HUMAN FIBROLAMELLAR HEPATOCELLULAR CARCINOMAS (hFL-HCCS)
20240254451 ยท 2024-08-01
Assignee
Inventors
- Eliane Wauthier (Chapel Hill, NC, US)
- Tsunekazu Oikawa (Chapel Hill, NC, US)
- Timothy Anh-Hieu DINH (Chapel Hill, NC, US)
- Praveen Sethupathy (Chapel Hill, NC, US)
- Lola M. Reid (Chapel Hill, NC)
Cpc classification
A01K2207/12
HUMAN NECESSITIES
A01K67/0271
HUMAN NECESSITIES
C12Y305/01098
CHEMISTRY; METALLURGY
International classification
G01N33/50
PHYSICS
A01K67/0271
HUMAN NECESSITIES
Abstract
The present disclosure provides a model of human fibrolamellar hepatocellular carcinoma (FL-HCC) cells maintained as a transplantable tumor line in a host and a method to establish a transplantable human FL-HCC tumor line. Methods of ex vivo cultures of the FL-HCC are provided. Methods of diagnosing and treating FL-HCC tumors are also provided.
Claims
1-19. (canceled)
20. A method of treating a patient determined to have human fibrolamellar hepatocellular carcinoma (hFL-HCC) by administering to the patient an effective amount of at least one therapeutic that decreases expression of at least one of C10orf128, CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3, PCSK1, PHACTR2, RPS6KA2, SLC16A14, TMEM163, or TNRC6C.
21. The method of claim 20, wherein the at least one therapeutic is selected from the group consisting of a small molecule, RNA interference, a locked nucleic acid (LNA), an immunotherapy, a hedgehog signaling inhibitor, a histone deacetylase inhibitor, a protein kinase inhibitor, and a regulator of substrate targets of PRKACA.
22-23. (canceled)
24. The method of claim 20, wherein the therapeutic decreases expression of at least one of PCSK1, CA12, NOVA1, SLC16A14, TNRC6C, TMEM163, and RPS6KA2.
25. The method of claim 20, wherein the therapeutic decreases expression of at least one of C10orf128, OAT, PAK3, PCSK1, PHACTR2, SLC16A14, TMEM163, and TNRC6C.
26. The method of claim 20, comprising selecting the therapeutic by introducing a candidate drug to a hFL-HCC cell line, and measuring expression of at least one of C10orf128, CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3, PCSK1, PHACTR2, RPS6KA2, SLC16A14, TMEM163, or TNRC6C upon treatment with the candidate drug to select the therapeutic.
27. The method of claim 26, wherein the selected candidate drug reduced expression of at least two of C10orf128, CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3, PCSK1, PHACTR2, RPS6KA2, SLC16A14, TMEM163, or TNRC6C in the hFL-HCC cell line.
28. The method of claim 26, wherein the selected candidate drug regulates substrate targets of the kinase PRKACA (Protein kinase A catalytic subunit alpha) or carbonic anhydrases.
29. The method of claim 26, wherein the hFL-HCC cell line is maintained in a non-human animal.
30. The method of claim 26, wherein the hFL-HCC cell line is cultured on tissue culture plastic or on or in hyaluronans.
31. The method of claim 30, wherein the hFL-HCC cell line is cultured in serum-free medium.
32. The method of claim 26, wherein the hFL-HCC cell line is cultured in the form of organoids or spheroids.
33. The method of claim 32, wherein the hFL-HCC cell line is cultured in the form of organoids comprising mesenchymal cells.
34. The method of claim 26, wherein the hFL-HCC cell line is derived from a tumor removed from the liver, from the biliary tree, from a subcutaneous tumor or from an intraperitoneal tumor of a patient suffering from hFL-HCC.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0059] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of necessary fee.
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
DETAILED DESCRIPTION
[0088] Fibrolamellar carcinomas (FLCs), also referred to as fibrolamellar hepatocellular carcinomas (FL-HCC), occur primarily in children and young adults without evidence of any chronic disease. FLCs were recognized only recently, within the last approximately 45 years, but now account for approximately 1-5% of liver cancers worldwide. The epidemiological factors remain unknown. To date, FLCs are treatable only by surgery, which however is unproductive if there is metastatic disease at the time of diagnosis. Other forms of therapy, such as chemo- and external radiation therapies, or specific drugs commonly used for hepatocellular carcinomas (HCCs), have proven ineffective for FLCs. The average time to death post-diagnosis for FLC patients is only about 18 months. This disclosure is related to tools for studying the disease (e.g., a transplantable tumor line), including drug screening and testing, as well as methods of suppressing the growth of fibrolamellar hepatocellular carcinomas (FL-HCC).
[0089] Embodiments according to the present disclosure will be described more fully hereinafter. Aspects of the disclosure may, however, be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art. The terminology used in the description herein is for the purpose of describing particular embodiments only and is not intended to be limiting.
[0090] Unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the present application and relevant art and should not be interpreted in an idealized or overly formal sense unless expressly so defined herein. While not explicitly defined by below, such terms should be interpreted according to their common meaning.
[0091] The terminology used in the description herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety.
[0092] The practice of the present technology will employ, unless otherwise indicated, conventional techniques of tissue culture, immunology, molecular biology, microbiology, cell biology, and recombinant DNA, which are within the skill of the art. See, e.g., Sambrook and Russell eds. (2001) Molecular Cloning: A Laboratory Manual, 3rd edition; the series Ausubel et al. eds. (2007) Current Protocols in Molecular Biology; the series Methods in Enzymology (Academic Press, Inc., N.Y.); MacPherson et al. (1991) PCR 1: A Practical Approach (IRL Press at Oxford University Press); MacPherson et al. (1995) PCR 2: A Practical Approach; Harlow and Lane eds. (1999) Antibodies, A Laboratory Manual; Freshney (2005) Culture of Animal Cells: A Manual of Basic Technique, 5th edition; Gait ed. (1984) Oligonucleotide Synthesis; U.S. Pat. No. 4,683,195; Hames and Higgins eds. (1984) Nucleic Acid Hybridization; Anderson (1999) Nucleic Acid Hybridization; Hames and Higgins eds. (1984) Transcription and Translation; Immobilized Cells and Enzymes (IRL Press (1986)); Perbal (1984) A Practical Guide to Molecular Cloning; Miller and Calos eds. (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory); Makrides ed. (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker eds. (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London); and Herzenberg et al. eds (1996) Weir's Handbook of Experimental Immunology.
