METHOD FOR PRODUCING GENETICALLY EDITED BIRDS HAVING RESISTANCE TO AVIAN INFLUENZA VIRUSES

Abstract

Provided is a method of producing a genome-edited bird having resistance to avian influenza viruses. A method according to an aspect may enable precise inhibition of interaction between virus proteins while maintaining the original function of an ANP32A gene in a host by substituting only key amino acids of the ANP32A gene. When the method is used, by including cell lines having resistance to avian influenza viruses, new poultry and bird breeds that may not pose any biological safety issues may be efficiently developed. Thus, it is expected that the potential for industrial application is high.

Claims

1. A recombinant vector comprising a guide RNA (gRNA) or a polynucleotide encoding the gRNA, wherein the guide RNA (gRNA) targets at least one residue selected from the group consisting of Asp149, Asp152, Asp182, and Asp185 in an Acidic Nuclear Phosphoprotein 32 Family Member A (ANP32A) gene.

2. The recombinant vector of claim 1, wherein the gRNA is represented by SEQ ID NO: 14.

3. The recombinant vector of claim 1, wherein the polynucleotide comprises a protospacer adjacent motif (PAM).

4. A genome-editing composition comprising the recombinant vector of claim 1 and at least one nuclease encoding sequence selected from the group consisting of CRISPR associated protein 9 (Cas9), CRISPR from Prevotella and Francisella 1 (Cpf1), a transcription activator-like effector nuclease (TALEN), and a zinc finger nuclease (ZFN).

5. The genome-editing composition of claim 4, wherein the genome-editing composition induces substitution of at least one selected from the group consisting of D149Y, D152H, D182Y, and D185H in an ANP32A gene.

6. The genome-editing composition of claim 4, wherein the composition is for inducing resistance to avian influenza viruses.

7. A transformed cell into which the recombinant vector of claim 1 is introduced.

8. The transformed cell of claim 7, wherein the cell is selected from the group consisting of stem cells, somatic cells, germ cells, fertilized eggs, and embryos, of a bird.

9. The transformed cell of claim 8, wherein the germ cells are primordial germ cells (PGCs).

10. The transformed cell of claim 7, wherein the transformed cell is a cell in which at least one residue selected from the group consisting of Asp149, Asp152, Asp182, and Asp185 in an ANP32A gene is substituted.

11. A method of producing a transformed cell, the method comprising introducing the recombinant vector of claim 1 or the genome-editing composition of claim 4 into a bird somatic cell.

12. A method of producing a genome-edited bird comprising transplanting the transformed cell of claim 7 into an embryo of a bird.

13. The method of claim 12, wherein the bird is selected from the group consisting of chickens, ducks, geese, quails, pheasants, and turkeys.

14. The method of claim 12, wherein the genome-edited bird has resistance to avian influenza viruses.

15. A genome-edited bird having resistance to avian influenza viruses, produced according to the method of claim 12.

16. A transformed cell into which the genome-editing composition of claim 4 is introduced.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0054] FIGS. 1A, 1B and 1C shows results of establishing a chicken ANP32A knockout DF-1 clone through CRISPR/Cas9-mediated genome editing. (1A) shows T7E1 analysis results of DF-1 cells transfected with a CRISPR/Cas9 vector including A#1 guide RNA (gRNA) targeting exon 1 of chicken ANP32A (cANP32A). Wild-type DF-1 cells were used as a control. (1B) shows results of mutational analysis of transfected DF-1 cells by Sanger sequencing. Insertion-deletion (in-del) mutation frequency is indicated in parentheses. Characters with strikethrough (thickest boldface) indicate deleted nucleotides, and characters without strikethrough (thickest boldface) indicate inserted nucleotides. ‘AAAGGATCCACTTAGAGCTG’ indicates a gRNA-binding site sequence, and ‘CGG’ indicates a protospacer adjacent motif (PAM) sequence, and ATG codons are indicated in italics at the beginning of the sequences. (1C) shows sequencing results using chromatography of a cANP32A-knockout clone (A112).

