TISSUE CULTURE MEDIA FOR SURVIVAL AND ENGRAFTMENT OF HUMAN PANCREATIC ISLETS
20240226179 ยท 2024-07-11
Assignee
Inventors
Cpc classification
A61K31/198
HUMAN NECESSITIES
C12N5/0677
CHEMISTRY; METALLURGY
C12N2500/60
CHEMISTRY; METALLURGY
A61K33/00
HUMAN NECESSITIES
A61K38/39
HUMAN NECESSITIES
A61K35/28
HUMAN NECESSITIES
International classification
C12N5/00
CHEMISTRY; METALLURGY
A61K31/198
HUMAN NECESSITIES
A61K38/39
HUMAN NECESSITIES
A61K33/00
HUMAN NECESSITIES
Abstract
This disclosure provides a culture media that facilitates survival and/or engraftment of transplanted cells. In one embodiment, this culture media comprises collagen I, albumin, L-glutamine and NaHCO.sub.3. In one embodiment, this culture media promotes enhanced survival and engraftment of ?-cells of human pancreatic islets transplanted under the skin. The protective effect of this culture media is mediated, at least partly, by upregulating anti-apoptotic signaling pathways.
Claims
1. A composition to facilitate the survival and engraftment of cells for transplantation, comprising: collagen I, albumin, L-glutamine and NaHCO.sub.3.
2. The composition of claim 1, wherein the cells are human cells or non-human animal cells.
3. The composition of claim 2, wherein the cells are ?-cells of pancreatic islets.
4. The composition of claim 2, wherein the cells are endocrine and/or secretory cells selected from the group consisting of hepatocytes, parathyroid cells and adrenal gland cells.
5. (canceled)
6. The composition of claim 3, wherein the ?-cells are human ?-cells, murine ?-cells, or porcine ?-cells or are stem cell-derived ?-cells.
7. The composition of claim 4, wherein the endocrine cells are alpha cells or stem cell-derived endocrine cells.
8.-10. (canceled)
11. The composition of claim 1, wherein the composition comprises about 60% to 94% of human collagen I, about 4% to 15% of human albumin, about 0.4% to 4% of L-glutamine, and about 1% to 5% of NaHCO.sub.3.
12.-14. (canceled)
15. A method of transplanting ?-cells of pancreatic islets into a host site, comprising: (a) mixing a population of the ?-cells with the composition of claim 1; and (b) transplanting the cells from (a) into the host site.
16. The method of claim 15, wherein the host is a human or a non-human animal.
17. The method of claim 15, wherein the ?-cells are human ?-cells, murine ?-cells, or porcine ?-cells or are stem cell-derived ?-cells.
18. (canceled)
19. The method of claim 15, wherein the ?-cells are autologous.
20. The method of claim 15, wherein the host is a human and the ?-cells are non-human ?-cells, wherein the non-human ?-cells are murine ?-cells or porcine ?-cells.
21. (canceled)
22. The method of claim 15, wherein the site is a subcutaneous space, a retroperitoneal space, an omentum or an abdominal cavity.
23.-24. (canceled)
25. The method of claim 15, wherein the composition comprises about 60% to 94% of human collagen I, about 4% to 15% of human albumin, about 0.4% to 4% of L-glutamine, and about 1% to 5% of NaHCO.sub.3.
26.-28. (canceled)
29. A pharmaceutical composition comprising collagen I, albumin, L-glutamine, NaHCO.sub.3 and autologous ?-cells of pancreatic islets of a subject.
30. The pharmaceutical composition of claim 29, wherein the autologous ?-cells are stem cell-derived ?-cells.
31.-32. (canceled)
33. The pharmaceutical composition of claim 29, wherein the composition comprises about 60% to 94% of human collagen I, about 4% to 15% of human albumin, about 0.4% to 4% of L-glutamine, and about 1% to 5% of NaHCO.sub.3.
34.-36. (canceled)
37. A method of treating Type I diabetes in a subject in need thereof, comprising: administering the pharmaceutical composition of claim 29 to a non-percutaneous trans-hepatic site of the subject.
38. The method of claim 37, wherein the non-percutaneous trans-hepatic site is a subcutaneous space, a retroperitoneal space, an omentum or an abdominal cavity.
39. The method of claim 37, wherein the subject is a human or a non-human animal.
40. The method of claim 37, wherein the autologous ?-cells are human ?-cells, murine ?-cells, or porcine ?-cells.
41.-43. (canceled)
44. The method of claim 37, wherein the pharmaceutical composition comprises about 60% to 94% of human collagen I, about 4% to 15% of human albumin, about 0.4% to 4% of L-glutamine, and about 1% to 5% of NaHCO.sub.3.
45.-47. (canceled)
48. A pharmaceutical composition comprising collagen I, albumin, L-glutamine, NaHCO.sub.3 and autologous cells of a subject.
49. The pharmaceutical composition of claim 48, wherein the autologous cells are endocrine and/or secretory cells selected from the group consisting of hepatocytes, parathyroid cells and adrenal gland cells.
50. The pharmaceutical composition of claim 48, wherein the endocrine cells are stem cell-derived endocrine cells.
51.-52. (canceled)
53. The pharmaceutical composition of claim 48, wherein the composition comprises about 60% to 94% of human collagen I, about 4% to 15% of human albumin, about 0.4% to 4% of L-glutamine, and about 1% to 5% of NaHCO.sub.3.
54.-56. (canceled)
57. A method of treating acute liver failure or hepatitis in a subject in need thereof, comprising: administering the pharmaceutical composition of claim 48 to a non-percutaneous trans-hepatic site of the subject, wherein the autologous cells are hepatocytes.
58. The method of claim 57, wherein the non-percutaneous trans-hepatic site is a subcutaneous space, a retroperitoneal space, an omentum or an abdominal cavity.
59. The method of claim 57, wherein the autologous hepatocytes are stem cell-derived hepatocytes.
60.-66. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
DETAILED DESCRIPTION OF THE INVENTION
[0032] The present invention may be understood more readily by reference to the following detailed description which forms a part of this disclosure. It is to be understood that this invention is not limited to the specific methods, products, conditions or parameters described and/or shown herein, and that the terminology used herein is for the purpose of describing particular embodiments by way of example only and is not intended to be limiting of the claimed invention.
[0033] As employed above and throughout the disclosure, the following terms and abbreviations, unless otherwise indicated, shall be understood to have the following meanings.
[0034] In this disclosure the singular forms a, an, and the include the plural reference, and reference to a particular numerical value includes at least that particular value, unless the context clearly indicates otherwise. Thus, for example, a reference to a compound is a reference to one or more of such compounds and equivalents thereof known to those skilled in the art, and so forth. The term plurality, as used herein, means more than one.
[0035] Throughout this application, various embodiments of this disclosure may be presented in a range format. It should be understood that a description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
[0036] Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases ranging/ranges between a first indicated number and a second indicated number and ranging/ranges from a first indicated number to a second indicated number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.
[0037] When values are expressed as approximations, by use of the antecedent about, it is understood that the particular value forms another embodiment. All ranges are inclusive and combinable. In one embodiment, the term about refers to a deviance of between 0.1-5% from the indicated number or range of numbers. In another embodiment, the term about refers to a deviance of between 1-10% from the indicated number or range of numbers. In another embodiment, the term about refers to a deviance of up to 20% from the indicated number or range of numbers. In one embodiment, the term about refers to a deviance of +10% from the indicated number or range of numbers. In another embodiment, the term about refers to a deviance of +5% from the indicated number or range of numbers.
[0038] As used herein, the terms component, composition, composition of compounds, compound, drug. pharmacologically active agent, active agent, therapeutic, therapy, treatment, or medicament are used interchangeably herein to refer to a compound or compounds or composition of matter which, when administered to a subject (human or animal) induces a desired pharmacological and/or physiologic effect by local and/or systemic action.
[0039] As used herein, the terms treatment or therapy (as well as different forms thereof) include preventative (e.g., prophylactic), curative or palliative treatment. As used herein, the term treating includes alleviating or reducing at least one adverse or negative effect or symptom of a condition, disease or disorder.