[0093] Unless the context indicates otherwise, it is specifically intended that the various features of the invention described herein can be used in any combination. Moreover, the disclosure also contemplates that in some embodiments, any feature or combination of features set forth herein can be excluded or omitted. To illustrate, if the specification states that a complex comprises components A, B and C, it is specifically intended that any of A, B or C, or a combination thereof, can be omitted and disclaimed singularly or in any combination.
[0094] All numerical designations, e.g., pH, temperature, time, concentration, and molecular weight, including ranges, are approximations which are varied (+) or (?) by increments of 1.0 or 0.1, as appropriate, or alternatively by a variation of +/?15%, or alternatively 10%, or alternatively 5%, or alternatively 2%. It is to be understood, although not always explicitly stated, that all numerical designations are preceded by the term about. It is to be understood that such range format is used for convenience and brevity and should be understood flexibly to include numerical values explicitly specified as limits of a range, but also to include all individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly specified. For example, a ratio in the range of about 1 to about 200 should be understood to include the explicitly recited limits of about 1 and about 200, but also to include individual ratios such as about 2, about 3, and about 4, and sub-ranges such as about 10 to about 50, about 20 to about 100, and so forth. It also is to be understood, although not always explicitly stated, that the reagents described herein are merely exemplary and that equivalents of such are known in the art.
Definitions
[0095] As used herein, the singular terms a, an, and the include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to a cell can include multiple cells unless the context clearly dictates otherwise.
[0096] The term about, as used herein when referring to a measurable value such as an amount or concentration (e.g., the percentage of collagen in the total proteins in the biomatrix scaffold) and the like, is meant to encompass variations of 20%, 10%, 5%, 1%, 0.5%, or even 0.1% of the specified amount.
[0097] The terms or acceptable, effective, or sufficient when used to describe the selection of any components, ranges, dose forms, etc. disclosed herein intend that said component, range, dose form, etc. is suitable for the disclosed purpose.
[0098] Also as used herein, and/or refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (or).
[0099] As used herein, the term aggregates refer to a plurality of cells that are amassed together. The aggregates may vary in both size and shape or may be substantially uniform in size and/or shape. The cell aggregates used herein can be of various shapes, such as, for example, a sphere, a cylinder (preferably with equal height and diameter), or rod-like among others. Although other shaped aggregates may be used, in one embodiment of the disclosure, it is generally preferable that the cell aggregates be spherical or cylindrical. If the aggregates are comprised of only one cell type, they are referred to as spheroids; if they are a mixture of multiple cell types (e.g. epithelia and mesenchymal cells), they are referred to as organoids. In addition, the term spheroid indicates a floating aggregate of cells all being the same cell type (e.g. an aggregate from a cell line); an organoid is a floating aggregate of cells comprised of multiple cell types, an epithelial cell and its mesenchymal partner cells, typically an endothelial cell and a stromal cell. The cells can be stem/progenitors of these categories of cells or can be mature cells.
[0100] As used herein, the term cell refers to a eukaryotic cell. In some embodiments, this cell is of animal origin and can be a stem cell or a somatic cell. The term population of cells refers to a group of one or more cells of the same or different cell type with the same or different origin. In some embodiments, this population of cells may be derived from a cell line; in some embodiments, this population of cells may be derived from a sample of organ or tissue.
[0101] The term biliary tree stem cells refers to stem cells found throughout the biliary tree with the ability to transition into committed hepatic and/or pancreatic progenitor cells. They are found in both the extramural glandstethered to the surface of the bile ductsand the intramural glandswithin the bile duct walls. The generic biomarkers for the biliary tree stem cells (hBTSCs) include pluripotency genes (e.g. OCT4, SOX2, NANOG, SALL4, KLF4, KLF5); one or another of the isoforms (standard or variant) of CD44, the hyaluronan receptors; CXCR4; cytokeratins 8 and 18. There are 3 stages identified so far: stage 1 hBTSCs: expresses sodium iodide symporter, CXCR4 but not LGR5 or EpCAM; stage 2 hBTSCs express less of NIS but gain expression of LGR5 but not EpCAM; stage 3 hBTSCs (found in the gallbladder, in the large intrahepatic bile ducts and hepato-pancreatic common duct) expresses LGR5 and EpCAM and is a precursor to the hepatic stem cells (in the liver) and to the pancreatic stem cells (in the hepato-pancreatic common duct.
[0102] As used herein the term cancer stem cells refers to the cells found within solid tumors or hematological cancers that possess characteristics associated with normal stem cells, specifically the ability to self-replicate and to be multipotent, that is give rise to multiple cell types.
[0103] The term hepatic stem cells refers to stem cells found in the canals of Hering, intrahepatic bile ductules, connecting the ends of the biliary tree to the liver and retaining the ability to self-replicate and be multipotent. The biomarkers for these cells include epithelial cell adhesion molecule (EpCAM) found in the cytoplasm and at the plasma membrane, neural cell adhesion molecule (NCAM), very low levels (if any) of albumin, an absence of alpha-fetoprotein (AFP), an absence of P450 A7, an absence of secretin receptor (SR). Hepatic stem cells and hepatoblasts express cytokeratins 8 and 18 and 19.
[0104] The term hepatoblasts refers to bipotent hepatic cells that can give rise to hepatocytic and cholangiocytic lineages, that have an extraordinary ability to proliferate (that is expand) but with less ability to self-replicate than is observed in hepatic stem cells. These cells are characterized by a biomarker profile that overlaps with but is distinct from hepatic stem cells, expressing EpCAM primarily at the plasma membrane, intercellular adhesion molecule (ICAM-1) but not NCAM, P450A7, cytokeratin 7, secretin receptor, albumin, high levels of AFP, and minimal (if any) pluripotency genes.
[0105] As used herein the term committed progenitor refers to a unipotent progenitor cell that gives rise to a single cell type, e.g. a committed hepatocytic progenitor cell (usually recognized by expression of albumin, AFP, glycogen, ICAM-1, various enzymes involved with glycogen synthesis) gives rise to hepatocytes and a committed biliary (or cholangiocytic) progenitor (recognized by expression of EpCAM, cytokeratins 7 and 19, aquaporins, CFTR, and membrane pumps associated with management of bile) gives rise to cholangiocytes.