[0055] FIGS. 2A, 2B, 2C and 2D shows results of analysis of functional significance of amino acid residues 149 to 175 of human ANP32 family members for viral replication and viral polymerase (vPol). (2A) shows results of Western blot analysis using an anti-FLAG antibody, in which overexpression of human ANP32 family members including hANP32A, hANP32B, hANP32C, hANP32D, and hANP32E were confirmed in ANP32A-deficient (A_KO) chicken DF-1 cells. (2B) shows results of determining viral titers by TCID.sub.50 analysis after infecting each A_KO cell expressing hANP32 protein with PR8-H5N8 (PB2-627E, or PB2-627K) influenza virus (MOI 0.1). (2C) shows results of multiple sequence alignment of amino acid residues 149 to 175 of hANP32 and chicken ANP32 (cANP32) family members. The percentage of identity to amino acid residues 149 to 175 of cANP32A is indicated. All protein sequences are sorted using Blosum62 scoring matrix in Geneious software (black: 100%; dark gray: 80% to 100%; and light gray: 60% to 80%; white: <60%). (2D) shows the forced expression effect of hANP32A, hANP32A_27 del, hANP32A_27 C, hANP32C, hANP32C_27 A, hANP32E, or hANP32E 27A on viral gene expression in A_KO cells after infection with PR8-H5N8 (PB2-627E). A_KO cells (empty) transfected with an empty vector were used as a control. Data are expressed as mean±standard deviation (n=3). *P<0.05, **P<0.01, ***P<0.001, and ****P<0.0001. ns=non-significant.

[0056] FIGS. 3A, 3B, 3C and 3D shows results of identifying key residues involved in influenza virus replication among amino acid residues 149 to 175 of ANP32A protein. (3A) shows results of pairwise sequence alignment of amino acid residues 149 to 175 of human ANP32A (hANP32A) and hANP32C. (3B) shows that viral titers measured after overexpression of hANP32A in which amino acid residues 149-161 or 162-175 of hANP32C were exchanged with the corresponding amino acid residues of hANP32A (149-161C and 162-175C, respectively) in ANP32A-deficient (A_KO) chicken DF-1 cells and infection of the cells with PR8-H5N8 (PB2-627E) influenza virus (MOI 0.1) for 24 hours. (3C) shows viral titers measured after overexpression of single amino acid-modified hANP32A containing D149Y, R150W, D152H, D157Y, and A160I in ANP32A-deficient (A_KO) chicken DF-1 cells and infection of the cells with PR8-H5N8 PB2-627E influenza virus (MOI 0.1) for 24 hours (upper image), and viral titers measured after overexpression of hANP32B or D149Y and D152H-modified hANP32B (hANP32BY149H152) in A_KO DF-1 cells and infection of the cells with PR8-H5N8 PB2-627E virus for 24 hours (lower image). (3D) shows results of pairwise sequence alignment of amino acid residues 149 to 161 of hANP32A and hANP32B. Data are expressed as mean±standard deviation (n=3). *P<0.05, **P<0.01, ***P<0.001, and ****P<0.0001. ns=non-significant.

[0057] FIGS. 4A, 4B and 4C shows results of analysis of functional roles of D149 and D152 of ANP32A in relation to interactions with influenza virus PB2 proteins. (4A) is a schematic view of a polar mapping of D149Y and D152H substitution in human ANP32A (hANP32A). (4B) shows virus titer measurements after overexpression of single amino acid-modified hANP32A containing D149Y, D149A, D149E, D149N, D152H, D152A, D152E, or D152N in ANP32A-deficient (A_KO) chicken DF-1 cells and infection of the cells with PR8-H5N8 PB2-627E influenza virus (MOI 0.1) for 24 hours. Data are expressed as mean±standard deviation (n=3). *P<0.05, **P<0.01, ***P<0.001, and ****P<0.0001. ns=non-significant. (4C) shows results of co-immunoprecipitation analysis using a FLAG antibody on A_KO cells co-transfected with FLAG-tagged hANP32A wild-type (WT) or hANP32A_D149Y/D152H and a viral polymerase (PA, PB1 and PB2-627E or 627K) for 24 hours. Each cell lysate and FLAG-immunoprecipitated proteins (FLAG-IP) were analyzed by western blotting using the indicated antibody.

