APTAMER FOR SPECIFICALLY RECOGNIZING SOLUBLE ST2 PROTEIN AND APPLICATION OF THE SAME

Abstract

A nucleic acid aptamer specifically recognizing soluble ST2 protein and its application, belonging to the field of variation or genetic engineering, are described. The technical problem addressed includes how to specifically detect sST2 protein. In order to address this technical problem, nucleic acid aptamers of single-stranded DNA with nucleotide sequences are shown in SEQ ID No. 1-10, respectively. SELEX technology, combined with high-throughput sequencing technology and bioinformatics analysis, reduces the rounds of screening and obtains candidate nucleic acid aptamers, and further analyzes its affinity and specificity to obtain a nucleic acid aptamer that specifically recognizes sST2 protein. The nucleic acid aptamer has the characteristics of high specificity, high stability, convenient synthesis, and easy labeling of functional groups, and the like, and may be used for the detection of sST2 protein and the preparation of biosensors, diagnosis and prognosis of cardiovascular diseases and other products.

Claims

1-10. (canceled)

11. A nucleic acid aptamer, comprising any one of the following: A1) any single-stranded DNA with a nucleotide sequence shown in any one of SEQ ID No. 4, 6, 5, 1, 2, 3, 7, 8, 9 and 10; A2) any single-stranded DNA with a nucleotide sequence having 75% or more identity with the nucleotide sequence defined in A1), and specifically recognizing sST2 protein; A3) any single-stranded RNA that is transcribed from the single-stranded DNA shown in A1) and specifically recognizes sST2 protein; A4) any single-stranded RNA or single-stranded RNA that hybridizes with the nucleotide sequence defined in A1) or A3) under stringent conditions, and specifically recognizes sST2 protein.

12. A probe comprising any of the nucleic acid aptamers according to claim 11 and a marker linked to the nucleic acid aptamer.

13. A sensor containing any nucleic acid aptamer according to claim 11.

14. A reagent or kit for detecting sST2 protein containing any nucleic acid aptamer according to claim 11.

15. A drug for preventing, improving or treating sST2 related diseases containing any nucleic acid aptamer according to claim 11.

16. The drug according to claim 15, wherein the sST2 related disease is a cardiovascular disease.

17. The drug according to claim 16, wherein the cardiovascular disease is selected from the group comprising the following: heart failure, atherosclerosis, hypertension, myocardial infarction, coronary heart disease, acute coronary syndrome, aortic aneurysm or aortic dissection.

18. A drug delivery system specifically targeting sST2 protein containing any nucleic acid aptamer according to claim 11.

19. A method of preventing or treating an sST2 related disease in a subject comprising the step of administering to the subject a prophylactically or therapeutically effective amount of any nucleic acid aptamer according to claim 11.

20. The method according to claim 19, wherein the sST2 related disease is cardiovascular disease.

21. The method according to claim 20, wherein the cardiovascular disease is selected from the group comprising the following: heart failure, atherosclerosis, hypertension, myocardial infarction, coronary heart disease, acute coronary syndrome, aortic aneurysm or aortic dissection.

22. A method for detecting sST2 protein comprising labelling a reporter group on any nucleic acid aptamer according to claim 11, making the nucleic acid aptamer that has labeled reporter group and a sample to be tested interact, and detecting sST2 protein through the signal detection of the reporter group.

23. A method of screening, diagnosing, or auxiliary diagnosis of an sST2 related disease in a subject comprising the step of detecting an sST2 protein in a sample of the subject using any of the nucleic acid aptamers claimed in claim 11.

24. The method according to claim 23, wherein the auxiliary diagnosis of an sST2-related disease in a subject comprises assessing a prognosis for the sST2 related disease, predicting a probability of death from the sST2 related disease, or assessing a risk stratification for heart failure in the subject.

25. The method according to claim 23, wherein the sST2 related disease is a cardiovascular disease.

26. The method according to claim 25, wherein the cardiovascular disease is selected from the group comprising the following: heart failure, atherosclerosis, hypertension, myocardial infarction, coronary heart disease, acute coronary syndrome, aortic aneurysm or aortic dissection.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0073] FIG. 1 is a diagram of the purified electrophoresis results of human sST2 protein.

[0074] FIG. 2 shows the percentage of elution ratio (first from left), binding ratio (second from left), and signal-to-noise ratio (third from left) after the 1.sup.st, 2.sup.nd, 3.sup.rd, 4.sup.th, 5.sup.th, 6.sup.th, and 7.sup.th round of screening.

[0075] FIG. 3 shows the EMSA (Electrophoretic Mobility Shift Assay) experimental result in Example 2.

[0076] FIG. 4 shows the results of affinity detection experiments between aptamers Apt4 (SEQ ID No.4), Apt5 (SEQ ID No.5) and Apt6 (SEQ ID No.6) and sST2 protein in Example 3.