[0106] As used herein, the term comprising is intended to mean that the compositions and methods include the recited elements, but do not exclude others. As used herein, the transitional phrase consisting essentially of (and grammatical variants) is to be interpreted as encompassing the recited materials or steps and those that do not materially affect the basic and novel characteristic(s) of the recited embodiment. See, In re Herz, 537 F.2d 549, 551-52, 190 U.S.P.Q. 461, 463 (CCPA 1976) (emphasis in the original); see also MPEP ? 2111.03. Thus, the term consisting essentially of as used herein should not be interpreted as equivalent to comprising. Consisting of shall mean excluding more than trace elements of other ingredients and substantial method steps for administering the compositions disclosed herein. Aspects defined by each of these transition terms are within the scope of the present disclosure.
[0107] The term culture or cell culture means the maintenance of cells in an artificial, in vitro environment. A cell culture system is used herein to refer to culture conditions in which a population of cells may be grown as monolayers or in suspension (spheroids, organoids).
[0108] Culture medium is used herein to refer to a nutrient solution for the culturing, growth, or proliferation of cells. Culture medium may be characterized by functional properties such as, but not limited to, the ability to maintain cells in a particular state (e.g. a pluripotent state, a quiescent state, etc.), to mature cellsin some instances, specifically, to promote the differentiation of progenitor cells into cells of a particular lineage. Non-limiting examples of culture media are Kubota's medium, a medium designed for endodermal stem/progenitors, a hormonally defined medium (HDM) designed to drive the stem/progenitors either to hepatocytes (HDM-H), to cholangiocytes (HDM-C), or to pancreatic islets (HDM-P), which are further defined herein below. In some embodiments the medium may be a seeding medium used to present or introduce cells into a given environment. In other embodiments, the medium may be a differentiation medium used to facilitate the differentiation of cells. Such media are comprised of a basal medium or a mixture of nutrients, minerals, amino acids, sugars, lipids, and trace elements and supplemented either with serum (serum supplemented media or SSM) or with a defined mix of purified hormones, growth factors and nutrients (HDM) and used for maintenance of cells ex vivo. As used herein, HDM-H is an HDM used in combination with substrata of type IV collagen and laminin to drive the differentiation of endodermal stem/progenitors to mature hepatocytes. HDM-C, as used herein, refers to an HDM used in combination with substrata of type I/III collagen and fibronectin and designed to drive the differentiation of endodermal stem/progenitors to mature cholangiocytes. HDM-P is an HDM used in combination with substrata of type IV collagen and laminin to drive the differentiation of endodermal stem/progenitors to a mature pancreatic islet fate. Basal media are buffers comprised of amino acids, sugars, lipids, vitamins, minerals, salts, and various nutrients in compositions that mimic the chemical constituents of interstitial fluid around cells. Basal media are the starting points for buffers used for cell cultures. In addition, cell culture media are usually comprised of basal media supplemented with a small percentage (typically 2-10%) serum to provide requisite signaling molecules (hormones, growth factors) needed to drive a biological process (e.g. proliferation, differentiation). Although the serum can be autologous to the cell types used in cultures, it is most commonly serum from animals routinely slaughtered for agricultural or food purposes such as serum from cows, sheep, goats, horses, etc. Serum is also used to inactivate enzymes that are part of tissue dissociation processes.
[0109] The terms equivalent or biological equivalent are used interchangeably when referring to a particular molecule, biological, or cellular material and intend those having minimal homology while still maintaining desired structure or functionality.
[0110] As used herein, the term expression refers to the process by which polynucleotides are transcribed into mRNA and/or the process by which the transcribed mRNA is subsequently being translated into peptides, polypeptides, or proteins. If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell. The expression level of a gene may be determined by measuring the amount of mRNA or protein in a cell or tissue sample. Further, the expression level of multiple genes can be determined to establish an expression profile for a particular sample. As used herein, the term lower level in reference to expression level refers to an amount in a cancer cell that is less than the amount in a non-cancer control sample.
[0111] Exemplary growth factors include, but are not limited to, epidermal growth factors (EGFs), fibroblast growth factors (FGFs), hepatocyte growth factors (HGFs), insulin-like growth factors (IGFs), transforming growth factors (TGFs), nerve growth factors (NGFs), neurotrophic factors, interleukins, leukemia inhibitory factors (LIFs), vascular endothelial cell growth factors (VEGFs), platelet-derived growth factors (PDGFs), stem cell factor (SCFs), colony stimulating factors (CSFs), GM-CSFs, erythropoietin, thrombopoietin, heparin binding growth factors, IGF binding proteins, placental growth factors, Wnt signals.
[0112] As used herein, the term functional may be used to modify any molecule, biological, or cellular material to intend that it accomplishes a particular, specified effect.
[0113] The term gene as used herein is meant to broadly include any nucleic acid sequence transcribed into an RNA molecule, whether the RNA is coding (e.g., mRNA) or non-coding (e.g., ncRNA).
[0114] As used herein, the term hyaluronan, or hyaluronic acid, refers to a polymer of a uronic acid and an aminosugar [1-3] composed of a disaccharide unit of glucosamine and gluronic acid linked by ?1-4, ?1-3 bonds and salts thereof. Thus, the term hyaluronan refers to both natural and synthetic hyaluronan.
[0115] As used herein, the term immunocompromised in reference to an animal is one with an impaired immune system such that it is incapable of fully reacting immunologically to pathogens. Those skilled in the art will recognize that this may be due to a genetic disorder, disease process, irradiation or drugs, such as corticosteroids or immunosuppressive agents, given to treat a disorder that inhibits immune function. Examples of drugs that suppress the immune system are methotrexate, cyclophosphamide, 6-mercaptopurine, vincristine, and the like. Suitable immunocompromised animals for use in the practice of the present disclosure are the athymic nude mouse, SCID mouse, SCID/NOD, NOD scid gamma (NSG), BNX immunodeficient mouse, and the like. In one preferred embodiment, the host will be immunocompromised if the transplant of hFL-HCC cells is allogeneic or xenogeneic
[0116] The term isolated as used herein refers to molecules or biologicals or cellular materials being substantially free from other materials.
[0117] Kubota's medium as used herein refers to any basal medium containing no copper, low calcium (<0.5 mM), insulin, transferrin/Fe, free fatty acids bound to purified albumin and, optionally, also high density lipoprotein. Kubota's Medium or its equivalent is serum-free and contains only purified and defined mix of hormones, growth factors, and nutrients. In certain embodiments, the medium is comprised of a serum-free basal medium (e.g., RPMI 1640 or DME/F12) containing no copper, low calcium (<0.5 mM) and supplemented with insulin (5 ?g/mL), transferrin/Fe (5 ?g/mL), high density lipoprotein (10 ?g/mL), selenium (10-10 M), zinc (10 12 M), nicotinamide (5 ?g/mL), and a mixture of purified free fatty acids bound to a form of purified albumin. Non-limiting, exemplary methods for the preparation of this media have been published elsewhere, e.g., Kubota H, Reid L M, Proceedings of the National Academy of Sciences (USA) 2000; 97:12132-12137, the disclosure of which is incorporated herein in its entirety by reference.
