (2) the type of cell involved; myeloid (myelogenous), lymphoid (lymphogenous), or monocytic; and (3) the increase or non-increase in the number abnormal cells in the blood-leukemic or aleukemic (subleukemic). Examples of leukemias that may be treated with a compound or method provided herein include, for example, acute nonlymphocytic leukemia, chronic lymphocytic leukemia, acute granulocytic leukemia, chronic granulocytic leukemia, acute promyelocytic leukemia, adult T-cell leukemia, aleukemic leukemia, a leukocythemic leukemia, basophylic leukemia, blast cell leukemia, bovine leukemia, chronic myelocytic leukemia, leukemia cutis, embryonal leukemia, eosinophilic leukemia, Gross' leukemia, hairy-cell leukemia, hemoblastic leukemia, hemocytoblastic leukemia, histiocytic leukemia, stem cell leukemia, acute monocytic leukemia, leukopenic leukemia, lymphatic leukemia, lymphoblastic leukemia, lymphocytic leukemia, lymphogenous leukemia, lymphoid leukemia, lymphosarcoma cell leukemia, mast cell leukemia, megakaryocytic leukemia, micromyeloblastic leukemia, monocytic leukemia, myeloblastic leukemia, myelocytic leukemia, myeloid granulocytic leukemia, myelomonocytic leukemia, Naegeli leukemia, plasma cell leukemia, multiple myeloma, plasmacytic leukemia, promyelocytic leukemia, Rieder cell leukemia, Schilling's leukemia, stem cell leukemia, subleukemic leukemia, or undifferentiated cell leukemia.

    [0044] The term “patient” or “subject in need thereof” is used in accordance with its plain ordinary meaning and refers to a living organism suffering from or prone to a disease or condition that can be treated by administration of a composition, compound, or method as provided herein. Non-limiting examples include humans, other mammals, bovines, rats, mice, dogs, monkeys, goat, sheep, cows, deer, and other non-mammalian animals. In some embodiments, a patient is human. In embodiments, the subject has, had, or is suspected of having cancer.

    [0045] As used herein, the terms “control” or “control experiment” are used in accordance with its plain ordinary meaning and refer to an experiment in which the subjects or reagents of the experiment are treated as in a parallel experiment except for omission of a procedure, reagent, or variable of the experiment. In some instances, the control is used as a standard of comparison in evaluating experimental effects. In some embodiments, a control is the measurement of the activity of a protein in the absence of a compound as described herein (including embodiments and examples).

    [0046] As used herein, the terms “treating” or “treatment” are used in accordance with its plain ordinary meaning and refer to any indicia of success in the therapy or amelioration of an injury, disease, pathology or condition, including any objective or subjective parameter such as abatement; remission; diminishing of symptoms or making the injury, pathology or condition more tolerable to the patient; slowing in the rate of degeneration or decline; making the final point of degeneration less debilitating; improving a patient's physical or mental well-being. The treatment or amelioration of symptoms can be based on objective or subjective parameters; including the results of a physical examination, neuropsychiatric exams, and/or a psychiatric evaluation. The term “treating” and conjugations thereof, may include prevention of an injury, pathology, condition, or disease. In embodiments, treating includes preventing. In embodiments, treating does not include preventing.

    [0047] As used herein, the term “percentage of sequence identity” is used in accordance with its plain ordinary meaning and is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.

    [0048] As used herein, the terms “identical” or percent “identity,” are used in accordance with their plain ordinary meanings and in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI web site http://www.ncbi.nlm.nih.gov/BLAST/or the like). Such sequences are then said to be “substantially identical.” This definition also refers to, or may be applied to, the compliment of a test sequence. The definition also includes sequences that have deletions and/or additions, as well as those that have substitutions. As described below, the preferred algorithms can account for gaps and the like. Preferably, identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is 50-100 amino acids or nucleotides in length.

    [0049] As used herein, the terms “affinity selection” or “affinity maturation” are used in accordance with their plain ordinary meanings and refer to a process in which an antibody is evolved from a reference antibody, typically by mutation of one or more amino acid residues, to have increased activity for a target antigen than a corresponding form of the reference antibody has for the same target antigen. Hence, the evolved antibody is optimized compared to the reference antibody. Selection of refined antibodies can be achieved through various biophysical and in vitro methods.

    [0050] As used herein, the term “fusion protein” is used in accordance with its plain ordinary meaning and refers to a covalently-linked polypeptide chain derived from two or more different proteins or genes of origin.

    [0051] As used herein, the terms “CD16 protein” or “CD16” or “FcγRIII” or “Fc gamma receptor III” are used in accordance with their plain ordinary meanings and refer to any of the recombinant or naturally-occurring forms of receptor CD16 or Cluster of Differentiation 16 (CD16), or variants or homologs thereof that maintain CD16 activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to CD16). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring CD16 protein. In embodiments, the CD16 protein is substantially identical to the protein identified by the UniProt reference number P08637 or a variant or homolog having substantial identity thereto. In embodiments, the CD16 protein is substantially identical to the protein identified by the UniProt reference number Q9ULV2 or a variant or homolog having substantial identity thereto. CD16 is a receptor for Fc region of IgG, and mediates antibody-dependent cellular cytotoxicity (ADCC).

    [0052] As used herein, the terms “CD32 protein” or “CD32” or “FcγRII” or “Fc gamma receptor II” are used in accordance with their plain ordinary meanings and refer to any of the recombinant or naturally-occurring forms of receptor CD32 or Cluster of Differentiation 32 (CD32), or variants or homologs thereof that maintain CD32 activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to CD32). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring CD32 protein. In embodiments, the CD32 protein is substantially identical to the protein identified by the UniProt reference number P12318 or a variant or homolog having substantial identity thereto. In embodiments, the CD32 protein is substantially identical to the protein identified by the UniProt reference number P31994 or a variant or homolog having substantial identity thereto. In embodiments, the CD32 protein is substantially identical to the protein identified by the UniProt reference number P31995 or a variant or homolog having substantial identity thereto. CD32 is a receptor for the Fc region of complexed or aggregated IgG, mediates B-cell activation, phagocytosis, and endocytosis of immune complexes.

    [0053] As used herein, the terms “CD64 protein” or “CD64” or “FcγRI” or “Fc gamma receptor I” are used in accordance with their plain ordinary meanings and refer to any of the recombinant or naturally-occurring forms of receptor CD64 or Cluster of Differentiation 64 (CD64), or variants or homologs thereof that maintain CD64 activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to CD64). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring CD64 protein. In embodiments, the CD64 protein is substantially identical to the protein identified by the UniProt reference number P12314 or a variant or homolog having substantial identity thereto. In embodiments, the CD64 protein is substantially identical to the protein identified by the UniProt reference number Q92637 or a variant or homolog having substantial identity thereto. In embodiments, the CD64 protein is substantially identical to the protein identified by the UniProt reference number P30273 or a variant or homolog having substantial identity thereto. CD64 is a high-affinity receptor that binds non-complexed immunoglobulins.

    [0054] As used herein, the terms “EGFR protein” or “EGFR” or “HER1” are used in accordance with their plain ordinary meanings and refer to any of the recombinant or naturally-occurring forms of epidermal growth factor receptor (EGFR) also known as ErbB-1 or HER1 in humans, or variants or homologs thereof that maintain EGFR activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to EGFR). In some aspects, the variants or homologs have t least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring EGFR protein. In embodiments, the EGFR protein is substantially identical to the protein identified by the UniProt reference number P00533 or a variant or homolog having substantial identity thereto. EGFR is a receptor tyrosine kinase.

    [0055] As used herein, the terms “PDGFR protein” or “PDGFR” are used in accordance with their plain ordinary meanings and refer to any of the recombinant or naturally-occurring forms of platelet-derived growth factor receptor (PDGFR) or variants or homologs thereof that maintain PDGFR activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to PDGFR). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring EGFR protein. In embodiments, the PDGFR protein is substantially identical to the protein PDGFR-alpha, identified by the UniProt reference number P16234 or a variant or homolog having substantial identity thereto. In embodiments, the PDGFR protein is substantially identical to the protein PDGFR-beta identified by the UniProt reference number P09619 or a variant or homolog having substantial identity thereto. PDGFR is a receptor tyrosine kinase.

    [0056] As used herein, the terms “HER-2 protein” or “HER2” or “human epidermal growth factor receptor 2” or “Receptor Tyrosine-Protein Kinase ERBB-2” or “ERBB2” or “proto-oncogene Neu” or “CD340” or “Cluster of Differentiation 340” are used in accordance with their plain ordinary meanings and refer to any of the recombinant or naturally-occurring forms of human epidermal growth factor receptor 2 (HER2) or variants or homologs thereof that maintain HER2 activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to HER2). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring HER2 protein. In embodiments, the HER2 protein is substantially identical to the protein identified by the UniProt reference number P04626 or a variant or homolog having substantial identity thereto. HER2 is a receptor tyrosine kinase.

    [0057] As used herein, the terms “HER-3 protein” or “HER3” or “human epidermal growth factor receptor 3” or “Receptor Tyrosine-Protein Kinase ERBB-3” or “ERBB3” or “proto-oncogene-like protein c-ErbB-3” are used in accordance with their plain ordinary meanings and refer to any of the recombinant or naturally-occurring forms of human epidermal growth factor receptor 3 (HER3) or variants or homologs thereof that maintain HER3 activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to HER3). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring HER3 protein. In embodiments, the HER3 protein is substantially identical to the protein identified by the UniProt reference number P21860 or a variant or homolog having substantial identity thereto. HER3 is a receptor tyrosine kinase.

    [0058] As used herein, the terms “HER-4 protein” or “HER4” or “human epidermal growth factor receptor 4” or “Receptor Tyrosine-Protein Kinase ERBB-4” or “ERBB4” or “proto-oncogene-like protein c-ErbB-4” are used in accordance with their plain ordinary meanings and refer to any of the recombinant or naturally-occurring forms of human epidermal growth factor receptor 4 (HER4) or variants or homologs thereof that maintain HER4 activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to HER4). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring HER4 protein. In embodiments, the HER4 protein is substantially identical to the protein identified by the UniProt reference number Q15303 or a variant or homolog having substantial identity thereto. HER4 is a receptor tyrosine kinase.

    [0059] As used herein, the terms “FGFR-1 protein” or “FGFR1” or “fibroblast growth factor receptor 1” or “basic fibroblast growth factor receptor” or “N-sam” or “proto-oncogene c-Fgr” are used in accordance with their plain ordinary meanings and refer to any of the recombinant or naturally-occurring forms of fibroblast growth factor receptor 1 (FGFR1) or variants or homologs thereof that maintain FGFR1 activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to FGFR1). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring FGFR1 protein. In embodiments, the FGFR1 protein is substantially identical to the protein identified by the UniProt reference number P11362 or a variant or homolog having substantial identity thereto. FGFR1 is a receptor tyrosine kinase.

    [0060] As used herein, the terms “FGFR-2 protein” or “FGFR2” or “fibroblast growth factor receptor 2” or “keratinocyte growth factor receptor” or “K-sam” are used in accordance with their plain ordinary meanings and refer to any of the recombinant or naturally-occurring forms of fibroblast growth factor receptor 2 (FGFR2) or variants or homologs thereof that maintain FGFR2 activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to FGFR2). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring FGFR2 protein. In embodiments, the FGFR2 protein is substantially identical to the protein identified by the UniProt reference number P21802 or a variant or homolog having substantial identity thereto. FGFR2 is a receptor tyrosine kinase.

    [0061] As used herein, the terms “FGFR-3 protein” or “FGFR3” or “fibroblast growth factor receptor 3” are used in accordance with their plain ordinary meanings and refer to any of the recombinant or naturally-occurring forms of fibroblast growth factor receptor 3 (FGFR3) or variants or homologs thereof that maintain FGFR3 activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to FGFR3). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring FGFR3 protein. In embodiments, the FGFR3 protein is substantially identical to the protein identified by the UniProt reference number P22607 or a variant or homolog having substantial identity thereto. FGFR3 is a receptor tyrosine kinase.

    [0062] As used herein, the terms “FGFR-4 protein” or “FGFR4” or “fibroblast growth factor receptor 4” are used in accordance with their plain ordinary meanings and refer to any of the recombinant or naturally-occurring forms of fibroblast growth factor receptor 4 (FGFR4) or variants or homologs thereof that maintain FGFR4 activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to FGFR4). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring FGFR4 protein. In embodiments, the FGFR4 protein is substantially identical to the protein identified by the UniProt reference number P22455 or a variant or homolog having substantial identity thereto. FGFR4 is a receptor tyrosine kinase.

    [0063] As used herein, the terms “VEGFR-1 protein” or “VEGFR1” or “vascular endothelial growth factor receptor 1” are used in accordance with their plain ordinary meanings and refer to any of the recombinant or naturally-occurring forms of vascular endothelial growth factor receptor 1 (VEGFR1) or variants or homologs thereof that maintain VEGFR1 activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to VEGFR1). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring VEGFR1 protein. In embodiments, the VEGFR1 protein is substantially identical to the protein identified by the UniProt reference number P17948 or a variant or homolog having substantial identity thereto. VEGFR1 is a receptor tyrosine kinase.

    [0064] As used herein, the terms “VEGFR-2 protein” or “VEGFR2” or “vascular endothelial growth factor receptor 2” are used in accordance with their plain ordinary meanings and refer to any of the recombinant or naturally-occurring forms of vascular endothelial growth factor receptor 1 (VEGFR2) or variants or homologs thereof that maintain VEGFR2 activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to VEGFR2). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring VEGFR2 protein. In embodiments, the VEGFR2 protein is substantially identical to the protein identified by the UniProt reference number P35968 or a variant or homolog having substantial identity thereto. VEGFR2 is a receptor tyrosine kinase.

    [0065] As used herein, the terms “VEGFR-3 protein” or “VEGFR3” or “vascular endothelial growth factor receptor 3” are used in accordance with their plain ordinary meanings and refer to any of the recombinant or naturally-occurring forms of vascular endothelial growth factor receptor 1 (VEGFR3) or variants or homologs thereof that maintain VEGFR3 activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to VEGFR3). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring VEGFR3 protein. In embodiments, the VEGFR3 protein is substantially identical to the protein identified by the UniProt reference number P35916 or a variant or homolog having substantial identity thereto. VEGFR3 is a receptor tyrosine kinase.

    [0066] As used herein, the terms “NTRK1 protein” or “NTRK1” or “Trk-A” or “high affinity nerve growth factor receptor” or “neurotrophic tyrosine kinase receptor type 1” or “tropomyosin-related kinase A” are used in accordance with their plain ordinary meanings and refer to any of the recombinant or naturally-occurring forms of high affinity nerve growth factor receptor (NTRK1) or variants or homologs thereof that maintain NTRK1 activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to NTRK1). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring NTKR1 protein. In embodiments, the NTKR1 protein is substantially identical to the protein identified by the UniProt reference number P04629 or a variant or homolog having substantial identity thereto. NTKR1 is a receptor tyrosine kinase.

    [0067] As used herein, the terms “NTRK2 protein” or “NTRK2” or “Trk-B” or “BDNF/NT-3 growth factors receptor” or “brain derived neurotrophic growth factor receptor” are used in accordance with their plain ordinary meanings and refer to any of the recombinant or naturally-occurring forms of oncogene BDNF/NT-3 growth factors receptor (NTRK2) or variants or homologs thereof that maintain NTRK2 activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to NTRK2). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring NTKR2 protein. In embodiments, the NTKR2 protein is substantially identical to the protein identified by the UniProt reference number Q16620 or a variant or homolog having substantial identity thereto. NTKR2 is a receptor tyrosine kinase.

    [0068] As used herein, the terms “NTRK3 protein” or “NTRK3” or “Trk-C” or “NT-3 growth factor receptor” are used in accordance with their plain ordinary meanings and refer to any of the recombinant or naturally-occurring forms of NT-3 growth factor receptor (NTRK3) or variants or homologs thereof that maintain NTRK3 activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to NTRK3). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring NTKR3 protein. In embodiments, the NTKR3 protein is substantially identical to the protein identified by the UniProt reference number Q16628 or a variant or homolog having substantial identity thereto. NTKR3 is a receptor tyrosine kinase.

    [0069] As used herein, the term “IGF1R protein” or “IGF1R” or “insulin-like growth factor receptor” are used in accordance with their plain ordinary meanings and refer to any of the recombinant or naturally-occurring forms of insulin-like growth factor receptor (IGF1R) or variants or homologs thereof that maintain IGF1R activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to IGF1R). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring IGF1R protein. In embodiments, the IGF1R protein is substantially identical to the protein identified by the UniProt reference number P08069 or a variant or homolog having substantial identity thereto. IGF1R is a receptor tyrosine kinase.

    [0070] As used herein, the terms “glutamyl endopeptidase V8” or “GluV8” or “SspA” or “endopeptidase Glu-C” or “V8 protease” or “staphylococcal serine protease” are used in accordance with their plain and ordinary meanings and refer to any of the recombinant or naturally-occurring forms of the SspA protein or variants or homologs thereof that maintain SspA activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to SspA). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring SspA polypeptide. In embodiments, SspA is the protein as identified by the UniProt reference number P0C1U8 or a variant or homolog having substantial identity thereto. SspA is a serine protease that preferentially cleaves peptide bonds on the carboxyl-terminal side of glutamate and aspartate.

    [0071] As used herein, the terms “immunoglobulin domain” or “Ig-domain” are used in accordance with their plain and ordinary meanings and refer to any of the recombinant or naturally-occurring forms of the Ig-domain or variants or homologs thereof that maintain the Ig-domain fold or three-dimensional structure. The Ig-domain belongs to a family of protein folds that consist of a 2-layer sandwich of 7-9 antiparallel beta-strands arranged in two beta-sheets with a Greek-key topology. The folding pattern typically consists of (N-terminal beta-hairpin-in sheet 1)-(beta-haripin-in sheet 2)-(beta-strand in sheet 1)-(C-terminal beta-hairpin in sheet 2) linkages. Immunoglobulin domains are the primary components of antibodies, and a large set of extracellular surface receptors, including receptor tyrosine kinases.

    [0072] As used herein, the terms “Immunoglobulin G” or “IgG” are used in accordance with their plain and ordinary meanings and refer to any of the recombinant or naturally-occurring forms of the IgG antibody protein or variants or homologs thereof that maintain IgG activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to IgG). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring IgG polypeptide. IgG antibodies are composed of four separate chains (two identical light chains and two identical heavy chains) that form a homodimer (via inter-heavy chain disulfide) of heterodimers (one light chain and one heavy chain interchain disulfide) in a canonical Y-shaped quaternary structure. The light chain includes a variable immunoglobulin domain (V.sub.L) and a constant immunoglobulin domain (C.sub.L). The heavy chain includes one variable immunoglobulin domain (V.sub.H) and three constant immunoglobulin domains (C.sub.H1, C.sub.H2, C.sub.H3). The variable domains form the antigen-recognition surface of an IgG antibody. There are four subclasses of IgG, IgG1, IgG2, IgG3, and IgG4 that are different by function. IgG1 mediates thymus-related immune responses against polypeptide and protein antigens. IgG2 mediates immune responses toward polysaccharide or carbohydrate antigens. IgG3 mediates high-affinity responses against proteins and polypeptide antigens. IgG4 has a role in responses associated with food allergies, but its function is largely unknown.

    [0073] As used herein, the terms “Fc region” or “fragment crystallizable region” are used in accordance with their plain and ordinary meanings and refer to any of the recombinant or naturally-occurring forms of the tail-end region (C-terminal) of an antibody that interacts with a cell-surface receptors known as Fc-receptors. The Fc region is comprised of two heavy chain constant Ig domains in the antibodies IgG, IgA, and IgD, and of three heavy chain constant Ig domains in the antibodies IgE and IgM.

    [0074] As used herein, the terms “Fab region” or “antigen-binding fragment region” are used in accordance with their plain and ordinary meanings and refer to any of the recombinant or naturally-occurring forms of the tail-end region (N-terminal) of an antibody that contains the antigen recognition and binding site. The Fab region is generally comprised of one variable domain and one constant domain from both the light chain and the heavy chain in the antibodies IgG, IgA, IgD, and IgE, and IgM.

    [0075] As used herein, the term “hinge region” is used in accordance with its plain and ordinary meaning and refers to any of the recombinant or naturally-occurring forms of the region of an antibody corresponding to the polypeptide sequence that connects the Fab and Fc domains in an antibody, and/or the sequence connecting two single chain variable fragments (scFv) from the light and heavy chains at the N-terminal end of the antibody.

    [0076] As used herein, the terms “pepsin” or “pepsinogen A” are used in accordance with their plain and ordinary meanings and refer to any of the recombinant or naturally-occurring forms of the pepsin protein or variants or homologs thereof that maintain pepsin activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to pepsin). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring pepsin polypeptide. In embodiments, pepsin is the protein as identified by the NCBI sequence reference GI:387013, homolog or functional fragment thereof.

    [0077] As used herein, the terms “Cathepsin G” or “Cathepsin G protease” are used in accordance with their plain and ordinary meanings and refer to any of the recombinant or naturally-occurring forms of the Cathepsin G protein or variants or homologs thereof that maintain Cathepsin G activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to Cathepsin G). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring Cathepsin G polypeptide. In embodiments, Cathepsin G is the protein as identified by the NCBI sequence reference GI:4503149, homolog or functional fragment thereof.

    [0078] As used herein, the terms “MMP3” or “MMP3 protease” are used in accordance with their plain and ordinary meanings and refer to any of the recombinant or naturally-occurring forms of the matrix metalloproteinase 3 (MMP3) or variants or homologs thereof that maintain MMP3 activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to MMP3). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring MMP3 polypeptide. In embodiments, MMP3 is the protein as identified by the NCBI sequence reference GI:77567646, homolog or functional fragment thereof.

    [0079] As used herein, the terms “MMP7” or “MMP7 protease” are used in accordance with their plain and ordinary meanings and refer to any of the recombinant or naturally-occurring forms of the matrix metalloproteinase 7 (MMP7) or variants or homologs thereof that maintain MMP7 activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to MMP7). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring MMP7 polypeptide. In embodiments, MMP7 is the protein as identified by the NCBI sequence reference GI:116861, homolog or functional fragment thereof.

    [0080] As used herein, the terms “MMP12” or “MMP12 protease” are used in accordance with their plain and ordinary meanings and refer to any of the recombinant or naturally-occurring forms of the matrix metalloproteinase 9 (MMP12) or variants or homologs thereof that maintain MMP12 activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to MMP12). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring MMP12 polypeptide. In embodiments, MMP12 is the protein as identified by the NCBI sequence reference GI:73858572, homolog or functional fragment thereof.

    [0081] As used herein, the term “Type I transmembrane protein” is used in accordance with its plain and ordinary meaning and refers to any of the recombinant or naturally-occurring forms of a membrane protein containing a single-pass transmembrane region, where the N-terminus of the protein is located on the extracellular surface.

    [0082] As used herein, the terms “CHO cell” or “Chinese Hamster Ovary cell” are used in accordance with their plain and ordinary meanings and refer to any epithelial cell lines derived from the ovary of the Chinese hamster.

    [0083] As used herein, the term “Kabat numbering” or “Kabat position” is used in accordance with its plain and ordinary meaning and refers to a scheme for the numbering of amino acid residues in antibodies based upon variable regions. The scheme is useful when comparing these variable regions between antibodies. In embodiments, the L248 position of the anti-CD20 antibody rituximab correlates with L325 of the antibody sequence according to other numbering systems.

    [0084] As used herein, the terms “expression vector” or “expression construct” are used in accordance with their plain and ordinary meanings and refer to any of the recombinant or naturally-occurring forms of a bacterial plasmid, bacmid, or virus or variants or homologs thereof that are for the use of expressing a target gene of interest as a protein product. The target of interest can be any gene of interest, including genes that encode for naturally-occurring proteins, any partial or modified variants of naturally-occurring proteins, chimeric proteins, tagged proteins, or de novo designed protein sequences. The expression vector must contain the elements necessary for gene expression, including, but not limited to, a promoter sequence, a ribosome-binding sequence, a start codon, the target of interest sequence, and a stop codon. The expression vector can be modified by any genetic engineering process or technique, including, but not limited to, polymerase chain reaction (PCR), restriction enzyme digest and DNA ligation, Gibson cloning, and CRISPR-related gene editing.

    [0085] As used herein, the term “surface display” is used in accordance with its plain ordinary meaning and refers to a process where a cellular system is used to express a protein or peptide on the cellular surface. The cellular system can be prokaryotic, or eukaryotic, and can include bacteria, yeast, insect, and mammalian cells. The surface display is achieved by expressing the protein of interest as a fusion protein, which is usually comprised of a partial or full sequence from an endogenously-expressed protein in the cellular system of choice and the protein(s) of interest.

    [0086] As used herein, the term “cytotoxicity” is used in accordance with its plain ordinary meaning and refers to quality of being toxic to cells.

    [0087] As used herein, the terms “antibody-dependent cellular cytotoxicity”, “ADCC”, and “antibody-dependent cell-mediated cytotoxicity” are used in accordance with their plain ordinary meanings and refer to an immune mechanism through which Fc receptor-bearing effector cells can recognize and kill antibody-coated target cells expressing tumor- or pathogen-derived antigens on their surface.