BEST MODE OF IMPLEMENTING THE PRESENT INVENTION

[0077] The present invention will be further described in detail below in conjunction with specific embodiments, and the given examples are only for clarifying the present invention, not for limiting the scope of the present invention. The examples provided below may be used as a guideline for those skilled in the art to make further improvements, and are not intended to limit the present invention in any way.

[0078] The experimental methods in the following examples, unless otherwise specified, are conventional methods, carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials and reagents used in the following examples may be obtained from commercial sources unless otherwise specified.

[0079] sST2 protein in the following examples was purchased from Beijing Sino Biological Technology Co., Ltd. (Cat: 10105-H08H). The results of its purification electrophoresis (SDS-PAGE) are shown in FIG. 1.

Example 1. Screening of Single-Stranded DNA Aptamers Targeting Human SST2 Protein

[0080] Single-stranded DNA (ssDNA) aptamers targeting human sST2 protein was obtained by using systematic evolution of ligands by exponential enrichment (SELEX) and high-throughput sequencing technology, and by applying bioinformatics analysis.

[0081] Specific steps are as follows:

1. Construction of a Random SsDNA Library

[0082] The random ssDNA library comprises two primer regions and a random region of 35 bases, the nucleotide sequence of which is shown in SEQ ID No.11, wherein positions 1-20 of SEQ ID No.11 are the forward primer region, positions 56-75 of SEQ ID No.11 are a reverse primer region, positions 21-55 of SEQ ID No.11 are 35 nucleotides N, and N represents A, G, C or T.

[0083] Wherein the forward primer sequence corresponding to the forward primer region is:

TABLE-US-00001 (SEQIDNo.12) 5-GACAGGCAGGACACCGTAAC-3;

[0084] The reverse primer sequence corresponding to the reverse primer region is:

TABLE-US-00002 (SEQIDNO.13) 5-GAAGAGGAGGGAGGTAGCAG-3.

2. Magnetic Bead Negative Screening

[0085] 2-1. Dissolve 10 ?l of 100 mM random ssDNA library in 480 ml of Binding buffer (137 mM NaCl; 2.7 mM KCl; 4.3 mM Na.sub.2HPO.sub.4; 1.4 mM KH.sub.2PO.sub.4), heat in a water bath at 95? C. for 10 min, and quench in an ice bath for 10 min, and left at room temperature for 10 min to prepare a library of ssDNA aptamers that form secondary structures. [0086] 2-2. Activation of the magnetic beads. The magnetic beads are treated with 50 mg/mL EDC and 50 mg/mL NHS to form carboxylated magnetic beads. Wash twice with 25 mM MES solution (pH=5.0) and add 10 ?L Binding Buffer, disperse the magnetic beads in Binding Buffer, ready for use. [0087] 2-3. Add all the activated magnetic beads to the ssDNA library solution with a total volume of 500 ?L, incubate at room temperature for 30 min, discard the magnetic beads after the incubation (magnetic separation), and keep the supernatant.

3. Magnetic Bead Screening for SsDNA Bound to the Target Molecule (SST2)

[0088] 3-1. Add 10 ?L of 10 ?M sST2 protein to the supernatant, and rotate at 25? C. for 1 h. [0089] 3-2. Activation of the magnetic beads, the steps are the same as those in 2-2 above. [0090] 3-3. Add the activated magnetic beads to the ssDNA solution for incubating sST2, and incubate at room temperature for 30 min. After the incubation, discard the supernatant and keep the magnetic beads. [0091] 3-4. After adding 500 ?L of Binding Buffer to the magnetic beads, place them on a shaker for 5 minutes, place them on a strong magnet for 1 minute, take out the supernatant, repeat washing 4 times (5 minutes each time), and collect each supernatant (W1-W4). [0092] 3-5. Add 1.8 ?L Proteinase K (20 mg/mL) to the washed magnetic beads, dilute to 120 ?L with Binding Buffer, place in a 52? C. incubator for 2 h, shake at 95? C. after the reaction and heat for 20 min to inactivate Proteinase K, and take out 120 ?L of supernatant, which is the eluate of the first round of screening (R1).

4. Preparation of the SsDNA Library for the Next Round of Screening

[0093] 4-1. Use the eluent (R1) as a template to prepare a small PCR sample, set different numbers of amplification rounds, and judge which cycle has the least amplification concentration and impure amplification bands by gel electrophoresis. The number of amplification rounds is usually set as 5, 9, 12, 15, 18, 21, and a blank control should be added when PCR is carried out. The system for the small sample PCR is shown in Table 1.