[0118] The term mesenchymal cell refer to cells of the mesenchyme. These are loose cells embedded in a mesh of proteins and fluid (i.e. extracellular matrix). Mesenchyme gives rise to most of the body's connective tissues.
[0119] The terms nucleic acid, polynucleotide, and oligonucleotide are used interchangeably and refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides or analogs thereof. Polynucleotides can have any three dimensional structure and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: a gene or gene fragment (for example, a probe, primer, EST or SAGE tag), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, RNAi, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers.
[0120] A polynucleotide can comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure can be imparted before or after assembly of the polynucleotide. The sequence of nucleotides can be interrupted by non-nucleotide components. A polynucleotide can be further modified after polymerization, such as by conjugation with a labeling component. The term also refers to both double and single stranded molecules. Unless otherwise specified or required, any aspect of this technology that is a polynucleotide encompasses both the double stranded form and each of two complementary single stranded forms known or predicted to make up the double stranded form.
[0121] The term protein, peptide and polypeptide are used interchangeably and in their broadest sense to refer to a compound of two or more subunit amino acids, amino acid analogs or peptidomimetics. The subunits may be linked by peptide bonds. In another aspect, the subunit may be linked by other bonds, e.g., ester, ether, etc. A protein or peptide must contain at least two amino acids and no limitation is placed on the maximum number of amino acids which may comprise a protein's or peptide's sequence. As used herein the term amino acid refers to either natural and/or unnatural or synthetic amino acids, including glycine and both the D and L optical isomers, amino acid analogs and peptidomimetics.
[0122] As used herein, the term subject and patient are used interchangeably and are intended to mean any animal. In some embodiments, the subject may be a mammal. In further embodiments, the subject may be a human or non-human animal (e.g. a mouse or rat).
[0123] As used herein, the terms substantially, substantial, and about are used to describe and account for small variations. When used in conjunction with an event or circumstance, the terms can refer to instances in which the event or circumstance occurs precisely as well as instances in which the event or circumstance occurs to a close approximation. For example, the terms can refer to less than or equal to ?10%, such as less than or equal to ?5%, less than or equal to ?4%, less than or equal to ?3%, less than or equal to ?2%, less than or equal to ?1%, less than or equal to ?0.5%, less than or equal to ?0.1%, or less than or equal to ?0.05%. In addition, when a cancer cell is said to substantially not express a particular gene, this refers to less than or equal to ?10% (or more preferably less than or equal to ?5%) as compared to a non-cancer cell.
[0124] The term transplantable in reference to a tumor line refers to a tumor grown in a laboratory animal. The term xenotransplantable is one that has or will be transplanted between members of different species, for example, a human tumor that is transplantable into a mouse. A tumor from a donor animal (e.g. a human) is removed and often prepared into a single-cell suspension and administered to the host/recipient animal (e.g. a mouse). Some tumors must be propagated by transplanting small pieces of tumor or minced tumor material.
[0125] As used herein, treating or treatment of a disease in a subject refers to (1) preventing the symptoms or disease from occurring in a subject that is predisposed or does not yet display symptoms of the disease; (2) inhibiting the disease or arresting its development; or (3) ameliorating or causing regression of the disease or the symptoms of the disease. As understood in the art, treatment is an approach for obtaining beneficial or desired results, including clinical results. For the purposes of the present technology, beneficial or desired results can include one or more, but are not limited to, alleviation or amelioration of one or more symptoms, diminishment of extent of a condition (including a disease), stabilized (i.e., not worsening) state of a condition (including disease), delay or slowing of condition (including disease), progression, amelioration or palliation of the condition (including disease), states and remission (whether partial or total), whether detectable or undetectable.
[0126] Many embodiments described herein relate to a non-human animal that is immunocompromised and able to be transplanted with human tumor cells without immunologically rejecting the human cells. Such a host is used for establishment of a transplantable human fibrolamellar hepatocellular carcinoma (hFL-HCC) tumor line such as TU-2010, a non-human, immunocompromised animal carrying a transplantable human tumor of fibrolamellar hepatocellular carcinoma cells; the tumor line is called TU-2010.
[0127] The immunocompromised animal can be, for example, devoid of T cells, devoid of B cells, lacking functional NK cells, and/or deficient in cytokine signaling. In some embodiments, the non-human animal is an immunocompromised mouse. The immunocompromised mouse can be, for example, a NOD scid gamma mouse (or NOD.Cg-Prkdc.sup.scid Il2rg.sup.tm1Wjl/SzJ
[0128] In some embodiments, the xenotransplanted tumor in the non-human animal is a subcutaneous tumor. In some embodiments, the xenotransplanted tumor in the non-human animal is an intraperitoneal tumor, an ascites. The xenotransplanted tumor, once depleted of the host cells, can comprise, for example, approximately 10.sup.6 to 10.sup.7 hFL-HCC cells/gram
[0129] The hFL-HCC tumor line, TU-2010, is unusually rich in cancer stem cells. Whereas hepatocellular carcinomas (HCCs) are comprised typically of ?0.5-3% cancer stem cells, and cholangiocarcinomas (CCAs) are comprised typically of ?10% cancer stem cells, the transplantable tumor line, TU-2010, is comprised of more than 60% cancer stem cells, a finding indicating the uniqueness of the TU-2010 tumor line.
[0130] The transplantable tumor line, TU-2010, is further comprised of a large percentage of mesenchymal cells derived from the host, the immunocompromised, non-human animal. The mesenchymal cells can comprise, for example, precursors to stellate cells, endothelial cells, stromal cells or pericytes. The non-human mesenchymal cells can account for 50% or more of the tumors transplanted subcutaneously and over 90% of those transplanted intraperitoneally.
[0131] The hFL-HCC cells of the TU-2010 transplantable tumor line express a fusion transcript DNAJB1-PRKACA that has been found in the majority (?70%) of human FL-HCC tumors.
[0132] The hFL-HCC cells of the TU-2010 transplantable tumor line do not express HDAC9.