    [0088] As used herein, the terms “antibody-dependent cellular phagocytosis” and “ADCP” are used in accordance with their plain ordinary meanings and refer to the mechanism by which antibody-opsonized target cells activate the Fc receptors on the surface of macrophages to induce phagocytosis, resulting the ingestion and degradation of the target cell. The macrophage Fc receptors refer to all classes of Fcγ receptors.

    [0089] As used herein, the terms “adaptive immune response”, “acquired immune system”, and “specific immune system” are used in accordance with their plain ordinary meanings and refer to a subsystem of the overall immune system that is composed of specialized, systemic cells and processes that eliminate designated targets. The targets are designated by identification via immunological memory. Immunological memory is created when the immune system had previously encountered the immune assault, and retained a record of it.

    [0090] As used herein, the term “dissociation constant” or “Kd” are used in accordance with their plain ordinary meanings and refer to a specific type of equilibrium constant that measures the propensity of two molecules to be associated with each other. In biochemistry, the dissociation constant is used to describe the relative affinity between a protein and a ligand, for example, an affinity of an antibody for an antigen. In general, the dissociation constant Kd can be described by the equation

    [00001] Kd = [ P ] [ L ] [ PL ]

    Where [P] is the molar concentration of protein, [L] is the molar concentration of ligand, and [PL] is the molar concentration of the protein-ligand complex.

    II. Antibodies

    [0091] In an aspect, provided herein are immunoglobulin G (IgG) antibodies including a Fab region and an Fc region connected through a hinge region, where the hinge region is resistant to cleavage by a protease.

    [0092] In embodiments, the IgG antibody is selected from an IgG1 antibody, an IgG2 antibody, an IgG3 antibody, and an IgG4 antibody. In embodiments, the IgG antibody is an IgG1 antibody. In embodiments, the IgG antibody is an IgG2 antibody. In embodiments, the IgG antibody is an IgG3 antibody. In embodiments, the IgG antibody is an IgG4 antibody.

    [0093] In embodiments, the hinge region is resistant to cleavage by a protease. In embodiments, resistance to cleavage by a protease means that a protease is unable to cleave the antibody at an amino acid sequence within the hinge region. In embodiments, resistance to cleavage by a protease is conferred by the amino acid sequence of the hinge region. In embodiments, resistance to cleavage by a protease is relative to a natural or wild type hinge region sequence. In embodiments, the natural or wild type hinge sequence is an amino acid sequencing including ELLGGPS (SEQ ID NO: 544). In embodiments, resistance to cleavage by a protease is relative to a known sequence control. In embodiments, the known sequence is an amino acid sequence including ELLGGPS (SEQ ID NO: 544), which is sensitive to cleavage by an IgG endopeptidase. In embodiments, human IgG2 hinge region comprising the amino acid sequence PVAGPS is resistant to IgG endopeptidase cleavage and may serve as a negative control. In embodiments, resistance to cleavage by a protease is above a certain threshold level using a specific known assay. In embodiments, the assay may be enzymatic digestion of IgG and SDS-PAGE and Coomassie staining to determine molecular weight of digested fragments.

    [0094] In embodiments, the hinge region includes a protease resistant sequence. In embodiments, the sequence is between amino acid positions 246-252 according to Kabat numbering. In embodiments, the sequence is positions corresponding to Kabat position 246-252. In embodiments, the protease resistant sequence is two or more amino acids in length. In embodiments, the protease resistant sequence is three amino acids in length. In embodiments, the protease resistant sequence is four amino acids in length. In embodiments, the protease resistant sequence is five amino acids in length. In embodiments, the protease resistant sequence is six amino acids in length. In embodiments, the protease resistant sequence is seven amino acids in length. In embodiments, the protease resistant sequence includes the amino acids of SEQ ID NO: 545. In embodiments, the protease resistant sequence includes the amino acids of SEQ ID NO: 546. In embodiments, the protease resistant sequence includes the amino acids of SEQ ID NO: 547.

    [0095] In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI). In embodiments, the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−12 M, about 1×10.sup.−5 M to about 1×10.sup.−11 M, about 1×10.sup.−5 M to about 1×10.sup.−10 M, about 1×10.sup.−5 M to about 1×10.sup.−9 M, about 1×10.sup.−5 M to about 1×10.sup.−8 M, about 1×10.sup.−5 M to about 1×10.sup.−7 M, about 1×10.sup.−5 M to about 1×10.sup.−6 M, about 1×10.sup.−6 M to about 1×10.sup.−13 M, about 1×10.sup.−6 M to about 1×10.sup.−12 M, about 1×10.sup.−6 M to about 1×10.sup.−11 M, about 1×10.sup.−6 M to about 1×10.sup.−10 M, about 1×10.sup.−6 M to about 1×10.sup.−9 M, about 1×10.sup.−6 M to about 1×10.sup.−8 M, about 1×10.sup.−6 M to about 1×10.sup.−7 M, about 1×10.sup.−7 M to about 1×10.sup.−13 M, about 1×10.sup.−7 M to about 1×10.sup.−12 M, about 1×10.sup.−7 M to about 1×10.sup.−11 M, about 1×10.sup.−7 M to about 1×10.sup.−10 M, about 1×10.sup.−7 M to about 1×10.sup.−9 M, about 1×10.sup.−7 M to about 1×10.sup.−8 M, about 1×10.sup.−8 M to about 1×10.sup.−13 M, about 1×10.sup.−8 M to about 1×10.sup.−12 M, about 1×10.sup.−8 M to about 1×10.sup.−11 M, about 1×10.sup.−8 M to about 1×10.sup.−10 M, about 1×10.sup.−8 M to about 1×10.sup.−9 M, about 1×10.sup.−9 M to about 1×10.sup.−13 M, about 1×10.sup.−9 M to about 1×10.sup.−12 M, about 1×10.sup.−9 M to about 1×10.sup.−11 M, about 1×10.sup.−9 M to about 1×10.sup.−10 M, about 1×10.sup.−10 M to about 1×10.sup.−13 M, about 1×10.sup.−10 M to about 1×10.sup.−12 M, about 1×10.sup.−10 M to about 1×10.sup.−11 M, about 1×10.sup.−11 M to about 1×10.sup.−13 M, about 1×10.sup.−11 M to about 1×10.sup.−12 M, or about 1×10.sup.−12 M to about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M, about 1×10.sup.−6 M, about 1×10.sup.−7 M, about 1×10.sup.−8 M, about 1×10.sup.−9 M, about 1×10.sup.−10 M, about 1×10.sup.−11 M, about 1×10.sup.−12 M, or about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

    [0096] In embodiments, the Fc region of the IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD32 (FcγRII). In embodiments, the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−12 M, about 1×10.sup.−5 M to about 1×10.sup.−11 M, about 1×10.sup.−5 M to about 1×10.sup.−10 M, about 1×10.sup.−5 M to about 1×10.sup.−9 M, about 1×10.sup.−5 M to about 1×10.sup.−8 M, about 1×10.sup.−5 M to about 1×10.sup.−7 M, about 1×10.sup.−5 M to about 1×10.sup.−6 M, about 1×10.sup.−6 M to about 1×10.sup.−13 M, about 1×10.sup.−6 M to about 1×10.sup.−12 M, about 1×10.sup.−6 M to about 1×10.sup.−11 M, about 1×10.sup.−6 M to about 1×10.sup.−10 M, about 1×10.sup.−6 M to about 1×10.sup.−9 M, about 1×10.sup.−6 M to about 1×10.sup.−8 M, about 1×10.sup.−6 M to about 1×10.sup.−7 M, about 1×10.sup.−7 M to about 1×10.sup.−13 M, about 1×10.sup.−7 M to about 1×10.sup.−12 M, about 1×10.sup.−7 M to about 1×10.sup.−11 M, about 1×10.sup.−7 M to about 1×10.sup.−10 M, about 1×10.sup.−7 M to about 1×10.sup.−9 M, about 1×10.sup.−7 M to about 1×10.sup.−8 M, about 1×10.sup.−8 M to about 1×10.sup.−13 M, about 1×10.sup.−8 M to about 1×10.sup.−12 M, about 1×10.sup.−8 M to about 1×10.sup.−11 M, about 1×10.sup.−8 M to about 1×10.sup.−10 M, about 1×10.sup.−8 M to about 1×10.sup.−9 M, about 1×10.sup.−9 M to about 1×10.sup.−13 M, about 1×10.sup.−9 M to about 1×10.sup.−12 M, about 1×10.sup.−9 M to about 1×10.sup.−11 M, about 1×10.sup.−9 M to about 1×10.sup.−10 M, about 1×10.sup.−10 M to about 1×10.sup.−13 M, about 1×10.sup.−10 M to about 1×10.sup.−12 M, about 1×10.sup.−10 M to about 1×10.sup.−11 M, about 1×10.sup.−11 M to about 1×10.sup.−13 M, about 1×10.sup.−11 M to about 1×10.sup.−12 M, or about 1×10.sup.−12 M to about 1×10.sup.−13 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M, about 1×10.sup.−6 M, about 1×10.sup.−7 M, about 1×10.sup.−8 M, about 1×10.sup.−9 M, about 1×10.sup.−10 M, about 1×10.sup.−11 M, about 1×10.sup.−12 M, or about 1×10.sup.−13 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−6 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−7 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−8 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−9 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−10 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−11 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−12 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−13 M to CD32 (FcγRII).

    [0097] In embodiments, the Fc region of the IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD16 (FcγRIII). In embodiments, the Fc region of the IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD16 (FcγRIII). In embodiments, the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−12 M, about 1×10.sup.−5 M to about 1×10.sup.−11 M, about 1×10.sup.−5 M to about 1×10.sup.−10 M, about 1×10.sup.−5 M to about 1×10.sup.−9 M, about 1×10.sup.−5 M to about 1×10.sup.−8 M, about 1×10.sup.−5 M to about 1×10.sup.−7 M, about 1×10.sup.−5 M to about 1×10.sup.−6 M, about 1×10.sup.−6 M to about 1×10.sup.−13 M, about 1×10.sup.−6 M to about 1×10.sup.−12 about 1×10.sup.−6 M to about 1×10.sup.−11 M, about 1×10.sup.−6 M to about 1×10.sup.−10 M, about 1×10.sup.−6 M to about 1×10.sup.−9 M, about 1×10.sup.−6 M to about 1×10.sup.−8 M, about 1×10.sup.−6 M to about 1×10.sup.−7 M, about 1×10.sup.−7 M to about 1×10.sup.−13 M, about 1×10.sup.−7 M to about 1×10.sup.−12 M, about 1×10.sup.−7 M to about 1×10.sup.−11 M, about 1×10.sup.−7 M to about 1×10.sup.−10 M, about 1×10.sup.−7 M to about 1×10.sup.−9 M, about 1×10.sup.−7 M to about 1×10.sup.−8 M, about 1×10.sup.−8 M to about 1×10.sup.−13 M, about 1×10.sup.−8 M to about 1×10.sup.−12 M, about 1×10.sup.−8 M to about 1×10.sup.−11 M, about 1×10.sup.−8 M to about 1×10.sup.−10 M, about 1×10.sup.−8 M to about 1×10.sup.−9 M, about 1×10.sup.−9 M to about 1×10.sup.−13 M, about 1×10.sup.−9 M to about 1×10.sup.−12 M, about 1×10.sup.−9 M to about 1×10.sup.−11 M, about 1×10.sup.−9 M to about 1×10.sup.−10 M, about 1×10.sup.−10 M to about 1×10.sup.−13 M, about 1×10.sup.−10 M to about 1×10.sup.−12 M, about 1×10.sup.−10 M to about 1×10.sup.−11 M, about 1×10.sup.−11 M to about 1×10.sup.−13 M, about 1×10.sup.−11 M to about 1×10.sup.−12 M, or about 1×10.sup.−12 M to about 1×10.sup.−13 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M, about 1×10.sup.−6 M, about 1×10.sup.−7 M, about 1×10.sup.−8 M, about 1×10.sup.−9 M, about 1×10.sup.−10 M, about 1×10.sup.−11 M, about 1×10.sup.−12 M, or about 1×10.sup.−13 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−6 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−7 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−8 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−9 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−10 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−11 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−12 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−13 M to CD16 (FcγRIII).

    [0098] In embodiments, the Fc region of the IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD64 (FcγRI). In embodiments, the Fc region of the IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD64 (FcγRI). In embodiments, the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−12 M, about 1×10.sup.−5 M to about 1×10.sup.−11 M, about 1×10.sup.−5 M to about 1×10.sup.−10 M, about 1×10.sup.−5 M to about 1×10.sup.−9 M, about 1×10.sup.−5 M to about 1×10.sup.−8 M, about 1×10.sup.−5 M to about 1×10.sup.−7 M, about 1×10.sup.−5 M to about 1×10.sup.−6 M, about 1×10.sup.−6 M to about 1×10.sup.−13 M, about 1×10.sup.−6 M to about 1×10.sup.−12 M, about 1×10.sup.−6 M to about 1×10.sup.−11 M, about 1×10.sup.−6 M to about 1×10.sup.−10 M, about 1×10.sup.−6 M to about 1×10.sup.−9 M, about 1×10.sup.−6 M to about 1×10.sup.−8 M, about 1×10.sup.−6 M to about 1×10.sup.−7 M, about 1×10.sup.−7 M to about 1×10.sup.−13 M, about 1×10.sup.−7 M to about 1×10.sup.−12 M, about 1×10.sup.−7 M to about 1×10.sup.−11 M, about 1×10.sup.−7 M to about 1×10.sup.−10 M, about 1×10.sup.−7 M to about 1×10.sup.−9 M, about 1×10.sup.−7 M to about 1×10.sup.−8 M, about 1×10.sup.−8 M to about 1×10.sup.−13 M, about 1×10.sup.−8 M to about 1×10.sup.−12 M, about 1×10.sup.−8 M to about 1×10.sup.−11 M, about 1×10.sup.−8 M to about 1×10.sup.−10 M, about 1×10.sup.−8 M to about 1×10.sup.−9 M, about 1×10.sup.−9 M to about 1×10.sup.−13 M, about 1×10.sup.−9 M to about 1×10.sup.−12 M, about 1×10.sup.−9 M to about 1×10.sup.−11 M, about 1×10.sup.−9 M to about 1×10.sup.−10 M, about 1×10.sup.−10 M to about 1×10.sup.−13 M, about 1×10.sup.−10 M to about 1×10.sup.−12 M, about 1×10.sup.−10 M to about 1×10.sup.−11 M, about 1×10.sup.−11 M to about 1×10.sup.−13 M, about 1×10.sup.−11 M to about 1×10.sup.−12 M, or about 1×10.sup.−12 M to about 1×10.sup.−13 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M, about 1×10.sup.−6 M, about 1×10.sup.−7 M, about 1×10.sup.−8 M, about 1×10.sup.−9 M, about 1×10.sup.−10 M, about 1×10.sup.−11 M, about 1×10.sup.−12 M, or about 1×10.sup.−13 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M to CD64 (FcγRI) In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−6 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−7 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−8 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−9 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−10 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−11 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−12 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−13 M to CD64 (FcγRI).

    [0099] In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by a protease. In embodiments, the protease is an IgG specific protease. In embodiments, the protease is an IgG endopeptidase. In embodiments, the IgG endopeptidase is selected from IdeS and IdeZ. In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by IdeS protease. In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by IdeZ protease.

    [0100] In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by a protease specific for an ELLGGPS (SEQ ID NO: 544) amino acid sequence. In embodiments, the ELLGGPS amino acid sequence specific protease, includes but is not limited to, pepsin, matrix metalloproteinase 7 (MMP7), matrix metalloproteinase 3 (MMP3), matrix metalloproteinase (MMP12), cathepsin G, and glutamyl endopeptidase V8 (GluV8). In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by pepsin. In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by matrix metalloproteinase 7 (MMP7). In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by matrix metalloproteinase 3 (MMP3). In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by matrix metalloproteinase (MMP12). In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by cathepsin G. In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by glutamyl endopeptidase V8 (GluV8).

    [0101] In an aspect, provided herein are immunoglobulin G (IgG) antibodies, including a Fab region and an Fc region connected through a hinge region, where the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

    [0102] In embodiments, the IgG antibody is selected from an IgG1 antibody, an IgG2 antibody, an IgG3 antibody, and an IgG4 antibody. In embodiments, the IgG antibody is an IgG1 antibody. In embodiments, the IgG antibody is an IgG2 antibody. In embodiments, the IgG antibody is an IgG3 antibody. In embodiments, the IgG antibody is an IgG4 antibody.

    [0103] In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI). In embodiments, the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−12 M, about 1×10.sup.−5 M to about 1×10.sup.−11 M, about 1×10.sup.−5 M to about 1×10.sup.−10 M, about 1×10.sup.−5 M to about 1×10.sup.−9 M, about 1×10.sup.−5 M to about 1×10.sup.−8 M, about 1×10.sup.−5 M to about 1×10.sup.−7 M, about 1×10.sup.−5 M to about 1×10.sup.−6 M, about 1×10.sup.−6 M to about 1×10.sup.−13 M, about 1×10.sup.−6 M to about 1×10.sup.−12 M, about 1×10.sup.−6 M to about 1×10.sup.−11 M, about 1×10.sup.−6 M to about 1×10.sup.−10 M, about 1×10.sup.−6 M to about 1×10.sup.−9 M, about 1×10.sup.−6 M to about 1×10.sup.−8 M, about 1×10.sup.−6 M to about 1×10.sup.−7 M, about 1×10.sup.−7 M to about 1×10.sup.−13 M, about 1×10.sup.−7 M to about 1×10.sup.−12 M, about 1×10.sup.−7 M to about 1×10.sup.−11 M, about 1×10.sup.−7 M to about 1×10.sup.−10 M, about 1×10.sup.−7 M to about 1×10.sup.−9 M, about 1×10.sup.−7 M to about 1×10.sup.−8 M, about 1×10.sup.−8 M to about 1×10.sup.−13 M, about 1×10.sup.−8 M to about 1×10.sup.−12 M, about 1×10.sup.−8 M to about 1×10.sup.−11 M, about 1×10.sup.−8 M to about 1×10.sup.−10 M, about 1×10.sup.−8 M to about 1×10.sup.−9 M, about 1×10.sup.−9 M to about 1×10.sup.−13 M, about 1×10.sup.−9 M to about 1×10.sup.−12 M, about 1×10.sup.−9 M to about 1×10.sup.−11 M, about 1×10.sup.−9 M to about 1×10.sup.−10 M, about 1×10.sup.−10 M to about 1×10.sup.−13 M, about 1×10.sup.−10 M to about 1×10.sup.−12 M, about 1×10.sup.−10 M to about 1×10.sup.−11 M, about 1×10.sup.−11 M to about 1×10.sup.−13 M, about 1×10.sup.−11 M to about 1×10.sup.−12 M, or about 1×10.sup.−12 M to about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M, about 1×10.sup.−6 M, about 1×10.sup.−7 M, about 1×10.sup.−8 M, about 1×10.sup.−9 M, about 1×10.sup.−10 M, about 1×10.sup.−11 M, about 1×10.sup.−12 M, or about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

    [0104] In embodiments, the Fc region of the IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD32 (FcγRII). In embodiments, the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−12 M, about 1×10.sup.−5 M to about 1×10.sup.−11 M, about 1×10.sup.−5 M to about 1×10.sup.−10 M, about 1×10.sup.−5 M to about 1×10.sup.−9 M, about 1×10.sup.−5 M to about 1×10.sup.−8 M, about 1×10.sup.−5 M to about 1×10.sup.−7 M, about 1×10.sup.−5 M to about 1×10.sup.−6 M, about 1×10.sup.−6 M to about 1×10.sup.−13 M, about 1×10.sup.−6 M to about 1×10.sup.−12 M, about 1×10.sup.−6 M to about 1×10.sup.−11 M, about 1×10.sup.−6 M to about 1×10.sup.−10 M, about 1×10.sup.−6 M to about 1×10.sup.−9 M, about 1×10.sup.−6 M to about 1×10.sup.−8 M, about 1×10.sup.−6 M to about 1×10.sup.−7 M, about 1×10.sup.−7 M to about 1×10.sup.−13 M, about 1×10.sup.−7 M to about 1×10.sup.−12 M, about 1×10.sup.−7 M to about 1×10.sup.−11 M, about 1×10.sup.−7 M to about 1×10.sup.−10 M, about 1×10.sup.−7 M to about 1×10.sup.−9 M, about 1×10.sup.−7 M to about 1×10.sup.−8 M, about 1×10.sup.−8 M to about 1×10.sup.−13 M, about 1×10.sup.−8 M to about 1×10.sup.−12 M, about 1×10.sup.−8 M to about 1×10.sup.−11 M, about 1×10.sup.−8 M to about 1×10.sup.−10 M, about 1×10.sup.−8 M to about 1×10.sup.−9 M, about 1×10.sup.−9 M to about 1×10.sup.−13 M, about 1×10.sup.−9 M to about 1×10.sup.−12 M, about 1×10.sup.−9 M to about 1×10.sup.−11 M, about 1×10.sup.−9 M to about 1×10.sup.−10 M, about 1×10.sup.−10 M to about 1×10.sup.−13 M, about 1×10.sup.−10 M to about 1×10.sup.−12 M, about 1×10.sup.−10 M to about 1×10.sup.−11 M, about 1×10.sup.−11 M to about 1×10.sup.−13 M, about 1×10.sup.−11 M to about 1×10.sup.−12 M, or about 1×10.sup.−12 M to about 1×10.sup.−13 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M, about 1×10.sup.−6 M, about 1×10.sup.−7 M, about 1×10.sup.−8 M, about 1×10.sup.−9 M, about 1×10.sup.−10 M, about 1×10.sup.−11 M, about 1×10.sup.−12 M, or about 1×10.sup.−13 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−6 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−7 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−8 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−9 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−10 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−11 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−12 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−13 M to CD32 (FcγRII).

    [0105] In embodiments, the Fc region of the IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD16 (FcγRIII). In embodiments, the Fc region of the IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD16 (FcγRIII). In embodiments, the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−12 M, about 1×10.sup.−5 M to about 1×10.sup.−11 M, about 1×10.sup.−5 M to about 1×10.sup.−10 M, about 1×10.sup.−5 M to about 1×10.sup.−9 M, about 1×10.sup.−5 M to about 1×10.sup.−8 M, about 1×10.sup.−5 M to about 1×10.sup.−7 M, about 1×10.sup.−5 M to about 1×10.sup.−6 M, about 1×10.sup.−6 M to about 1×10.sup.−13 M, about 1×10.sup.−6 M to about 1×10.sup.−12 M, about 1×10.sup.−6 M to about 1×10.sup.−11 M, about 1×10.sup.−6 M to about 1×10.sup.−10 M, about 1×10.sup.−6 M to about 1×10.sup.−9 M, about 1×10.sup.−6 M to about 1×10.sup.−8 M, about 1×10.sup.−6 M to about 1×10.sup.−7 M, about 1×10.sup.−7 M to about 1×10.sup.−13 M, about 1×10.sup.−7 M to about 1×10.sup.−12 M, about 1×10.sup.−7 M to about 1×10.sup.−11 M, about 1×10.sup.−7 M to about 1×10.sup.−10 M, about 1×10.sup.−7 M to about 1×10.sup.−9 M, about 1×10.sup.−7 M to about 1×10.sup.−8 M, about 1×10.sup.−8 M to about 1×10.sup.−13 M, about 1×10.sup.−8 M to about 1×10.sup.−12 M, about 1×10.sup.−8 M to about 1×10.sup.−11 M, about 1×10.sup.−8 M to about 1×10.sup.−10 M, about 1×10.sup.−8 M to about 1×10.sup.−9 M, about 1×10.sup.−9 M to about 1×10.sup.−13 M, about 1×10.sup.−9 M to about 1×10.sup.−12 M, about 1×10.sup.−9 M to about 1×10.sup.−11 M, about 1×10.sup.−9 M to about 1×10.sup.−10 M, about 1×10.sup.−10 M to about 1×10.sup.−13 M, about 1×10.sup.−10 M to about 1×10.sup.−12 M, about 1×10.sup.−10 M to about 1×10.sup.−11 M, about 1×10.sup.−11 M to about 1×10.sup.−13 M, about 1×10.sup.−11 M to about 1×10.sup.−12 M, or about 1×10.sup.−12 M to about 1×10.sup.−13 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M, about 1×10.sup.−6 M, about 1×10.sup.−7 M, about 1×10.sup.−8 M, about 1×10.sup.−9 M, about 1×10.sup.−10 M, about 1×10.sup.−11 M, about 1×10.sup.−12 M, or about 1×10.sup.−13 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−6 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−7 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−8 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−9 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−10 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−11 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−12 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−13 M to CD16 (FcγRIII).