[0058] FIGS. 5A, 5B and 5C shows results of genome editing by CRISPR/Cas9 of exon 4 of chicken ANP32A. (5A) shows the chicken ANP32A (cANP32A) gene structure and target genetic locus (exon 4) of A#4 guide RNA (gRNA). (5B) shows results of T7E1 analysis of DF-1 cells transfected with A#4 CRISPR/Cas9 vector. Wild-type DF-1 cells were used as a control. (5C) shows results of mutational analysis of transfected DF-1 cells by Sanger sequencing. In-del mutation frequency is indicated in parentheses. Characters with strikethrough (thickest boldface) indicate deleted nucleotides, and characters without strikethrough (thickest boldface) indicate inserted nucleotides. Characters in bold indicate gRNA binding sites, and ‘TGG’ indicates a protospacer adjacent motif (PAM) sequence.

[0059] FIG. 6 shows results of HDR-mediated precise residue substitution of chicken ANP32A gene in DF-1 cells. The sequencing results of exons 4 and 5 of chicken ANP32A (cANP32A) obtained from transfected DF-1 cells are shown by using chromatography. cANP32A represents a wild-type sequence, and HDR donor represents an HDR donor plasmid sequence. In parentheses, non-homologous end joining (NHEJ) involving in-del or homology-directed repair (HDR) is indicated.

[0060] FIGS. 7A, 7B and 7C show results of confirming acquisition of AIV resistance through precise correction of chicken ANP32A gene in DF-1 cells. (7A) is a schematic view of an HDR-mediated precise correction process of exons 4 and 5 of chicken ANP32A. The donor plasmid includes D149Y, D152H, D182Y, and D185H-modified cANP32A having homology arms (HAs) on both sides. (7B) is a protein sequence of a cANP32A-modified DF-1 clone through cDNA sequencing from exon 4 to exon 5 of cANP32A. (7C) shows virus titers measured after infecting a premature stop codon (A.sub.YHYH101), a wild-type (A.sub.YHYH103), and HDR (A.sub.YHYH106) DF-1 clones with PR8-H5N8 PB2-627E or PB2-627K influenza virus (MOI 0.1). Data are expressed as mean±standard deviation (n=3). *P<0.05, **P<0.01, ***P<0.001, and ****P<0.0001. ns=non-significant.

DETAILED DESCRIPTION

[0061] Hereinafter, the present disclosure will be described in more detail with reference to Examples. However, these Examples are for illustrative purposes only, and the present disclosure is not intended to be limited by these Examples.

Experiment Method

Sequence analysis of ANP32 family gene

[0062] To find key genes involved in proliferation of avian influenza viruses, human and chicken ANP32 family genes (ANP32A, ANP32B, ANP32C, ANP32D, and ANP32E) were analyzed. In particular, sequence information of cANP32A (XP_413932), cANP32B (NP_001026105), cANP32E (NP_001006564), hANP32A (NP_006296), hANP32B (NP_006392), hANP32C (NP_036535), hANP11232D (NP_036536), and hANP32D (NP_036536) provided from NCBI database was obtained. Then, pairwise sequence alignment and multiple sequence alignment analysis were performed. The protein sequences were aligned by using Geneious R6 software (Biomatters Ltd., Auckland, New Zealand) using Blosum62 scoring matrix, and 12 gap open penalty and 3 gap extension penalty were used.

Production of Recombinant Avian Influenza Viruses

[0063] Recombinant avian influenza viruses PR8-H5N8 PB2-627E and -627K were produced using reverse genetics approach from 8 bidirectional PHW2000 plasm ids in the same method as in the previous study (Park et al., J Infect Dis, 2019). Briefly, 8 bidirectional plasmids were co-transfected with co-cultured Madin-Darby canine kidney cells (MDCK; ATCC, CCL-34) and human 293T embryonic kidney cells (HEK293T; ATCC, CRL-11268) to obtain virus. The obtained virus was grown in MDCK infection medium consisting of DMEM supplemented with 0.3% bovine serum albumin (BSA), 1x ABAM, and 1 μg/mL TPCK-treated trypsin (Sigma-Aldrich, MO, USA), and then the obtained virus was cultured for 48 hours at 37° C. The virus stock was further propagated in 10-day-old incubated eggs, and an aliquot of the infectious virus was stored at −80° C. for further experiments.