[0133] The hFL-HCC cells of the TU-2010 transplantable tumor line express LGR5 but substantially do not express or express negligible level of epithelial cell adhesion molecule (EpCAM)
[0134] Human fibrolamellar hepatocellular carcinomas, including the cells in TU-2010, have phenotypic traits indicative of an origin from one or another of the biliary tree stem cell (hBTSC) populations. These include expression of one or more of the following markers: [0135] endodermal stem/progenitor transcription factors (SOX9, SOX17, PDX1, FOXA1) [0136] one or more stem cell genes such as the hyaluronan receptors (CD44), SALL4, LGR5, TROP-2, prominin (CD133), and Sonic Hedgehog (SHH) [0137] one or more pluripotency genes and genes indicative of self-replication selected from NANOG, OCT4, KLF4, KLF5, SOX2, BMI1, AGR2 and SALL4. [0138] one or more hepatic markers selected from CK7, CK18, CK19, CD68, DCLK1, HepPar-1, and KRT20 (KRT20 is found also in the epithelial cells of the intestine) [0139] one or more pancreatic/endocrine markers such as PDX1, NGN3, PCSK1.
[0140] Fibrolamellar hepatocellular carcinomas, including the FL-HCCs in TU-2010, express various markers indicative of malignancy. The TU-2010 line expresses high levels of anterior gradient protein 2 homolog (AGR-2), associated with the down regulation of the phosphoprotein, P53, a tumor suppressor, and it secretes large amounts of enzymes that degrade extracellular matrix components. These findings are relevant to regulation of p53.
[0141] The hFL-HCC tumors, including the cells of the TU-2010 tumor line, express high levels of the aryl hydrocarbon receptor (AHR) implicating a possible pathogenic and oncogenic process involving dioxins or dioxin-like molecules.
[0142] The hFL-HCC tumors have aberrations or loss of expression of one (or more) histone deacetylases. For example the TU-2010 tumor line's cells have a lack of expression of HDAC 9, a member of a family of histone deacetylases involved in epigenetic repression and involved in regulation of transcription, development and cell cycle. HDAC 9 serves deacetylation of lysine residues on the N-terminal part of certain core histones (H2A, H2B, H3 and H4).
[0143] The non-human host used for transplantable human tumors, such as the transplantable human tumor line, TU-2010, is, of necessity, an immunocompromised host since the transplants are xenogeneic. The immunocompromised host can be, for example, devoid of T cells, devoid of B cells, lacking functional NK cells, and/or deficient in cytokine signaling. In some embodiments, the non-human host is an immunocompromised mouse. The immunocompromised mouse can be, for example, a NOD scid gamma (NSG) mouse.
[0144] The tumor cells of the transplantable tumor line can be transplanted subcutaneously or intraperitoneally in the non-human host.
[0145] The hFL-HCC tumors are rich in cancer stem cells. TU-2010 transplantable tumor line is particularly rich in human cancer stem cells. Whereas hepatocellular carcinomas (HCCs) are comprised typically of ?0.5-3% cancer stem cells, and cholangiocarcinomas (CCAs) are typically ?10% cancer stem cells, the TU-2010 transplantable tumor line is more than 60% cancer stem cells.
[0146] The hFL-HCCs can be highly desmoplastic, meaning that the tumor cells elicit a strong reaction from mesenchymal cells located near to the tumor cells. The TU-2010 tumor line is representative of this ability of hFL-HCCs to elicit desmoplastic responses; it comprises a mixture of hFL-HCC cells and a large percentage of host (i.e. murine) mesenchymal cells that can comprise, for example, precursors to stellate cells and endothelial cells. The host mesenchymal cells can account for over half of the cells of the tumor in subcutaneous tumors and over 90% of them in intraperitoneal tumors
[0147] The human FL-HCC cells of the tumor line, TU-2010, express the fusion transcript DNAJB1-PRKACA, found in ?80% of FL-HCC tumors.
[0148] The cells of the human transplantable tumor line, TU-2010, express LGR5 but substantially do not express or express negligible levels of EpCAM.
[0149] In some embodiments, the human FL-HCC cells of the tumor line, TU-2010, express one or more markers indicative of an origin in one or another of the biliary tree stem cell subpopulations. These include one or more of the following biomarkers: [0150] endodermal stem/progenitor transcription factors (SOX9, SOX17, PDX1, FOXA1), [0151] stem cell genes such as the hyaluronan receptors (CD44), LGR5, TROP-2, prominin (CD133), and Sonic Hedgehog (SHH) [0152] one or more pluripotency genes and genes indicative of self-replication selected from NANOG, OCT4, KLF4, KLF5, SOX2, BMI1, and SALL4 [0153] one or more hepatic markers selected from CK7, CK18, CK19, CD68, DCLK1, and HepPar-1, and KRT20 (also found in the epithelial cells of the intestine) [0154] one or more pancreatic/endocrine markers such as PDX1, NGN3, PCSK1.
[0155] The human FL-HCC cells, such as occurs in the TU-2010 tumor line, express biomarkers of malignancy. These include high levels of the anterior gradient protein 2 homolog (AGR-2), associated with the down regulation of the phosphoprotein, p53, a tumor suppressor and/or secrete high levels of enzymes that degrade extracellular matrix components.
[0156] The human FL-HCC cells, such as those of the TU-2010 tumor line and in primary FL-HCCs, express high levels of the aryl hydrocarbon receptor (AHR) implicating a possible pathogenic/oncogenic process involving dioxins or dioxin-like molecules as contributing to the development of the TU-2010 tumor cells and other FL-HCCs.
[0157] Human FL-HCCs have aberrations in or loss of expression of one or another of the histone deacetylase genes, a family of genes involved in regulation of transcription, development and the cell cycle through enzymatic removal of acetyl groups from histones. For example, the TU-2010 tumor line's cells have a lack of expression of HDAC9, HDAC 9 is involved in deacetylation of lysine residues on the N-terminal part of certain core histones (e.g. H2A, H2B, H3 and H4). HDAC9 is low in primary FL-HCC tumors and also in HCCs as well.
[0158] Further embodiments relate to a tissue sample obtained from the tumor line.
[0159] hFL-HCC Cell Cultures. Many embodiments described herein also relate to a cell culture comprising human FL-HCC cells. Ideally the hFL-HCCs are maintained in culture in a serum-free medium. In some embodiments, the serum-free medium is Kubota's Medium, one that culture selects for endodermal stem/progenitors and is non-permissive for cells at later maturational lineage stages.