    [0106] In embodiments, the Fc region of the IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD64 (FcγRI). In embodiments, the Fc region of the IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD64 (FcγRI). In embodiments, the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−12 M, about 1×10.sup.−5 M to about 1×10.sup.−11 M, about 1×10.sup.−5 M to about 1×10.sup.−10 M, about 1×10.sup.−5 M to about 1×10.sup.−9 M, about 1×10.sup.−5 M to about 1×10.sup.−8 M, about 1×10.sup.−5 M to about 1×10.sup.−7 M, about 1×10.sup.−5 M to about 1×10.sup.−6 M, about 1×10.sup.−6 M to about 1×10.sup.−13 M, about 1×10.sup.−6 M to about 1×10.sup.−12 M, about 1×10.sup.−6 M to about 1×10.sup.−11 M , about 1×10.sup.−6 M to about 1×10.sup.−10 M, about 1×10.sup.−6 M to about 1×10.sup.−9 M, about 1×10.sup.−6 M to about 1×10.sup.−8 M, about 1×10.sup.−6 M to about 1×10.sup.−7 M, about 1×10.sup.−7 M to about 1×10.sup.−13 M, about 1×10.sup.−7 M to about 1×10.sup.−12 M, about 1×10.sup.−7 M to about 1×10.sup.−11 M, about 1×10.sup.−7 M to about 1×10.sup.−10 M, about 1×10.sup.−7 M to about 1×10.sup.−9 M, about 1×10.sup.−7 M to about 1×10.sup.−8 M, about 1×10.sup.−8 M to about 1×10.sup.−13 M, about 1×10.sup.−8 M to about 1×10.sup.−12 M, about 1×10.sup.−8 M to about 1×10.sup.−11 M, about 1×10.sup.−8 M to about 1×10.sup.−10 M, about 1×10.sup.−8 M to about 1×10.sup.−9 M, about 1×10.sup.−9 M to about 1×10.sup.−13 M, about 1×10.sup.−9 M to about 1×10.sup.−12 M, about 1×10.sup.−9 M to about 1×10.sup.−11 M, about 1×10.sup.−9 M to about 1×10.sup.−10 M, about 1×10.sup.−10 M to about 1×10.sup.−13 M, about 1×10.sup.−10 M to about 1×10.sup.−12 M, about 1×10.sup.−10 M to about 1×10.sup.−11 M, about 1×10.sup.−11 M to about 1×10.sup.−13 M, about 1×10.sup.−11 M to about 1×10.sup.−12 M, or about 1×10.sup.−12 M to about 1×10.sup.−13 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M, about 1×10.sup.−6 M, about 1×10.sup.−7 M, about 1×10.sup.−8 M, about 1×10.sup.−9 M, about 1×10.sup.−10 M, about 1×10.sup.−11 M, about 1×10.sup.−12 M, or about 1×10.sup.−13 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M to CD64 (FcγRI) In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−6 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−7 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−8 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−9 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−10 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−11 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−12 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−13 M to CD64 (FcγRI).

    [0107] In embodiments, the Fc region includes one or more amino acid substitutions conferring higher binding affinity for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) compared to a wild type Fc. In embodiments, the Fc region includes one or more amino acid substitutions conferring higher binding affinity for CD32 (FcγRII) compared to a wild type Fc. In embodiments, the Fc region includes one or more amino acid substitutions conferring higher binding affinity for CD16 (FcγRIII) compared to a wild type Fc. In embodiments, the Fc region includes one or more amino acid substitutions conferring higher binding affinity for CD64 (FcγRI) compared to a wild type Fc.

    [0108] In embodiments, the Fc region includes one or more amino acid substitutions that confers higher binding affinity for CD16 (FcγRIII) compared to wild type and is selected from S252D, I351E, and A349L according to Kabat numbering. In embodiments, the Fc region includes a S252D amino acid substitution. In embodiments, the Fc region includes an I351E amino acid substitution. In embodiments, the Fc region includes an A349L amino acid substitution. In embodiments, the Fc region includes S252D and I351E amino acid substitutions. In embodiments, the Fc region includes S252D, I351E, and A349L amino acid substitutions.

    [0109] In embodiments, the Fc region of the IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD32 (FcγRII). In an embodiments, the Fc region of the IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD16 (FcγRIII). In an embodiments, the Fc region of the IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD64 (FcγRI).

    [0110] In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by a protease. In embodiments, the protease is an IgG specific protease. In embodiments, the IgG specific protease is selected from IdeS and IdeZ. In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by IdeS protease. In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by IdeZ protease.

    [0111] In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by a protease specific for an ELLGGPS amino acid sequence (SEQ ID NO: 544). In embodiments, the ELLGGPS amino acid sequence specific protease, includes but is not limited to, pepsin, matrix metalloproteinase 7 (MMP7), matrix metalloproteinase 3 (MMP3), matrix metalloproteinase (MMP12), cathepsin G, and glutamyl endopeptidase V8 (GluV8). In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by pepsin. In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by matrix metalloproteinase 7 (MMP7). In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by matrix metalloproteinase 3 (MMP3). In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by matrix metalloproteinase (MMP12). In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by cathepsin G. In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by glutamyl endopeptidase V8 (GluV8).

    [0112] In embodiments, the hinge region includes a protease resistant sequence. In embodiments, the sequence is between amino acid positions 246-252 according to Kabat numbering. In embodiments, the sequence is between positions corresponding to Kabat position 246-252. In embodiments, the protease resistant sequence is two or more amino acids in length. In embodiments, the protease resistant sequence is three amino acids in length. In embodiments, the protease resistant sequence is four amino acids in length. In embodiments, the protease resistant sequence is five amino acids in length. In embodiments, the protease resistant sequence is six amino acids in length. In embodiments, the protease resistant sequence is seven amino acids in length. In embodiments, the protease resistant sequence includes the amino acids of SEQ ID NO: 545. In embodiments, the protease resistant sequence includes the amino acids of SEQ ID NO: 546. In embodiments, the protease resistant sequence includes the amino acids of SEQ ID NO: 547.

    III. Recombinant Proteins

    [0113] In an aspect, provided herein are recombinant proteins including a Type I transmembrane domain, an immunoglobulin G (IgG) antibody, wherein the transmembrane domain is fused to the C-terminus of the IgG antibody, where the recombinant protein is resistant to cleavage by a protease.

    [0114] In embodiments, the Type I transmembrane domain is capable of dimerization. In embodiments, the Type I transmembrane domain is selected from an EGFR, PDGFR-alpha, PDGFR-beta, HER2, HER3, HER4, FGFR1, FGFR2, FGFR3, FGFR4, VEGFR1, VEGFR2, VEGFR3, Trk-A, Trk-B, Trk-C, and insulin receptor transmembrane domain. In embodiments, the Type I transmembrane domain is an EGFR transmembrane domain. In embodiments, the Type I transmembrane domain is a PDGFR-alpha transmembrane domain. In embodiments, the Type I transmembrane domain is a PDGFR-beta transmembrane domain. In embodiments, the Type I transmembrane domain is an HER2 transmembrane domain. In embodiments, the Type I transmembrane domain is an HER3 transmembrane domain. In embodiments, the Type I transmembrane domain is an HER4 transmembrane domain. In embodiments, the Type I transmembrane domain is an FGFR1 transmembrane domain. In embodiments, the Type I transmembrane domain is an FGFR2 transmembrane domain. In embodiments, the Type I transmembrane domain is an FGFR3 transmembrane domain. In embodiments, the Type I transmembrane domain is an FGFR4 transmembrane domain. In embodiments, the Type I transmembrane domain is a VEGFR1 transmembrane domain. In embodiments, the Type I transmembrane domain is a VEGFR2 transmembrane domain. In embodiments, the Type I transmembrane domain is a VEGFR3 transmembrane domain. In embodiments, the Type I transmembrane domain is a Trk-A transmembrane domain. In embodiments, the Type I transmembrane domain is a Trk-B transmembrane domain. In embodiments, the Type I transmembrane domain is a Trk-C transmembrane domain. In embodiments, the Type I transmembrane domain is an insulin receptor transmembrane domain.

    [0115] In embodiments, the recombinant protein includes an IgG antibody selected from IgG1, IgG2, IgG3, and IgG4. In embodiments, the IgG antibody is IgG1 antibody. In embodiments, the IgG antibody is IgG2 antibody. In embodiments, the IgG antibody is IgG3 antibody. In embodiments, the IgG antibody is IgG4 antibody.

    [0116] In embodiments of the recombinant proteins provided herein, the IgG antibody includes an Fc (fragment crystallizable) region, a Fab (antigen-binding fragment) region, and a hinge region. In embodiments, the IgG antibody includes an Fc (fragment crystallizable) region. In embodiments, the IgG antibody includes a Fab (garment crystallizable) region. In embodiments, the IgG antibody includes an Fc (antigen-binding fragment) region. In embodiments, the recombinant protein wherein the IgG antibody includes a hinge region.

    [0117] In embodiments of the recombinant proteins provided herein, the hinge region includes a protease resistant sequence. In embodiments, the sequence is between amino acid positions 246-252 according to Kabat numbering. In embodiments, the sequence is between positions corresponding to Kabat positions 246-252. In embodiments, the protease resistant sequence is two or more amino acids in length. In embodiments, the protease resistant sequence is three amino acids in length. In embodiments, the protease resistant sequence is four amino acids in length. In embodiments, the protease resistant sequence is five amino acids in length. In embodiments, the protease resistant sequence is six amino acids in length. In embodiments, the protease resistant sequence is seven amino acids in length. In embodiments, the protease resistant sequence includes the amino acids of SEQ ID NO: 546. In embodiments, the protease resistant sequence includes the amino acids of SEQ ID NO: 545. In embodiments, the protease resistant sequence includes the amino acids of SEQ ID NO: 547.

    [0118] In embodiments of the recombinant proteins provided herein, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI). In embodiments, the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−12 M, about 1×10.sup.−5 M to about 1×10.sup.−11 M, about 1×10.sup.−5 M to about 1×10.sup.−10 M, about 1×10.sup.−5 M to about 1×10.sup.−9 M, about 1×10.sup.−5 M to about 1×10.sup.−8 M, about 1×10.sup.−5 M to about 1×10.sup.−7 M, about 1×10.sup.−5 M to about 1×10.sup.−6 M, about 1×10.sup.−6 M to about 1×10.sup.−13 M, about 1×10.sup.−6 M to about 1×10.sup.−12 M, about 1×10.sup.−6 M to about 1×10.sup.−11 M, about 1×10.sup.−6 M to about 1×10.sup.−10 M, about 1×10.sup.−6 M to about 1×10.sup.−9 M, about 1×10.sup.−6 M to about 1×10.sup.−8 M, about 1×10.sup.−6 M to about 1×10.sup.−7 M, about 1×10.sup.−7 M to about 1×10.sup.−13 M, about 1×10.sup.−7 M to about 1×10.sup.−12 M, about 1×10.sup.−7 M to about 1×10.sup.−11 M, about 1×10.sup.−7 M to about 1×10.sup.−10 M, about 1×10.sup.−7 M to about 1×10.sup.−9 M, about 1×10.sup.−7 M to about 1×10.sup.−8 M, about 1×10.sup.−8 M to about 1×10.sup.−13 M, about 1×10.sup.−8 M to about 1×10.sup.−12 M, about 1×10.sup.−8 M to about 1×10.sup.−11 M, about 1×10.sup.−8 M to about 1×10.sup.−10 M, about 1×10.sup.−8 M to about 1×10.sup.−9 M, about 1×10.sup.−9 M to about 1×10.sup.−13 M, about 1×10.sup.−9 M to about 1×10.sup.−12 M, about 1×10.sup.−9 M to about 1×10.sup.−11 M, about 1×10.sup.−9 M to about 1×10.sup.−10 M, about 1×10.sup.−10 M to about 1×10.sup.−13 M, about 1×10.sup.−10 M to about 1×10.sup.−12 M, about 1×10.sup.−10 M to about 1×10.sup.−11 M, about 1×10.sup.−11 M to about 1×10.sup.−13 M, about 1×10.sup.−11 M to about 1×10.sup.−12 M, or about 1×10.sup.−12 M to about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M, about 1×10.sup.−6 M, about 1×10.sup.−7 M, about 1×10.sup.−8 M, about 1×10.sup.−9 M, about 1×10.sup.−10 M, about 1×10.sup.−11 M, about 1×10.sup.−12 M, or about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

    [0119] In embodiments of the recombinant proteins provided herein, the Fc region of the IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD32 (FcγRII). In embodiments, the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−12 M, about 1×10.sup.−5 M to about 1×10.sup.−11 M, about 1×10.sup.−5 M to about 1×10.sup.−10 M, about 1×10.sup.−5 M to about 1×10.sup.−9 M, about 1×10.sup.−5 M to about 1×10.sup.−8 M, about 1×10.sup.−5 M to about 1×10.sup.−7 M, about 1×10.sup.−5 M to about 1×10.sup.−6 M, about 1×10.sup.−6 M to about 1×10.sup.−13 M, about 1×10.sup.−6 M to about 1×10.sup.−12 M, about 1×10.sup.−6 M to about 1×10.sup.−11 M, about 1×10.sup.−6 M to about 1×10.sup.−10 M, about 1×10.sup.−6 M to about 1×10.sup.−9 M, about 1×10.sup.−6 M to about 1×10.sup.−8 M, about 1×10.sup.−6 M to about 1×10.sup.−7 M, about 1×10.sup.−7 M to about 1×10.sup.−13 M, about 1×10.sup.−7 M to about 1×10.sup.−12 M, about 1×10.sup.−7 M to about 1×10.sup.−11 M, about 1×10.sup.−7 M to about 1×10.sup.−10 M, about 1×10.sup.−7 M to about 1×10.sup.−9 M, about 1×10.sup.−7 M to about 1×10.sup.−8 M, about 1×10.sup.−8 M to about 1×10.sup.−13 M, about 1×10.sup.−8 M to about 1×10.sup.−12 M, about 1×10.sup.−8 M to about 1×10.sup.−11 M, about 1×10.sup.−8 M to about 1×10.sup.−10 M, about 1×10.sup.−8 M to about 1×10.sup.−9 M, about 1×10.sup.−9 M to about 1×10.sup.−13 M, about 1×10.sup.−9 M to about 1×10.sup.−12 M, about 1×10.sup.−9 M to about 1×10.sup.−11 M, about 1×10.sup.−9 M to about 1×10.sup.−10 M, about 1×10.sup.−10 M to about 1×10.sup.−13 M, about 1×10.sup.−10 M to about 1×10.sup.−12 M, about 1×10.sup.−10 M to about 1×10.sup.−11 M, about 1×10.sup.−11 M to about 1×10.sup.−13 M, about 1×10.sup.−11 M to about 1×10.sup.−12 M, or about 1×10.sup.−12 M to about 1×10.sup.−13 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M, about 1×10.sup.−6 M, about 1×10.sup.−7 M, about 1×10.sup.−8 M, about 1×10.sup.−9 M, about 1×10.sup.−10 M, about 1×10.sup.−11 M, about 1×10.sup.−12 M, or about 1×10.sup.−13 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−6 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−7 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−8 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−9 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−10 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−11 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−12 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of out 1×10.sup.−13 M to CD32 (FcγRII).

    [0120] In embodiments of the recombinant proteins provided herein, the Fc region of the IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD16 (FcγRIII). In embodiments, the Fc region of the IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD16 (FcγRIII). In embodiments, the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−12 M, about 1×10.sup.−5 M to about 1×10.sup.−11 M, about 1×10.sup.−5 M to about 1×10.sup.−10 M, about 1×10.sup.−5 M to about 1×10.sup.−9 M, about 1×10.sup.−5 M to about 1×10.sup.−8 M, about 1×10.sup.−5 M to about 1×10.sup.−7 M, about 1×10.sup.−5 M to about 1×10.sup.−6 M, about 1×10.sup.−6 M to about 1×10.sup.−13 M, about 1×10.sup.−6 M to about 1×10.sup.−12 M, about 1×10.sup.−6 M to about 1×10.sup.−11 M, about 1×10.sup.−6 M to about 1×10.sup.−10 M, about 1×10.sup.−6 M to about 1×10.sup.−9 M, about 1×10.sup.−6 M to about 1×10.sup.−8 M, about 1×10.sup.−6 M to about 1×10.sup.−7 M, about 1×10.sup.−7 M to about 1×10.sup.−13 M, about 1×10.sup.−7 M to about 1×10.sup.−12 M, about 1×10.sup.−7 M to about 1×10.sup.−11 M, about 1×10.sup.−7 M to about 1×10.sup.−10 M, about 1×10.sup.−7 M to about 1×10.sup.−9 M, about 1×10.sup.−7 M to about 1×10.sup.−8 M, about 1×10.sup.−8 M to about 1×10.sup.−13 M, about 1×10.sup.−8 M to about 1×10.sup.−12 M, about 1×10.sup.−8 M to about 1×10.sup.−11 M, about 1×10.sup.−8 M to about 1×10.sup.−10 M, about 1×10.sup.−8 M to about 1×10.sup.−9 M, about 1×10.sup.−9 M to about 1×10.sup.−13 M, about 1×10.sup.−9 M to about 1×10.sup.−12 M, about 1×10.sup.−9 M to about 1×10.sup.−11 M, about 1×10.sup.−9 M to about 1×10.sup.−10 M, about 1×10.sup.−10 M to about 1×10.sup.−13 M, about 1×10.sup.−10 M to about 1×10.sup.−12 M, about 1×10.sup.−10 M to about 1×10.sup.−11 M, about 1×10.sup.−11 M to about 1×10.sup.−13 M, about 1×10.sup.−11 M to about 1×10.sup.−12 M, or about 1×10.sup.−12 M to about 1×10.sup.−13 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M, about 1×10.sup.−6 M, about 1×10.sup.−7 M, about 1×10.sup.−8 M, about 1×10.sup.−9 M, about 1×10.sup.−10 M, about 1×10.sup.−11 M, about 1×10.sup.−12 M, or about 1×10.sup.−13 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−6 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−7 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−8 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−9 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−10 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−11 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−12 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−13 M to CD16 (FcγRIII).

    [0121] In embodiments of the recombinant proteins provided herein, the Fc region of the IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD64 (FcγRI). In embodiments, the Fc region of the IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD64 (FcγRI). In embodiments, the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−12 M, about 1×10.sup.−5 M to about 1×10.sup.−11 M, about 1×10.sup.−5 M to about 1×10.sup.−10 M, about 1×10.sup.−5 M to about 1×10.sup.−9 M, about 1×10.sup.−5 M to about 1×10.sup.−8 M, about 1×10.sup.−5 M to about 1×10.sup.−7 M, about 1×10.sup.−5 M to about 1×10.sup.−6 M, about 1×10.sup.−6 M to about 1×10.sup.−13 M, about 1×10.sup.−6 M to about 1×10.sup.−12 M, about 1×10.sup.−6 M to about 1×10.sup.−11 M, about 1×10.sup.−6 M to about 1×10.sup.−10 M, about 1×10.sup.−6 M to about 1×10.sup.−9 M, about 1×10.sup.−6 M to about 1×10.sup.−8 M, about 1×10.sup.−6 M to about 1×10.sup.−7 M, about 1×10.sup.−7 M to about 1×10.sup.−13 M, about 1×10.sup.−7 M to about 1×10.sup.−12 M, about 1×10.sup.−7 M to about 1×10.sup.−11 M, about 1×10.sup.−7 M to about 1×10.sup.−10 M, about 1×10.sup.−7 M to about 1×10.sup.−9 M, about 1×10.sup.−7 M to about 1×10.sup.−8 M, about 1×10.sup.−8 M to about 1×10.sup.−13 M, about 1×10.sup.−8 M to about 1×10.sup.−12 M, about 1×10.sup.−8 M to about 1×10.sup.−11 M, about 1×10.sup.−8 M to about 1×10.sup.−10 M, about 1×10.sup.−8 M to about 1×10.sup.−9 M, about 1×10.sup.−9 M to about 1×10.sup.−13 M, about 1×10.sup.−9 M to about 1×10.sup.−12 M, about 1×10.sup.−9 M to about 1×10.sup.−11 M, about 1×10.sup.−9 M to about 1×10.sup.−10 M, about 1×10.sup.−10 M to about 1×10.sup.−13 M, about 1×10.sup.−10 M to about 1×10.sup.−12 M, about 1×10.sup.−10 M to about 1×10.sup.−11 M, about 1×10.sup.−11 M to about 1×10.sup.−13 M, about 1×10.sup.−11 M to about 1×10.sup.−12 M, or about 1×10.sup.−12 M to about 1×10.sup.−13 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M, about 1×10.sup.−6 M, about 1×10.sup.−7 M, about 1×10.sup.−8 M, about 1×10.sup.−9 M, about 1×10.sup.−10 M, about 1×10.sup.−11 M, about 1×10.sup.−12 M, or about 1×10.sup.−13 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M to CD64 (FcγRI) In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−6 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−7 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−8 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−9 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−10 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−11 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−12 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−13 M to CD64 (FcγRI).

    [0122] In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by a protease. In embodiments, the protease is an IgG specific protease. In embodiments, the IgG specific protease is selected from IdeS and IdeZ. In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by IdeS protease. In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by IdeZ protease.

    [0123] In embodiments of the recombinant proteins provided herein, the IgG antibody includes a protease resistant sequence resistant to cleavage by a protease specific for an ELLGGPS amino acid sequence (SEQ ID NO: 544). In embodiments, the ELLGGPS amino acid sequence specific protease, includes but is not limited to, pepsin, matrix metalloproteinase 7 (MMP7), matrix metalloproteinase 3 (MMP3), matrix metalloproteinase (MMP12), cathepsin G, and glutamyl endopeptidase V8 (GluV8). In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by pepsin. In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by matrix metalloproteinase 7 (MMP7). In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by matrix metalloproteinase 3 (MMP3). In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by matrix metalloproteinase (MMP12). In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by cathepsin G. In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by glutamyl endopeptidase V8 (GluV8).

    [0124] In an aspect, provided herein are recombinant proteins including a Type I transmembrane domain, an immunoglobulin G (IgG) antibody, where the transmembrane domain is fused to the C-terminus of the IgG antibody and where the recombinant protein includes an Fc region with a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

    [0125] In embodiments, the Type I transmembrane domain is capable of dimerization. In embodiments, the Type I transmembrane domain is selected from an EGFR, PDGFR-alpha, PDGFR-beta, HER2, HER3, HER4, FGFR1, FGFR2, FGFR3, FGFR4, VEGFR1, VEGFR2, VEGFR3, Trk-A, Trk-B, Trk-C, and insulin receptor transmembrane domain. In embodiments, the Type I transmembrane domain is an EGFR transmembrane domain. In embodiments, the Type I transmembrane domain is a PDGFR-alpha transmembrane domain. In embodiments, the Type I transmembrane domain is a PDGFR-beta transmembrane domain. In embodiments, the Type I transmembrane domain is an HER2 transmembrane domain. In embodiments, the Type I transmembrane domain is an HER3 transmembrane domain. In embodiments, the Type I transmembrane domain is an HER4 transmembrane domain. In embodiments, the Type I transmembrane domain is an FGFR1 transmembrane domain. In embodiments, the Type I transmembrane domain is an FGFR2 transmembrane domain. In embodiments, the Type I transmembrane domain is an FGFR3 transmembrane domain. In embodiments, the Type I transmembrane domain is an FGFR4 transmembrane domain. In embodiments, the Type I transmembrane domain is a VEGFR1 transmembrane domain. In embodiments, the Type I transmembrane domain is a VEGFR2 transmembrane domain. In embodiments, the Type I transmembrane domain is a VEGFR3 transmembrane domain. In embodiments, the Type I transmembrane domain is a Trk-A transmembrane domain. In embodiments, the Type I transmembrane domain is a Trk-B transmembrane domain. In embodiments, the Type I transmembrane domain is a Trk-C transmembrane domain. In embodiments, the Type I transmembrane domain is an insulin receptor transmembrane domain.

    [0126] In embodiments, the recombinant protein includes an IgG antibody selected from IgG1, IgG2, IgG3, and IgG4. In embodiments, the IgG antibody is IgG1 antibody. In embodiments, the IgG antibody is IgG2 antibody. In embodiments, the IgG antibody is IgG3 antibody. In embodiments, the IgG antibody is IgG4 antibody.

    [0127] In embodiments of the recombinant proteins provided herein, the IgG antibody includes an Fc (fragment crystallizable) region, a Fab (antigen-binding fragment) region, and a hinge region. In embodiments, the IgG antibody includes an Fc (fragment crystallizable) region. In embodiments, the IgG antibody includes a Fab (garment crystallizable) region. In embodiments, the IgG antibody includes an Fc (antigen-binding fragment) region. In embodiments, the recombinant protein wherein the IgG antibody includes a hinge region.