Virus Titration

[0064] TCID.sub.50 was determined by performing virus titration of infected cells in MDCK cells. Briefly, a confluent layer of MDCK cells cultured in serum-free DMEM supplemented with 0.3% BSA, 1% penicillin/streptomycin, and 1 μg/mL TPCK-trypsin in 96-well plates, i.e., a supernatant of the infected cells was used for infection. Serial dilutions of the supernatant were added in triplicate to 5 wells of a 96-well plate. After 72 hours to 96 hours, the cell denaturation effect was observed and quantified through crystal violet (Sigma-Aldrich) staining. The TCID.sub.50per mL was calculated using Spearman-Karber formula (Gilles, Eur J Toxicol Environ Hyg, 1974).

RT-qPCR

[0065] Total RNA was extracted using RNeasy mini kit (Qiagen), and reverse transcription was performed using Superscript IV First-strand Synthesis System (Thermo Fisher Scientific). RT-qPCR based on EvaGreen qPCR dye (Biotium, CA, USA) was performed three times using the StepOnePlus real-time PCR system (Thermo Fisher Scientific). The target gene-specific forward and reverse primers are shown in Table 1. Relative quantification of target gene expression was calculated using the 2-AAct formula (here, .sup.ΔΔCt=(Ct of target gene - Ct of ACTB) group - (Ct of target gene - Ct of ACTB) control.

Co-Immunoprecipitation

[0066] Total protein was prepared from cell lysates of transfected cells using immunoprecipitation lysis buffer (Thermo Fisher Scientific). For immunoprecipitation, target antibody-conjugated magnetic beads were prepared using Dynabeads Protein G kit (Thermo Fisher Scientific) according to the manufacturer's instructions. Briefly, non-specific binding proteins were removed in advance by incubating with unbound magnetic beads with gentle rotation at 4° C. for 30 minutes. Then, the previously removed cell lysate was cultured with target antibody-conjugated magnetic beads at 4° C. overnight while gently rotating. Magnetic beads were collected using a magnetic field, and then washed 4 times for unbound protein with a wash buffer. The immunoprecipitated protein was eluted for 5 minutes using an elution buffer and denatured at 95° C. for 5 minutes using 2×Laemmli sample buffer (BioRad). Magnetic beads were collected using a magnetic field, and then the supernatant was used for subsequent experiments.

Western Blotting

[0067] The total protein or immunoprecipitated protein was separated by 10% SDS-PAGE. The separated protein was transferred to a PVDF membrane and blocked for 1 hour. The membrane was incubated with an appropriate primary antibody and then incubated with an appropriate HRP-conjugated secondary antibody (Thermo Fisher Scientific). The antibodies used in the experiment are as follows: anti-ACTB (sc-47778, Santa Cruz, TX, USA), anti-ANP32A (sc-100767, Santa Cruz), anti-FLAG (F1804, Sigma-Aldrich), anti-PA (GTX125932, GeneTex, CA, USA), anti-PB1 (GTX125923, GeneTex), anti-PB2 (GTX125926, GeneTex), and anti-NP (GTX125989, GeneTex). Immunoreactive proteins were visualized using ECL select Western blotting detection reagent (GE Healthcare Bio-Sciences, NJ, USA), and signals were detected using BioRad ChemiDoc XRS imaging system (BioRad, CA, USA).

Statistical Analysis

[0068] For statistical analysis, GraphPad Prism (GraphPad Software, CA, USA) was used. Significance between groups was determined through one-way ANOVA analysis using Bonferni's multiple comparisons. P<0.05 indicates statistical significance.