TABLE-US-00003 TABLE 1 System for small sample PCR (20 ul) Components Volume Taq enzyme 10 ul Water 4 ul Forward primer 2 ul (a primer with Biotin is used) Reverse primer 2 ul (a primer with Biotin is used) Template 2 ul Total volume 20 ul

[0094] Taking samples that have completed predetermined rounds of amplification at 72? C. extension.

4-2. Large Sample PCR

[0095] After small sample PCR, judge the optimal number of amplification rounds by gel electrophoresis experiment, and perform a large sample PCR according to the number of amplification rounds. 6-8 tubes are needed with a volume of 100 ?l for each tube. The system for the large sample PCR is shown in Table 2.

TABLE-US-00004 TABLE 2 System for large sample PCR (100 ul) Components Volume Taq enzyme 50 ul Water 20 ul Forward primer 10 ul (a primer with Biotin is used) Reverse primer 10 ul (a primer with Biotin is used) Template 10 ul Total volume 100 ul

4-3. Preparation of Single Stranded DNA (Secondary Library)

[0096] {circle around (1)} Slowly pass the products obtained after large sample PCR through the streptomycin coated agarose beads one by one. After all the samples pass through the column, wash them twice with 200 ?l PBS. [0097] {circle around (2)} Add 100 ?l of NaOH, the collected liquid after passing through the column is the target single stranded DNA, add 2 ?l of 15 M HCL (hydrochloric acid) to neutralize, and mix well. [0098] {circle around (3)} Detect the concentration of the collected single stranded DNA (ssDNA) solution as the library for the next round of screening.

5. Fluorescent Quantitative PCR Detection and Screening the Enrichment Degree of Library

[0099] 5-1. Using the supernatant W1-W4 collected in step 3-4 and the eluate R1 of the first round as templates, perform fluorescent quantitative PCR. [0100] 5-2. The elution ratio, binding ratio and signal-to-noise ratio of each round of screening may be obtained through the number of cycles of fluorescent quantitative PCR and the standard curve, and the enrichment degree of the library may be evaluated based on these references.

6. Multiple Rounds of Screening and High Throughput Sequencing

[0101] 6-1. Repeat the screening steps 1-5, and use the secondary library obtained in the previous round as the initial library for each screening. During the screening process, the screening pressure was increased by reducing the amount of library input and adding negative screening proteins to increase the enrichment degree of the ssDNA library. [0102] 6-2. After 7 rounds of screening, the results of fluorescent quantitative PCR show that the ssDNA library has been significantly enriched, much higher than the 6.sup.th round (results shown in FIG. 2), so the ssDNA from the 6.sup.th and 7.sup.th rounds were amplified by PCR. The amplified and purified products were subjected to high throughput sequencing. By comparing the abundance of the sequencing results, the top 10 DNA sequences were determined, and their nucleotide sequences are shown in Table 3.

TABLE-US-00005 TABLE3 Sequenceinformationofthetop10aptamersintermsofabundance Name SEQIDNo. Length Sequence(5-3) Apt1 SEQID 35 TCCATCCACTCGGGGCTAGAAGCCGTGAGAATCTG No.1 Apt2 SEQID 35 TCCATCCACTCGGGCCCTAGGGCGTGTATGTCCAT No.2 Apt3 SEQID 35 TCCATCCACTCGGCCTACTAAGGGTTTCGTTCACC No.3 Apt4 SEQID 36 TCCATCCACTCGGGGCGGGGGCTCGTGCTCTATTTC No.4 Apt5 SEQID 35 CCTCCATCCACTCGGCGCAACGCCGGGGCTCGGCC No.5 Apt6 SEQID 35 TCCATTCACTCGACCGCTGACGCGGGTGTCGTTTT No.6 Apt7 SEQID 35 TCCATGCACTCGCCCTTGAAAGGGTTCCCTCCGTT No.7 Apt8 SEQID 35 TCCATCCACTCGGCGCCACGCGGTTTCTCCAGATT No.8 Apt9 SEQID 35 TCCATGCACTCGCGCTACCGGCGTGCCCGTAGATC No.9 Apt10 SEQID 35 TCCATTCACTCGCAGCGGGGTCGCGTGAGGCGCAA No.10

Example 2. Gel Electrophoretic Mobility Assay (EMSA) to Detect the Binding of Aptamers to SST2 Protein

[0103] EMSA (Electrophoretic Mobility Shift Assay) is an in vitro technique for detecting the interaction between protein and DNA sequence (or RNA sequence), which may be used for qualitative and quantitative analysis. Purified proteins and DNA sequences (or RNA sequences) are usually incubated in a homogeneous environment, followed by separation of protein-DNA complexes and non-binding sequences on non-denaturing polyacrylamine (PAGE) gel electrophoresis. The principle of separation is that the protein-DNA complex moves slower than the non-binding sequence due to the binding of macromolecular substances such as proteins on the DNA.