    [0128] In embodiments of the recombinant proteins provided herein, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI). In embodiments, the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−12 M, about 1×10.sup.−5 M to about 1×10.sup.−11 M, about 1×10.sup.−5 M to about 1×10.sup.−10 M, about 1×10.sup.−5 M to about 1×10.sup.−9 M, about 1×10.sup.−5 M to about 1×10.sup.−8 M, about 1×10.sup.−5 M to about 1×10.sup.−7 M, about 1×10.sup.−5 M to about 1×10.sup.−6 M, about 1×10.sup.−6 M to about 1×10.sup.−13 M, about 1×10.sup.−6 M to about 1×10.sup.−12 M, about 1×10.sup.−6 M to about 1×10.sup.−11 M, about 1×10.sup.−6 M to about 1×10.sup.−10 M, about 1×10.sup.−6 M to about 1×10.sup.−9 M, about 1×10.sup.−6 M to about 1×10.sup.−8 M, about 1×10.sup.−6 M to about 1×10.sup.−7 M, about 1×10.sup.−7 M to about 1×10.sup.−13 M, about 1×10.sup.−7 M to about 1×10.sup.−12 M, about 1×10.sup.−7 M to about 1×10.sup.−11 M, about 1×10.sup.−7 M to about 1×10.sup.−10 M, about 1×10.sup.−7 M to about 1×10.sup.−9 M, about 1×10.sup.−7 M to about 1×10.sup.−8 M, about 1×10.sup.−8 M to about 1×10.sup.−13 M, about 1×10.sup.−8 M to about 1×10.sup.−12 M, about 1×10.sup.−8 M to about 1×10.sup.−11 M, about 1×10.sup.−8 M to about 1×10.sup.−10 M, about 1×10.sup.−8 M to about 1×10.sup.−9 M, about 1×10.sup.−9 M to about 1×10.sup.−13 M, about 1×10.sup.−9 M to about 1×10.sup.−12 M, about 1×10.sup.−9 M to about 1×10.sup.−11 M, about 1×10.sup.−9 M to about 1×10.sup.−10 M, about 1×10.sup.−10 M to about 1×10.sup.−13 M, about 1×10.sup.−10 M to about 1×10.sup.−12 M, about 1×10.sup.−10 M to about 1×10.sup.−11 M, about 1×10.sup.−11 M to about 1×10.sup.−13 M, about 1×10.sup.−11 M to about 1×10.sup.−12 M, or about 1×10.sup.−12 M to about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M, about 1×10.sup.−6 M, about 1×10.sup.−7 M, about 1×10.sup.−8 M, about 1×10.sup.−9 M, about 1×10.sup.−10 M, about 1×10.sup.−11 M, about 1×10.sup.−12 M, or about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

    [0129] In embodiments of the recombinant proteins provided herein, the Fc region of the IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD32 (FcγRII). In embodiments, the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−12 M, about 1×10.sup.−5 M to about 1×10.sup.−11 M, about 1×10.sup.−5 M to about 1×10.sup.−10 M, about 1×10.sup.−5 M to about 1×10.sup.−9 M, about 1×10.sup.−5 M to about 1×10.sup.−8 M, about 1×10.sup.−5 M to about 1×10.sup.−7 M, about 1×10.sup.−5 M to about 1×10.sup.−6 M, about 1×10.sup.−6 M to about 1×10.sup.−13 M, about 1×10.sup.−6 M to about 1×10.sup.−12 M, about 1×10.sup.−6 M to about 1×10.sup.−11 M, about 1×10.sup.−6 M to about 1×10.sup.−10 M, about 1×10.sup.−6 M to about 1×10.sup.−9 M, about 1×10.sup.−6 M to about 1×10.sup.−8 M, about 1×10.sup.−6 M to about 1×10.sup.−7 M, about 1×10.sup.−7 M to about 1×10.sup.−13 M, about 1×10.sup.−7 M to about 1×10.sup.−12 M, about 1×10.sup.−7 M to about 1×10.sup.−11 M, about 1×10.sup.−7 M to about 1×10.sup.−10 M, about 1×10.sup.−7 M to about 1×10.sup.−9 M, about 1×10.sup.−7 M to about 1×10.sup.−8 M, about 1×10.sup.−8 M to about 1×10.sup.−13 M, about 1×10.sup.−8 M to about 1×10.sup.−12 M, about 1×10.sup.−8 M to about 1×10.sup.−11 M, about 1×10.sup.−8 M to about 1×10.sup.−10 M, about 1×10.sup.−8 M to about 1×10.sup.−9 M, about 1×10.sup.−9 M to about 1×10.sup.−13 M, about 1×10.sup.−9 M to about 1×10.sup.−12 M, about 1×10.sup.−9 M to about 1×10.sup.−11 M, about 1×10.sup.−9 M to about 1×10.sup.−10 M, about 1×10.sup.−10 M to about 1×10.sup.−13 M, about 1×10.sup.−10 M to about 1×10.sup.−12 M, about 1×10.sup.−10 M to about 1×10.sup.−11 M, about 1×10.sup.−11 M to about 1×10.sup.−13 M, about 1×10.sup.−11 M to about 1×10.sup.−12 M, or about 1×10.sup.−12 M to about 1×10.sup.−13 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M, about 1×10.sup.−6 M, about 1×10.sup.−7 M, about 1×10.sup.−8 M, about 1×10.sup.−9 M, about 1×10.sup.−10 M, about 1×10.sup.−11 M, about 1×10.sup.−12 M, or about 1×10.sup.−13 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−6 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−7 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−8 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−9 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−10 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−11 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−12 M to CD32 (FcγRII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−13 M to CD32 (FcγRII).

    [0130] In embodiments of the recombinant proteins provided herein, the Fc region of the IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD16 (FcγRIII). In embodiments, the Fc region of the IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD16 (FcγRIII). In embodiments, the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−12 M, about 1×10.sup.−5 M to about 1×10.sup.−11 M, about 1×10.sup.−5 M to about 1×10.sup.−10 M, about 1×10.sup.−5 M to about 1×10.sup.−9 M, about 1×10.sup.−5 M to about 1×10.sup.−8 M, about 1×10.sup.−5 M to about 1×10.sup.−7 M, about 1×10.sup.−5 M to about 1×10.sup.−6 M, about 1×10.sup.−6 M to about 1×10.sup.−13 M, about 1×10.sup.−6 M to about 1×10.sup.−12 M, about 1×10.sup.−6 M to about 1×10.sup.−11 M, about 1×10.sup.−6 M to about 1×10.sup.−10 M, about 1×10.sup.−6 M to about 1×10.sup.−9 M, about 1×10.sup.−6 M to about 1×10.sup.−8 M, about 1×10.sup.−6 M to about 1×10.sup.−7 M, about 1×10.sup.−7 M to about 1×10.sup.−13 M, about 1×10.sup.−7 M to about 1×10.sup.−12 M, about 1×10.sup.−7 M to about 1×10.sup.−11 M, about 1×10.sup.−7 M to about 1×10.sup.−10 M, about 1×10.sup.−7 M to about 1×10.sup.−9 M, about 1×10.sup.−7 M to about 1×10.sup.−8 M, about 1×10.sup.−8 M to about 1×10.sup.−13 M, about 1×10.sup.−8 M to about 1×10.sup.−12 M, about 1×10.sup.−8 M to about 1×10.sup.−11 M, about 1×10.sup.−8 M to about 1×10.sup.−10 M, about 1×10.sup.−8 M to about 1×10.sup.−9 M, about 1×10.sup.−9 M to about 1×10.sup.−13 M, about 1×10.sup.−9 M to about 1×10.sup.−12 M, about 1×10.sup.−9 M to about 1×10.sup.−11 M, about 1×10.sup.−9 M to about 1×10.sup.−10 M, about 1×10.sup.−10 M to about 1×10.sup.−13 M, about 1×10.sup.−10 M to about 1×10.sup.−12 M, about 1×10.sup.−10 M to about 1×10.sup.−11 M, about 1×10.sup.−11 M to about 1×10.sup.−13 M, about 1×10.sup.−11 M to about 1×10.sup.−12 M, or about 1×10.sup.−12 M to about 1×10.sup.−13 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M, about 1×10.sup.−6 M, about 1×10.sup.−7 M, about 1×10.sup.−8 M, about 1×10.sup.−9 M, about 1×10.sup.−10 M, about 1×10.sup.−11 M, about 1×10.sup.−12 M, or about 1×10.sup.−13 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−6 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−7 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−8 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−9 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−10 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−11 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−12 M to CD16 (FcγRIII). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−13 M to CD16 (FcγRIII).

    [0131] In embodiments of the recombinant proteins provided herein, the Fc region of the IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD64 (FcγRI). In embodiments, the Fc region of the IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD64 (FcγRI). In embodiments, the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−12 M, about 1×10.sup.−5 M to about 1×10.sup.−11 M, about 1×10.sup.−5 M to about 1×10.sup.−10 M, about 1×10.sup.−5 M to about 1×10.sup.−9 M, about 1×10.sup.−5 M to about 1×10.sup.−8 M, about 1×10.sup.−5 M to about 1×10.sup.−7 M, about 1×10.sup.−5 M to about 1×10.sup.−6 M, about 1×10.sup.−6 M to about 1×10.sup.−13 M, about 1×10.sup.−6 M to about 1×10.sup.−12 M, about 1×10.sup.−6 M to about 1×10.sup.−11 M, about 1×10.sup.−6 M to about 1×10.sup.−10 M, about 1×10.sup.−6 M to about 1×10.sup.−9 M, about 1×10.sup.−6 M to about 1×10.sup.−8 M, about 1×10.sup.−6 M to about 1×10.sup.−7 M, about 1×10.sup.−7 M to about 1×10.sup.−13 M, about 1×10.sup.−7 M to about 1×10.sup.−12 M, about 1×10.sup.−7 M to about 1×10.sup.−11 M, about 1×10.sup.−7 M to about 1×10.sup.−10 M, about 1×10.sup.−7 M to about 1×10.sup.−9 M, about 1×10.sup.−7 M to about 1×10.sup.−8 M, about 1×10.sup.−8 M to about 1×10.sup.−13 M, about 1×10.sup.−8 M to about 1×10.sup.−12 M, about 1×10.sup.−8 M to about 1×10.sup.−11 M, about 1×10.sup.−8 M to about 1×10.sup.−10 M, about 1×10.sup.−8 M to about 1×10.sup.−9 M, about 1×10.sup.−9 M to about 1×10.sup.−13 M, about 1×10.sup.−9 M to about 1×10.sup.−12 M, about 1×10.sup.−9 M to about 1×10.sup.−11 M, about 1×10.sup.−9 M to about 1×10.sup.−10 M, about 1×10.sup.−10 M to about 1×10.sup.−13 M, about 1×10.sup.−10 M to about 1×10.sup.−12 M, about 1×10.sup.−10 M to about 1×10.sup.−11 M, about 1×10.sup.−11 M to about 1×10.sup.−13 M, about 1×10.sup.−11 M to about 1×10.sup.−12 M, or about 1×10.sup.−12 M to about 1×10.sup.−13 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M, about 1×10.sup.−6 M, about 1×10.sup.−7 M, about 1×10.sup.−8 M, about 1×10.sup.−9 M, about 1×10.sup.−10 M, about 1×10.sup.−11 M, about 1×10.sup.−12 M, or about 1×10.sup.−13 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−5 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−6 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−7 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−8 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−9 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−10 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−11 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−12 M to CD64 (FcγRI). In embodiments, the Fc region of an IgG antibody described herein has a dissociation constant of about 1×10.sup.−13 M to CD64 (FcγRI).

    [0132] In embodiments of the recombinant proteins provided herein, the hinge region includes a protease resistant sequence. In embodiments, the sequence is between amino acid positions 246-252 according to Kabat numbering. In embodiments, the sequence is between positions corresponding to Kabat positions 246-252. In embodiments, the protease resistant sequence is two or more amino acids in length. In embodiments, the protease resistant sequence is three amino acids in length. In embodiments, the protease resistant sequence is four amino acids in length. In embodiments, the protease resistant sequence is five amino acids in length. In embodiments, the protease resistant sequence is six amino acids in length. In embodiments, the protease resistant sequence is seven amino acids in length. In embodiments, the protease resistant sequence includes the amino acids of SEQ ID NO: 546. In embodiments, the protease resistant sequence includes the amino acids of SEQ ID NO: 545. In embodiments, the protease resistant sequence includes the amino acids of SEQ ID NO: 547.

    [0133] In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by a protease. In embodiments, the protease is an IgG specific protease. In embodiments, the IgG specific protease is selected from IdeS and IdeZ. In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by IdeS protease. In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by IdeZ protease.

    [0134] In embodiments, the IgG antibody hinge region is two amino acids in length and includes an amino acid sequence of DW, YD, QW, QE, PW, QD, or DD. In embodiments, the IgG antibody hinge region is three amino acids in length and includes an amino acid sequence of XDW, XDW, XYD, XQW, XQE, XPW, XQD, or XDD, where X is any amino acid. In embodiments, the IgG antibody hinge region is four amino acids in length and includes an amino acid sequence of XXDW, XXDW, XXYD, XXQW, XXQE, XXPW, XXQD, or XXDD, where X is any amino acid. In embodiments, the IgG antibody hinge region is five amino acids in length and includes an amino acid sequence of XXXDW, XXXYD, XXXQW, XXXQE, XXXPW, XXXQD, or XXXDD, where X is any amino acid. In embodiments, the IgG antibody hinge region is six amino acids in length and includes an amino acid sequence of XXXXDW, XXXXYD, XXXXQW, XXXXQE, XXXXPW, XXXXQD, or XXXXDD, where X is any amino acid. In embodiments, the IgG antibody hinge region is seven amino acids in length and includes an amino acid sequence of XXXXXDW, XXXXXYD, XXXXXQW, XXXXXQE, XXXXXPW, XXXXXQD, or XXXXXDD, where X is any amino acid. In embodiments, the IgG antibody hinge region is eight amino acids in length and includes an amino acid sequence of XXXXXXDW, XXXXXXYD, XXXXXXQW, XXXXXXQE, XXXXXXPW, XXXXXXQD, or XXXXXXDD, where X is any amino acid. In embodiments, the IgG antibody hinge region is nine amino acids in length and includes an amino acid sequence of XXXXXXXDW, XXXXXXXYD, XXXXXXXQW, XXXXXXXQE, XXXXXXXPW, XXXXXXXQD, or XXXXXXXDD, where X is any amino acid. In embodiments, the IgG antibody hinge region includes an amino acid sequence of XCWDW, XXCWDW, XXXCWDW, XXXXXCWDW, XXXXXCWDW, XXXXXXCWDW, XXXXXXXCWDW, ETCWDW, DSCWDW, YDCWDW, DDCWDW, DMCWDW, EHCWDW, IICWDW, DVCWDW, EFCWDW, FNCWDW, EETCWDW, EDSCWDW, EETCWDD, or EETQWDD where X is any amino acid.

    [0135] In embodiments, the IgG antibody hinge region includes DW, YD, QW, QE, PW, QD, DD, CWDW, ETCWDW, DSCWDW, YDCWDW, DDCWDW, DMCWDW, EHCWDW, IICWDW, DVCWDW, EFCWDW, FNCWDW, EETCWDW (SEQ ID NO: 545), EDSCWDW (SEQ ID NO: 547), EETCWDD, EETCWSW (SEQ ID NO: 547), EETQWDD. In some aspects, the variants or homologs have one, two, three four, five or six amino acid sequence identity.

    [0136] In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of any one of Abciximab, Adalimumab, Alemtuzumab, Alemtuzumab, Alirocumab, Arcitumomab, Atezolizumab, Avelumab, Basiliximab, Belimumab, Besilesomab, Bevacizumab, Bevacizumab, Bezlotoxumab, Brentuximab, Brodalumab, Canakinumab, Capromab, Catumaxomab, Certolizumab pegol, Cetuximab, Daratumumab, Denosumab, Dinutuximab, Dupilumab, Durvalumab, Eculizumab, Efalizumab, Elotuzumab, Fanolesomab, Gemtuzumab ozogamicin, Golimumab, Ibritumomab tiuxetan, Idarucizumab, Imiciromab, Infliximab, Ipilimumab, Mepolizumab, Muromonab-CD3, Natalizumab, Necitumumab, Nivolumab, Nofetumomab, Obiltoxaximab, Obinutuzumab, Ocrelizumab, Ofatumumab, Olaratumab, Omalizumab, Palivizumab, Panitumumab, Pembrolizumab, Pertuzumab, Ramucirumab, Ranibizumab, Raxibacumab, Reslizumab, Rituximab, Satumomab, Secukinumab, Siltuximab, Sulesomab, Tocilizumab, Tositumomab, Trastuzumab, Trastuzumab emtansine, Ustekinumab, Vedolizumab, Volocumab, and Votumumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Abciximab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Adalimumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Alemtuzumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Alemtuzumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Alirocumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Arcitumomab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Atezolizumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Avelumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Basiliximab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Belimumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Besilesomab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Bevacizumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Bezlotoxumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Brentuximab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Brodalumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Canakinumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Capromab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Catumaxomab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Certolizumab pegol. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Cetuximab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Daratumumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Denosumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Dinutuximab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Dupilumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Durvalumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Eculizumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Efalizumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Elotuzumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Fanolesomab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Gemtuzumab ozogamicin. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Golimumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Ibritumomab tiuxetan. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Idarucizumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Imiciromab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Infliximab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Ipilimumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Mepolizumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Muromonab-CD3. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Natalizumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Necitumumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Nivolumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Nofetumomab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Obiltoxaximab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Obinutuzumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Ocrelizumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Ofatumumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Olaratumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Omalizumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Palivizumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Panitumumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Pembrolizumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Pertuzumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Ramucirumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Ranibizumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Raxibacumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Reslizumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Rituximab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Satumomab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Secukinumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Siltuximab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Sulesomab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Tocilizumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Tositumomab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Trastuzumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Trastuzumab emtansine. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Ustekinumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Vedolizumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Volocumab. In embodiments, the IgG antibody includes a Fab region that is identical to the Fab region of Votumumab.

    [0137] In embodiments of the recombinant proteins provided herein, the IgG antibody includes a protease resistant sequence resistant to cleavage by a protease specific for an ELLGGPS amino acid sequence (SEQ ID NO: 544). In embodiments, the ELLGGPS amino acid sequence specific protease, includes but is not limited to, pepsin, matrix metalloproteinase 7 (MMP7), matrix metalloproteinase 3 (MMP3), matrix metalloproteinase (MMP12), cathepsin G, and glutamyl endopeptidase V8 (GluV8). In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by pepsin. In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by matrix metalloproteinase 7 (MMP7). In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by matrix metalloproteinase 3 (MMP3). In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by matrix metalloproteinase (MMP12). In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by cathepsin G. In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by glutamyl endopeptidase V8 (GluV8).

    IV. Anti-CD20 Antibodies

    [0138] In an aspect, provided herein is an anti-CD20 antibody including a complementarity determining region (CDR) as encoded by a nucleic acid sequence of any of one SEQ ID Nos: 551-588.

    [0139] In embodiments, provided herein is an anti-CD20 antibody that binds CD20 or an antigen fragment thereof, where the antibody includes a complementarity determining region (CDR) and encoded by a nucleic acid sequence as set forth in FIG. 14 (also reproduced in Tables 1, 2, and 3). In embodiments, provided herein is an anti-CD20 antibody that binds CD20 or an antigen fragment thereof, where the antibody includes a complementarity determining region (CDR) with amino acid sequence as set forth in Tables 1, 2 or 3. In embodiments, provided herein is an anti-CD20 antibody that binds CD20 or an antigen fragment thereof, where the antibody includes a complementarity determining region (CDR) with amino an acid sequence of any one of SEQ ID Nos: 589-629 or 633-635. In embodiments, provided herein is an antibody that binds CD20 or an antigen fragment thereof, with higher binding affinity to CD20 compared to non-mutated Rituximab (a CD20 binding antibody). In embodiments, provided herein is an antibody that binds CD20 or an antigen fragment thereof, with higher binding affinity to CD20 and includes a protease resistant hinge region when compared to non-mutated Rituximab (a CD20 binding antibody). In embodiments, provided herein is an antibody that binds CD20 or an antigen fragment thereof, with higher binding affinity to CD20 and includes mutations in one or more of the heavy chain CDR1, heavy chain CDR2, heavy chain CDR3, light chain CDR1, light chain CDR2, and light chain CDR3 compared to non-mutated Rituximab (a CD20 binding antibody).

    [0140] In embodiments, the anti-CD20 antibody includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCGGGGAAGCGGTATAAC (SEQ ID NO: 551). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO: 549), and a heavy chain CDR3 encoded by nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), the light chain CDR2 is encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and the light chain CDR3 is encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P01A09 and is further described in the description of Table 1 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR1 sequence is encoded by a nucleotide sequence of TATACCGGGGAAGCGGTATAAC (SEQ ID NO: 551).

    [0141] In embodiments, the anti-CD20 antibody includes a heavy chain CDR1 amino acid sequence of YTGKRYN (SEQ ID NO: 592). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO: 590) and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P01A09 and is further described in the description of Table 1 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR1 amino acid sequence is YTGKRYN (SEQ ID NO: 592).

    [0142] In embodiments, the anti-CD20 antibody includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTGTTTTAGGTATAAC (SEQ ID NO: 552). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO: 549), and a heavy chain CDR3 encoded by nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), the light chain CDR2 is encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and the light chain CDR3 is encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P01B01 and is further described in the description of Table 1 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR1 sequence is encoded by a nucleotide sequence of TATACCTGTTTTAGGTATAAC (SEQ ID NO: 552).

    [0143] In embodiments, the anti-CD20 antibody includes a heavy chain CDR1 amino acid sequence of YTCFRYN (SEQ ID NO: 593). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO: 590) and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P01B01 and is further described in the description of Table 1 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR1 amino acid sequence is YTCFRYN (SEQ ID NO: 593).

    [0144] In embodiments, the anti-CD20 antibody includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAATTCGTTTG (SEQ ID NO: 553). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO: 549), and a heavy chain CDR3 encoded by nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), the light chain CDR2 is encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and the light chain CDR3 is encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P02C12 and is further described in the description of Table 1 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR1 sequence is encoded by a nucleotide sequence of TATACCTTCACAATTCGTTTG (SEQ ID NO: 553).

    [0145] In embodiments, the anti-CD20 antibody includes a heavy chain CDR1 amino acid sequence of YTFTIRL (SEQ ID NO: 594). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO: 590) and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P02C12 and is further described in the description of Table 1 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR1 amino acid sequence is YTFTIRL (SEQ ID NO: 594).

    [0146] In embodiments, the anti-CD20 antibody includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCGGGCGTTTTTATAAC (SEQ ID NO: 554). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO: 549), and a heavy chain CDR3 encoded by nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), the light chain CDR2 is encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and the light chain CDR3 is encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P02F01 and is further described in the description of Table 1 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR1 sequence is encoded by a nucleotide sequence of TATACCGGGCGTTTTTATAAC (SEQ ID NO: 554).

    [0147] In embodiments, the anti-CD20 antibody includes a heavy chain CDR1 amino acid sequence of YTGRFYN (SEQ ID NO: 595). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO: 590) and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P02F01 and is further described in the description of Table 1 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR1 amino acid sequence is YTGRFYN (SEQ ID NO: 595).

    [0148] In embodiments, the anti-CD20 antibody includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCAGTTGGATGTATAAC (SEQ ID NO: 555). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO: 549), and a heavy chain CDR3 encoded by nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), the light chain CDR2 is encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and the light chain CDR3 is encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P03A05 and is further described in the description of Table 1 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR1 sequence is encoded by a nucleotide sequence of TATACCAGTTGGATGTATAAC (SEQ ID NO: 555).

    [0149] In embodiments, the anti-CD20 antibody includes a heavy chain CDR1 amino acid sequence of YTSWMYN (SEQ ID NO: 596). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO: 590) and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P03A05 and is further described in the description of Table 1 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR1 amino acid sequence is YTSWMYN (SEQ ID NO: 596).

    [0150] In embodiments, the anti-CD20 antibody includes a heavy chain CDR1 encoded by a nucleotide sequence of TGGTTGTGGACAAGCTATAAC (SEQ ID NO: 556). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO: 549), and a heavy chain CDR3 encoded by nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), the light chain CDR2 is encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and the light chain CDR3 is encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P05B09 and is further described in the description of Table 1 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR1 sequence is encoded by a nucleotide sequence of TGGTTGTGGACAAGCTATAAC (SEQ ID NO: 556).

    [0151] In embodiments, the anti-CD20 antibody includes a heavy chain CDR1 amino acid sequence of WLWTSYN (SEQ ID NO: 597). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO: 590) and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P05B09 and is further described in the description of Table 1 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR1 amino acid sequence is WLWTSYN (SEQ ID NO: 597).

    [0152] In embodiments, the anti-CD20 antibody includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTGGGGGATTTATAAC (SEQ ID NO: 557). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO: 549), and a heavy chain CDR3 encoded by nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), the light chain CDR2 is encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and the light chain CDR3 is encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P05H07 and is further described in the description of Table 1 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR1 sequence is encoded by a nucleotide sequence of TATACCTGGGGGATTTATAAC (SEQ ID NO: 557).

    [0153] In embodiments, the anti-CD20 antibody includes a heavy chain CDR1 amino acid sequence of YTWGIYN (SEQ ID NO: 598). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO: 590) and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P05H07 and is further described in the description of Table 1 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR1 amino acid sequence is YTWGIYN (SEQ ID NO: 598).

    [0154] In embodiments, the anti-CD20 antibody includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGGTATAAT (SEQ ID NO: 558). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO: 549), and a heavy chain CDR3 encoded by nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), the light chain CDR2 is encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and the light chain CDR3 is encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P04A02 and is further described in the description of Table 1 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR1 sequence is encoded by a nucleotide sequence of TATACCTTCACAAGGTATAAT (SEQ ID NO: 558).