[0040] The terms subject. individual, and patient are used interchangeably herein, and refer to an animal, for example a human, to whom treatment, including prophylactic treatment, with the pharmaceutical composition according to the present invention, is provided. The term subject as used herein refers to human and non-human animals. The terms non-human animals and non-human mammals are used interchangeably herein and include all vertebrates, e.g., mammals, such as non-human primates (particularly higher primates), sheep, dog, rodent, (e.g., mouse or rat), guinea pig, goat, pig, cat, rabbits, cows, horses and non-mammals such as reptiles, amphibians, chickens, and turkeys.
[0041] Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting. Each literature reference or other citation referred to herein is incorporated herein by reference in its entirety.
[0042] As discussed above, the intrahepatic milieu is inhospitable to intraportal islet allografts, limiting their applicability to ameliorate Type 1 Diabetes (T1D). Although the subcutaneous space represents an alternate, safe and easily accessible site for pancreatic islet transplantation, lack of neovascularization and the resulting hypoxic cell death have largely limited the longevity of graft survival and function, and pose a barrier to widespread clinical adoption of islet transplantation. A crucial step to ensure widespread adoption and safety of clinical islet transplantation is islet implantation at an easily accessible site. This disclosure provides an Islet Viability Matrix (IVM) that can uniformly promote and maintain graft survival and function in the subcutaneous space, curing T1D through a previously unknown anti-apoptotic mechanism. The IVM described and provided herein is in one embodiment a mixture of human collagen I, L-glutamine, fetal bovine serum, sodium bicarbonate and medium 199, which when admixed with murine, porcine or human islets, promotes uniform islet survival subcutaneously. Described herein is the successful subcutaneous transplantation of pancreatic islets admixed with a device-free IVM, resulting in long-term euglycemia in diverse immune-competent and immuno-incompetent animal models.
[0043] Data presented herein indicate that subcutaneous pancreatic islet transplantation with IVM represents a novel approach and a viable alternative to the current standard for clinical islet transplantation in T1D. This disclosure provides a device-free system, involving a single injection of an islet-IVM mixture, that does not result in major avascular, hypoxic or fibrotic reactions in either the subcutaneous or retroperitoneal spaces. The protective effect of this IVM mixture is mediated, at least in part, by upregulation of anti-apoptotic signaling pathways. By preserving normal insulin and glucagon production, islets bedaubed with IVM maintain basal glycemia across mouse species as well as in a nonhuman primate model. Establishment of this method augments the utility of pancreatic islet transplantation, as well as related cellular therapies in tissue engineering and reparative medicine.
[0044] Many research efforts have focused on developing devices that could be seeded with whole islets (or stem cell-derived ?-cell lines) with the intent to implant these loaded devices into a host. A distinct advantage of the IVM disclosed herein is that no device is needed. Employing a device in itself presents a big biologic challenge because host responses would be induced against the material or fabric of the foreign device, thereby leading to fibrosis and loss of islet viability.
[0045] In one aspect, the compositions provided herein facilitate the survival and engraftment of cells for transplantation, the composition comprises 10?M199, collagen I, albumin, L-glutamine and NaHCO.sub.3. In one embodiment, the cells are human cells. In one embodiment, the cells are ?-cells of pancreatic islets. In one embodiment, the collagen I is human collagen I. In one embodiment, the albumin is human albumin. In one embodiment, fetal bovine serum is used. In one embodiment, the L-glutamine:NaHCO.sub.3 ratio is about 1:4. In one embodiment, the L-glutamine:albumin ratio is about 1:18. In one embodiment, the L-glutamine:collagen I ratio is about 1:160. In one embodiment, the L-glutamine: 10?M199 ratio is about 1:18.
[0046] In one embodiment, the composition comprises about 60% to 94% of collagen I. In another embodiment, the composition comprises about 4% to 15% of albumin. In one embodiment, the composition comprises about 0.4% to 4% of L-glutamine. In one embodiment, the composition comprises about 1% to 5% of NaHCO.sub.3.
[0047] In another aspect, provided herein are methods of transplanting cells such as ?-cells of pancreatic islets into a host site, comprising the steps of: mixing a population of ?-cells with a media composition disclosed herein, and then transplanting this mixture of cells into the host site. The host can be a human or a non-human animal. In one embodiment, the ?-cells are human, murine, or porcine ?-cells. In another embodiment, the cells are alpha cells, delta cells or PP cells in the pancreas. In an embodiment, the endocrine cells are stem cell-derived endocrine cells. In an embodiment, the transplant into the host site is a xenotransplant. In certain embodiments, the host is a human and the ?-cells are non-human ?-cells, wherein the non-human ?-cells are murine ?-cells or porcine ?-cells. In another embodiment, the host is a non-human animal and the ?-cells are human ?-cells. In one embodiment, the cells are transplanted into a subcutaneous space or retroperitoneal space. In another embodiment, the cells are transplanted into an omentum or an abdominal cavity.
[0048] In another aspect, provided herein are pharmaceutical compositions comprising collagen I, albumin, L-glutamine, NaHCO.sub.3 and autologous ?-cells of pancreatic islets of a subject. In an embodiment, the collagen I is human collagen I. In one embodiment, the albumin is human albumin. In some embodiments, the pharmaceutical composition further comprises fetal bovine serum. In some embodiments, the pharmaceutical composition comprises about 60% to 94% of collagen I. In an embodiment, the pharmaceutical composition comprises about 4% to 15% of albumin. In one embodiment, the composition comprises about 0.4% to 4% of L-glutamine. In various embodiments, the composition comprises about 1% to 5% of NaHCO.sub.3.
[0049] In another aspect, provided herein are methods of treating Type I diabetes in a subject in need thereof, the method comprising: administering a pharmaceutical composition comprising collagen I, albumin, L-glutamine, NaHCO.sub.3 and autologous ?-cells of pancreatic islets of a subject to a non-percutaneous trans-hepatic site of the subject. In an embodiment, the non-percutaneous trans-hepatic site is a subcutaneous space or retroperitoneal space. In another embodiment, the cells are transplanted into an omentum or an abdominal cavity. In some embodiments, the subject is a human or an animal. In an embodiment, the collagen I is human collagen I. In one embodiment, the albumin is human albumin. In some embodiments, the pharmaceutical composition further comprises fetal bovine serum. In certain embodiments, the pharmaceutical composition comprises about 60% to 94% of collagen I. In one embodiment, the pharmaceutical composition comprises about 4% to 15% of albumin. In one embodiment, the composition comprises about 0.4% to 4% of L-glutamine. In some embodiments, the composition comprises about 1% to 5% of NaHCO.sub.3.
[0050] Also provided herein are pharmaceutical compositions comprising collagen I, albumin, L-glutamine, NaHCO.sub.3 and autologous cells of a subject. In some embodiments, the autologous cells are endocrine and/or secretory cells, such as but not limited to, hepatocytes, parathyroid cells or adrenal gland cells. In certain embodiments, the endocrine cells are alpha cells. In an embodiment, the endocrine cells are stem cell-derived endocrine cells. In certain embodiments, the autologous endocrine and/or secretory cells are stem cell-derived hepatocytes, parathyroid cells or adrenal gland cells. In an embodiment, the collagen I is human collagen I. In some embodiments, the albumin is human albumin. In certain embodiments, the pharmaceutical composition further comprises fetal bovine serum. In an embodiment, the pharmaceutical composition comprises about 4% to 15% of albumin. In one embodiment, the composition comprises about 0.4% to 4% of L-glutamine. In various embodiments, the composition comprises about 1% to 5% of NaHCO.sub.3.
[0051] Also provided herein are methods of treating acute liver failure or hepatitis in a subject in need thereof, the method comprising: administering a pharmaceutical composition comprising collagen I, albumin, L-glutamine, NaHCO.sub.3 and autologous cells to a non-percutaneous trans-hepatic site of the subject, wherein the autologous cells are hepatocytes. In an embodiment, the autologous hepatocytes are stem cell-derived hepatocytes. In one embodiment, the non-percutaneous trans-hepatic site is a subcutaneous space or retroperitoneal space. In another embodiment, the cells are transplanted into an omentum or an abdominal cavity. In some embodiments, the subject is a human or an animal. In one embodiment, the collagen I is human collagen I. In one embodiment, the albumin is human albumin. In some embodiments, the pharmaceutical composition further comprises fetal bovine serum. In certain embodiments, the pharmaceutical composition comprises about 60% to 94% of collagen I. In an embodiment, the pharmaceutical composition comprises about 4% to 15% of albumin. In one embodiment, the composition comprises about 0.4% to 4% of L-glutamine. In some embodiments, the composition comprises about 1% to 5% of NaHCO.sub.3.