[0160] Kubota's Medium is a wholly defined medium originally designed for rodent hepatoblasts and later found effective also human hepatoblasts (hHBs), human hepatic stem cells (hHpSCs), human biliary tree stem cells (hBTSCs), human pancreatic stem cells and for human hepatic and pancreatic progenitors. In some embodiments, Kubota's Medium comprises any basal medium (e.g., RPMI 1640 or DMEM-F12) with no copper, low calcium (e.g., 0.3 mM), ?10-9 M selenium, ?0.1% bovine serum albumin or human serum albumin (highly purified and fatty acid free), ?4.5 mM nicotinamide, ?0.1 nM zinc sulfate heptahydrate, ?10.sup.?8 M hydrocortisone, ?5 ?g/ml transferrin/Fe, ?5 ?g/ml insulin, ?10 ?g/ml high density lipoprotein, and a mixture of purified free fatty acids that are added after binding them to purified serum albumin. The free fatty acid mixture consists of ?100 mM each of palmitic acid, palmitoleic acid, oleic acid, linoleic acid, linolenic acid, and stearic acid
[0161] In some embodiments used for maintaining the cells as stem cells, the serum-free medium is further supplemented with hyaluronans or substrata of hyaluronans are used.
[0162] In some embodiments when the cells are being differentiated towards an adult fate, the serum-free hormonally defined medium is comprised of Kubota's Medium is further supplemented with at least one growth factor or cytokine. The growth factor can be, for example, epidermal growth factor (EGF), hepatocyte growth factor (HGF) fibroblast growth factor (FGF) and/or vascular endothelial cell growth factor (VEGF).
[0163] In some embodiments as when the cells are being differentiated towards a hepatocyte fate, the serum-free hormonally defined medium is comprised of Kubota's Medium is further supplemented with: calcium to a level of ?0.6 mM; ?10.sup.?12 M copper; EGF (?10 ng/ml); bFGF (?20 ng/ml); tri-iodothyronine or T3 (?10.sup.?9 M); glucagon (7 ?g/L), galactose (2 g/L), oncostatin M (?10 ng/ml); and HGF (?20 ng/ml). For more optimal differentiation to an hepatocyte fate, this HDM is used in combination with embedding the cells into a mixture of type IV collagen, laminin, and hyaluronans.
[0164] In some embodiments as when the cells are being differentiated towards a cholangiocyte fate, the serum-free hormonally defined medium is comprised of Kubota's Medium that is further supplemented with: calcium to a level of ? 0.6 mM; ?10.sup.?12 M copper; bFGF (?20 ng/ml); T3 (?10.sup.?9M); VEGF (20 ng/ml) and HGF (10 ng/ml). For more optimal differentiation to a cholangiocyte fate, this HDM-C is used in combination with embedding the cells into a mix of type I collagen and hyaluronans.
[0165] In some embodiments as when the cells are being differentiated towards a pancreatic islet fate, the serum-free hormonally defined medium is comprised of Kubota's Medium is prepared without hydrocortisone and then further supplemented with: calcium to a level of ?0.6 mM; ?10.sup.?12 M copper; bFGF (?20 ng/ml); B27 (?2%), ascorbic acid (?0.1 mM), cyclopamine (?0.25 ?M), retinoic acid (?1 ?M); furthermore, the bFGF is used for the first 4 days and then is replaced with exendin-4 (50 ng/ml) and HGF (20 ng/ml) for the remainder of the time. For more optimal differentiation to a pancreatic islet fate, this HDM-P is used in combination with embedding cells into a mix of type IV collagen, laminin, and hyaluronans.
[0166] In some embodiments, the cultures are primary cultures of the dispersed tumor and so are a mix of the hFL-HCCs and the host (e.g. murine) mesenchymal cells.
[0167] In some embodiments, the human cells can be purified by immune-selection from the tumor cell suspensions such that the cultures are predominantly (>90%) the human FL-HCC cells.
[0168] In some embodiments, the human FL-HCC cells of the cell cultures are rich in cancer stem cells. If the host (e.g. murine) mesenchymal cells have been depleted by immune-selection technologies, the hFL-HCCs are dominant (>90% of the cells in culture) and comprised of cancer stem cells that are over 50% and up to 70% of the human cells in the cultures.
[0169] In some embodiments, the human FL-HCC cells are plated onto a culture substratum such as plastic; in some, the substratum can be a purified form of a matrix component (e.g. hyaluronan, a collagen, an adhesion molecule such as laminin); in some, the substratum can be a complex extracellular matrix extract such as a biomatrix scaffold or Matrigel.
[0170] In some embodiments, the human FL-HCC cells of the cell culture can be established as spheroids or organoids, floating aggregates of cells. In other embodiments, the hFL-HCC cells of the cell culture are in the form of monolayers.
Methods for Establishing and Maintaining hFL-HCC Tumor Lines
[0171] In some embodiments, the hFL-HCC cells are obtained from an ascites fluid; in some embodiments, the hFL-HCC cells are obtained from a solid tumor from a patient suffering from the disease. To establish a tumor line, the tumor cells must first be culture selected for the cancer stem/progenitors present in the tumor. The culture selection makes use of restrictive conditions that are not permissive for other lineage stages of cells other than the ones desired. The method comprises culturing cells obtained from the ascites fluid or from the solid tumor with a wholly defined, serum-free media (e.g., Kubota's Medium), designed to culture select endodermal stem/progenitor cells (such as the cancer stem cells in the human FL-HCC tumors).
[0172] Many embodiments described herein also relate to a method for obtaining a human FL-HCC tumor line, comprising isolating human FL-HCC cells from a human subject suffering from FL-HCC; culture selecting the cancer stem/progenitor cell population(s) under conditions permissive for the cancer stem cells but not for the later maturational lineage stages of cells; and then transplanting them into an immunocompromised, non-human animal. The immunocompromised non-human animal can be, for example, an immunocompromised mouse such as NOD scid gamma (NSG) mouse.
[0173] In some embodiments, the hFL-HCC cells isolated from the human subject are transplanted subcutaneously into the immunocompromised non-human animal. In some embodiments, the hFL-HCC cells isolated from the human subject are transplanted intraperitoneally into the immunocompromised non-human animal.