    [0155] In embodiments, the anti-CD20 antibody includes a heavy chain CDR1 amino acid sequence of YTFTRYN (SEQ ID NO: 599). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO: 590) and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P04A02 and is further described in the description of Table 1 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR1 amino acid sequence is YTFTRYN (SEQ ID NO: 599).

    [0156] In an embodiment, the antibody that binds CD20 or an antigen fragment thereof includes in sequence: a CDR1 encoded by a nucleotide sequence of TATACCTTCACATTTCCTTAT (SEQ ID NO: 559). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO: 549), and a heavy chain CDR3 encoded by nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), the light chain CDR2 is encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and the light chain CDR3 is encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P05F06 and is further described in the description of Table 1 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR1 sequence is encoded by a nucleotide sequence of TATACCTTCACATTTCCTTAT (SEQ ID NO: 559).

    [0157] In embodiments, the anti-CD20 antibody includes a heavy chain CDR1 amino acid sequence of YTFTFPY (SEQ ID NO: 600). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO: 590) and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P05F06 and is further described in the description of Table 1 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR1 amino acid sequence is YTFTFPY (SEQ ID NO: 600).

    [0158] In embodiments, the anti-CD20 antibody includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCGGTATTCGGTATAAC (SEQ ID NO: 560). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO: 549), and a heavy chain CDR3 encoded by nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), the light chain CDR2 is encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and the light chain CDR3 is encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P07C04 and is further described in the description of Table 1 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR1 sequence is encoded by a nucleotide sequence of TATACCGGTATTCGGTATAAC (SEQ ID NO: 560).

    [0159] In embodiments, the anti-CD20 antibody includes a heavy chain CDR1 amino acid sequence of YTGIRYN (SEQ ID NO: 601). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO: 590) and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P07C04 and is further described in the description of Table 1 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR1 amino acid sequence is YTGIRYN (SEQ ID NO: 601).

    [0160] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCTTGTATCTT (SEQ ID NO: 561). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P04D06 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by a nucleotide sequence of ATTTATCCGGGCTTGTATCTT (SEQ ID NO: 561).

    [0161] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 amino acid sequence of IYPGLYL (SEQ ID NO: 602). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P04D06 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGLYL (SEQ ID NO: 602).

    [0162] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 encoded by a nucleotide sequence of CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCACGCTGCTG (SEQ ID NO: 562). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P04F01 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by a nucleotide sequence of ATTTATCCGGGCACGCTGCTG (SEQ ID NO: 562).

    [0163] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 amino acid sequence of IYPGTLL (SEQ ID NO: 603). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P04F01 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGTLL (SEQ ID NO: 603).

    [0164] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCCATATGGGG (SEQ ID NO: 563). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P04F02 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by a nucleotide sequence of ATTTATCCGGGCCATATGGGG (SEQ ID NO: 563).

    [0165] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 amino acid sequence of IYPGHMG (SEQ ID NO: 604). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P04F02 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGHMG (SEQ ID NO: 604).

    [0166] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCATGCTTTGG (SEQ ID NO: 564). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P04G03 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by a nucleotide sequence of ATTTATCCGGGCATGCTTTGG (SEQ ID NO: 564).

    [0167] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 amino acid sequence of IYPGMLW (SEQ ID NO: 605). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P04G03 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGMLW (SEQ ID NO: 605).

    [0168] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCGCTGTTTCG (SEQ ID NO: 565). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P04H06 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by a nucleotide sequence of ATTTATCCGGGCGCTGTTTCG (SEQ ID NO: 565).

    [0169] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 amino acid sequence of YTFTSYN (SEQ ID NO: 589). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P04H06 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGAVS (SEQ ID NO: 606).

    [0170] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCACTCATAAG (SEQ ID NO: 566). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P04H07 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by a nucleotide sequence of ATTTATCCGGGCACTCATAAG (SEQ ID NO: 566).

    [0171] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 amino acid sequence of IYPGTHK (SEQ ID NO: 607). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P04H07 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is f IYPGTHK (SEQ ID NO: 607).

    [0172] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCACTCAGTCT (SEQ ID NO: 567). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P06A06 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by a nucleotide sequence of ATTTATCCGGGCACTCAGTCT (SEQ ID NO: 567).

    [0173] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 amino acid sequence of IYPGTQS (SEQ ID NO: 608). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P06A06 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGTQS (SEQ ID NO: 608).

    [0174] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCAATGCGGAT (SEQ ID NO: 568). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P06B11 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by a nucleotide sequence of ATTTATCCGGGCAATGCGGAT (SEQ ID NO: 568).

    [0175] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 amino acid sequence of IYPGNAD (SEQ ID NO: 609). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P06B11 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGNAD (SEQ ID NO: 609).

    [0176] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCAGTTTTGAG (SEQ ID NO: 569). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P06H01 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by a nucleotide sequence of ATTTATCCGGGCAGTTTTGAG (SEQ ID NO: 569).

    [0177] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 amino acid sequence of IYPGSFE (SEQ ID NO: 610). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P06H01 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGSFE (SEQ ID NO: 610).

    [0178] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCACGTTTCTT (SEQ ID NO: 570). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P04D09 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by a nucleotide sequence of ATTTATCCGGGCACGTTTCTT (SEQ ID NO: 570).

    [0179] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 amino acid sequence of IYPGTFL (SEQ ID NO: 611). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P04D09 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGTFL (SEQ ID NO: 611).

    [0180] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGTTACGGGCGAT (SEQ ID NO: 571). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P05A03 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by a nucleotide sequence of ATTTATCCGGTTACGGGCGAT (SEQ ID NO: 571).

    [0181] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 amino acid sequence of IYPVTGD (SEQ ID NO: 612). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P05A03 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPVTGD (SEQ ID NO: 612).

    [0182] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGTATCTGGGCGAT (SEQ ID NO: 572). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P05A12 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by a nucleotide sequence of ATTTATCCGTATCTGGGCGAT (SEQ ID NO: 572).

    [0183] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 amino acid sequence of IYPGLYL (SEQ ID NO: 602). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P05A12 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPYLGD (SEQ ID NO: 613).

    [0184] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 encoded by a nucleotide sequence of TTTATCCGTGGAATGGCGAT (SEQ ID NO: 573). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P05B02 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by a nucleotide sequence of ATTTATCCGTGGAATGGCGAT (SEQ ID NO: 573).

    [0185] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 amino acid sequence of IYPWNGD (SEQ ID NO: 614). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P05B02 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPWNGD (SEQ ID NO: 614).

    [0186] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCTTGTATCTT (SEQ ID NO: 561). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P06B04 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by a nucleotide sequence of ATTTATCCTCTGTGGGGCGAT (SEQ ID NO: 574).

    [0187] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 amino acid sequence of IYPLWGD (SEQ ID NO: 615). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P06B04 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPLWGD (SEQ ID NO: 615).

    [0188] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCAGTAGTCGT (SEQ ID NO: 575). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P06B11 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by a nucleotide sequence of ATTTATCCGGGCAGTAGTCGT (SEQ ID NO: 575).

    [0189] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 amino acid sequence of IYPGSSR (SEQ ID NO: 616). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P06B11 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGSSR (SEQ ID NO: 616).

    [0190] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCACTTTTCGT (SEQ ID NO: 576). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P06H05 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by a nucleotide sequence of ATTTATCCGGGCACTTTTCGT (SEQ ID NO: 576).

    [0191] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 amino acid sequence of IYPGTFR (SEQ ID NO: 617). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P06H05 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGTFR (SEQ ID NO: 617).

    [0192] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCGTTGGTCGG (SEQ ID NO: 577). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P06H11 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by a nucleotide sequence of ATTTATCCGGGCGTTGGTCGG (SEQ ID NO: 577).

    [0193] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 amino acid sequence of IYPGVGR (SEQ ID NO: 618). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P06H11 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGVGR (SEQ ID NO: 618).

    [0194] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCTCTCAGGCG (SEQ ID NO: 578). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P07F02 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by a nucleotide sequence of ATTTATCCGGGCTCTCAGGCG (SEQ ID NO: 578).

    [0195] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 amino acid sequence of IYPGSEA (SEQ ID NO: 619). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P07F02 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGSEA (SEQ ID NO: 619).

    [0196] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCAGTAATATG (SEQ ID NO: 579). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P07F10 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by a nucleotide sequence of ATTTATCCGGGCAGTAATATG (SEQ ID NO: 579).

    [0197] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 amino acid sequence of IYPGSNM (SEQ ID NO: 620). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P07F10 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGSNM (SEQ ID NO: 620).

    [0198] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCGCTTTTCTT (SEQ ID NO: 580). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 550). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P08B05 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR2 sequence is encoded by a nucleotide sequence of ATTTATCCGGGCGCTTTTCTT (SEQ ID NO: 580).

    [0199] In embodiments, the anti-CD20 antibody includes a heavy chain CDR2 amino acid sequence of IYPGAFL (SEQ ID NO: 621). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR3 amino acid sequence of RSTYYGGDWYFN (SEQ ID NO: 591). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P08B05 and is further described in the description of Table 2 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR2 amino acid sequence is IYPGAFL (SEQ ID NO: 621).

    [0200] In embodiments, the anti-CD20 antibody includes a heavy chain CDR3 encoded by a nucleotide sequence of CAGTCTATTTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 581). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO: 549). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P07C02 and is further described in the description of Table 3 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR3 sequence is encoded by a nucleotide sequence of CAGTCTATTTATTATGGCGGCGATTGGTATTTTAAC (SEQ ID NO: 581).

    [0201] In embodiments, the anti-CD20 antibody includes a heavy chain CDR3 amino acid sequence of QSIYYGGDWYFN (SEQ ID NO: 622). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO: 590). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P07C02 and is further described in the description of Table 3 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR3 amino acid sequence is QSIYYGGDWYFN (SEQ ID NO: 622).

    [0202] In embodiments, the anti-CD20 antibody includes a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGCTGATTGCT (SEQ ID NO: 582). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO: 549). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P07H08 and is further described in the description of Table 3 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR3 sequence is encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGCTGATTGCT (SEQ ID NO: 582).

    [0203] In embodiments, the anti-CD20 antibody includes a heavy chain CDR3 amino acid sequence of RSTYYGGDWLIA (SEQ ID NO: 623). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO: 590). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P07H08and is further described in the description of Table 3 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR3 amino acid sequence is RSTYYGGDWLIA (SEQ ID NO: 623).

    [0204] In embodiments, the anti-CD20 antibody includes a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCGTGGCGGGGGGCGATTGGTATTTTAA (SEQ ID NO: 583). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO: 549). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P07H10and is further described in the description of Table 3 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR3 sequence is encoded by a nucleotide sequence of CGCAGCACCGTGGCGGGGGGCGATTGGTATTTTAA (SEQ ID NO: 583).

    [0205] In embodiments, the anti-CD20 antibody includes a heavy chain CDR3 amino acid sequence of RSTVAGGDWYFN (SEQ ID NO: 624). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO: 590). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P07H10 and is further described in the description of Table 3 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR3 amino acid sequence is RSTVAGGDWYFN (SEQ ID NO: 624).

    [0206] In embodiments, the anti-CD20 antibody includes a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGCGGTGGCGG (SEQ ID NO: 584). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO: 549). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P08A01 and is further described in the description of Table 3 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR3 sequence is encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGCGGTGGCGG (SEQ ID NO: 584).

    [0207] In embodiments, the anti-CD20 antibody includes a heavy chain CDR3 amino acid sequence of RSTYYGGDWRWR (SEQ ID NO: 625). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO: 590). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P08A0land is further described in the description of Table 3 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR3 amino acid sequence is RSTYYGGDWRWR (SEQ ID NO: 625).

    [0208] In embodiments, the anti-CD20 antibody includes a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGGTTTTGGTATTTTAAC (SEQ ID NO: 585). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO: 549). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P08B11 and is further described in the description of Table 3 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR3 sequence is encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGGTTTTGGTATTTTAAC (SEQ ID NO: 585).

    [0209] In embodiments, the anti-CD20 antibody includes a heavy chain CDR3 amino acid sequence of RSTYYGGFWYFN (SEQ ID NO: 626). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO: 590). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P08B11 and is further described in the description of Table 3 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR3 amino acid sequence is RSTYYGGFWYFN (SEQ ID NO: 626).

    [0210] In embodiments, the anti-CD20 antibody includes a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTCTTGGGCT (SEQ ID NO: 586). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO: 549). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P08G02 and is further described in the description of Table 3 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR3 sequence is encoded by a nucleotide sequence of CGCAGCACCTATTATGGCGGCGATTGGTCTTGGGCT (SEQ ID NO: 586).

    [0211] In embodiments, the anti-CD20 antibody includes a heavy chain CDR3 amino acid sequence of QSIYYGGDWYFN (SEQ ID NO: 622). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO: 590). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P08G02 and is further described in the description of Table 3 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR3 amino acid sequence is RSTYYGGDWSWA (SEQ ID NO: 627).

    [0212] In embodiments, the anti-CD20 antibody includes a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCATGTGTAAGGGCGATTGGTATTTTAAC (SEQ ID NO: 587). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO: 549). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P07A06 and is further described in the description of Table 3 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR3 sequence is encoded by a nucleotide sequence of CGCAGCACCATGTGTAAGGGCGATTGGTATTTTAAC (SEQ ID NO: 587).

    [0213] In embodiments, the anti-CD20 antibody includes a heavy chain CDR3 amino acid sequence of RSTMCKGDWYFN (SEQ ID NO: 628)). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO: 590). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P07A06 and is further described in the description of Table 3 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR3 amino acid sequence is RSTMCKGDWYFN (SEQ ID NO: 628).

    [0214] In embodiments, the anti-CD20 antibody includes a heavy chain CDR3 encoded by a nucleotide sequence of CGCAGCACCATGTTGGGTGGCGATTGGTATTTTAAC (SEQ ID NO: 588). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 encoded by a nucleotide sequence of TATACCTTCACAAGCTATAAC (SEQ ID NO: 548), and a heavy chain CDR2 encoded by a nucleotide sequence of ATTTATCCGGGCAACGGCGAT (SEQ ID NO: 549). In embodiments, the anti-CD20 antibody further includes a light chain CDR1 encoded by a nucleotide sequence of GCGAGCAGCAGCGTGAGC (SEQ ID NO: 630), a light chain CDR2 encoded by a nucleotide sequence of GGAAGCGGCACCAGC (SEQ ID NO: 631), and a light chain CDR3 encoded by a nucleotide sequence of TGGACCAGCAACCCGCCG (SEQ ID NO: 632). In embodiments, this anti-CD20 antibody is referred to as P08E05 and is further described in the description of Table 3 below. In embodiments, the anti-CD20 antibody is encoded by a nucleic acid sequence that encodes the amino acid sequence of rituximab, except that the heavy chain CDR3 sequence is encoded by a nucleotide sequence of CGCAGCACCATGTTGGGTGGCGATTGGTATTTTAAC (SEQ ID NO: 588).

    [0215] In embodiments, the anti-CD20 antibody includes a heavy chain CDR3 amino acid sequence of RSTMLGGDWYFN (SEQ ID NO: 629). In embodiments, the anti-CD20 antibody further includes a heavy chain CDR1 amino acid sequence of YTFTSYN (SEQ ID NO: 589), and a heavy chain CDR2 amino acid sequence of IYPGNGD (SEQ ID NO: 590). In embodiments, the anti-CD20 antibody further includes the light chain CDR1 amino acid sequence of ASSSVS (SEQ ID NO: 633), the light chain CDR2 amino acid sequence of GSGTS (SEQ ID NO: 634), and the light chain CDR3 amino acid of WTSNPP (SEQ ID NO: 635). In embodiments, this anti-CD20 antibody is referred to as P08E05and is further described in the description of Table 3 below. In embodiments, the anti-CD20 antibody has the amino acid sequence of rituximab, except that the heavy chain CDR3 amino acid sequence is RSTMLGGDWYFN (SEQ ID NO: 629).

    IV. Expression Systems

    [0216] In an aspect, provided herein is an isolated nucleic acid encoding a recombinant protein as described herein.

    [0217] In embodiments, provided herein is an isolated nucleic acid encoding a recombinant protein that includes a Type I transmembrane domain and an immunoglobulin G (IgG) antibody, where the transmembrane domain is fused to the C-terminus of the IgG antibody and where the recombinant protein is resistant to cleavage by a protease. In embodiments, provided herein is isolated nucleic acid encoding a recombinant protein that includes a Type I transmembrane domain and an immunoglobulin G (IgG) antibody, where the transmembrane domain is fused to the C-terminus of the IgG antibody and where the recombinant protein includes an Fc region with a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

    [0218] In embodiments, provided herein is an expression vector including an isolated nucleic acid encoding a recombinant protein that includes a Type I transmembrane domain and an immunoglobulin G (IgG) antibody, where the transmembrane domain is fused to the C-terminus of the IgG antibody and where the recombinant protein is resistant to cleavage by a protease. In embodiments, provided herein is an expression vector including an isolated nucleic acid encoding a recombinant protein that includes a Type I transmembrane domain and an immunoglobulin G (IgG) antibody, where the transmembrane domain is fused to the C-terminus of the IgG antibody and where the recombinant protein includes an Fc region with a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

    [0219] In embodiments, provided herein is a cell containing an expression vector as described. Specifically, provided herein is a cell containing an expression vector that includes an isolated nucleic acid encoding a recombinant protein that includes a Type I transmembrane domain and an immunoglobulin G (IgG) antibody, where the transmembrane domain is fused to the C-terminus of the IgG antibody and where the recombinant protein is resistant to cleavage by a protease. Specifically, provided herein is a cell containing an expression vector that includes an isolated nucleic acid encoding a recombinant protein that includes a Type I transmembrane domain and an immunoglobulin G (IgG) antibody, where the transmembrane domain is fused to the C-terminus of the IgG antibody and where the recombinant protein includes an Fc region with a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI). In embodiments, the cell is a mammalian cell. In embodiments, the mammalian cell is a Chinese hamster ovary (CHO) cell. In embodiments, an IgG antibody encoded by an expression vector as described is expressed on the surface of a cell. In embodiments, an IgG antibody encoded by an expression vector as described is expressed on the surface of a Chinese hamster ovary (CHO) cell.

    V. Methods of Use

    [0220] In an aspect, provided herein are methods of binding a ligand to a cell surface recombinant protein, the method including contacting a ligand with a cell surface recombinant protein, where the cell surface recombinant protein includes a Type I transmembrane domain, an immunoglobulin G (IgG) antibody, where the Type I transmembrane domain is fused to the C-terminus of the IgG antibody, and where the IgG antibody is capable of binding a ligand, and further where the cell surface protein is resistant to cleavage by a protease or has higher binding affinity for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

    [0221] In embodiments of a method of binding a ligand to a cell surface protein, the cell is a CHO cell. In embodiments of a method of binding a ligand to a CHO cell surface protein, the protein is a recombinant protein as described herein. In embodiments of a method of binding a ligand to a CHO cell surface protein, the surface protein is a recombinant protein including a Type I transmembrane domain and an immunoglobulin G (IgG) antibody and where the transmembrane domain is fused to the C-terminus of the IgG antibody. In embodiments of a method of binding a ligand to a CHO cell surface protein, the recombinant protein is resistant to cleavage by a protease. In embodiments of a method of binding a ligand to a CHO cell surface protein, the recombinant protein has higher binding affinity for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

    [0222] In embodiments of a method of binding a ligand to a cell surface protein, the Type I transmembrane domain is capable of dimerization. In embodiments, the Type I transmembrane domain is selected from an EGFR, PDGFR-alpha, PDGFR-beta, HER2, HER3, HER4, FGFR1, FGFR2, FGFR3, FGFR4, VEGFR1, VEGFR2, VEGFR3, Trk-A, Trk-B, Trk-C, and insulin receptor transmembrane domain. In embodiments, the Type I transmembrane domain is an EGFR transmembrane domain. In embodiments, the Type I transmembrane domain is a PDGFR-alpha transmembrane domain. In embodiments, the Type I transmembrane domain is a PDGFR-beta transmembrane domain. In embodiments, the Type I transmembrane domain is an HER2 transmembrane domain. In embodiments, the Type I transmembrane domain is an HER3 transmembrane domain. In embodiments, the Type I transmembrane domain is an HER4 transmembrane domain. In embodiments, the Type I transmembrane domain is an FGFR1 transmembrane domain. In embodiments, the Type I transmembrane domain is an FGFR2 transmembrane domain. In embodiments, the Type I transmembrane domain is an FGFR3 transmembrane domain. In embodiments, the Type I transmembrane domain is an FGFR4 transmembrane domain. In embodiments, the Type I transmembrane domain is a VEGFR1 transmembrane domain. In embodiments, the Type I transmembrane domain is a VEGFR2 transmembrane domain. In embodiments, the Type I transmembrane domain is a VEGFR3 transmembrane domain. In embodiments, the Type I transmembrane domain is a Trk-A transmembrane domain. In embodiments, the Type I transmembrane domain is a Trk-B transmembrane domain. In embodiments, the Type I transmembrane domain is a Trk-C transmembrane domain. In embodiments, the Type I transmembrane domain is an insulin receptor transmembrane domain.

    [0223] In embodiments of a method of binding a ligand to a cell surface protein, the recombinant protein includes an IgG antibody selected from IgG1, IgG2, IgG3, and IgG4. In embodiments, the IgG antibody is IgG1 antibody. In embodiments, the IgG antibody is IgG2 antibody. In embodiments, the IgG antibody is IgG3 antibody. In embodiments, the IgG antibody is IgG4 antibody.

    [0224] In embodiments of a method of binding a ligand to a cell surface protein, the IgG antibody includes a protease resistant sequence resistant to cleavage by a protease. In embodiments, the protease is an IgG specific protease. In embodiments, the IgG specific protease is selected from IdeS and IdeZ. In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by IdeS protease. In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by IdeZ protease.

    [0225] In embodiments of a method of binding a ligand to a cell surface protein, the IgG antibody includes a protease resistant sequence resistant to cleavage by a protease specific for an ELLGGPS amino acid sequence (SEQ ID NO: 544). In embodiments, the ELLGGPS amino acid sequence specific protease, includes but is not limited to, pepsin, matrix metalloproteinase 7 (MMP7), matrix metalloproteinase 3 (MMP3), matrix metalloproteinase (MMP12), cathepsin G, and glutamyl endopeptidase V8 (GluV8). In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by pepsin. In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by matrix metalloproteinase 7 (MMP7). In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by matrix metalloproteinase 3 (MMP3). In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by matrix metalloproteinase (MMP12). In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by cathepsin G. In embodiments, the IgG antibody includes a protease resistant sequence resistant to cleavage by glutamyl endopeptidase V8 (GluV8).

    [0226] In embodiments of a method of binding a ligand to a CHO cell surface protein, the recombinant protein has higher binding affinity for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) and the recombinant protein includes an Fc region with a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) as described above.

    [0227] In an aspect, provided herein is a method of treating cancer in a patient including administering a therapeutic IgG antibody and an IgG specific protease, where the therapeutic IgG antibody is resistant to an IgG specific protease.

    [0228] Embodiments of the methods of treating cancer include a therapeutic IgG antibody, where the therapeutic IgG antibody for treating cancer is an antibody with any of the antibody characteristics described herein.

    [0229] Embodiments of the methods of treating cancer include a therapeutic IgG antibody, where the therapeutic IgG antibody includes an IgG antibody selected from IgG1, IgG2, IgG3, and IgG4. In embodiments, the therapeutic IgG antibody is IgG1 antibody. In embodiments, the therapeutic IgG antibody is IgG2 antibody. In embodiments, the therapeutic IgG antibody is IgG3 antibody. In embodiments, the IgG antibody is IgG4 antibody.

    [0230] Embodiments of the methods of treating cancer include a therapeutic IgG antibody, where the therapeutic IgG antibody includes an Fc (fragment crystallizable) region, a Fab (antigen-binding fragment) region, and a hinge region. In embodiments, the therapeutic IgG antibody includes an Fc (fragment crystallizable) region. In embodiments, the therapeutic IgG antibody includes a Fab (garment crystallizable) region. In embodiments, the therapeutic IgG antibody includes an Fc (antigen-binding fragment) region. In embodiments, the therapeutic IgG antibody includes a hinge region.