[0052] In this description, each of the steps of the invention and variations thereof are described. This description is not intended to be limiting and changes in the components, sequence of steps, and other variations would be understood to be within the scope of the present invention.
[0053] In one aspect, provided herein are pharmaceutical compositions comprising collagen I, albumin, L-glutamine, NaHCO.sub.3 and autologous ? cells of pancreatic islets of a subject. In one embodiment, the pharmaceutical composition comprises about 60% to 94% of collagen I. In one embodiment, the pharmaceutical composition comprises about 4% to 15% of albumin. In one embodiment, the pharmaceutical composition comprises about 0.4% to 4% of L-glutamine. In one embodiment, the pharmaceutical composition comprises about 1% to 5% of NaHCO.sub.3. In one embodiment, the composition further comprises fetal bovine serum.
[0054] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.
[0055] The following examples are presented in order to illustrate certain embodiments of the invention more fully. The examples should in no way be construed, however, as limiting the broad scope of the invention.
Example 1
Islet Viability Matrix (IVM) for the Survival and Engraftment of Human Pancreatic Islets
Materials and Methods
Affinity Antibody-Coupled Bead Purification of Tissue Specific EVs
[0056] MHC specific antibody was covalently conjugated to N-hydroxysuccinamide magnetic beads (Pierce) per manufacturer's protocol. Fifty to 100 ?g protein equivalent of EVs were incubated with antibody beads overnight at 4? C. The bead bound and unbound EV fractions were separated per manufacturer's protocol. EVs bound to beads were eluted using tris glycine and utilized for downstream analysis.
Animals and Induction of Diabetes
[0057] Male C57BL/6 (B6) and B6.CB17-Prkdcscid (B6 SCID) mice aged 8-12 weeks, used as islet donors and recipients, were obtained from the Jackson Laboratory, Bar Harbor, ME. Female BALB/c and C3H mice aged 8-12 weeks were used as allogeneic islet donors. Recipients were rendered diabetic by a single intraperitoneal injection of streptozotocin (SICOR Pharmaceuticals, Inc. Irvine, CA) at a dose of 250 mg/kg. At 5 days after streptozotocin administration, animals with two consecutive (daily) non-fasting blood glucose levels>350 mg/dL (Accu-Chek Glucometer, Roche Diagnostics, Indianapolis, IN) were used as islet recipients. The protocol was approved by the University of Pennsylvania's Institutional Animal Care and Use Committee, and in accordance with the National Institutes of Health's Guide for the Care and Use of Laboratory Animals.
Assessment of Islet Graft Function
[0058] Blood Glucose levels were monitored twice weekly after transplantation and recipients with non-fasting glucose concentrations<200 mg/dL were considered to have achieved normoglycemia. When two consecutive daily non-fasting glucose levels were >300 mg/dL after a period of primary graft function, islet grafts were considered to have failed. An intraperitoneal glucose tolerance test was performed on the animals with long-term normoglycemia (>100 days). In select recipients, the site bearing the islet grafts (skin or retroperitoneum) were excised and the tissues were analyzed for immunohistochemical confirmation of isolated islets.
Biochemical Analysis of Exosome Content
[0059] For total RNA (including microRNA and mRNA) purification, RNA was extracted from EVs using Trizol, followed by RNeasy mini kit, per manufacturer's protocol (Qiagen, Germany). For total protein isolation, EV pellet was lysed in 1?RIPA buffer with 1? concentration of protease inhibitor cocktail (Sigma-Aldrich Co., MO). For Western Blot analysis, EV and cell lysate total proteins were isolated and separated on polyacrylamide gels and transferred on polyvinylidene difluoride membrane (Life Technologies, NY). The blot was blocked, incubated with desired antibody at concentration per manufacturer's protocol. Horseradish peroxidase coupled secondary antibody (Santa Cruz Biotechnologies Inc.) was added per manufacturer's protocol and detected through chemiluminescence using Image quant LAS 400 Phospho-Imager (GE Health, USA).
[0060] TISE and cell total RNA representing the transplanted human xenoislet mass was analyzed using the Agilent 2100 Bioanalyzer and Nanodrop spectrophotometry at the University of Pennsylvania Molecular Profiling Facility. All protocols were performed according to the Qiagen QIAseq miRNA sample prep kit (catalogue #331502).
Extracellular Vesicle (EV) Isolation
[0061] EVs were isolated by high exclusion limit agarose-based gel chromatography along with ultracentrifugation. Briefly, 500 ?L to 1 mL plasma was obtained from the islet recipient after centrifugation of the blood sample at 500 g for 10 minutes. To eliminate cells and debris, the solution was filtered through a 0.22 ?m filter and then passed through a Sepharose 2B column. The eluent was collected in 1 mL fractions. The EV fraction was pooled after monitoring absorbance at 280 nm. The pooled fraction underwent ultracentrifuge at 110,000 g for 2 hours at 4? C., and the pelleted EV fraction was resuspended in PBS for downstream analysis.
[0062] Anti-HLA-A2 antibodies (Santa Cruz Biotechnologies, TX) were utilized for NanoSight fluorescent staining and analysis of human islet EVs purified from recipient mouse plasma. Antibodies to human FXYD2 (Abnova), insulin, glucagon, somatostatin, CD3, CD4, CD8, CD56, CD19, CD56, TSG101, aquaporin 2, podocalyxin-1, and to mouse MHC I were purchased from Santa Cruz Biotechnologies. Secondary antibodies and isotype controls (anti-goat, anti-rabbit, anti-mouse, goat IgG, rabbit IgG, and mouse IgG) were also purchased from Santa Cruz Biotechnologies. Anti-goat, anti-rabbit, and anti-mouse conjugated quantum dot (605 nm) were purchased from Life Technologies (Grand Island, NY) and utilized per manufacturer's protocol for NanoSight fluorescent analysis.
EV Sequencing Analysis
[0063] The read layouts obtained from EV sequencing were processed. First, the sequencing adapter was trimmed, and then reads were taken that had exact matches to the inner fixed region and extracted the flanking sequences as RNA and UMI respectively. Alignments were done with bowtie using the flags -q -k 4 --best --norc. Duplicate UMIs were reduced by transcript, by removing duplicates that align to the same read. The frequency of similar UMIs produced by sequencing errors was small, and normalization was performed by converting the read counts to CPM. For the miRNA analysis, exosome sequences were aligned to miRbase release 21. All of the target librariesmiRNA, tRNA, and RefSeqhad duplicate entries, therefore the best alignments were taken and allowed reads to map to multiple places.
Immunohistochemistry
[0064] The proportion and intensity of the stained epitopes were evaluated using QuPath v0.1.2.
Islet Isolation And Transplantation
[0065] Mouse pancreatic islet isolation was performed by collagenase P (Roche Diagnostics, Indianapolis, IN) digestion and density gradient separation. Human isolated pancreatic islets were procured from deceased organ donors through an Integrated Islet Distribution Program with consent from the regional Organ Procurement Organization (Gift of Life Donor Program). Islets were incubated in CMRL 1066 medium (Mediatech, Manassas, VA) containing 5.5 mM d-glucose, 0.5% human albumin (Talecris Biotherapeutics, Research Triangle Park, NC), 10 U/mL Heparin (Sagent Pharmaceuticals, Schaumberg, IL), 100 ?g/mL penicillin/streptomycin, and 2 mM L-glutamine. Porcine islets were obtained from Dr. Bernhard Herring at the University of Minnesota.
[0066] The recipient mice were anesthetized by an intraperitoneal injection of Ketamine HCl (50 mg/kg body weight; Abbott Laboratories, North Chicago, IL). In the subcutaneous (SC) transplantation model, a small skin incision was established over the lower abdomen to create a SC pocket in which islets were injected immediately after isolation in either a suspension of 250 ?L of RPMI-1640 (islets alone) or admixed in tissue culture enriched of Collagen I (Organogenesis, Canton, MA), human albumin, L-glutamine and NaHCO.sub.3 (IVM. islet viability matrix). In the retroperitoneal (RP) transplantation model, the mouse abdominal cavity was opened, and islets were injected underneath the peritoneal layer in the right posterior retroperitoneal space. Islet transplantation was performed at the University of Pennsylvania per procedural protocols (CIT07 and CIT06). Islet viability, quantity, and function were analyzed by the Islet Core Facility per institution approved protocols.