[0174] In some embodiments, the method comprises transplanting from 10 to 108 hFL-HCC cells, or about 10.sup.2 to 10.sup.7 hFL-HCC cells, or about 10.sup.2 to 10 hFL-HCC cells, or about 10 to 10 hFL-HCC cells, or about 10 to 10 hFL-HCC cells, or about 10 to 10.sup.6 hFL-HCC cells, or about 10.sup.6 to 10.sup.7 hFL-HCC cells, into the immunocompromised non-human animal. In some embodiments, the method comprises monitoring the immunocompromised non-human animal for tumor formation for 2 to 9 months. Depending on the number of cells transplanted (with more transplanted cells correlating with more rapid tumor formation), for example, formation of a xenografted human tumor can occur in about 2-3 months (with transplantation of over 106 cells), and ranging to 7-9 months (with transplantation of 10-100 cells).
[0175] Many embodiments described herein also relate to a method for maintaining a human FL-HCC tumor line, comprising obtaining human FL-HCC cells from a first passaged xenografted tumor, dispersing the cells by enzymatic or mechanical methods into a cell suspension, and transplanting the human FL-HCC cells into a second immunocompromised non-human animal. The first and second immunocompromised non-human animals can be, for example, immunocompromised mice such as NOD scid gamma mice.
[0176] In some embodiments, the method comprises culturing cells obtained from the xenografted tumor with a serum-free medium (e.g., Kubota's Medium) to culture select human FL-HCC cells. In some embodiments, the serum-free medium is supplemented with hyaluronans. In some embodiments, the serum-free medium is supplemented with one or more growth factors. The growth factors can be, for example, HGF, FGF, EGF, and/or VEGF.
[0177] In some embodiments, the human FL-HCC cells obtained from the first immunocompromised non-human animal are transplanted subcutaneously into the second immunocompromised non-human animal. In some embodiments, the human FL-HCC cells obtained from the first immunocompromised non-human animal are transplanted intraperitoneally into the second immunocompromised non-human animal.
Method for Culturing hFL-HCC Cells
[0178] Many embodiments described herein also relate to a method for culturing human FL-HCC cells, comprising separating human FL-HCC cells of a xenografted tumor from non-human cells, suspending the separated human FL-HCC cells in a serum-free medium (e.g., Kubota's Medium), and plating the hFL-HCC cells onto culture plastic, or onto a purified matrix component (e.g. hyaluronan, a collagen, an adhesion molecule such as laminin) or into/onto a complex extracellular matrix extract (e.g. biomatrix scaffolds, Matrigel).
[0179] In some embodiments, the human FL-HCC cells of the xenografted tumor are separated from non-human cells (e.g. murine mesenchymal cells) by magnetic immuno-selection or by an equivalent immune-selection technology (e.g. flow cytometry) or any technology that distinguishes human from non-human cells.
[0180] In some embodiments, the culture substratum comprises a culture plastic. In some embodiments, the culture substratum comprises a monolayer coating or a 3-dimensional form (e.g. hydrogel) of a purified extracellular matrix component (e.g. hyaluronan, a collagen, an adhesion molecule such as laminin), a mix of one or more of the matrix component, or an extract enriched in extracellular matrix (e.g. biomatrix scaffolds, Matrigel).
[0181] In some embodiments, the human FL-HCC cells are suspended in the medium and aggregation of the cells occurs to form spheroids if only the hFL-HCC are part of the aggregates or organoids if the aggregates contain hFL-HCC and other cell types (e.g. vascular or mesenchymal cells). In some embodiments, the plated hFL-HCC cells form monolayers.
Method for Drug Screening and Testing
[0182] Many embodiments described herein also relate to a method for drug screening, comprising contacting a candidate drug with cultured hFL-HCC cells, and monitoring the effect(s) of the candidate drug on the cultured hFL-HCC cells.
[0183] In some embodiments, the cultured hFL-HCC cells are in the form of floating aggregates of cells, spheroids or organoids.
[0184] Many embodiments described herein also relate to a method for drug testing, comprising administering a candidate drug to a non-human animal that has been transplanted with a tumor containing human FL-HCC cells, and monitoring the effect of the candidate drug on the xenotransplanted tumor.
[0185] Many embodiments described herein also relate to a method for suppressing the growth of human FL-HCC cells, comprising treating the hFL-HCC cells with a hedgehog signaling pathway inhibitor and/or a histone deacetylase inhibitor and/or some other candidate drug.
[0186] In some embodiments, the method comprises treating the human FL-HCC cells with a hedgehog signaling pathway inhibitor (e.g., GDC-0449). In some embodiments, the method comprises treating the human FL-HCC cells with a histone deacetylase inhibitor (e.g., SAHA or SBHA).
[0187] Many embodiments described herein also relate to a method for treating FL-HCC in a human patient, comprising administering to the patient an effective amount of a hedgehog signaling pathway inhibitor and/or a histone deacetylase inhibitor.
[0188] In some embodiments, the method comprises administering to the patient an effective amount of a hedgehog signaling pathway inhibitor (e.g., GDC-0449). In some embodiments, the method comprises administering to the patient an effective amount of a histone deacetylase inhibitor (e.g., SAHA or SBHA).
Method for Diagnosis of hFL-HCCs
[0189] At present, the only biomarker identified for ?80% of human FL-HCCs is the fusion gene, DNAJB1-PRKACA. Histologically, the tumor is recognizable as aggregates of large polygonal cells with abundant eosinophilic cytoplasm, large, vesiculated nuclei and large nucleoli; the tumor cells are nestled within bands of stroma. In addition to the fusion gene and the distinctive histological traits, one can identify hFL-HCCs by phenotypic traits typical of biliary tree stem cells. These hFL-HCC tumors are hypothesized to derive from one or another of the biliary tree stem cell subpopulations that constitute the native stem cells and progenitors for both liver and pancreas.
[0190] Recognition of the origins of hFL-HCCs from hBTSC subpopulations is indicated by the expression of: [0191] one or more endodermal transcription factors (e.g. SOX9, SOX17, PDX1, FOXA1) [0192] one or more pluripotency genes and genes indicative of self-replication (e.g. NANOG, OCT4, KLF4, KLF5, SOX2, BMI1, TROP-2, and SALL4) and evidence for multipotency [0193] one or more hepatic markers (e.g. alpha-fetoprotein, albumin, CK7, CK18, CK19, CD68, DCLK1, and HepPar-1), and KRT20 (also found in the epithelial cells of the intestine) [0194] one or more pancreatic/endocrine markers (e.g. PDX1, NGN3, PCSK1, insulin, glucagon, amylase, MUC or mucin).