Experimental Results

Example 1. Sequence Analysis of ANP32 Family Gene

[0069] As compared with human ANP32A (hANP32A), chicken ANP32A (cANP32A) contains additional amino acid residues 176 to 208, which are duplicated from amino acid residues 149 to 175 (27 residues). However, the functional role of the 27 amino acid residues of hANP32A has not yet been studied. Therefore, based on the comparison between hANP32A family members, it was attempted to find key amino acid residues contributing to viral polymerase activity through modification of 27 residues. As a result of investigating the sequence identity of the amino acid residues 149-175 of hANP32 family members through pairwise sequence alignment, it was found that the percent of identity of hANP32A with hANP32B, hANP32C, hANP32D, and hANP32E was approximately 68.3%, 86.1%, 89.3% and 56.6%, respectively. Next, as a result of investigating the sequence identity of N-terminal leucine rich repeat (LRR) and C-terminal low complexity acidic region (LCAR) domain through pairwise sequence alignment, it was found that the percent of identity of LRR and LCAR domains of hANP32A with LRR and LCAR domains of hANP32B, hANP32C, hANP32D, and hANP32E was 81.1%, 87.2%, 89.3%, and 71.6%, respectively. In the LCAR domain, the percent of identity of hANP32A with hANP32B, hANP32C, and hANP32E was about 4.7%, 84.4%, and 43.7%, respectively (hANP32D was excepted because the LCAR domain is not present in hANP32D).

Example 2. Construction of Recombinant Vector Targeting cANP32A Through CRISPR/Cas9 System

[0070] A CRISPR/Cas9 vector targeting the cANP32A gene was produced using a pX459 vector in the same method as in the previous study (Lee et al., Dev Comp Immunol, 2017). The sequences of all oligonucleotides used for PCR analysis and CRISPR/Cas9 vector production are shown in Table 1.

TABLE-US-00002 TABLE 1 Sequence ID Sequence (5′-3′) Use ID No. ANP32A ex1-F CACCGGCGACGATGGACGGGACGAG Sequencing  5 ANP32A ex1-R AAACCTCGTCCCGTCCATCGTCGCC Sequencing  6 ANP32A ex4/5-F CTGTCTGTCCTGTAGAGGTTTA Sequencing  7 ANP32A ex4/5-R GTCTTCCTCCTTCCAGTCTCT Sequencing  8 ACTB qRT-F AGGAGATCACAGCCCTGGCA RT-qPCR  9 ACTB qRT-R CAATGGAGG GTCCGG ATTCA RT-qPCR 10 viral M qRT-F AACCGAGGTCGAAACGTACG RT-qPCR 11 viral M qRT-R CGGTGAGCGTGA ACACAAAT RT-qPCR 12 A#1 gRNA AAAGGATCCACTTAGAGCTG gRNA 13 sequence A#4 gRNA CCACAACTCACATACCTCGA gRNA 14 sequence

[0071] Briefly, the annealed oligonucleotide for each gRNA was ligated to the pX459 vector through the Golden Gate assembly method, and the prepared CRISPR/Cas9 vector was analyzed through Sanger sequencing. For homology directed repair (HDR)-mediated precise gene editing of cANP32A, double-cut donor-mediated HDR was performed using a donor plasmid (Bionics, Seoul, Korea) in the same method as in the previous study (Park et al., J Infect Dis, 2019). The HDR donor plasm id for amino acid residue substitution of D149Y, D152H, D182Y, and D185H is a target genetic locus with two gRNA-PAM sequences on flanking, and 400 bp of homology arms on the right and left are included. The gRNA sequence targeting cANP32A exon 4 (A#4) between the homology arms of the donor plasmid on right and left was modified to prevent further cleavage after HDR.

Example 3. Transfection of Fibroblast Cells Using Recombinant Vector

[0072] The CRISPR/Cas9 recombinant vector produced in Example 2 was mixed with Lipofectamine 2000 reagent (Thermo Fisher-Invitrogen) in Opti-MEM (Thermo Fisher-Invitrogen), and the mixture was introduced and transfected to chicken fibroblast cell line DF-1 (CRL-12203; ATCC, VA, USA). DF-1 used at this time was maintained in DMEM (Hyclone, Logan, Utah, USA) medium to which 10% fetal bovine serum (FBS; Hyclone) and 1x antibiotic-antimycotic (ABAM; Thermo Fisher-Invitrogen, Carlsbad, Calif., USA) were added. After transfection, puromycin (Thermo Fisher Scientific) was added to the culture medium for 4 days to select transfected cells. The puromycin-selected single DF-1 cells were inoculated into individual wells of a 96-well plate. After clonal expansion of each single DF-1 cell, genomic DNA was extracted from the clone and used for sequence analysis.