NanoSight EV Analysis
[0067] Purified EVs were analyzed on the NanoSight NS300 (405 nm laser diode) on the light scatter mode for EV quantification and scatter distribution according to manufacturer's protocols (Malvern instruments Inc., MA, USA). Before each experimental run, the machine was calibrated for nanoparticle size and quantity using standardized nanoparticle and dilutions provided by the manufacturer. Surface marker detection on EVs was performed using the fluorescence mode on the NanoSight NS300. Secondary antibodies conjugated to quantum dots with emission at 605 nm were utilized for fluorescence detection of primary antibodies binding against specific surface proteins. Each experimental run was performed in duplicates, and an appropriate IgG isotype control fluorescence was performed to assess background.
Nonhuman Primate
[0068] Male and a female cynomolgus monkeys (M. Fascicularis) weighing 3.0-4.0 kg were used for autologous islet transplantation. The monkeys were obtained from the vendors Spring Scientific (Perkasie, PA). Prior to use for transplantation, serological testing was performed on each animal to ensure that they were not infected with Herpes B. Schmidt-Ruppin strain of the Rous sarcoma virus, simian T-cell lymphotropic virus, or simian immunodeficiency virus. All animals had continuous water supply and were fed with regular primate diet supplemented with fresh fruits twice daily. All animal care and handling were performed in accordance with the guidelines established by the Department of Health and Human Services' guide for care and use of primates, as well as the IACUC guidelines.
[0069] Pancreatectomy. Monkeys were sedated using ketamine (15 mg/kg) and atropine (0.05 mg/kg), prepared for operation, and intubated. Anesthesia was initiated with midazolam (1 mg/kg) and maintained with isoflurane and oxygen. Haircoat was clipped closely from the nipples to mid-thigh and laterally to the end of the vertebral processes and skin, followed by scrubbing with a preliminary chlorhexidine solution. Animals were placed in a supine position, and the surgical field given a second chlorhexidine scrub. The abdomen was opened using a midline laparotomy. The spleen and greater omentum were reflected to expose the entire pancreas. The right and left pancreatic limbs were mobilized, preserving pancreatic vasculature, and the pancreas then carefully dissected from the duodenal serosa. The common pancreatic duct was identified at the duodenum, ligated, and transversely incised distal to the ligation. Through this incision, pancreatic duct was cannulated with an angiocatheter, and secured with ligature. The pancreas is then excised, placed in cold UW's solution and transported to the islet isolation laboratory. Finally, the incisions are closed layer by layer.
[0070] Subcutaneous Islet Transplantation. Under general anesthesia, the animals were placed in a supine position, and the transplant field prepared. The solution containing isolated islets was slowly infused in the subcutaneous area. The needle point was then swabbed with an antiseptic. Finally, the animal was recovered in an incubator and extubated as soon as possible.
[0071] Islet graft function. The blood glucose levels were monitored twice daily for the first month then twice weekly after transplantation and recipients with non-fasting glucose concentrations<200 mg/dL were considered to have achieved normoglycemia. When two consecutive daily non-fasting glucose levels were >300 mg/dl after a period of primary graft function, islet grafts were considered to have failed. Islet graft biopsies were performed under general anesthesia. Tissue samples (1-2 cm.sup.2) were processed for standard hematoxylin-eosin (H&E) and immunohistochemistry (IHC) staining.
Replication Assay
[0072] In vivo bromodeoxyuridine (BrdU) labeling was achieved by diluting drinking water with (1 mg/mL) BrdU (Sigma) for 3 days. BrdU staining was performed using the Zymed BrdU Staining Kit according to the manufacturer's instructions. BrdU-positive nuclei were counted blinded from at least 20 islets per mouse from four to six mice per group. The protocol was approved by the Institutional Animal Care and Use Committee of the University of Pennsylvania.
RNA Isolation and Real-Time PCR Analysis
[0073] Islets from overnight fasted 18-wk-old mice were isolated using the standard collagenase procedure as previously described. Total RNA from islets was isolated in Trizol (Invitrogen) according to the manufacturer's instructions. Islet RNA was reverse-transcribed using 1 ?g of Oligo(dT) primer, SuperScript II Reverse Transcriptase, and accompanying reagents (Invitrogen). PCR reaction mixes were assembled using the Brilliant SYBR Green QPCR Master Mix (Stratagene). Reactions were performed using the SYBR Green (with Dissociation Curve) program on the Mx4000 Multiplex Quantitative PCR System (Stratagene). All reactions were performed in triplicate with reference dye normalization, and median CT values were used for analysis. Islet purity was assessed and was determined to be >90% endocrine tissue.
[0074] For exosome analysis, total RNA (25 to 50 ng) from islet cells and EVs were reverse-transcribed with the SuperScript III one-step RT-PCR system (Life Technologies) for gene expression validation. The primers used were:
TABLE-US-00001 humaninsulin (forward) (SEQIDNO:1) 5-CCTTGTGAACCAACACCTG-3, (reverse) (SEQIDNO:2) 5-GTAGAAGAAGCCTCGTTCCC-3(80bp); humanglucagon (forward) (SEQIDNO:3) 5-CCCAAGATTTTGTGCAGTGGTT-3, (reverse) (SEQIDNO:4) 5-CAGCATGTCTCTCAAATTCATCGTG-3(80bp); humansomatostatin (forward) (SEQIDNO:5) 5-GATGCCCTGGAACCTGAAGA-3, (reverse) (SEQIDNO:6) 5-CCGGGTTTGAGTTAGCAGATCT-3(82bp); humanFXYD2?a (forward) (SEQIDNO:7) 5-ACTGGGTTGTCGATGGACGGT-3, (reverse) (SEQIDNO:8) 5-CGGCTCATCTTCATTGATTTG-3(188bp); humanFXYD2?b (forward) (SEQIDNO:9) 5-GACAGGTGGTACCTG-3, (reverse) (SEQIDNO:10) 5-CGGCTCATCTTCATTGATTTG-3(188bp); and human?-actinprimersare (forward) (SEQIDNO:11) 5-CTGTACGCCAACACAGTGCT-3, (reverse) (SEQIDNO:12) 5-GCTCAGGAGGAGCAATGATC-3(127bp).
Scanning Electron Microscopy (SEM)
[0075] Paraffin-embedded samples of skin and subcutaneous tissues were sectioned longitudinally until the implanted islets were visually observed, thereby facing off the block to expose the site of engraftment. Subsequently, the tissue was deparaffinized in xylene, rehydrated through an ethanol series of 100%, 95%, 90%, 80%, 70%, 0% to DPBS. The tissues were then fixed overnight at 4? C. with a solution of 2.5% glutaraldehyde and 1.25% formaldehyde in 0.1 M sodium cacodylate buffer. The tissues were subsequently washed three times with DPBS, post-fixed for one hour with 1% osmium tetroxide and 1.5% potassium ferrocyanide in water, then washed three times with PBS and dehydrated in an ethanol series (50%, 70%, 80%, 90%, 95%?2, 100%?3, 5 min. each). The samples were then dried at the CO2 critical point, plasma sputtered with 80:20 gold:palladium alloy, and finally imaged with an FEI Quanta 250 Scanning Electron Microscope operating at high chamber vacuum with 5 kV beam energy.
Statistical Analysis
[0076] Data are expressed as mean?standard deviation. The significance of differences between two independent groups was calculated by the Wilcoxon Rank Sum/Mann-Whitney U Test, unless otherwise specified. Differences were considered significant at P<0.05. The gene-set enrichment analysis was performed using the WEB-based Gene SeT Analysis Toolkit.