[0104] The experimental steps are as follows:

1. DNA Heat Treatment

[0105] According to the experimental formula shown in Table 4, the aptamer was added to the buffer solution and nuclease-free water, heated at 95? C. for 10 minutes, quenched on ice for 10 minutes, and room temperature for 10 minutes.

TABLE-US-00006 TABLE 4 DNA heat treatment experimental formula Buffer solution Number of Aptamer sST2 (2 ? binding Nuclease- Total Sample (20 ?M) (10 ?M) buffer) free water volume Negative 2 ?L 10 ?L 8 ?L 20 ?L Control Experimental 2 ?L 8 ?L 10 ?L 20 ?L Group

2. Incubation of DNA and Target

[0106] The above DNA solution and sST2 protein were slowly mixed to a final volume of 20 ?L, and a sample containing only aptamer and no protein was used as a negative control, and incubated with rotation at room temperature for 30 minutes.

3. Gel Electrophoresis

[0107] Non-denaturing PAGE gel electrophoresis was performed on negative controls and samples, gel imaging was performed after dye staining, and analysis was performed with imaging software. The results are shown in FIG. 3, all of the aptamers Apt1-10 shown in SEQ ID No.1-10 strongly bind to sST2, wherein the binding of Apt4 shown in SEQ ID No.4, Apt5 shown in SEQ ID No.5 and Apt6 shown in SEQ ID No.6 is more significant.

Example 3. Determination of Affinity of Apt4, Apt5 and Apt6 to SST2 Protein

[0108] 1. Incubate the detection target sST2 protein with the silanized and bifunctionalized optical fiber at room temperature for 6 h. [0109] 2. The DNA of Apt4, Apt5 and Apt6 was labeled with CY5.5, and the DNA of Apt4, Apt5 and Apt6 were prepared in different concentrations: 0 nM, 10 nM, 50 nM, 100 nM, 200 nM, 500 nM, and 1000 nM. [0110] 3. Load the optical fiber into the detection instrument, and each concentration of aptamer passes through the detection instrument in turn according to the steps set in the sample injection (as shown in Table 5).

TABLE-US-00007 TABLE 5 Injection setting steps Injection steps Injection time Waiting time Buffer solution 20 s 5 s Sample (A48-cy5) 20 s 180 s (binding) Buffer solution 20 s 180 s (dissociation) Regeneration solution 30 s 5 s Buffer solution 30 s 0 s

[0111] The composition of buffer solution in Table 5 is 137 mM NaCl; 2.7 mM KCl; 4.3 mM Na.sub.2HPO.sub.4; 1.4 mM KH.sub.2PO.sub.4; the regeneration solution is 2 M NaCl. [0112] 4. Record the fluorescence photometry value of each concentration gradient DNA entering the detector, and use the GraphPad Prism software to perform curve fitting based on the measured fluorescence photometry value, and use the equation Y=Bmax*X/(Kd+X) to calculate the Kd value. The results are shown in FIG. 4, the binding value Kd of Apt4 shown in SEQ ID No.4 to sST2 protein is 127 nM, the binding value Kd of Apt5 shown in SEQ ID No.5 to sST2 protein is 188 nM, and the binding value Kd of Apt6 shown in SEQ ID No. 6 to sST2 protein is 173 nM.

[0113] The present invention has been described in detail above. For those skilled in the art, without departing from the spirit and scope of the present invention, and without unnecessary experiments, the present invention may be practiced in a wider range under equivalent parameters, concentrations and conditions. While specific examples of the invention have been given, it should be understood that the invention may be further modified. In one word, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made with conventional techniques known in the art and departing from the disclosed scope of this application. Applications of some of the essential features are possible within the scope of the appended claims below.

INDUSTRIAL APPLICATION

[0114] The invention adopts MCP-SELEX technology, combines high throughput sequencing technology and bioinformatics analysis, reduces the rounds of screening and obtains candidate aptamers. Further analysis of its affinity and specificity resulted in the ssDNA aptamer specifically recognizing sST2 protein. The ssDNA aptamer of the present invention has the characteristics of high specificity, high stability, convenient synthesis, easy labeling of functional groups, and the like, can specifically recognize and bind to sST2 protein, and is used for the detection of sST2 protein and the preparation of biosensors. At the same time, ssDNA aptamer of the present invention is also a potential therapeutic drug for sST2 related diseases, and may be used to prepare reagents for clinical diagnosis or drugs for disease treatment.

[0115] The present invention provides highly specific aptamers that may be screened in vitro, may be obtained in high throughput, has a short screening period, is convenient to synthesize, has good stability, high affinity, and is easy to modify and label for the detection of sST2. The aptamers may be chemically synthesized, does not rely on biology, is cheap, and is easy to store. At the same time, the aptamers of the present invention may be used alone or carry related drugs, and has development prospects for the treatment of diseases in which sST2 is involved.