Example 4. T7E1 Analysis and Genome DNA Sequence Analysis

[0073] To evaluate the target efficiency of CRISPR/Cas9 in the transfected DF-1 cells produced in Example 3, T7 endonuclease 1 (T7E1) analysis was performed. The primer sets used for amplification of the genomic region including the CRISPR/Cas9 target site are shown in Table 1. To form heteroduplex DNA, amplicons were reannealed after denaturation, and the reannealed heteroduplex amplicons were digested with T7E1 (New England Biolabs) enzyme at 37° C. for 20 minutes. The product digested with T7E1 was analyzed by 1 agarose gel electrophoresis. For sequence analysis, the PCR product containing the target site was cloned into pGEM-T Easy vector (Promega, WI, USA), followed by sequencing using an ABI Prism 3730 XL DNA analyzer (Thermo Fisher-Applied Biosystems, CA, USA). For sequence analysis, BLAST (http://blast.ncbi.nlm.nih.gov) and Geneious R6 software (Biomatters Ltd.) were used.

[0074] Specifically, the CRISPR/Cas9 vector targeting exon 1 of cANP32A (A#1 vector) was prepared to investigate whether hANP32 family members may be involved in replication of avian influenza in cANP32A-knockout DF-1 cells (A_KO) (FIG. 1A). The A#1 vector was transfected into DF-1 cells, genomic DNA was isolated from the transfected cells, and T7E1 analysis was performed. As a result, it was confirmed that the DF-1 cells transfected with the A#1 vector had an in-del (indel) mutation in exon 1 of cANP32A (FIG. 1B). In addition, as a result of genomic DNA sequencing, it was confirmed that the mutation rate was 81.8% (9/11) (FIG. 1C). After culturing individual DF-1 clones, the A_KO112 DF-1 clone in which 2nt was deleted from exon 1 of cANP32A was used as a representative A_KO cell in subsequent experiments.

Example 5. Functional Effects of ANP32 Family and Effects of ANP32 Mutations on vPol Activity

[0075] In order to identify whether mutations induced at residues 149 to 175 in an ANP32 protein may affect viral polymerase (vPol) activity of avian influenza, an overexpression vector carrying the cANP32A or codon-optimized hANP32A, hANP32C, or hANP32E sequence expressed by a cytomegalovirus (CMV) promoter was constructed in the same method as in the previous study (Park et al., J Infect Dis, 2019). Modification or gene swapping experiments of residues 149 to 175 of ANP32 protein were performed using a Q5 site-directed mutagenesis kit (New England Biolabs, MA, USA). All plasmid constructs were verified by DNA sequencing. For transient expression of the modified ANP32 protein, the constructed vector was transfected into DF-1 cells using Lipofectamine 2000 reagent (Thermo Fisher-Invitrogen). After 48 hours of transfection, expression of hANP32 protein in A_KO cells was verified by Western blot (FIG. 2A). Then, the transfected cells were infected with recombinant avian influenza viruses PR8-H5N8 PB2-627E and -627K for 24 hours to analyze virus replication and proliferation.

[0076] As a result, it was confirmed that hANP32C, hANP32D, or hANP32E overexpression did not contribute to virus replication, whereas hANP32A and hANP32B expression enabled virus replication in A_KO cells regardless of PB2-627 residue (FIG. 2B). The results show that hANP32C shares a higher sequence identity with hANP32A, as compared with ANP32B, however, unlike hANP32A and hANP32B, hANP32C does not efficiently participate in virus replication of AIV.