Results
Murine, Porcine and Human Islets Transplantation
[0077] Murine, porcine and human islets admixed with a cell-free IVM (islet viability matrix) and without any device, thrive subcutaneously and maintain robust glycemic control (
[0078] Whether utilizing human islets would afford similar success when engrafted subcutaneously in diabetic immune-incompetent hosts was examined next. In contrast to mice receiving human pancreatic islets transplanted without IVM, those engrafted with IVM uniformly reversed diabetes (
[0079] Subsequently, kinetics of glucose disposal was evaluated when the recipients bearing long-term subcutaneous islets underwent glucose tolerance testing. Long-term recipients bearing IVM.sup.+ islets from mice, swine or humans (n=5 in each group) demonstrated normal glucose disposal, akin to healthy non-diabetic mice (
[0080] In anticipation of its translational impact, the above method was corroborated with subcutaneous transplantation of autologous islets in a non-human primate. Grafting macaque islets with IVM underneath the skin rendered the animal normoglycemic (
Mechanism of Transplant Survival
[0081] To explore the mechanisms underlying the success of the subcutaneous islet transplant method above, it is hypothesized that the transplant islet-specific exosomes (TISEs) might provide a quantitative window into how IVM fosters cell survival. Thus, the human-into-mouse islet transplant model was utilized and exosomal RNA profiles were compared between the IVM.sup.+ and IVM.sup.? conditions (
[0082] Furthermore, western blot analyses showed expression of insulin almost exclusively in the IVM.sup.+ exosomes, and demonstrated an increased expression of GLP-1, GLPIR, Bcl-2 and Bcl-xL in the IVM.sup.+ group compared to IVM.sup.? (
[0083] Antibodies targeted at specific epitopes for Bcl-2, Von Willebrand Factor (VWF), Vascular endothelial growth factor (VEGF) and GLP-1 were utilized for staining. The results show that human IVM.sup.+ islets had a substantially higher proportion and intensity for the stained epitopes compared to IVM.sup.? at POD 1 and 10 (
[0084] To better appreciate the temporal dynamics of gene regulation and islet endocrine function, age-matched immunocompetent B6 mice were divided into two groupsin one group, human IVM.sup.+ islets were subcutaneously engrafted, while the other group received IVM.sup.? islets. Glucose measurements at 3, 6 and 24 hr post-transplantation revealed that animals in the IVM.sup.+ group achieved glucose homeostasis as early as 3 hr post-engraftment (
[0085] Encouraged by the molecular underpinnings that allow IVM.sup.+ islets to survive underneath the skin, whether the islet-IVM mixture might enable transplants at other sites, such as the retroperitoneal space, was examined. Indeed, murine, porcine or human islets admixed with IVM and transplanted in the retroperitoneum uniformly restored normoglycemia in diabetic hosts. Moreover, similar to the grafts in the subcutaneous space, excision of the retroperitoneal island containing pancreatic islets led to recurrent diabetes (
Example 2
Islet Transplantation in the Subcutaneous Space Achieves Long-term Euglycemia in Preclinical Models of Type 1 Diabetes
[0086] This example reports a previously undescribed mixture of human collagen 1, L-glutamine, fetal bovine serum, sodium bicarbonate and medium 199, which when admixed with murine, porcine or human islets, promotes uniform survival of the islets subcutaneously.
Methods
Composition and Preparation of the Islet Viability Matrix
[0087] 10?M199 (Sigma Life Science, Cat #M0650-100ML), L-glutamine (Mediatech Inc., Cat #25-005-CI), FBS (HyClone Laboratories Inc., Cat #SH30071.03) 7.5% sodium bicarbonate, NaHCO.sub.3(Life Technologies Corporation, Cat #25080-094), Type I collagen (Advanced BioMatrix, Cat #5007-20ML)
[0088] Table 1 shows the constituents and their respective concentrations needed to create 1.0 mL of Islet Viability Matrix (IVM). Each ingredient and the final product must be kept on ice at all times to prevent solidification at higher temperatures.
TABLE-US-00002 TABLE 1 Components of IVM Concentration in Approximate Ingredients 1 ml IVM Ratio 10? Medium (M) 199 91 ?l 23 L-glutamine 8 ?l 2 Fetal Bovine Serum (FBS) 100 ?l 25 NaHCO.sub.3 (7.5%) 23 ?l 6 Type 1 Collagen 778 ?l 195
Murine Islet Transplantation Models
Animals
[0089] Immune competent (Balb/cByJStock Number: 000651, and C57BL/6J, B6Stock Number: 000664), and Immune Incompetent (B6.Cg-Prkdc.sup.scid/SzJ (B6/scidStock Number: 001913), CBySmn.Cg-Prkdc.sup.scid/J (Balb/c/scidStock Number: 001803), NU/J (Balb/c/nudeStock No: 002019), B6.Cg-Foxn1.sup.nu/J (B6/nudeStock Number: 000819) and NOD-scid IL2Rgamma.sup.null (NOGStock Number: 005557)) male mice aged 8-12 weeks, used as islet donors and recipients, were obtained from the Jackson Laboratory, Bar Harbor, ME. Littermate controls were not utilized as these experiments involved transplantation of mouse, porcine and human islets into diabetic recipients.
[0090] Animals were housed in conditions to minimize stress, including a 12-hour light/12-hour dark cycle, ?50% humidity, and a 20-21? ? C. temperature.
Diabetes Induction
[0091] Recipients were rendered diabetic by a single intraperitoneal injection of streptozotocin (SICOR Pharmaceuticals, Inc., Irvine, CA) at a dose of 200 mg/kg. At 5 days after streptozotocin (STZ) administration, animals with three consecutive (daily) non-fasting blood glucose levels>350 mg/dl (Contour Blood Glucose Monitoring System, Bayer HealthCare LLC, Mishawaka, IN, USA) were used as islet recipients. The protocol and all animal studies were approved by the University of Pennsylvania's IACUC (Protocol Numbers: 805662, 800932 and 805005), and in accordance with the NIH's Guide for the Care and Use of Laboratory Animals.
Islet Isolation
[0092] Mouse pancreatic islet isolation was done by collagenase P (Roche Diagnostics, Indianapolis, IN) digestion and density gradient separation. Islets were kept in a suspension of RPMI-1640 medium.
Islet Transplantation
[0093] The recipient mice were anesthetized by inhalation of 2-5% Isoflurane (Isoflurane USP, Clipper Distribution Company LLC, St Joseph, MO, USA).
[0094] In the subcutaneous (SC) transplantation model, a small skin incision (0.3-0.5 cm) was established over the lower abdomen to create a right and left lower quadrant SC pocket in which 400 fresh islets (hand-picked) were injected immediately in either a 360 ?L suspension of RPMI-1640 (islets alone; IA) or admixed in 360 ?L IVM into right and left SC pockets separately.
[0095] In the retroperitoneal (RP) transplantation model, the mouse right lower abdominal cavity was opened, and 400 manually-picked fresh islets in either a suspension of 180 ?L of RPMI-1640 (islets alone) or admixed in 180 ?L IVM were injected with 25-gauge butterfly needle underneath the peritoneal layer in the right posterior retroperitoneal space.
[0096] Of note, regardless of the number of isolated islets (ranging from 200-800), the volume of IVM (360 ?L IVM for SC and 180 ?L IVM for RP) in which they were suspended remains the same, largely due to anatomical space constraints in the animal.
Immunosuppressive Regimen Following Allogeneic or Xenogeneic Transplantation in Mice
[0097] The immunosuppression regimen was based on targeting both T and B cells to promote the survival of islet allograft tolerance. Briefly, the maintenance immunosuppression consisted of rapamycin (0.5 mg/kg intraperitoneal daily; qd), starting the day of islet transplantation for a duration of seven days. To target the ?-cell compartment, we used 10F4, a monoclonal antibody against mouse B lymphocyte stimulator (BLyS), 100 ?g intraperitoneally 20 days before transplant in two doses, 24 hours apart. 10F4 was provided by Human Genome Sciences, courtesy of Dr. Michael Cancro (Pathology and Laboratory Medicine, University of Pennsylvania), and eliminates primary B cells. 10F4 was also given again starting day 10 in a tapering dose, from 50 ?g/week in week 2, down to 5 ?g/week starting week 8. Immunosuppression was discontinued at day 66.
Porcine Islet Transplantation Models
Islet Isolation
[0098] Porcine islets were obtained from Dr. Bernhard Herring's laboratory at the University of Minnesota. Islets were incubated in CMRL 1066 medium (Mediatech, Inc. Cat #98-304-CV) containing 5.5 mM d-glucose, 0.05% human albumin (Telesis Biotherapeutics, Research Triangle Park, NC), 10 U/mL Heparin (Sagent Pharmaceuticals, Schaumberg, IL), 100 ?g/mL penicillin/streptomycin, and 2 mM L-glutamine.