    [0231] Embodiments of the methods of treating cancer include a therapeutic IgG antibody, where the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of any one of Abciximab, Adalimumab, Alemtuzumab, Alemtuzumab, Alirocumab, Arcitumomab, Atezolizumab, Avelumab, Basiliximab, Belimumab, Besilesomab, Bevacizumab, Bevacizumab, Bezlotoxumab, Brentuximab, Brodalumab, Canakinumab, Capromab, Catumaxomab, Certolizumab pegol, Cetuximab, Daratumumab, Denosumab, Dinutuximab, Dupilumab, Durvalumab, Eculizumab, Efalizumab, Elotuzumab, Fanolesomab, Gemtuzumab ozogamicin, Golimumab, Ibritumomab tiuxetan, Idarucizumab, Imiciromab, Infliximab, Ipilimumab, Mepolizumab, Muromonab-CD3, Natalizumab, Necitumumab, Nivolumab, Nofetumomab, Obiltoxaximab, Obinutuzumab, Ocrelizumab, Ofatumumab, Olaratumab, Omalizumab, Palivizumab, Panitumumab, Pembrolizumab, Pertuzumab, Ramucirumab, Ranibizumab, Raxibacumab, Reslizumab, Rituximab, Satumomab, Secukinumab, Siltuximab, Sulesomab, Tocilizumab, Tositumomab, Trastuzumab, Trastuzumab emtansine, Ustekinumab, Vedolizumab, Volocumab, and Votumumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Abciximab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Adalimumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Alemtuzumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Alemtuzumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Alirocumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Arcitumomab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Atezolizumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Avelumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Basiliximab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Belimumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Besilesomab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Bevacizumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Bezlotoxumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Brentuximab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Brodalumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Canakinumab. In embodiments, the I therapeutic gG antibody includes a Fab region that is identical to the Fab region of Capromab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Catumaxomab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Certolizumab pegol. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Cetuximab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Daratumumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Denosumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Dinutuximab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Dupilumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Durvalumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Eculizumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Efalizumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Elotuzumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Fanolesomab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Gemtuzumab ozogamicin. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Golimumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Ibritumomab tiuxetan. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Idarucizumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Imiciromab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Infliximab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Ipilimumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Mepolizumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Muromonab-CD3. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Natalizumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Necitumumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Nivolumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Nofetumomab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Obiltoxaximab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Obinutuzumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Ocrelizumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Ofatumumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Olaratumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Omalizumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Palivizumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Panitumumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Pembrolizumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Pertuzumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Ramucirumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Ranibizumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Raxibacumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Reslizumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Rituximab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Satumomab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Secukinumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Siltuximab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Sulesomab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Tocilizumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Tositumomab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Trastuzumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Trastuzumab emtansine. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Ustekinumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Vedolizumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Volocumab. In embodiments, the therapeutic IgG antibody includes a Fab region that is identical to the Fab region of Votumumab.

    [0232] Embodiments of the methods of treating cancer include a therapeutic IgG antibody, where the therapeutic IgG antibody includes a hinge region that includes a protease resistant sequence. In embodiments, the sequence is between amino acid positions 246-252 according to Kabat numbering. In embodiments, the sequence is between positions corresponding to Kabat positions 246-252. In embodiments, the protease resistant sequence is two or more amino acids in length. In embodiments, the protease resistant sequence is three amino acids in length. In embodiments, the protease resistant sequence is four amino acids in length. In embodiments, the protease resistant sequence is five amino acids in length. In embodiments, the protease resistant sequence is six amino acids in length. In embodiments, the protease resistant sequence is seven amino acids in length. In embodiments, the protease resistant sequence includes the amino acids of SEQ ID NO: 546. In embodiments, the protease resistant sequence includes the amino acids of SEQ ID NO: 545. In embodiments, the protease resistant sequence includes the amino acids of SEQ ID NO: 547.

    [0233] Embodiments of the methods of treating cancer include a therapeutic IgG antibody, where the therapeutic IgG antibody hinge region is two amino acids in length and includes an amino acid sequence of DW, YD, QW, QE, PW, QD, or DD. In embodiments, the therapeutic IgG antibody hinge region is three amino acids in length and includes an amino acid sequence of XDW, XDW, XYD, XQW, XQE, XPW, XQD, or XDD, where X is any amino acid. In embodiments, the therapeutic IgG antibody hinge region is four amino acids in length and includes an amino acid sequence of XXDW, XXDW, XXYD, XXQW, XXQE, XXPW, XXQD, or XXDD, where X is any amino acid. In embodiments, the therapeutic IgG antibody hinge region is five amino acids in length and includes an amino acid sequence of XXXDW, XXXYD, XXXQW, XXXQE, XXXPW, XXXQD, or XXXDD, where X is any amino acid. In embodiments, the therapeutic IgG antibody hinge region is six amino acids in length and includes an amino acid sequence of XXXXDW, XXXXYD, XXXXQW, XXXXQE, XXXXPW, XXXXQD, or XXXXDD, where X is any amino acid. In embodiments, the therapeutic IgG antibody hinge region is seven amino acids in length and includes an amino acid sequence of XXXXXDW, XXXXXYD, XXXXXQW, XXXXXQE, XXXXXPW, XXXXXQD, or XXXXXDD, where X is any amino acid. In embodiments, the therapeutic IgG antibody hinge region is eight amino acids in length and includes an amino acid sequence of XXXXXXDW, XXXXXXYD, XXXXXXQW, XXXXXXQE, XXXXXXPW, XXXXXXQD, or XXXXXXDD, where X is any amino acid. In embodiments, the therapeutic IgG antibody hinge region is nine amino acids in length and includes an amino acid sequence of XXXXXXXDW, XXXXXXXYD, XXXXXXXQW, XXXXXXXQE, XXXXXXXPW, XXXXXXXQD, or XXXXXXXDD, where X is any amino acid. In embodiments, the therapeutic IgG antibody hinge region includes an amino acid sequence of XCWDW, XXCWDW, XXXCWDW, XXXXXCWDW, XXXXXCWDW, XXXXXXCWDW, XXXXXXXCWDW, ETCWDW, DSCWDW, YDCWDW, DDCWDW, DMCWDW, EHCWDW, IICWDW, DVCWDW, EFCWDW, FNCWDW, EETCWDW, EDSCWDW, EETCWDD, or EETQWDD where X is any amino acid.

    [0234] Embodiments of the methods of treating cancer include a therapeutic IgG antibody, where the therapeutic IgG antibody includes a hinge region that includes DW, YD, QW, QE, PW, QD, DD, CWDW, ETCWDW, DSCWDW, YDCWDW, DDCWDW, DMCWDW, EHCWDW, IICWDW, DVCWDW, EFCWDW, FNCWDW, EETCWDW (SEQ ID NO: 545), EDSCWDW (SEQ ID NO: 547), EETCWDD, EETCWSW (SEQ ID NO: 547), EETQWDD. In some aspects, the variants or homologs have one, two, three, four, five or six amino acid sequence identity.

    [0235] Embodiments of the methods of treating cancer include a therapeutic IgG antibody, where the therapeutic IgG antibody includes a protease resistant sequence resistant to cleavage by a protease. In embodiments, the protease is an IgG specific protease. In embodiments, the IgG specific protease is selected from IdeS and IdeZ. In embodiments, the therapeutic IgG antibody includes a protease resistant sequence resistant to cleavage by IdeS protease. In embodiments, the therapeutic IgG antibody includes a protease resistant sequence resistant to cleavage by IdeZ protease.

    [0236] Embodiments of the methods of treating cancer include a therapeutic IgG antibody, where the therapeutic IgG antibody includes a protease resistant sequence resistant to cleavage by a protease specific for an ELLGGPS amino acid sequence (SEQ ID NO: 544). In embodiments, the ELLGGPS amino acid sequence specific protease, includes but is not limited to, pepsin, matrix metalloproteinase 7 (MMP7), matrix metalloproteinase 3 (MMP3), matrix metalloproteinase (MMP12), cathepsin G, and glutamyl endopeptidase V8 (GluV8). In embodiments, the therapeutic IgG antibody includes a protease resistant sequence resistant to cleavage by pepsin. In embodiments, the therapeutic IgG antibody includes a protease resistant sequence resistant to cleavage by matrix metalloproteinase 7 (MMP7). In embodiments, the therapeutic IgG antibody includes a protease resistant sequence resistant to cleavage by matrix metalloproteinase 3 (MMP3). In embodiments, the therapeutic IgG antibody includes a protease resistant sequence resistant to cleavage by matrix metalloproteinase (MMP12). In embodiments, the therapeutic IgG antibody includes a protease resistant sequence resistant to cleavage by cathepsin G. In embodiments, the therapeutic IgG antibody includes a protease resistant sequence resistant to cleavage by glutamyl endopeptidase V8 (GluV8).

    [0237] Embodiments of the methods of treating cancer include a therapeutic IgG antibody, where the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to one or more of CD20, CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI). RI). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−12 M, about 1×10.sup.−5 M to about 1×10.sup.−11 M, about 1×10.sup.−5 M to about 1×10.sup.−10 M, about 1×10.sup.−5 M to about 1×10.sup.−9 M, about 1×10.sup.−5 M to about 1×10.sup.−8 M, about 1×10.sup.−5 M to about 1×10.sup.−7 M, about 1×10.sup.−5 M to about 1×10.sup.−6 M, about 1×10.sup.−6 M to about 1×10.sup.−13 M, about 1×10.sup.−6 M to about 1×10.sup.−12 M, about 1×10.sup.−6 M to about 1×10.sup.−11 M, about 1×10.sup.−6 M to about 1×10.sup.−10 M, about 1×10.sup.−6 M to about 1×10.sup.−9 M, about 1×10.sup.−6 M to about 1×10.sup.−8 M, about 1×10.sup.−6 M to about 1×10.sup.−7 M, about 1×10.sup.−7 M to about 1×10.sup.−13 M, about 1×10.sup.−7 M to about 1×10.sup.−12 M, about 1×10.sup.−7 M to about 1×10.sup.−11 M, about 1×10.sup.−7 M to about 1×10.sup.−10 M, about 1×10.sup.−7 M to about 1×10.sup.−9 M, about 1×10.sup.−7 M to about 1×10.sup.−8 M, about 1×10.sup.−8 M to about 1×10.sup.−13 M, about 1×10.sup.−8 M to about 1×10.sup.−12 M, about 1×10.sup.−8 M to about 1×10.sup.−11 M, about 1×10.sup.−8 M to about 1×10.sup.−10 M, about 1×10.sup.−8 M to about 1×10.sup.−9 M, about 1×10.sup.−9 M to about 1×10.sup.−13 M, about 1×10.sup.−9 M to about 1×10.sup.−12 M, about 1×10.sup.−9 M to about 1×10.sup.−11 M, about 1×10.sup.−9 M to about 1×10.sup.−10 M, about 1×10.sup.−10 M to about 1×10.sup.−13 M, about 1×10.sup.−10 M to about 1×10.sup.−12 M, about 1×10.sup.−10 M to about 1×10.sup.−11 M, about 1×10.sup.−11 M to about 1×10.sup.−13 M, about 1×10.sup.−11 M to about 1×10.sup.−12 M, or about 1×10.sup.−12 M to about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI). In embodiments, the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−5 M, about 1×10.sup.−6 M, about 1×10.sup.−7 M, about 1×10.sup.−8 M, about 1×10.sup.−9 M, about 1×10.sup.−10 M, about 1×10.sup.−11 M, about 1×10.sup.−12 M, or about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

    [0238] Embodiments of the methods of treating cancer include a therapeutic IgG antibody, where the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD32 (FcγRII). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−12 M, about 1×10.sup.−5 M to about 1×10.sup.−11 M, about 1×10.sup.−5 M to about 1×10.sup.−10 M, about 1×10.sup.−5 M to about 1×10.sup.−9 M, about 1×10.sup.−5 M to about 1×10.sup.−8 M, about 1×10.sup.−5 M to about 1×10.sup.−7 M, about 1×10.sup.−5 M to about 1×10.sup.−6 M, about 1×10.sup.−6 M to about 1×10.sup.−13 M, about 1×10.sup.−6 M to about 1×10.sup.−12 M, about 1×10.sup.−6 M to about 1×10.sup.−11 M, about 1×10.sup.−6 M to about 1×10.sup.−10 M, about 1×10.sup.−6 M to about 1×10.sup.−9 M, about 1×10.sup.−6 M to about 1×10.sup.−8 M, about 1×10.sup.−6 M to about 1×10.sup.−7 M, about 1×10.sup.−7 M to about 1×10.sup.−13 M, about 1×10.sup.−7 M to about 1×10.sup.−12 M, about 1×10.sup.−7 M to about 1×10.sup.−11 M, about 1×10.sup.−7 M to about 1×10.sup.−10 M, about 1×10.sup.−7 M to about 1×10.sup.−9 M, about 1×10.sup.−7 M to about 1×10.sup.−8 M, about 1×10.sup.−8 M to about 1×10.sup.−13 M, about 1×10.sup.−8 M to about 1×10.sup.−12 M, about 1×10.sup.−8 M to about 1×10.sup.−11 M, about 1×10.sup.−8 M to about 1×10.sup.−10 M, about 1×10.sup.−8 M to about 1×10.sup.−9 M, about 1×10.sup.−9 M to about 1×10.sup.−13 M, about 1×10.sup.−9 M to about 1×10.sup.−12 M, about 1×10.sup.−9 M to about 1×10.sup.−11 M, about 1×10.sup.−9 M to about 1×10.sup.−10 M, about 1×10.sup.−10 M to about 1×10.sup.−13 M, about 1×10.sup.−10 M to about 1×10.sup.−12 M, about 1×10.sup.−10 M to about 1×10.sup.−11 M, about 1×10.sup.−11 M to about 1×10.sup.−13 M, about 1×10.sup.−11 M to about 1×10.sup.−12 M, or about 1×10.sup.−12 M to about 1×10.sup.−13 M to CD32 (FcγRII). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−5 M, about 1×10.sup.−6 M, about 1×10.sup.−7 M, about 1×10.sup.−8 M, about 1×10.sup.−9 M, about 1×10.sup.−10 M, about 1×10.sup.−11 M, about 1×10.sup.−12 M, or about 1×10.sup.−13 M to CD32 (FcγRII). In embodiments, the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−5 M to CD32 (FcγRII). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−6 M to CD32 (FcγRII). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−7 M to CD32 (FcγRII). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−8 M to CD32 (FcγRII). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−9 M to CD32 (FcγRII). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−10 M to CD32 (FcγRII). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−11 M to CD32 (FcγRII). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−12 M to CD32 (FcγRII). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−13 M to CD32 (FcγRII).

    [0239] Embodiments of the methods of treating cancer include a therapeutic IgG antibody, where the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD16 (FcγRIII). In embodiments, the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD16 (FcγRIII). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−12 M, about 1×10.sup.−5 M to about 1×10.sup.−11 M, about 1×10.sup.−5 M to about 1×10.sup.−10 M, about 1×10.sup.−5 M to about 1×10.sup.−9 M, about 1×10.sup.−5 M to about 1×10.sup.−8 M, about 1×10.sup.−5 M to about 1×10.sup.−7 M, about 1×10.sup.−5 M to about 1×10.sup.−6 M, about 1×10.sup.−6 M to about 1×10.sup.−13 M, about 1×10.sup.−6 M to about 1×10.sup.−12 M, about 1×10.sup.−6 M to about 1×10.sup.−11 M, about 1×10.sup.−6 M to about 1×10.sup.−10 M, about 1×10.sup.−6 M to about 1×10.sup.−9 M, about 1×10.sup.−6 M to about 1×10.sup.−8 M, about 1×10.sup.−6 M to about 1×10.sup.−7 M, about 1×10.sup.−7 M to about 1×10.sup.−13 M, about 1×10.sup.−7 M to about 1×10.sup.−12 M, about 1×10.sup.−7 M to about 1×10.sup.−11 M, about 1×10.sup.−7 M to about 1×10.sup.−10 M, about 1×10.sup.−7 M to about 1×10.sup.−9 M, about 1×10.sup.−7 M to about 1×10.sup.−8 M, about 1×10.sup.−8 M to about 1×10.sup.−13 M, about 1×10.sup.−8 M to about 1×10.sup.−12 M, about 1×10.sup.−8 M to about 1×10.sup.−11 M, about 1×10.sup.−8 M to about 1×10.sup.−10 M, about 1×10.sup.−8 M to about 1×10.sup.−9 M, about 1×10.sup.−9 M to about 1×10.sup.−13 M, about 1×10.sup.−9 M to about 1×10.sup.−12 M, about 1×10.sup.−9 M to about 1×10.sup.−11 M, about 1×10.sup.−9 M to about 1×10.sup.−10 M, about 1×10.sup.−10 M to about 1×10.sup.−13 M, about 1×10.sup.−10 M to about 1×10.sup.−12 M, about 1×10.sup.−10 M to about 1×10.sup.−11 M, about 1×10.sup.−11 M to about 1×10.sup.−13 M, about 1×10.sup.−11 M to about 1×10.sup.−12 M, or about 1×10.sup.−12 M to about 1×10.sup.−13 M to CD16 (FcγRIII). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−5 M, about 1×10.sup.−6 M, about 1×10.sup.−7 M, about 1×10.sup.−8 M, about 1×10.sup.−9 M, about 1×10.sup.−10 M, about 1×10.sup.−11 M, about 1×10.sup.−12 M, or about 1×10.sup.−13 M to CD16 (FcγRIII). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−5 M to CD16 (FcγRIII). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−6 M to CD16 (FcγRIII). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−7 M to CD16 (FcγRIII). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−8 M to CD16 (FcγRIII). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−9 M to CD16 (FcγRIII). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−10 M to CD16 (FcγRIII). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−11 M to CD16 (FcγRIII). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−12 M to CD16 (FcγRIII). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−13 M to CD16 (FcγRIII).

    [0240] Embodiments of the methods of treating cancer include a therapeutic IgG antibody, where the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD64 (FcγRI). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD64 (FcγRI). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−12 M, about 1×10.sup.−5 M to about 1×10.sup.−11 M, about 1×10.sup.−5 M to about 1×10.sup.−10 M, about 1×10.sup.−5 M to about 1×10.sup.−9 M, about 1×10.sup.−5 M to about 1×10.sup.−8 M, about 1×10.sup.−5 M to about 1×10.sup.−7 M, about 1×10.sup.−5 M to about 1×10.sup.−6 M, about 1×10.sup.−6 M to about 1×10.sup.−13 M, about 1×10.sup.−6 M to about 1×10.sup.−12 M, about 1×10.sup.−6 M to about 1×10.sup.−11 M, about 1×10.sup.−6 M to about 1×10.sup.−10 M, about 1×10.sup.−6 M to about 1×10.sup.−9 M, about 1×10.sup.−6 M to about 1×10.sup.−8 M, about 1×10.sup.−6 M to about 1×10.sup.−7 M, about 1×10.sup.−7 M to about 1×10.sup.−13 M, about 1×10.sup.−7 M to about 1×10.sup.−12 M, about 1×10.sup.−7 M to about 1×10.sup.−11 M, about 1×10.sup.−7 M to about 1×10.sup.−10 M, about 1×10.sup.−7 M to about 1×10.sup.−9 M, about 1×10.sup.−7 M to about 1×10.sup.−8 M, about 1×10.sup.−8 M to about 1×10.sup.−13 M, about 1×10.sup.−8 M to about 1×10.sup.−12 M, about 1×10.sup.−8 M to about 1×10.sup.−11 M, about 1×10.sup.−8 M to about 1×10.sup.−10 M, about 1×10.sup.−8 M to about 1×10.sup.−9 M, about 1×10.sup.−9 M to about 1×10.sup.−13 M, about 1×10.sup.−9 M to about 1×10.sup.−12 M, about 1×10.sup.−9 M to about 1×10.sup.−11 M, about 1×10.sup.−9 M to about 1×10.sup.−10 M, about 1×10.sup.−10 M to about 1×10.sup.−13 M, about 1×10.sup.−10 M to about 1×10.sup.−12 M, about 1×10.sup.−10 M to about 1×10.sup.−11 M, about 1×10.sup.−11 M to about 1×10.sup.−13 M, about 1×10.sup.−11 M to about 1×10.sup.−12 M, or about 1×10.sup.−12 M to about 1×10.sup.−13 M to CD64 (FcγRI). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−5 M, about 1×10.sup.−6 M, about 1×10.sup.−7 M, about 1×10.sup.−8 M, about 1×10.sup.−9 M, about 1×10.sup.−10 M, about 1×10.sup.−11 M, about 1×10.sup.−12 M, or about 1×10.sup.−13 M to CD64 (FcγRI). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−5 M to CD64 (FcγRI). In embodiments, t the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−6 M to CD64 (FcγRI). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−7 M to CD64 (FcγRI). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−8 M to CD64 (FcγRI). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−9 M to CD64 (FcγRI). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−10 M to CD64 (FcγRI). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−11 M to CD64 (FcγRI). In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−12 M to CD64 (FcγRI).

    [0241] In embodiments, the Fc region of the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−13 M to CD64 (FcγRI).

    [0242] In an aspect, provided herein are methods of enhancing efficacy of therapeutic IgG antibody in a subject including mutating the hinge region of a therapeutic IgG antibody to produce a variant of the therapeutic IgG antibody that is resistant to a protease according to any of the various embodiments described herein.

    [0243] In embodiments of a method of enhancing efficacy of therapeutic IgG antibody in a subject, the therapeutic IgG antibody is resistant to a protease, where the protease is an IgG specific protease. In embodiments, the IgG specific protease is selected from IdeS and IdeZ. In embodiments, the IgG specific protease is IdeS protease. In embodiments, the IgG specific protease is IdeZ protease. In embodiments, the protease is specific for an ELLGGPS amino acid sequence (SEQ ID NO: 544). In embodiments, the ELLGGPS amino acid sequence specific protease is selected from pepsin, matrix metalloproteinase 7 (MMP7), matrix metalloproteinase 3 (MMP3), matrix metalloproteinase (MMP12), cathepsin G, and glutamyl endopeptidase V8 (GluV8). In embodiments, the ELLGGPS amino acid sequence specific protease is pepsin. In embodiments, the ELLGGPS amino acid sequence specific protease is matrix metalloproteinase 7 (MMP7). In embodiments, the ELLGGPS amino acid sequence specific protease is matrix metalloproteinase 3 (MMP3). In embodiments, the ELLGGPS amino acid sequence specific protease is matrix metalloproteinase (MMP12). In embodiments, the ELLGGPS amino acid sequence specific protease is cathepsin G. In embodiments, the ELLGGPS amino acid sequence specific protease is glutamyl endopeptidase V8 (GluV8).

    [0244] In embodiments of a method of enhancing efficacy of therapeutic IgG antibody in a subject, the therapeutic IgG antibody is any antibody as described above and herein. Further, the therapeutic IgG antibody is an antibody selected from Herceptin and any other IgG therapeutic mAb that relies on the Fc region of the IgG antibody binding to FcγR of any innate immune cell (e.g., NK cells, monocytes, macrophages, dendritic cells, and granulocytes) for its efficacy.

    [0245] Further disclosed herein are methods of using proteins, antibodies, fusion proteins, antibody fragments, antigens and Chinese Hamster Ovary (CHO) cells as described herein. In some embodiments, the methods relate to using proteins, antibodies, fusion proteins, antibody fragments, antigens and CHO cells for rapid optimization of an antibody-antigen interactions via affinity selection. In some embodiments, the methods relate to using proteins, antibodies, fusion proteins, antibody fragments, antigens and CHO cells as described herein to improve efficacy of a therapeutic antibody where a portion or full therapeutic effect is mediated via ADCC or ADCP.

    [0246] In an aspect, provided herein are methods of generating an IgG antibody with a hinge region resistant to an IgG specific protease.

    [0247] In an aspect, provided herein are methods of generating an IgG antibody with a hinge region able to bind CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) with higher affinity.

    [0248] In an aspect, provided herein are methods of generating an IgG antibody with a hinge region able to bind CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) with lower affinity.

    [0249] In an aspect, provided herein are methods of generating an IgG antibody with hinge regions that are resistant to the IgG specific protease and are able to bind CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) with higher affinity

    [0250] In an aspect, provided herein are methods of generating an IgG antibody with hinge regions that are resistant to the IgG specific protease and are able to bind CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) with lower affinity.

    [0251] In an aspect, provided herein are methods of generating an IgG antibody with varied affinity to its specific antigen.

    [0252] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.

    P-Embodiments

    [0253] Embodiment P-1. An immunoglobulin G (IgG) antibody comprising a Fab region and an Fc region connected through a hinge region, wherein the hinge region is resistant to cleavage by a protease.

    [0254] Embodiment P-2. The IgG antibody of Embodiment 1, wherein the IgG antibody is an IgG1 antibody, an IgG2 antibody, an IgG3 antibody, or an IgG4 antibody.

    [0255] Embodiment P-3. The IgG antibody of any one of Embodiments 1-2, wherein the IgG antibody is an IgG1 antibody.

    [0256] Embodiment P-4. The IgG antibody of any one of Embodiments 1-2, wherein the IgG antibody is an IgG2 antibody.

    [0257] Embodiment P-5. The IgG antibody of any one of Embodiments 1-2, wherein the IgG antibody is an IgG3 antibody.

    [0258] Embodiment P-6. The IgG antibody of any one of Embodiments 1-2, wherein the IgG antibody is an IgG4 antibody.

    [0259] Embodiment P-7. The IgG antibody of Embodiment 6, wherein the hinge region comprises a protease resistant sequence between amino acid positions 246-252 according to the EU numbering of Kabat.

    [0260] Embodiment P-8. The IgG antibody of Embodiment 7, wherein the protease resistant sequence is 2 or more amino acids in length.

    [0261] Embodiment P-9. The IgG antibody of Embodiment 7, wherein the protease resistant sequence is 3 amino acids in length.

    [0262] Embodiment P-10. The IgG antibody of Embodiment 7, wherein the protease resistant sequence is 4 amino acids in length.

    [0263] Embodiment P-11. The IgG antibody of Embodiment 7, wherein the protease resistant sequence is 5 amino acids in length.

    [0264] Embodiment P-12. The IgG antibody of Embodiment 7, wherein the protease resistant sequence is 6 amino acids in length.

    [0265] Embodiment P-13. The IgG antibody of Embodiment 7, wherein the protease resistant sequence is 7 amino acids in length.