[0077] Next, to analyze functional significance of 27 residues for vPol activity, residues 149 to 175 of human and chicken ANP32 proteins were aligned. As a result, it was confirmed that the sequence identity of the 27 residues varied from 48.1% to 100% in the ANP32 family members of human and chicken. Specifically, the sequence identities between cANP32A and hANP32A, cANP32B, hANP32B, hANP32C, cANP32E, and hANP32E were 100%, 51.9%, 70.4%, 66.7%, 48.1%, and 48.1%, respectively (FIG. 2C).

[0078] In this regard, an analysis was performed to identify whether different residues between hANP32A and hANP32C have a differential role in vPol activity and virus replication. First, a vector from which residues 149 to 175 of hANP32A were removed (hANP32A27del), a vector from which residues 149 to 175 of hANP32A were replaced with residues 149 to 175 of hANP32C (hANP32A27C), a vector from which residues 149 to 175 of hANP32C were replaced with residues 149 to 175 of hANP32A (hANP32C27A), or a vector from which residues 149 to 175 of hANP32E were replaced with residues 149 to 175 of hANP32A (hANP32E27A) was constructed. After transfecting the constructed vectors into A_KO cells, the cells were infected with H5N8-627E, and the expression level of the virus gene was analyzed using RT-qPCR. As a result, it was confirmed that overexpression of hANP32A27del, hANP32A27C, hANP32C, hANP32E, or hANP32E27A did not contribute to virus gene transcription, whereas overexpression of control hANP32A or hANP32C27A could contribute to virus gene transcription in A_KO cells. In particular, for hANP32C, it was shown that the vector (hANP32C27A) in which 27 residues of hANP32A were replaced may contribute to vPol activity, but hANP32E27A did not contribute to vPol activity. It was found that the remaining domains LRR and LCAR are also essential to vPol activity, in addition to the 27 residues (FIG. 2D).

Example 6. Identification of Key Amino Acids of ANP32A Involved in vPol Activity

[0079] In order to identify key amino acid residues among the 27 residues involved in vPol activity and virus proliferation, the ANP32A sequence was mutated. First, hANP32A residues 149 to 161 and 162 to 175 residues were replaced with 149 to 161C and 162 to 175C regions of hANP32C, respectively, to produce h32A (FIG. 3A). As a result, as compared with the expression of hANP32A in A_KO cells, it was confirmed that the expression of 149 to 161C in hANP32A showed a significant decrease in the virus titer of AIV, whereas the expression of 162 to 175C did not show a significant difference (FIG. 3B).

[0080] Next, through pairwise sequence comparison between hANP32C and hANP32A including D149Y, R150A, D152H, D156Y, and A161I substitutions, it was investigated whether single residue substitution may inhibit AIV replication. As a result, it was confirmed that substitution of D149Y and D152H in hANP32A significantly reduced the transcription level of the virus gene. From the results, Asp149 (D149) and Asp152 (D152) were found to be key amino acid residues involved in vPol activity and virus proliferation. Additionally, as a result of overexpressing hANP32B-modified protein in A_KO cells and analyzing the virus titer, it was confirmed that D149Y and D152H substitution (hANP32BD149Y/D152H) in hANP32B significantly reduced the virus titer of AIV, as compared with overexpression of wild-type hANP32B (FIG. 3C).

[0081] To confirm whether the functional roles of D149 and D152 are conserved in both hANP32A and hANP32B, pairwise sequence alignment of residues 149 to 161 was performed. As a result, it was confirmed that D149 and D152 were conserved in both hANP32A and hANP32B (FIG. 3D).

Example 7. Effect of Protein Interaction on vPol Activity

[0082] In consideration of a significant polarity difference at amino acid residues 149 and 152 between hANP32A and hANP32C, polarity mapping by the Geneious Program was used to focus on the polarity and charge of the residue to determine which molecular interactions were involved in the residue. (FIG. 4A). Then, residues 149 and 152 were substituted with representative non-polar alanine (A), polar acid glutamate (E), and polar non-charged asparagine (N), respectively. As a result of overexpressing the hANP32 mutant protein in A_KO cells, it was confirmed that D149Y, D149A and D149E significantly reduced the virus titer, whereas D149N showed no significant difference, as compared with wild-type hANP32A. In addition, while D152H, D152A, and D152N significantly reduced the virus titer, it was confirmed that D152E did not show a significant difference, as compared with wild-type hANP32A (FIG. 4B). From the results, it was found that residues D149 and D152 were involved in vPol activity through hydrogen bonding and electrostatic interaction, respectively.