Islet Transplantation
[0099] The recipient mice were anesthetized by inhalation of 2-5% Isoflurane (Isoflurane USP, Clipper Distribution Company LLC. St Joseph, MO). The SC and RP transplantation experiments were carried out as detailed above in the Murine Islet Transplantation Models section. The protocol and all animal studies were approved by the University of Pennsylvania's Institutional Animal Care and Use Committee (IACUC) (Protocol Numbers: 805662, 800932 and 805005), and in accordance with the Guide for the Care and Use of Laboratory Animals prepared by the NIH.
Human Islet Transplantation Models
Islet Isolation
[0100] The comprehensive islet transplantation program at the University of Pennsylvania served as the resource for the human islets used in this study. It is part of the Integrated Islet Distribution Program (IIDP), and along with other centers, formed the Clinical Islet Transplant consortium (CIT) to initiate phase 3 trials of islet transplantation in Type 1 Diabetes. The source (either through IIDP or CIT) of the isolated human islets used in the experiments of this example were all procured per the CIT manufacturing guidelines. which are described at: www.isletstudy.org. Human islets used via both the IIDP program as well as through CIT were procured at University of Pennsylvania's Islet GMP facility. Particularly with respect to the CIT, islets were obtained from pancreata that were originally intended for clinical use as part of the phase 3 clinical islet transplantation study. However, from several donors, the recovered yield was not high enough for clinical use despite high quality of the islets. These islet preps were then used for non-clinical activity such as distribution to research investigators and the experiments described here. The release criteria was followed as mandated by the NIH/FDA, including glucose-stimulated insulin release, restoration of normoglycemia in diabetic NOG mice, and perfusion studies for kinetics of insulin and glucagon secretion.
[0101] The recovery of pancreata from deceased organ donors was overseen under the auspices of the local/regional organ procurement agency (www.donors1.org; Gift of Life Donor Program, Philadelphia, PA). The staff of the organ procurement agency obtained consent for organ recovery from the next of kin/donor's family members without any intervention from the investigators using the organs for research, in accordance with the U.S. Federal Mandate. A summary of the characteristics of human islet donors used in the experiments is described in
Islet Transplantation
[0102] The recipient mice were anesthetized by inhalation of 2-5% Isoflurane (Isoflurane USP, Clipper Distribution Company LLC, St Joseph, MO). The SC and RP transplantation experiments were carried out as detailed above in the Murine Islet Transplantation Models section.
Assessment of Islet Graft Function
Islet Graft Monitoring
[0103] Blood Glucose levels were monitored twice daily after transplantation and recipients with non-fasting glucose concentrations<200 mg/dL were considered to have achieved normoglycemia. When two consecutive daily non-fasting glucose levels were >300 mg/dl after a period of one week, islet grafts were considered to have failed and the recipient was considered to have primary non-function of the islet transplant.
Glucose Tolerance Test
[0104] An intraperitoneal glucose tolerance test (IPGTT) was performed on the animals with long-term normoglycemia (>100 days). Blood glucose levels were analyzed using the Contour Blood Glucose Monitoring System (Bayer HealthCare LLC, Mishawaka, IN).
Excision of Islet bearing site
[0105] To confirm that the islet grafts were the sole source of maintaining normoglycemia, a cohort of long term normoglycemic islet recipients, underwent excision of the islet bearing sites (skin or retroperitoneum). This uniformly led to prompt recurrence of diabetes within 24 hours. In recipients transplanted without IVM, excision of graft bearing sites occurred on day 7. In recipients transplanted with Islet+IVM, excision of graft bearing sites occurred between 100-458 days.
Nonhuman Primate Models
Animals
[0106] Two male cynomolgus monkeys (Macaca fascicularis) were obtained from Spring Scientific Perkasie, PA, for autologous islet transplantation. Monkey 1 (ID #212077) had an initial body weight of 3.5 kg and age 4 years, whereas monkey 2 (ID #210069) had an initial body weight of 3.9 kg and age 4 years. Prior to transplantation, serological testing was performed on each animal to ensure that they were not infected with Herpes B. Schmidt-Ruppin strain of the Rous sarcoma virus, Simian T-cell Lymphotropic Virus (STLV), or Simian Immunodeficiency Virus (SIV). All animals had continuous water supply and were fed with regular primate diet supplemented with fresh fruits twice daily. All animal care and handling were done in accordance with the guidelines set forth by the Department of Health and Human Services' guide for care and use of primates, as well as the IACUC guidelines.
Diabetes Induction
[0107] To perform islet auto-transplantation and assess the efficacy of IVM to promote islet engraftment in subcutaneous space in the absence of anti-islet alloreactivity, diabetes in the monkeys was induced by subtotal pancreatectomy (?85-90%) in 2 cynomolgus monkeys. Monkeys were sedated using ketamine (15 mg/kg) and atropine (0.05 mg/kg), prepared for operation, and intubated. Anesthesia was initiated with midazolam (1 mg/kg) and maintained with isoflurane and oxygen. Haircoat was clipped closely from the nipples to mid-thigh and laterally to the end of the vertebral processes and skin, followed by scrubbing with a preliminary chlorhexidine solution. Animals were placed in a supine position, and the surgical field given a second chlorhexidine scrub. The abdomen was opened using a midline laparotomy. The spleen and greater omentum were reflected to expose the entire pancreas. The right and left pancreatic limbs were mobilized, preserving pancreatic vasculature, and the pancreas then carefully dissected from the duodenal serosa. The common pancreatic duct was identified at the duodenum, ligated, and transversely incised distal to the ligation. Through this incision, pancreatic duct was cannulated with an angio-catheter, and secured with ligature. The pancreas was then excised, placed in cold UW solution and transported to the islet isolation laboratory. Finally, incisions were closed layer by layer. General anesthesia was maintained while the pancreas was processed for islet isolation.
Islet Isolation
[0108] Islets were isolated by collagenase digestion and differential centrifugation.
Subcutaneous Islet Transplantation
[0109] While under general anesthesia, the animals were placed in a supine position, and after the sterile prepping of the abdomen a small incision (3-4 cm) was established in left lower quadrant of the abdomen and the needle connected to a syringe containing the isolated islets plus IVM, was inserted into the subcutaneous space. The total inoculum volume was slowly infused in the subcutaneous compartment and the needle point was then swabbed with an antiseptic. Finally, the animal was recovered in an incubator and extubated thereafter. Per the advice of our IACUC veterinarians, monkeys were not treated with exocrine extracts during the post islet transplantation.
Islet Graft Function
[0110] According to IACUC recommendation, after transplantation blood glucose levels in islet auto-transplanted monkeys were monitored twice daily for the first three months, then daily thereafter. Recipients with non-fasting glucose concentrations<200 mg/dL were considered to have achieved normoglycemia requiring no daily exogenous insulin administration. When two consecutive daily non-fasting glucose levels were >300 mg/dL after a period of primary graft function, islet grafts were considered to have failed mandating treatment with exogenous insulin twice daily. Towards POD 400, as a result of frequent blood sampling from the tip of the tail, the tail developed a wound. The IACUC veterinarian's recommendation was to not sample the animal for a period of several weeks to months, giving it enough time to completely heal. Any gaps in daily blood glucose measurements during the 3-year-long follow up were based on the uniform recommendation of veterinary staff to comply with ethical handling of the animal with proper care.
[0111] Biopsies of the islet bearing skin were performed under general anesthesia. Tissue samples (1-2 cm.sup.2) were processed for standard H&E and IHC staining.
Tracking the Clinical Course of the Cynomolgus Monkeys
[0112] For cynomolgus monkey #212077 (body weight 3.5 kg), the excised pancreas weighed 6 grams, yielding 84,000 IEQs. The volume of the islet tissue pellet was 0.3 mL which was added to 16.7 mL of IVM yielding an inoculum containing 5,000 IEQ/mL of IVM. The entire inoculum (23,729 IEQ/kg body weight) was infused into the subcutaneous space. It is important to note that the pre-transplant glucose level in this monkey ranged from 30-110 mg/dL. The duration from subtotal pancreatectomy to subcutaneous islet autotransplantation was 5 hours.