    [0266] Embodiment P-14. The IgG antibody of Embodiment 7, wherein the protease resistant sequence comprises the amino acids of SEQ ID NO: 545.

    [0267] Embodiment P-15. The IgG antibody of any one of Embodiments 1-14, wherein the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

    [0268] Embodiment P-16. The IgG antibody of any one of Embodiments 1-15, wherein the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD32.

    [0269] Embodiment P-17. The IgG antibody of any one of Embodiments 1-16, wherein the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD16.

    [0270] Embodiment P-18. The IgG antibody of any one of Embodiments 1-17, wherein the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD64.

    [0271] Embodiment P-19. The IgG antibody of any one of Embodiments 1-18, wherein the protease is an IgG specific protease.

    [0272] Embodiment P-20. The IgG antibody of Embodiment 19, wherein the IgG specific protease is selected from IdeS and IdeZ

    [0273] Embodiment P-21. The IgG antibody of Embodiment 20, wherein the protease is IdeS.

    [0274] Embodiment P-22. The IgG antibody of Embodiment 20, wherein the protease is IdeZ.

    [0275] Embodiment P-23. The IgG antibody of any one of Embodiments 1-18, wherein the protease is selected from pepsin, matrix metalloproteinase 7 (MMP7), matrix metalloproteinase 3 (MMP3), matrix metalloproteinase (MMP12), cathepsin G, and glutamyl endopeptidase V8 (GluV8).

    [0276] Embodiment P-24. An immunoglobulin G (IgG) antibody, wherein the antibody comprises a Fab region and an Fc region connected through a hinge region, wherein the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

    [0277] Embodiment P-25. The IgG antibody of Embodiment 24, wherein the Fc region comprises one or more amino acid substitutions conferring higher binding affinity for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) compared to a wild type Fc.

    [0278] Embodiment P-26. The IgG antibody of Embodiment 25, wherein the Fc region comprises an amino acid substitution selected from S252D, I351E, and A349L according to the EU numbering of Kabat and wherein the substitution confers higher binding affinity for CD16 (FcγRIII) compared to wild type.

    [0279] Embodiment P-27. The IgG antibody of Embodiment 26, wherein the Fc region comprises amino acid substitution S252D.

    [0280] Embodiment P-28. The IgG antibody of Embodiment 26, wherein the Fc region comprises amino acid substitution I351E.

    [0281] Embodiment P-29. The IgG antibody of Embodiment 26, wherein the Fc region comprises amino acid substitutions S252D and I351E.

    [0282] Embodiment P-30. The IgG antibody of Embodiment 26, wherein the Fc region comprises amino acid substitutions S252D, I351E, and A349.

    [0283] Embodiment P-31. The IgG antibody of any one of Embodiments 24 or 25, wherein the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD32.

    [0284] Embodiment P-32. The IgG antibody of any one of Embodiments 24-30, wherein the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD16.

    [0285] Embodiment P-33. The IgG antibody of any one of Embodiments 24 or 25, wherein the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD64.

    [0286] Embodiment P-34. The IgG antibody of any one of Embodiments 24-33, wherein the antibody is resistant to protease cleavage.

    [0287] Embodiment P-35. The IgG antibody of Embodiment 34, wherein the protease is an IgG specific protease.

    [0288] Embodiment P-36. The IgG antibody of Embodiment 35, wherein the IgG specific protease is IdeS.

    [0289] Embodiment P-37. The IgG antibody of Embodiment 35, wherein the IgG specific protease is IdeZ.

    [0290] Embodiment P-38. The IgG antibody of Embodiment 34, wherein the protease is selected from pepsin, matrix metalloproteinase 7 (MMPI), matrix metalloproteinase 3 (MMP3), matrix metalloproteinase (MMP12), cathepsin G, and glutamyl endopeptidase V8 (GluV8).

    [0291] Embodiment P-39. The IgG antibody of any one of Embodiments 34-38, wherein the hinge region comprises a protease resistant sequence at amino acid positions 246-252 according to the EU numbering of Kabat and that is 2 or more amino acids in length.

    [0292] Embodiment P-40. The IgG antibody of Embodiment 39, wherein the protease resistant sequence is 3 amino acids in length.

    [0293] Embodiment P-41. The IgG antibody of Embodiment 39, wherein the protease resistant sequence is 4 amino acids in length.

    [0294] Embodiment P-42. The IgG antibody of Embodiment 39, wherein the protease resistant sequence is 5 amino acids in length.

    [0295] Embodiment P-43. The IgG antibody of Embodiment 39, wherein the protease resistant sequence is 6 amino acids in length.

    [0296] Embodiment P-44. The IgG antibody of Embodiment 39, wherein the protease resistant sequence is 7 amino acids in length.

    [0297] Embodiment P-45. The IgG antibody of Embodiment 39, wherein the hinge region comprises the amino acids of SEQ ID NO: 545.

    [0298] Embodiment P-46. A recombinant protein comprising:

    [0299] a Type I transmembrane domain; and

    [0300] b. an immunoglobulin G (IgG) antibody;

    [0301] wherein the transmembrane domain is fused to the C-terminus of the IgG antibody; and

    [0302] wherein the recombinant protein is resistant to cleavage by a protease.

    [0303] Embodiment P-47. The recombinant protein of Embodiment 46, wherein the Type I transmembrane domain is capable of dimerization.

    [0304] Embodiment P-48. The recombinant protein of any one of claim 46 or 47, wherein the Type I transmembrane domain is selected from an EGFR, PDGFR-alpha, PDGFR-beta, HER2, HER3, HER4, FGFR1, FGFR2, FGFR3, FGFR4, VEGFR1, VEGFR2, VEGFR3, Trk-A, Trk-B, Trk-C, and insulin receptor transmembrane domain.

    [0305] Embodiment P-49. The recombinant protein of any one of Embodiments 46-48, wherein the Type I transmembrane domain is an EGFR transmembrane domain.

    [0306] Embodiment P-50. The recombinant protein of any one of Embodiments 46-49, wherein the IgG antibody is an IgG1 antibody, an IgG2 antibody, an IgG3 antibody, or an IgG4 antibody.

    [0307] Embodiment P-51. The recombinant protein of any one of Embodiments 46-49, wherein the IgG domain is an IgG1 antibody.

    [0308] Embodiment P-52. The recombinant protein of any one of Embodiments 46-49, wherein the IgG domain is an IgG2 antibody.

    [0309] Embodiment P-53. The recombinant protein of any one of Embodiments 46-49, wherein the IgG domain is an IgG3 antibody.

    [0310] Embodiment P-54. The recombinant protein of any one of Embodiments 46-49, wherein the IgG domain is an IgG4 antibody.

    [0311] Embodiment P-55. The recombinant protein of any one of Embodiments 46-54, wherein the IgG antibody comprises an Fc (fragment crystallizable) region, a Fab (antigen-binding fragment) region, and a hinge region.

    [0312] Embodiment P-56. The recombinant protein of Embodiment 55, wherein the IgG antibody comprises an Fc region.

    [0313] Embodiment P-57. The recombinant protein of Embodiment 55, wherein the IgG antibody comprises a hinge region.

    [0314] Embodiment P-58. The recombinant protein of any one of Embodiments 55-57, wherein the hinge region comprises a protease resistant sequence between amino acid positions 246-252 according to the EU numbering of Kabat and that is 2 or more amino acids in length.

    [0315] Embodiment P-59. The recombinant protein of Embodiment 58, wherein the protease resistant sequence is 3 amino acids in length.

    [0316] Embodiment P-60. The recombinant protein of Embodiment 58, wherein the protease resistant sequence is 4 amino acids in length.

    [0317] Embodiment P-61. The recombinant protein of Embodiment 58, wherein the protease resistant sequence is 5 amino acids in length.

    [0318] Embodiment P-62. The recombinant protein of Embodiment 58, wherein the protease resistant sequence is 6 amino acids in length.

    [0319] Embodiment P-63. The recombinant protein of Embodiment 58, wherein the protease resistant sequence is 7 amino acids in length.

    [0320] Embodiment P-64. The recombinant protein of Embodiment 58, wherein the hinge region comprises the amino acids of SEQ ID NO: 545.

    [0321] Embodiment P-65. The recombinant protein of any one of Embodiments 46-64, wherein the recombinant protein comprises an Fc region with a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

    [0322] Embodiment P-66. The recombinant protein of any one of Embodiments 46-65, wherein the recombinant protein comprises an Fc region with a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD32.

    [0323] Embodiment P-67. The recombinant protein of any one of Embodiments 46-66, wherein the recombinant protein comprises an Fc region with a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD16.

    [0324] Embodiment P-68. The recombinant protein of any one of Embodiments 46-67, wherein the recombinant protein comprises an Fc region with a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD64.

    [0325] Embodiment P-69. The recombinant protein of any one of Embodiments 46-68, wherein the protease is an IgG specific protease.

    [0326] Embodiment P-70. The recombinant protein of Embodiment 69, wherein the IgG specific protease is selected from IdeS and IdeZ.

    [0327] Embodiment P-71. The recombinant protein of Embodiment 70, wherein the IgG specific protease is IdeS.

    [0328] Embodiment P-72. The recombinant protein of Embodiment 70, wherein the IgG specific protease is IdeZ.

    [0329] Embodiment P-73. The recombinant protein of Embodiment 69, wherein the protease is selected from pepsin, matrix metalloproteinase 7 (MMPI), matrix metalloproteinase 3 (MMP3), matrix metalloproteinase (MMP12), cathepsin G, and glutamyl endopeptidase V8 (GluV8).

    [0330] Embodiment P-74. A recombinant protein comprising:

    [0331] a. a Type I-transmembrane domain; and

    [0332] b. an immunoglobulin G (IgG) antibody; [0333] wherein the transmembrane domain is fused to the C-terminus of the IgG antibody; and wherein the recombinant protein comprises an Fc region with a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

    [0334] Embodiment P-75. The recombinant protein of Embodiment 74, wherein the Type I transmembrane domain is capable of dimerization.

    [0335] Embodiment P-76. The recombinant protein of any one of Embodiments 74 or 75, wherein the Type I transmembrane domain is selected from an EGFR, PDGFR-alpha, PDGFR-beta, HER2, HER3, HER4, FGFR1, FGFR2, FGFR3, FGFR4, VEGFR1, VEGFR2, VEGFR3, Trk-A, Trk-B, Trk-C, and insulin receptor transmembrane domain.

    [0336] Embodiment P-77. The recombinant protein of any one of Embodiments 74-76, wherein the Type I transmembrane domain is an EGFR transmembrane domain.

    [0337] Embodiment P-78. The recombinant protein of any one of Embodiments 74-77, wherein the IgG antibody is an IgG1 antibody, an IgG2 antibody, an IgG3 antibody, or an IgG4 antibody.

    [0338] Embodiment P-79. The recombinant protein of any one of Embodiments 74-78, wherein the IgG domain is an IgG1 antibody.

    [0339] Embodiment P-80. The recombinant protein of any one of Embodiments 74-78, wherein the IgG domain is an IgG2 antibody.

    [0340] Embodiment P-81. The recombinant protein of any one of Embodiments 74-78, wherein the IgG domain is an IgG3 antibody.

    [0341] Embodiment P-82. The recombinant protein of any one of Embodiments 74-78, wherein the IgG domain is an IgG4 antibody.

    [0342] Embodiment P-83. The recombinant protein of any one of Embodiments 74-82, wherein the Fc region comprises one or more amino acids conferring high binding affinity for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI) compared to wild type Fc.

    [0343] Embodiment P-84. The recombinant protein of any one of Embodiments 74-83, wherein the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD32.

    [0344] Embodiment P-85. The recombinant protein of any one of Embodiments 74-83, wherein the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD16.

    [0345] Embodiment P-86. The recombinant protein of any one of Embodiments 74-83, wherein the Fc region has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to CD64.

    [0346] Embodiment P-87. The recombinant protein of any one of Embodiments 74-85, wherein the recombinant protein is resistant to protease cleavage.

    [0347] Embodiment P-88. The recombinant protein of Embodiment 87, wherein the protease is an IgG specific protease.

    [0348] Embodiment P-89. The recombinant protein of Embodiment 88, wherein the IgG protease is IdeS.

    [0349] Embodiment P-90. The recombinant protein of Embodiment 88, wherein the IgG protease is IdeZ.

    [0350] Embodiment P-91. The recombinant protein of Embodiment 87, wherein the protease is selected from pepsin, matrix metalloproteinase 7 (MMPI), matrix metalloproteinase 3 (MMP3), matrix metalloproteinase (MMP12), cathepsin G, and glutamyl endopeptidase V8 (GluV8).

    [0351] Embodiment P-92. The recombinant protein of any one of Embodiments 74-91, wherein the recombinant protein comprises a hinge region and wherein the hinge region comprises a protease resistant sequence at amino acid positions 246-252 according to the EU numbering of Kabat and that is 2 or more amino acids in length.

    [0352] Embodiment P-93. The recombinant protein of Embodiment 92, wherein the protease resistant sequence is 3 amino acids in length.

    [0353] Embodiment P-94. The recombinant protein of Embodiment 92, wherein the protease resistant sequence is 4 amino acids in length.

    [0354] Embodiment P-95. The recombinant protein of Embodiment 92, wherein the protease resistant sequence is 5 amino acids in length.

    [0355] Embodiment P-96. The recombinant protein of Embodiment 92, wherein the protease resistant sequence is 6 amino acids in length.

    [0356] Embodiment P-97. The recombinant protein of Embodiment 92, wherein the protease resistant sequence is 7 amino acids in length.

    [0357] Embodiment P-98. The recombinant protein of Embodiment 92, wherein the hinge region comprises the amino acids of SEQ ID NO: 545.

    [0358] Embodiment P-99. An isolated nucleic acid encoding the recombinant protein of any one of Embodiments 46-98.

    [0359] Embodiment P-100. An expression vector comprising the nucleic acid of Embodiment 99.

    [0360] Embodiment P-101. A cell comprising the expression vector of Embodiment 100.

    [0361] Embodiment P-102. The cell of Embodiment 101, wherein the cell is a eukaryotic cell.

    [0362] Embodiment P-103. The cell of Embodiment 101 or 102, wherein the cell is a Chinese hamster ovary cell.

    [0363] Embodiment P-104. The cell of any one of Embodiments 101-103, wherein an IgG antibody is expressed at the surface of the cell.

    [0364] Embodiment P-105. An anti-CD20 antibody comprising the CDRs as set forth in FIG. 3.

    [0365] Embodiment P-106. A method of binding a ligand to a CHO cell surface recombinant protein, the method comprising contacting a ligand with a CHO cell surface recombinant protein, wherein said CHO cell surface recombinant protein comprises:

    [0366] i. an EGFR-transmembrane domain; and

    [0367] ii. an immunoglobulin G (IgG) antibody; [0368] wherein the EGFR-transmembrane domain is fused to the C-terminus of the IgG domain; and [0369] wherein the IgG antibody is capable of binding a ligand; and [0370] wherein the CHO cell surface protein is resistant to cleavage by an IgG-specific protease or has higher binding affinity for one or more of CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

    [0371] Embodiment P-107. A method of treating cancer in a patient comprising administering a therapeutic IgG antibody and an IgG specific protease, wherein the therapeutic IgG antibody is resistant to an IgG specific protease.

    [0372] Embodiment P-108. The method of Embodiment 107, wherein the therapeutic IgG antibody has a dissociation constant of about 1×10.sup.−5 M to about 1×10.sup.−13 M to one or more of CD20, CD32 (FcγRII), CD16 (FcγRIII), and CD64 (FcγRI).

    [0373] Embodiment P-109. A method of enhancing efficacy of therapeutic IgG antibody in a subject comprising administering to the subject an IgG specific protease and a therapeutic IgG that is resistant to the IgG specific protease.

    [0374] Embodiment P-110. The method of Embodiment 109, wherein the IgG specific protease is selected from IdeS and IdeZ

    EXAMPLES

    Example 1

    IgG Antibodies and Endopeptidase

    [0375] FIG. 1 schematically illustrates that human immune cells are naturally coated with endogenous IgG, which prevents interactions between a therapeutic mAb and FcγRs expressed on the surface of the human immune cells. This thereby limits the binding of therapeutic mAb to FcγRs thus limits the efficacy of the therapeutic mAb.

    [0376] The flow cytometric data in FIG. 2 demonstrates that human NK cells are naturally coated with IgG molecules, which can be removed by incubation with the IdeS enzyme. Human PBMCs were digested with IdeS for 30 minutes at 37° C. and stained with antibodies against linage markers or against human IgG Fc. Note CD3+ T cells do not express FcγRs and therefore do not bind human IgG under any condition.

    [0377] FIG. 3 schematically illustrates a strategy for enhancing therapeutic efficiency of mAbs. Panel (a) depicts FcγRs on immune cells are normally occupied by endogenous IgG; panel (b) shows IdeS digestion can remove endogenous IgG and free-up FcγR binding sites for infused therapeutic mAbs, which are engineered to be resistant to IdeS and retain FcγR binding function; (c) shows infused therapeutic mAb may first bind onto unoccupied FcγR or as depicted in (d) may first bind tumor-associated antigen expressed on the cancer cell. Regardless, once the antigen-mAb-FcγR crosslink, the FcγR+ cell undergoes immune activation (f). The flow chart illustrates that the more FcγRs that are unoccupied and therefore available for binding the therapeutic mAb, the more tumor cells are eliminated.

    Example 2

    Novel Therapeutic Antibody Screening and Engineering Platform

    [0378] A number of FDA approved antibody therapeutics developed thus far are produced in Chinese hamster ovarian (CHO) cells, because recombinant proteins produced by CHO cells possess post translational modifications that are compatible and bioactive in humans. Therefore, CHO cells represent an ideal system for therapeutic antibody screening and engineering.

    [0379] The experiments conducted herein aimed to develop a method to display full length, fragments, or combinations of Ig- and/or Fc-containing fusion proteins on the surface of CHO cells.

    [0380] A method of selecting one subset of CHO cell surface expressed EGFR-TMH/mAb and EGFR-TMF/FcγR fusion proteins via flow cytometry was developed. Each IgG or Fc-containing molecule expressed on the surface of the CHO cells is fully functional, including individual IgG domains, Fc domains, partial antibodies, partial receptors, full length antibody, full length antibody, or a combination of individual IgG/Fc domains behaves similarly to the analogous soluble construct (removing the EGFR-TMH portion). Flow cytometry was employed as the method to study different portions of these molecules, identifying their physical and chemical characteristics for an application of interest.

    [0381] EGFR-TMH (SEQ ID NO: 6) was tested to optimize surface expression of IgG in CHO cells. As shown in the top row of FIG. 4, results for surface expression of IgG-Fc with a GFP reporter are presented. In the bottom row of FIG. 4, results for surface expression of full length rituximab with a GFP marker are presented. The fluorescence of GFP on the X axis is proportional to the surface density expression of Fc and of rituximab on the surface of the CHO cells. Each of these two IgG molecules expressed on the surface of the CHO cells was as functional as soluble IgG, allowing use of flow cytometry to study different portions of the IgG. This eliminates the need for protein purification to optimize mAb binding properties to their cognate antigen and to the three classes of Fc-gamma receptors (FcγR) expressed on the surface of innate immune effector cells.

    [0382] The hinge region of IgG is almost untouched by previous studies because it is highly flexible and the two hinges bind FcγR tightly and asymmetrically. IgG1 FcΔ16 was made by deleting the WT hinge region sequence ELLGGPS. Amino acids were added to the N-terminus of IgG1 FcΔ16 and variants that gained CD16α binding were selected for next round modification. Several de novo hinge regions were generated using the CHO cell display platform which shows higher affinity to FcγRs than the original (or wild type) hinge region. It is important to note that this technology is also a platform technology in that it can be used to modify any antibody for which the sequence is known in order to obtain variants with increased or decreased binding affinity for FcγRs.

    [0383] FIG. 5 illustrates the generation of new lower hinge for IgG1Fc with enhanced binding affinity to CD16α and resistance to cleavage by IdeS and IdeZ. Amino acids were added in a stepwise fashion to the N-terminus of IgG1 Δ16 (SEQ ID NO: 16), which does not bind CD16α. Clones acquiring CD16α binding were selected for by sequentially attaching more amino acids step by step to increase binding affinity. The 7AA de novo hinge regions that were tested, found to be resistant to IdeS/Z and showed similar or higher binding affinity to CD16α than the wild type sequence were engrafted to the mAb.

    [0384] The wild type lower hinge region of human IgG1 binds to FcγRIII CD16α with relatively low affinity (FIG. 6). Panel (A) shows human IgG1 Fc Δ16 (SEQ ID NO: 16), which lacks of the wild type hinge (ELLGGPS; SEQ ID NO: 544), lost binding to FcγRIII CD16. Four-hundred (400) combinations of 2 amino acids were added to the N-terminus of human IgG1 Fc Δ16, and individually measured for their binding to CD16α and other FcγRs. Among all the sequences that acquired CD16a binding, DW was selected for next round optimizations which lead to the identification of CWDW, and subsequently other 6 and 7 AA sequences.

    [0385] FIG. 6 illustrates the stepwise acquisition of CD16α binding by sequentially adding AAs to IgG1FcΔ16 at its N-terminus. FIG. 6A show binding affinity of various constructs of human IgG1FcΔ16 fused with EGFR transmembrane helix domain and displayed as a type 1 membrane protein on the CHO cell surface. Due to the lack of a hinge region, IgG1FcΔ16 does not bind human CD16α. Four hundred 2AA combinations were added at the N-terminus of IgG1FcΔ16 and individually assayed for their binding to CD16a by rapid flow cytometric analysis. The first two AA, DW, were selected for further optimization and led to the identification of 4AA, 6AA and 7AA de novo hinges with increasing CD16a binding as shown. These experiments were performed in the presence of IdeS, demonstrating resistance of the novel IgG1 hinge regions to cleavage. FIG. 6B shows individual panels of all the positive clones as more AAs were added.

    [0386] FIG. 7 shows data collected from CHO cells transfected with rituximab-EGFR. The hinge region of the rituximab is composed of either the wild type (WT) hinge (ELLGGPS; SEQ ID NO: 544), or one of two de novo IdeS/IdeZ-resistant hinges: EETCWDW, which has higher affinity for FcγR CD16α than the WT or EDSCWDW, which has lower affinity for FcγR CD16α than the WT. The assessment of surface IgG1 expression on the CHO cells was accomplished using soluble fluorescent labeled CD16α Val176 binding and fluorescent labeled anti-human Fc antibody (that binds a region of the Fc not affected by the cleavage). CD16α Val176 and Phe176 are polymorphisms with different affinity for IgG1. Transfected CHO cells were either incubated with media alone (control, upper row) or digested with IdeZ at 37° C. for 30 minutes before staining (lower row). The binding affinities of IgG1 for CD16α are indicated in the upper left-hand quadrant of each histogram. As noted in the lower row, incubation with IdeZ resulted in cleavage of the WT hinge with loss of CD16α binding and affinity), while the de novo hinges were resistant to cleavage by IdeZ and therefore retained both binding and nearly identical affinity when compared to the upper row.

    [0387] De novo hinges can be engrafted into different antibodies and still retain the same IdeS/IdeZ resistance and improved FcγRs binding (FIG. 8, FIG. 10). Similar constructs can be generated to modify mAb binding to the three classes of IgG FcγRs. It is well established that there are three classes of FcγR: FcγRI (CD64) has the highest affinity and is found on granulocytes; FcγRII (CD32) has intermediate affinity and is found on monocytes and dendritic cells; FcγRIII (CD16) has lower affinity and is found on monocytes, macrophages and on natural killer cells. IgG contains two Fab arms, an Fc domain and a flexible hinge region linked between the Fab arms and the Fc domain. Both the Fc domain and the hinge region of IgG contribute to binding FcγRs (including CD64, CD32, CD16) expressed on innate immune effector cells and mediate target cell destruction by cellular means including antibody-dependent cellular cytotoxicity (ADCC) and/or antibody-dependent cellular phagocytosis (ADCP). Significant efforts have been made toward improving IgG-FcγR binding.

    [0388] FIG. 8 shows binding affinity of various FcγRs to CHO cells expressing rituximab whose hinge moiety is either WT (ELLGGPS; SEQ ID NO: 544) or has been engineered with novel de novo hinge regions variants (EETCWDW, SEQ ID NO: 545 or EDSCWDW, SEQ ID NO: 546) using the methodology described herein and shown in FIG. 7. The resulting surface IgG expression and binding affinities of various FcγRs were quantified using fluorescent labeled FcγRs ectodomain as indicated on the Y axis, and fluorescent labeled anti-human Fc antibody on the X axis. The FcγRs binding affinity to each hinge moiety is indicated in the upper left quadrant of each histogram. Note that the two novel AA hinge regions (EETCWDW, SEQ ID NO: 545 and EDSCWDW, SEQ ID NO: 546) show a dramatic decrease in affinity to CD16b and CD32a compared to WT (ELLGGPS, SEQ ID NO: 544), but show higher affinity to CD16α and CD64 compared to WT.