[0083] In order to confirm whether the mutation of the identified residue affects the protein interaction between ANP32A and vPol protein, additional immunoprecipitation analysis was performed. Specifically, the interaction between wild-type or mutant hANP32A and vPol protein in A_KO DF-1 clone was analyzed. As a result, viral PA and PB2 proteins were co-immunoprecipitated with wild-type hANP32A (hANP32Awt). On the other hand, it was confirmed that the hANP32AD149Y/D152H mutant exhibited reduced interaction with virus protein after anti-FLAG co-immunoprecipitation regardless of residue PB2-627 (FIG. 4C). Through the results, it was confirmed that mutations at residues D149 and D152 of hANP32A were involved in the interaction between ANP32A and vPol protein.

Example 8. Precise Gene Editing for Chicken ANP32A

[0084] By using the CRISPR/Cas9 system, it was confirmed that precise substitution of amino acid residues for chicken ANP32A via homologous recombination significantly reduced virus replication in chicken cells. First, to target exon 4 of the cANP32A gene, DF-1 cells were transfected with CRISPR/Cas9 vector containing A#4 gRNA sequence, and it was confirmed that target efficiency was performed by T7E1 analysis and genomic DNA sequencing of transfected DF-1 cells. (FIGs. 5A, 5B, and 5C).

[0085] Because cANP32A has additionally cloned D182 and D185 residues, D149Y, D152H, D182Y, and D185H (A.sub.YHYH ) modifications were induced for the cANP32A gene using a double cut-mediated HDR system in the method as in the previous study (Zhang et al., Genome Biol, 2017; Park et al., J Infect Dis, 2019) (FIG. 7A). As a result of co-transfecting A#4 CRISPR/Cas9 vector and donor plasmid into DF-1 cells, it was confirmed that the HDR efficiency was about 11% (1/9) (FIG. 6).

[0086] Next, a DF-1 clone was established through single cell clone expansion of the transfected cell, and as a result of performing cDNA sequencing on the established clone, a clone (A.sub.YHYH 106) in which the target sequence was precisely substituted was confirmed (FIG. 7B). In addition, it was confirmed that A.sub.YHYH 101, A.sub.YHYH 102, A.sub.YHYH 104, A.sub.YHYH 105, and A.sub.YHYH 107 had a premature stop codon at exon 4.

[0087] In order to evaluate the exact modification effect of cANP32A residue in DF-1, established cell clones including A.sub.YHYH 101 (premature stop codon), A.sub.YHYH 103 (wild-type), and A.sub.YHYH 106 (HDR) were used with MOI 0.1 PR8-H5N8 LPAI (PB2-627E or PB2-627K). As a result, it was confirmed that the virus titer in both A.sub.YHYH 101 and A.sub.YHYH 106 clones was significantly lower than in A.sub.YHYH103 clone regardless of residue PB2-627 (FIG. 7C). From the results, it was confirmed that correct substitution with D149Y, D152H, D182Y, and D185H in cANP32A gene may significantly reduce AIV proliferation in chicken host cells.

[0088] Through the results, it was confirmed that the method according to one aspect may acquire resistance to avian influenza viruses (AIV) by inducing mutations in an ANP32A, which is involved in virus replication in host cells. In particular, by modifying only the key amino acid residue of ANP32A, it was confirmed that resistance to AIV may be acquired by precisely limiting only the interaction in the relationship with the AIV protein while maintaining the original function of the ANP32A gene. Therefore, the method according to one aspect may be widely applied to disease-resistant cell lines, disease-resistant poultry, and animal production.

[0089] As described above, specific parts of the present invention have been described in detail, and it will be apparent to of ordinary skill in the art that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereto. Accordingly, it will be said that the substantial scope of the present invention is defined by the appended claims and their equivalents.