[0113] For cynomolgus monkey #210069, in addition to the protocol detailed above, this animal received STZ (50 mg/kg) after subtotal pancreatectomy to eliminate residual native islets in the pancreatic head remnant. The excised pancreas weighed 5 gm, yielding 46,125 IEQ's that were cultured in vitro overnight. During this period, the monkey had free access to water and food and several blood glucose determinations revealed the level 200 mg/del requiring exogenous insulin treatment. The islets were then removed from the culture. The islet tissue pellet volume was 0.2 mL which was added to 9.8 mL of IVM, yielding an inoculum containing about 5,000 IEQ/mL of IVM. The entire inoculum (11,827 IEQ/kg body weight) was transplanted subcutaneously into the LLQ of the abdomen. Of note, the duration from subtotal pancreatectomy to subcutaneous islet autotransplantation was 20 hours. In our attempts to eliminate the residual islets in the remnant of the pancreatic head, persistent STZ in the animal may have led to the loss of islet cells transplanted under the skin 20 hours after STZ administration.
[0114] During a year-long follow up, the animal remained diabetic, requiring daily insulin (
BrdU Incorporation Assay
[0115] In vivo bromodeoxyuridine (BrdU) labeling was achieved by diluting drinking water with (1 mg/mL) BrdU (Product #B9285, Sigma-Aldrich Co., LLC. St. Louis, MO) for 3 days, as previously described. Briefly, islet bearing skin sections containing human islets were harvested, fixed overnight with 4% paraformaldehyde, and processed for paraffin sectioning. Histological analysis of slides was performed using BrdU, Ki67, insulin, and glucagon. Slides were processed for immunostaining as follows: sections were incubated in blocking reagent (1% BSA in PBS) for 30 min, followed by incubation with the appropriate primary antibodies in the blocking reagent overnight at 4? C. Slides were washed thrice in PBS for 3-5 min each, followed by incubation for 45 min at room temperature in the appropriate secondary antibodies in blocking reagent. Slides were washed again in PBS (thrice for 5 min each) and mounted. Images were captured on the Keyence All-in-One Fluorescence Microscope using the 0.95 NA 40? objective (Nikon). BrdU-positive nuclei were counted, blinded from at least 20 islet ?-cells per mouse from four mice per group. The protocol was approved by the IACUC of the University of Pennsylvania.
RNA Isolation for Real-Time (RT) PCR Analysis
[0116] Islets from overnight fasted 18-wk-old mice were isolated using the standard collagenase procedure. Islet purity was assessed by Dithizone staining and shown to be >90% endocrine tissue. Total RNA from islets was isolated in Trizol (Invitrogen) followed by RNeasy mini kit or with RNeasy FFPE kit according to the manufacturer's instructions. Islet RNA was reverse transcribed using either 1 ?g of Oligo(dT) primer or random hexamer, SuperScript II Reverse Transcriptase, and accompanying reagents (Invitrogen). PCR reactions were assembled using the Brilliant SYBR Green QPCR Master Mix and done with the SYBR Green (with Dissociation Curve) program on the Mx3005P qPCR System (Stratagene). All reactions were done in triplicate with reference dye normalization, and median CT values were used for analysis. The following primers were used:
TABLE-US-00003 hSLC2A2F: (SEQIDNO:13) ATCCAAACTGGAAGGAACCC hSLC2A2R: (SEQIDNO:14) CATGTGCCACACTCACACAA hINSULINF: (SEQIDNO:15) AGGCCATCAAGCAGATCACT hINSULINR: (SEQIDNO:16) GCACAGGTGTTGGTTCACAA hPDX1F: (SEQIDNO:17) CCTTGTGCTCGGGTTATGTT hPDX1R: (SEQIDNO:18) ATCATCCCACTGCCAGAAAG hVEGFF: (SEQIDNO:19) CTACCTCCACCATGCCAAGT hVEGFR: (SEQIDNO:20) GCAGTAGCTGCGCTGATAGA
Immunohistochemistry Analyses
[0117] Islet-bearing skin or native pancreatic tissue biopsy samples were fixed in Bouin's or formalin solution. The tissues were processed for routine histology and stained with hematoxylin and eosin (H&E). For immunohistochemical analysis, serial paraffin sections were prepared and stained using anti insulin and glucagon (DAKO Cytomation, Carpinteria, CA), anti-Bovine and human collagen I, anti-human Bcl-2, anti-human VWF, anti-human VEGF, anti-human GLP-1 (Abcam, Cambridge, MA) and anti-human Ki67 antibodies (ThermoScientific, Grand Island, NY). The anti-collagen antibodies were species specific with minimal to no cross-reactivity with mouse collagen. The following products were used: anti-human collagen antibody (Product #C-2456, Sigma, Saint Louis) and anti-bovine collagen antibody (NB100-64523, Novus Biologicals).
[0118] Immunofluorescence Antibodies conjugated with Cy2 or Cy3 IgG (Jackson IRL, West Grove, PA) were used as the second step reagents. Immunohistochemistry for Bcl-2, VWF, VEGF, GLP-1 staining was carried out using the Dako Envision+system, peroxidase diaminobenzidine method (Dakocytomation, Carpinteria, CA). After de-paraffinization, antigen retrieval was carried out by boiling the slides in 10 mM citrate buffer, pH 6 or tris-based, pH 9 (Vector, Burlingame, CA) for 20 min. All antibodies at optimal dilution were incubated overnight at 4? C. Slides were then incubated with anti-rabbit or mouse HRP polymer for 30 min at room temperature followed by DAB+substrate-chromagen solution for 5 min at room temperature. Slides were counterstained with hematoxylin and mounted. The details of all the antibodies used for immunohistochemistry are described in Table 2.
TABLE-US-00004 TABLE 2 Details of antibodies used for immunohistochemical analyses of the subcutaneously transplanted islets Catalog Number (Clone, Antibody Vendor where applicable) Lot Number Dilution* Polyclonal guinea pig Dako A0564 10095957 1:250 anti-Insulin Polyclonal rabbit anti- Proteintech Group, Inc 15954-1-AP 00024282 1:500 Glucagon Monoclonal mouse anti- Sigma C2456 (COL-1) 088M4784V 1:75 Collagen I Monoclonal rabbit anti- Abcam ab32124 (E17) GR3232704-3 1:100 Bcl-2 Monoclonal mouse anti- Abcam ab201336 GR3195786-9 1:100 VWF (3E2D10 + VWF635) Monoclonal rabbit anti- Abcam ab27620 (SP28) GR3214982-1 RTU VEGF Monoclonal rabbit anti- Abcam ab108443 GR215906-3 1:100 GLP-1 (EPR4042-1) Monoclonal rabbit anti- Thermo Fisher RM-9106-R4 (SP1) 9106R802C RTU Ki67 Scientific Cy?2 AffiniPure Jackson 711-225-152 136061 1:400 Donkey Anti-Rabbit IgG ImmunoResearch (H + L) Laboratories, Inc Cy?2 AffiniPure Jackson 715-225-151 137363 1:400 Donkey Anti-Mouse IgG ImmunoResearch (H + L) Laboratories, Inc Cy?3 AffiniPure Jackson 706-165-148 119998 1:400 Donkey Anti-Guinea Pig ImmunoResearch IgG (H + L) Laboratories, Inc Cy?5 AffiniPure Jackson 711-175-152 139802 1:200 Donkey Anti-Rabbit ImmunoResearch IgG Laboratories, Inc Coat anti rabbit HRP Vector lab MP-7451 ZE1015 RTU conjugated antibody Coat anti mouse HRP Vector lab MP-7452 ZE0620 RTU conjugated antibody *RTU indicates ready-to-use; no dilution needed.
[0119] The proportion and intensity of the stained epitopes were evaluated using QuPath v0.1.2. Before running the image analysis algorithm on a particular slide, automated image masking was done per the developer's recommended steps (github.com/qupath/qupath/wiki). The accuracy of this automated ROI annotation was manually checked by an independent pathologist. Subsequently, QuPath's algorithm analyzed all ROIs in the inclusion annotation, excluding any tissue artifacts. Each section image had ?5 ROIs of sufficiently high quality, and using each ROI as the unit of analysis, a Kruskal-Wallis H Test was performed to compare the output distributions for the proportion and intensity of staining between the IVM.sup.+ and IVM.sup.? groups.