    [0389] FIG. 9 provides a representative example illustrating the resistance of the novel hinge region (EETCWDW) to cleavage by IdeS/IdeZ. In this example the anti-CD20 mAb rituximab either contains its wild type (WT) hinge region or has been engineered to express the novel (EETCWDW) hinge region. WT rituximab or EETCWDW rituximab were first incubated at 37° C. for 30 minutes in the presence or absence of IdeZ protease. Next, the CD20(+) Daudi lymphoma cells were incubated with the processed WT or novel (EETCWDW) rituximab, washed and then stained with fluorescently-labelled anti human Fc antibody. The WT rituximab pre-incubated with IdeZ can no longer be detected on the surface of the CD20(+) Daudi lymphoma cells when stained with fluorescently-labelled anti human Fc antibody (left histogram, dashed line), while the EETCWDW rituximab can still be detected (right histogram, dashed line).

    Example 3

    Endopeptidase Resistant Hinge and FcγR Binding

    [0390] The selection of the EETCWDW hinge region and its variants for FcγR binding properties and resistance to IdeS/IdeZ represents a platform technology, because the results seen with the anti-CD20 mAb rituximab are highly reproducible using a second unrelated therapeutic mAb, the anti-Her2/neu mAb called trastuzumab or Herceptin®. FIG. 10 shows CHO cells transfected with trastuzumab-EGFR. The trastuzumab contains either its wild type (WT) hinge moiety or one of two de novo novel hinge moieties EETCWDW (SEQ ID NO: 545) or EDSCWDW (SEQ ID NO: 546) that were engineered to replace of the WT hinge region of trastuzumab using the same methodology described herein for rituximab. EETCWDW and EDSCWDW trastuzumab demonstrate identical binding properties as was demonstrated with rituximab when engineered with the same two novel hinge regions as shown in FIG. 8. Specifically, the two novel trastuzumab mAbs with AA hinge regions (EETCWDW or EDSCWDW) show a dramatic decrease in affinity to CD16β and CD32α compared to WT (ELLGGPS) but show higher affinity to CD16α and CD64 than WT yet show no cleavage by either IdeZ or IdeS (not shown). The resulting surface IgG expression and binding affinities of various FcγRs were quantified using fluorescent labeled FcγRs ectodomain as indicated on the Y axis, and fluorescent labeled anti-human Fc antibody on the X axis. The FcγRs binding affinity to each hinge moiety is indicated in the upper left quadrant of each histogram.

    [0391] FIG. 11 shows natural killer (NK) cell activation by staining for CD16/CD62L and CD107α/CD69, respectively. The higher affinity of EETCWDW rituximab for CD16α (compared to WT rituximab) leads to greater or stronger activation of the NK cell. When the NK cells' CD16 recognizes and binds EETCWDW rituximab that is bound to the B cell target, there is greater downregulation of CD16α, compared to the NK cells CD16 recognizing WT rituximab bound to the B cell target (compare FIG. 11A upper “control” row left lower quadrant “WT” (45.2) vs “EETCWDW” (80.5). The same is true for CD62L which downregulated following NK cell activation. When the NK cell recognizes EETCWDW rituximab binding to the B cell target, there is greater upregulation of CD107α, compared to the NK cell recognizing WT rituximab binding to the B cell target (compare FIG. 11B upper “control” row right upper quadrant “WT” (35.3) vs “EETCWDW” (62.8). The same is true for CD69. Further, treatment with IdeZ virtually eliminates activation of NK cells by WT rituximab (compare FIG. 11A “control” row, left lower quadrant “WT” (45.2) vs lower “IdeZ” row, left lower quadrant “WT” (8.8); and compare (FIG. 11B) upper “control” row right upper quadrant “WT” (35.8) vs lower “IdeZ” row, right upper quadrant “WT” (1.9). In contrast, treatment with IdeZ results in no or little decrease in NK cell activation by EETCWDW rituximab (compare FIG. 11A “control” row, left lower quadrant “EETCWDW” (80.5) vs lower “IdeZ” row, left lower quadrant “EETCWDW” (80.5); and compare FIG. 11B upper “control” row right upper quadrant “EETCWDW” (62.8) vs lower “IdeZ” row, right upper quadrant “EETCWDW” (47.5).

    [0392] FIG. 11C shows representative data demonstrating that the higher affinity of EETCWDW rituximab for CD16α leads to greater NK cell depletion of B cells in blood by antibody dependent cellular cytotoxicity (ADCC), and even greater depletion in the presence of IdeZ (“IdeZ”), when compared to WT rituximab. When the NK cell recognizes EETCWDW rituximab binding to the CD19(+) B cell target in blood without IdeZ (“control”), there is 17% greater depletion of CD19(+) B cells compared to the NK cell recognizing WT rituximab binding to the CD19(+) B cell target in control blood (compare FIG. 11C upper “control” row right lower quadrant “WT” (6.0) vs “EETCWDW” (5.0). However, when the NK cell recognizing WT rituximab binding to the CD19(+) B cell target in control blood is compared to the NK cell recognizing WT rituximab binding to the CD19(+) B cell target following incubation with IdeZ, CD19(+) B cell depletion is 63% worse (compare FIG. 11C upper “control” row right lower quadrant “WT” (6.0) vs lower “IdeZ” row right lower quadrant “WT” (9.8). In contrast, when to the NK cell recognizes EETCWDW rituximab binding to the CD19(+) B cell target following incubation with IdeZ, CD19(+) B cell depletion is improved by 50% when compared to NK cells recognizing WT rituximab binding to the CD19(+) B cell target following incubation with control blood (compare FIG. 11C upper “control” row right lower quadrant “WT” (6.0) vs lower “IdeZ” row right lower quadrant “EETCWDW” (3.0).

    [0393] In FIG. 11A, it was demonstrated that the higher affinity of EETCWDW rituximab for CD16α (compared to WT rituximab) leads to greater or stronger activation of the NK cell in whole blood, as measured by the downregulation of CD16α. FIG. 12 demonstrates how increasing concentrations of AB serum (and therefore increasing the concentration of endogenous IgG) in blood out competes EETCWDW rituximab for binding to NK cell FcγRIIIA (CD16α), thereby diminishing NK cell activation (compare the ability of NK cells' CD16 to recognize and bind EETCWDW rituximab bound to B cells in blood containing 6.7% serum (14.2% of NK cells down regulate surface expression of CD16) versus the ability of NK cells' CD16 to recognize and bind EETCWDW rituximab bound to B cells in blood containing 40% serum (only 5.5% of NK cells down regulate surface expression of CD16). However, adding IdeZ to the 40% serum substantially removes the endogenous IgG from binding to NK cell FcγRIIIA (CD16α), and allows the NK cells' CD16 to recognize and bind EETCWDW rituximab bound to B cells in blood resulting in an increase of NK cell activation as measured by a substantial downregulation of CD16α (5.5% in 40% AB serum without IdeZ compared to 22.7% in 40% AB serum with IdeZ).

    Example 4

    Rituximab Variants

    [0394] Endogenous IgG in human plasma binds Fcγ receptors (R) on all innate immune cells, limiting the access of the exogenously administered therapeutic antibody to FcγR on natural killer (NK) cells, monocytes, macrophages and granulocytes. Rituximab is a CD20 antibody with the human IgG1 constant region. Rituximab's Fab region binds CD20 on B cells and its Fc region binds FcγRIIIa (CD16) and activates NK cells through antibody-dependent cellular cytotoxicity (ADCC), thereby depleting the benign or malignant B cell population. For ADCC to occur, the therapeutic antibody must bind the FcγR innate immune effector cell with its Fc region and it must bind the antigen on the target cell with its Fab region. The discovery focuses on enhancement of (1) the binding affinity and (2) enhancement of the percent occupancy of the therapeutic antibody's Fc region to the number of FcγR expressed on the surface of the innate immune effector cell. The data herein demonstrate these principles using (1) the well-known therapeutic antibody Rituximab, which binds to CD20 and can deplete both normal and malignant B cells; and (2) the human NK cells as an innate immune cell that bears FcγR. The discoveries/inventions described herein are meant to describe a platform that can be adapted for any therapeutic antibody that engages any immune cells through binding FcγRs for part or all of its function.

    [0395] One of the challenges with antibody therapy is that it must compete for FcγR binding with the massive amount of endogenous IgG that exists in the human body, and modifications in the hinge region of a therapeutic mAb to improve its binding to FcγR will not fully displace endogenous IgG binding to FcγR on all of the innate immune effector cells. This in turn will limit the therapeutic efficacy of mAb that work via ADCC and/or ADCP. However, it has been demonstrated in humans that intravenous administration of IgG peptidases IdeZ and IdeS cleaves endogenous IgG at the hinge region and completely disrupts endogenous IgG-FcγR binding, leaving the FcγR vacant for binding by the therapeutic mAb. Because so little sequence modification has been focused the IgG hinge region, most all humanized antibodies have the wild type hinge sequence and are therefore sensitive to IdeZ and IdeS cleavage, thus, treatment with IdeZ or IdeS would also cleave the hinge region of the therapeutic mAb. Importantly, the modifications in the hinge region using the CHO cell display produced in any therapeutic mAb strategy can be made to be resistant to cleavage by the IgG peptidases IdeZ and IdeS (FIG. 7 and FIG. 9). Thus, from a practical standpoint, the IgG peptidases IdeZ and IdeS can be administered to patients (Jordan et al.), cleave all endogenous IgG and therefore open all IgG-FcγRs for exclusive binding by the modified mAb, vastly increasing the number of innate immune effector cells armed with the therapeutic mAb and capable of performing ADCC and ADCP. This discovery could therefore dramatically improve the efficacy of therapeutic mAb whose mechanism of action partially or fully occurs via ADCC and ADCP, such as rituximab for the treatment of lymphoma and multiple sclerosis.

    [0396] The IdeZ (and IdeS) enzyme cuts human IgG1 right after the first glycine of native ELLGGPS amino acid (AA) hinge sequence of endogenous IgG as well as wild type rituximab, thereby removing both endogenous IgG and wild type rituximab from binding Fcγ receptors, canceling NK cell activation (FIG. 11A, top row) and lowering rituximab-mediated B cell depletion by >50% (i.e., 6% to 9.8%; FIG. 11B, top row). IdeZ did not cut the synthesized rituximab with the novel EETCWDW AA hinge sequence (referred to in FIGS. 8 and 9 as “EETCWDW rituximab”). Thus, the presence of IdeZ did not cancel NK cell activation (FIG. 11A, bottom row), and improved ADCC depletion of B cells (FIG. 11A, bottom row). IdeZ-mediated removal of endogenous IgG from binding to Fcγ receptors presumably created more Fcγ receptor binding for the “EETCWDW rituximab” and therefore boosted NK cell ADCC and B cell depletion by 50% compared to wild type rituximab in the absence of IdeZ (FIG. 11B, 3.0% vs 6.0% residual B cells, respectively).

    [0397] When an NK cell engages a therapeutic monoclonal antibody by binding its Fc region to the NK cell's FcγRIII (CD16) and the Fab region to the target cell, the NK cell is activated, ADCC occurs, and CD16 is downregulated on the surface of the NK cell. As plasma or serum increase, the amount of endogenous IgG increases and competitively inhibits the binding of exogenous therapeutic antibody Fc region to the NK cell's CD16, thereby limiting NK cell's ability to bind the therapeutic antibody and activate to kill the intended target by ADCC (FIG. 12; compare 14.2% downregulation of CD16 in 6.7% serum vs 5.5% downregulation of CD16 in 40% serum). With the addition of IdeZ, endogenous IgG is cleaved and cannot bind to CD16, thereby freeing up CD16 binding sites on the NK cell for the IdeZ-resistant “EETCWDW rituximab” to bind and activate the NK cells despite 40% serum (compare 5.5% downregulation of CD16 in the absence of IdeZ to 22.7% downregulation of CD16 in the presence of IdeZ. This leads to improved depletion of the tumor target, which in this case is the B cell in blood (FIG. 11B). These principles are illustrated for the FcγR on NK cells (CD16), but also apply to the FcγR on monocytes, macrophages (CD16 and CD32a) as well as granulocytes (CD64), each of whose FcγRs are normally occupied by endogenous IgG

    [0398] An affinity selection process was initiated by generating a library of rituximab by introducing random mutations in the region where rituximab binds to CD20 and the many variants are characterized as having increased or decreased affinity to CD20. The variants were expressed on the surface of CHO cells using as EGFR-TMH fusion proteins and assessed for binding affinity of each variant toward a fluorescently labeled CD20 (FIG. 13). The data in FIG. 13 demonstrates rituximab expressed on the surface of CHO cells as rituximab-EGFR fusion protein. The X axis shows a fluorescently labeled anti-Fc mAb that can bind to CHO cells expressing IgG1-EGFR or rituximab-EGFR. The Y axis shows a fluorescently labeled CD20 molecule that can bind to rituximab-EGFR. In the left histogram, the CHO cells express IgG1 Fc-EGFR, thus binding on the X axis but no binding on the Y axis. The middle histogram expresses rituximab-EGFR and quantifies the affinity rituximab has for CD20. The histogram to the right shows the binding of the fluorescently labeled CD20 molecule to rituximab (Line A), or to a hypothetical variant of rituximab with higher affinity for CD20 compared to the actual rituximab (Line B), or to a hypothetical variant of rituximab with lower affinity for CD20 compared to the actual rituximab (Line C). Right panels show the expression of the CH2-CH3 fragment of Fc on the surface of CHO cells, so no binding by the human fluorescently labeled CD20 molecule.

    [0399] FIG. 14 illustrates flow cytometry density plots of sequence-dependent rituximab target selection and corresponding sequences. The representative example shows multiple clones from the rituximab library consisting of CD20 binding variants and flow cytometric measurement of binding affinity for each variant to a fluorescently labeled CD20 molecule, as demonstrated in FIG. 13.

    [0400] Rituximab heavy chain CDR1, CDR2, CDR3 and light chain CDR3 are the main regions involved in binding CD20. To test and validate embodiments described herein, a mutation library was made in the heavy chain CDR1, CDR2, and CDR3 respectively, and representative mutants from each library were identified. Those mutants only differ at the specified CDR region. For example, clone A-P01A09 differs from wild type rituximab at heavy chain CDR1, with mutation underlined. Therefore, light chain CDR1, CDR2, and CDR3 are wild type, non-mutated rituximab sequences. Specifically, all variants described herein include wild type rituximab light chain CDR1 (nucleic acid sequence: GCGAGCAGCAGCGTGAGC; amino acid sequence: ASSSVS), light chain CDR2 (nucleic acid sequence: GGAAGCGGCACCAGC; amino acid sequence: GSGTS) and light chain CDR3 (nucleic acid sequence: TGGACCAGCAACCCGCCG; amino acid sequence: WTSNPP).

    [0401] The CDR region variants tested are provided in Tables 1-3 below and FIG. 14. The table indicates the clones created and tested in experiments described herein. Each clone has a variant in a single CDR region with the other CDR regions being wildtype or non-mutated rituximab. In this instance, wildtype is the CDR of the anti-CD20 antibody rituximab. The variation in the CDR as compared to the non-variant or “wildtype” CDR is underlined in the table. For instance, Table 1 shows clones with mutations in CDR1 of rituximab (underlined) and having CDR2 and CDR3 the same as non-mutated (also referred to as wildtype (WT)) rituximab. Each clone in Table 1 has a nucleic acid sequence that encodes rituximab except for the noted CDR change relative to rituximab. For example, clone P01A09 in the first row has a variant heavy chain CDR1 (underlined sequence shows specific differences) relative to rituximab, but heavy chain CDR2 and heavy chain CDR3 are non-mutated sequences relative to rituximab. In addition, P01A09 includes non-mutated light chain CDR1, non-mutated light chain CDR2, non-mutated light chain CDR3. Indeed, the sequence of P01A09 matches the sequence of rituximab except for variant heavy chain CDR1.

    TABLE-US-00001 TABLE 1 Nucleic Acid Amino Acid Heavy chain CDRI WT: Heayy chain CDRI WT: TATACCTTCACAAGCTATAAC YTFTSYN CLONES (SEQ ID NO: 548) (SEQ ID NO: 589) P01A09 TATACCGGGGAAGCGGTATAAC YTGKRYN (SEQ ID NO: 551) (SEQ ID NO: 592) P01B01 TATACCTGTTTTAGGTATAAC YTCFRYN (SEQ ID NO: 552) (SEQ ID NO: 593) P02C12 TATACCTTCACAATTCGTTTG YTFTIRL (SEQ ID NO: 553) (SEQ ID NO: 594) P02F01 TATACCGGGCGTTTTTATAAC YTGRFYN (SEQ ID NO: 554) (SEQ ID NO: 595) P03A05 TATACCAGTTGGATGTATAAC YTSWMYN (SEQ ID NO: 555) (SEQ ID NO: 596) P05B09 TGGTTGTGGACAAGCTATAAC WLWTSYN (SEQ ID NO: 556) (SEQ ID NO: 597) P05H07 TATACCTGGGGGATTTATAAC YTWGIYN (SEQ ID NO: 557) (SEQ ID NO: 598) P04A02 TATACCTTCACAAGGTATAAT YTFTRYN (SEQ ID NO: 558) (SEQ ID NO: 599) P05F06 TATACCTTCACATTTCCTTAT YTFTFPY (SEQ ID NO: 559) (SEQ ID NO: 600) P07C04 TATACCGGTATTCGGTATAAC YTGIRYN (SEQ ID NO: 560) (SEQ ID NO: 601)

    TABLE-US-00002 TABLE 2 CDR2 Variants Nucleic Acid Amino Acid Heavy chain CDR2 WT: Heavy chain CDR2 WT: ATTTATCCGGGCAACGGCGAT IYPGNGD CLONES (SEQ ID NO: 549) (SEQ ID NO: 590) P04D06 ATTTATCCGGGCTTGTATCTT IYPGLYL (SEQ ID NO: 561) (SEQ ID NO: 602) P04F01 ATTTATCCGGGCACGCTGCTG IYPGTLL (SEQ ID NO: 562) (SEQ ID NO: 603) P04F02 ATTTATCCGGGCCATATGGGG IYPGHMG (SEQ ID NO: 563) (SEQ ID NO: 604) P04G03 ATTTATCCGGGCATGCTTTGG IYPGMLW (SEQ ID NO: 564) (SEQ ID NO: 605) P04H06 ATTTATCCGGGCGCTGTTTCG IYPGAVS (SEQ ID NO: 565) (SEQ ID NO: 606) P04H07 ATTTATCCGGGCACTCATAAG IYPGTHK (SEQ ID NO: 566) (SEQ ID NO: 607) P06A06 ATTTATCCGGGCACTCAGTCT IYPGTQS (SEQ ID NO: 567) (SEQ ID NO: 608) P06B11 ATTTATCCGGGCAATGCGGAT IYPGNAD (SEQ ID NO: 568) (SEQ ID NO: 609) P06H01 ATTTATCCGGGCAGTTTTGAG IYPGSFE (SEQ ID NO: 569) (SEQ ID NO: 610) P04D09 ATTTATCCGGGCACGTTTCTT IYPGTFL (SEQ ID NO: 570) (SEQ ID NO: 611) P05A03 ATTTATCCGGTTACGGGCGAT IYPVTGD (SEQ ID NO: 571) (SEQ ID NO: 612) P05A12 ATTTATCCGTATCTGGGCGAT IYPYLGD (SEQ ID NO: 572) (SEQ ID NO: 613) P05B02 ATTTATCCGTGGAATGGCGAT IYPWNGD (SEQ ID NO: 573) (SEQ ID NO: 614) P06B04 ATTTATCCTCTGTGGGGCGAT IYPLWGD (SEQ ID NO: 574) (SEQ ID NO: 615) P06B11 ATTTATCCGGGCAGTAGTCGT IYPGSSR (SEQ ID NO: 575) (SEQ ID NO: 616) P06H05 ATTTATCCGGGCACTTTTCGT IYPGTFR (SEQ ID NO: 576) (SEQ ID NO: 617) P06H11 ATTTATCCGGGCGTTGGTCGG IYPGVGR (SEQ ID NO: 577) (SEQ ID NO: 618) P07F02 ATTTATCCGGGCTCTCAGGCG IYPGSEA (SEQ ID NO: 578) (SEQ ID NO: 619) P07F10 ATTTATCCGGGCAGTAATATG IYPGSNM (SEQ ID NO: 579) (SEQ ID NO: 620) P08B05 ATTTATCCGGGCGCTTTTCTT IYPGAFL (SEQ ID NO: 580) (SEQ ID NO: 621)

    TABLE-US-00003 TABLE 3 CDR3 Variants Nucleic Acid Heavy chain CDR3 WT: Amino Acid CGCAGCACCTATTATGGCGG Heavy chain CDR3 WT: CGATTGGTATTTTAAC RSTYYGGDWYFN CLONES (SEQ ID NO: 550) (SEQ ID NO: 591) P07C02 CAGTCTATTTATTATGGCGG QSIYYGGDWYFN CGATTGGTATTTTAAC (SEQ ID NO: 622) (SEQ ID NO: 581) P07H08 CGCAGCACCTATTATGGCGG RSTYYGGDWLIA CGATTGGCTGATTGCT (SEQ ID NO: 623) (SEQ ID NO: 582) P07H10 CGCAGCACCGTGGCGGGGGG RSTVAGGDWYFN CGATTGGTATTTTAAC (SEQ ID NO: 624) (SEQ ID NO: 583) P08A01 CGCAGCACCTATTATGGCGG RSTYYGGDWRWR CGATTGGCGGTGGCGG (SEQ ID NO: 625) (SEQ ID NO: 584) P08B11 CGCAGCACCTATTATGGCGG RSTYYGGFWYFN GTTTTGGTATTTTAAC (SEQ ID NO: 626) (SEQ ID NO: 585) P08G02 CGCAGCACCTATTATGGCGG RSTYYGGDWSWA CGATTGGTCTTGGGCT (SEQ ID NO: 627) (SEQ ID NO: 586) P07A06 CGCAGCACCATGTGTAAGGG RSTMCKGDWYFN CGATTGGTATTTTAAC (SEQ ID NO: 628) (SEQ ID NO: 587) P08E05 CGCAGCACCATGTTGGGTGG RSTMLGGDWYFN CGATTGGTATTTTAAC (SEQ ID NO: 629) (SEQ ID NO: 588)

    [0402] FIG. 15 illustrates the progressive acquisition of IdeS resistance by single amino acid substitution. The first leucine (L248) upstream of IdeS/Z cleavage site was mutated to the other 19 amino acids individually. Wild-type or single amino acid mutants of rituximab were expressed on CHO cells as type I membrane proteins and tested for their expression and binding to human CD16α using fluorescent labeled anti-human IgG Fc and CD16α ectodomain. The L248E and L248D mutations acquired significant IdeS resistance with only slight loss of CD16α binding.

    [0403] FIG. 16 illustrates the binding of wild-type, L248E, and L248D hinge mutant rituximab to human FcγRs. Wild-type or the single amino acid mutants of rituximab (L248E and L248E) were expressed on CHO cells as type I membrane proteins and tested for their expression and binding to human FcγRs using fluorescent labeled anti-human Fc and different human FcγR ectodomains. The L248E and L248D mutations had a slight decrease in affinity for CD16α, CD16β, and CD32α, and had an increase in affinity for CD64 as compared to the wild-type protein.

    REFERENCES

    [0404] 1. Chen Zhou, Frederick W Jacobsen, Ling Cai, Qing Chen, and Weyen David Shen. Development of a novel mammalian cell surface antibody display platform. MAbs. 2010 September-October; 2(5): 508-518. [0405] 2. Cumbers S J, Williams G T, Davies S L, Grenfell R L, Takeda S, Batista F D, et al. Generation and iterative affinity maturation of antibodies in vitro using hypermutating B-cell lines. Nat Biotechnol. 2002; 20:1129-1134. [0406] 3. Ho M, Nagata S, Pastan I. Isolation of anti-CD22 Fv with high affinity by Fv display on human cells. P Natl Acad Sci USA. 2006; 102:9637-9642. [0407] 4. Urban J H, Schneider R M, Compe M, Finger C, Cichutek K, Alvarez-Vallina L, et al. Selection of functional human antibodies from retroviral display libraries. Nucleic Acids Res. 2005:33-35. [0408] 5. Wolkowicz R, Jager G C, Nolan G P. A random peptide library fused to CCR5 for selection of mimetopes expressed on the mammalian cell surface via retroviral vectors. J Biol Chem. 2005; 280:15195-15201. [0409] 6. Zauderer M, Smith E S. In vitro methods of producing and identifying immunoglobulin molecules in eukaryotic cells. US patent application 2002-0123057A1. [0410] 7. Akamatsu Y, Pakabunto K, Xu Z, Zhang Y, Tsurushia N. Whole IgG surface display on mammalian cells: Application to isolation of neutralizing chicken monoclonal anti-IL-12 antibodies. J Immunol Methods. 2007; 327:40-52. [0411] 8. Beerli R R, Bauer M, Buser R B, Gwerder M, Muntwiler S, Maurer P, et al. Isolation of human monoclonal antibodies by mammalian cell display. P Natl Acad Sci USA. 2008; 105:14336-14341. [0412] 9. Higuchi K, Araki T, Matsuzaki O, Sato A, Kanno K, Kitaguchi N, et al. Cell display library for gene cloning of variable regions of human antibodies to hepatitis B surface antigen. J Immunol Methods. 1997; 202:193-204. [0413] 10. Jordan et al N Engl J Med 2017; 377:442-453; 2017.