Biochemical Analysis of Transplanted Islet-Specific Exosome Contents
Affinity Antibody-Coupled Bead Purification of Tissue Specific EVs
[0120] MHC specific antibody was covalently conjugated to N-hydroxysuccinamide magnetic beads (Pierce) per manufacturer's protocol. 50 to 100 ?g protein equivalent of EVs were incubated with antibody beads overnight at 4? C. The bead bound EV fractions were separated per manufacturer's protocol. EVs bound to beads were eluted using tris glycine and utilized for downstream analysis. Unconjugated HLA allele-specific anti-HLA A2 monoclonal IgG antibody (Catalogue #0791HA) was purchased from One Lambda (West Hills, CA), for donor HLA class I specific exosome isolation from recipient mouse plasma total pool of exosomes. Antibodies to insulin (15848-1-AP; used at a dilution of 1:200), TSG 101(28283-1-AP; used at a dilution of 1:500) were purchased from Proteintech Lab; antibodies to GLPIR (sc-390774; used at a dilution of 1:200), GLP-1 (sc-57166; used at a dilution of 1:200), Bcl-2 (sc-7382; used at a dilution of 1:200), and Bcl-XL (sc-56021; used at a dilution of 1:200) were purchased from Santa Cruz Biotechnologies. Secondary antibodies conjugated to HRP (ready-to-use anti-rabbit, anti-mouse were purchased from Vector Lab: MP7451 and MP7452, respectively).
Extracellular Vesicle (EV) Isolation
[0121] Exosomes were isolated from mouse plasma by using Sepharose 2B bead based size exclusion chromatography followed by ultracentrifugation. Briefly, 250 ?L to 500 ?L of plasma was passed through a Sepharose 2B column. Eluent was collected in fractions and pooled after monitoring absorbance at 280 nm. The pooled fraction was ultracentrifuged at 110,000 g for 2 hours at 4? C., pellet was resuspended in 1?PBS for downstream analysis. Purified nanoparticles were analyzed on the NanoSight NS300 at light scatter mode for exosomes quantity and size distribution according to manufacturer's protocols (Malvern instruments Inc., MA).
RNA Isolation from Exosomes.
[0122] Total RNA (including microRNAs and mRNA), was extracted from NHS-HLA-Class I bead bound exosomes using Trizol, followed by RNeasy mini kit, according to manufacturer's protocol (Qiagen, Germany).
Western Blot Analysis.
[0123] Donor HLA-class I specific exosomes bound to NHS-beads were lysed and separated on polyacrylamide gels, and transferred onto Nitrocellulose membrane (Life Technologies, NY). The blot was blocked, incubated with desired primary antibody, HRP coupled secondary antibody (Santa Cruz Biotechnologies) per manufacturer's protocol and detected through Chemiluminescence using Phospho-Imager (Amersham Imager 680, GE Health).
Library Preparation and Sequencing
[0124] Exosomal RNA samples were assayed for quantity and quality with an Agilent 2100 Bioanalyzer instrument using the Agilent RNA 6000 Pico Kit (Agilent Technologies, Part number 5067-1513). Libraries were prepared using QIAseq miRNA Library Kit (QIAGEN, cat #331502) as per standard protocol in the kit's sample prep guide. Libraries were assayed for overall quality and quantified using High Sensitivity DNA Kit of Agilent 2100 Bioanalyzer (Agilent Technologies, Part number 5067-4626). Samples were multiplexed for sequencing. 100 bp single-read sequencing of multiplexed pool of samples was carried out on an Illumina HiSeq 4000 sequencer. Illumina's bcl2fastq version v2.20.0.422 software was used to convert bcl to demultiplexed fastq files.
Trimming Adapter Sequence and UMI Extraction
[0125] The library prep kit when sequenced to 100 bp produces reads a the read, a UMI, as well as fixed or nearly fixed sequences. The program cutadapt was used to remove the trailing adapter AGATCGGAAGAGCACACGTCT with settings -m 36 -max-n 1. Then the UMI was extracted and the putative smRNA sequence using a custom R script. Briefly, trimmed reads that had more than 3 Ns, or were less than 55 bases long, or did not contain an exact match to the sequence AACTGTAGGCACCATCAAT were dropped. The last 12 bases of reads were trimmed and recorded as the UMI. The 19 bases matching the inner adapter sequence were trimmed and the leading sequence was retained as the smRNA sequence. The UMI was appended to the def-line, and the trimmed read and base qualities were saved in FASTQ format.
Building Chimeric Bowtie Libraries and Transcript Quantification
[0126] Three bowtie libraries (bowtie v1.2.3) were built that consisted of mouse and human (1) miRNA hairpins, (2) tRNAs, and (3) RefSeq sequences. The smRNA reads from above were aligned to each separately using the command bowtie -q -k 4 --best --sam --norc. Expression of miRNA, tRNA, and RefSeq were quantified using the bowtie output files using a custom R script that used libraries Rsamtools, and GenomicAlignments to process the bowtie BAM files. Simple species filtering and UMI reduction was performed as follows. Alignments were filtered to retain only those with the best bowtie stratum (XA BAM tag). Then any reads which had a top-stratum match to both human and mouse were discarded. UMI reduction was performed by binning unique combinations of reference sequence name (i.e., miRNA, tRNA, or RefSeq id), start position, and UMI. Overall raw expression for a reference sequence was calculated as the number of unique reads aligning to each sequence. Raw read counts were also converted to CPM by adding a pseudocount of 1 to all detected transcripts, normalizing to total counts, then taking log 2.
Gene Expression in Immunodeficient Mice
[0127] To further examine the kinetics of gene expression with islet endocrine function in vivo, further to the study in immunocompetent B6 mice in Example 1, age-matched streptozotocin-treated NSG mice were divided into two groupsin one group, human IVM.sup.+ islets were subcutaneously engrafted, while the other group received IVM.sup.? islets. Glucose measurements at 3, 6, 24 and 48 hr post-transplantation revealed that animals in the IVM.sup.+ group achieve glucose homeostasis as early as 6 hr post-engraftment (
TABLE-US-00005 TABLE 3 Results of human IVM.sup.+ islet or IVM.sup.? islet transplantation in NSG immunodeficient mice and immunocompromised B6/Nude mice. N/sample Number Transplant Recipient size of Islets Site* Graft.sup.? NG.sub.24 NG.sub.48 NG.sub.168 NSG 8 200 KC lA 0 0 25 NSG 6 200 PV lA 0 0 17 NSG 6 200 SC lVM 17 33 67 NSG 10 400 KC lA 60 60 80 NSG 6 400 PV lA 33 50 67 NSG 8 400 SC lVM 88 100 100 B6/Nude 10 500 KC lA 60 70 100 B6/Nude 5 500 PV lA 60 60 80 B6/Nude 10 500 SC lVM 80 80 100 *KC = Kidney Capsule; PV = Portal Vein; SC = Subcutaneous Space. .sup.?lA = islets alone; lVM = islets implanted subcutaneously with lVM. NG.sub.x = % of animals normoglycemic within x hours NSG = non-obese diabetic SCID gamma mouse
Statistics and Reproducibility
[0128] All statistical analyses were performed using R v3.5.3 (www.r-project.org). Data are expressed as mean?standard deviation unless indicated otherwise. The significance of differences between two independent groups was calculated by the Wilcoxon Rank Sum/Mann-Whitney U Test, or the Student's two-sample t-test, as indicated. For representative IHC images, experiments were performed five independent times using distinct biological isolates. The IHC distributions obtained from QuPath were compared between the IVM.sup.? and IVM.sup.+ groups using the Kruskal-Wallis H Test. Cell culture experiments were repeated in independent biological triplicates to ensure reproducibility of the observations. Differences were considered significant at P<0.05 after Benjamini-Hochberg correction for multiple hypothesis testing. The initial pathway analyses were carried out using multicross (cran.r-project.org/web/packages/multicross/index.html), and subsequent gene-set enrichment analysis performed using the WEB-based Gene SeT AnaLysis Toolkit (WebGestalt; www.webgestalt.org). A filter of False Discovery Rate (FDR)<0.05 was used to obtain selected pathways with the highest enrichment.
[0129] Unless stated otherwise, each experiment was repeated a minimum of five times per sample. Representative histology images shown in
Data Availability Statement
[0130] Raw and processed exosome sequencing data have been submitted to GEO (Accession number GSE145593).
[0131] While certain features of the invention have been illustrated and described herein, many modifications, substitutions, changes, and equivalents will now occur to those of ordinary skill in the art. It is, therefore, to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true spirit of the invention.