[0195] Recognition of malignancy in hFL-HCCs is indicated by: [0196] Expression of high levels of anterior gradient protein 2 homolog (AGR-2), associated with the down regulation of the phosphoprotein, p53, a tumor suppressor. [0197] Release of high levels of enzymes that degrade and dissolve extracellular matrix (e.g. heparanase, matrix metalloproteinases-MMPs) [0198] Aberrant regulation of p53, a tumor suppressor
[0199] Recognition of factors contributing to the pathogenic/oncogenic process in hFL-HCCs is indicated by: high levels of the aryl hydrocarbon receptor (AHR) implicating a possible contribution of dioxins or dioxin-like molecules in the aetiology of hFL-HCCs
[0200] Recognition of key genes that are affected in hFL-HCCs is indicated by: aberrations in or absence of one or more histone deacetylases (HDAC), enzymes critically associated with regulation of transcription, development, cell proliferation, and the cell cycle.
[0201] In addition, the human FL-HCC tumors will have biomarkers of malignancy. Some of the biomarkers indicative of malignancy include high levels of expression of AGR2, over-production of matrix-degrading enzymes (e.g. heparanase, matrix metalloproteinases or MMPs), very high levels of AHR and aberrant levels of one or another HDAC gene and/or aberrations in the regulation of p53, a tumor suppressor.
[0202] In some embodiment, the method further comprises culturing cells obtained from an ascites fluid or solid tumor derived from a human subject and subjecting it to culture conditions that are wholly serum-free and in a medium (e.g., Kubota's Medium), designed for culture selection of endodermal cancer stem/progenitors and then detecting the formation of spheroids or organoids.
[0203] Methods for Determining Whether a Patient has FL-HCC and Treating a Patient Diagnosed with FL-HCC
[0204] In one aspect is provided a method of determining whether a patient has fibrolamellar hepatocellular carcinoma (FL-HCC), comprising: (a) measuring gene expression levels of at least one of C10orf128, CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3, PCSK1, PHACTR2, RPS6KA2, SLC16A14, TMEM163, and TNRC6C; and (b) comparing the gene expression level to one or more control samples.
[0205] In some embodiments, overexpression of C10orf128, CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3, PCSK1, PHACTR2, RPS6KA2, SLC16A14, TMEM163 or TNRC6C relative to the control sample is associated with presence of FL-HCC. On the other hand, a lack of increased expression of C10orf128, CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3, PCSK1, PHACTR2, RPS6KA2, SLC16A14, TMEM163 or TNRC6C relative to the control sample indicates that the patient is not likely to have FL-HCC.
[0206] In other embodiments, overexpression of PCSK1, CA12, NOVA1, SLC16A14, TNRC6C, TMEM163, and RPS6KA2 relative to the control sample is associated with presence of FL-HCC. On the other hand, a lack of increased expression of PCSK1, CA12, NOVA1, SLC16A14, TNRC6C, TMEM163, and RPS6KA2 relative to the control sample indicates that the patient is not likely to have FL-HCC.
[0207] In yet other embodiments, overexpression of C10orf128, OAT, PAK3, PCSK1, PHACTR2, SLC16A14, TMEM163, and TNRC6C relative to the control sample is associated with presence of FL-HCC. On the other hand, a lack of increased expression of PCSK1, CA12, NOVA1, SLC16A14, TNRC6C, TMEM163, and RPS6KA2 relative to the control sample indicates that the patient is not likely to have FL-HCC.
[0208] In some embodiments, the control sample is selected from the group consisting of hepatocellular carcinomas (HCCs), cholangiocarcinomas (CCAs), normal liver cells, and normal cholangiocytes.
[0209] As used herein, the term overexpression refers to the level of mRNA and/or protein of a specific, for example, C10orf128, CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3, PCSK1, PHACTR2, RPS6KA2, SLC16A14, TMEM163 or TNRC6C, expressed in a suspected tumor cell of a sample collected from a patient being elevated in comparison to the level as measured in a control sample. The mRNA and/or protein expression level may be determined by a number of techniques known in the art including, but not limited to, quantitative RT-PCR, western blotting, immunohistochemistry, and suitable derivatives of the above.
[0210] In some embodiments, the gene expression of PCSK1 and at least one additional gene selected from the group consisting of C10orf128, CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3, PHACTR2, RPS6KA2, SLC16A14, TMEM163, and TNRC6C is measured. In another embodiment, the gene expression of PCSK1 and at least one additional gene selected from the group consisting of C10orf128, CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3, PHACTR2, RPS6KA2, SLC16A14, TMEM163, and TNRC6C is overexpressed.
[0211] In some embodiments, at least two, at least three, at least four, at least five, at least six, at least seven or all eight of genes C10orf128, CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3, PCSK1, PHACTR2, RPS6KA2, SLC16A14, TMEM163 and TNRC6C are measured. In some embodiments, at least two, at least three, at least four, at least five, at least six, at least seven or all eight of genes C10orf128, CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3, PCSK1, PHACTR2, RPS6KA2, SLC16A14, TMEM163 and TNRC6C are overexpressed. In some embodiments, any one of the listed genes is expressly excluded from the genetic signature of hFL-HCC.
[0212] In one aspect is provided a method of treating a patient determined to have FL-HCC by administering to the patient an effective amount of at least one therapeutic that decreases expression of at least one of C10orf128, CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3, PCSK1, PHACTR2, RPS6KA2, SLC16A14, TMEM163, or TNRC6C.
[0213] In some embodiments, the at least one therapeutic is selected from the group consisting of a small molecule, RNA interference, and a locked nucleic acid (LNA). In other embodiments, the at least one therapeutic is an immunotherapy.
[0214] In one aspect is provided a method of treating a patient determined to have hFL-HCC by administering to the patient an effective amount of at least one therapeutic that regulates PRKACA or SRC network hubs.
[0215] In another aspect is provided method of treating a patient determined to have hFL-HCC by administering to the patient an effective amount of at least one therapeutic that regulates substrate targets of the kinase PRKACA (Protein kinase A catalytic subunit alpha) or carbonic anhydrases.
WORKING EXAMPLES
[0216] Human fibrolamellar hepatocellular carcinomas (hFL-HCCs) are rare liver cancers occurring in young people, have an unknown aetiology, and are currently treatable only by surgery. Immunohistochemistry (IHC) of 9 hFL-HCCs and tissue microarrays of 18 FL-HCCs indicated robust expression of endodermal stem/progenitor markers (SOX9, PDX1, SOX17, sonic hedgehog-SHH, SALL4, OCT4).
[0217] A first-ever, transplantable hFL-HCC tumor line, TU-2010, established in immunocompromised mice, proved rich in cancer stem cells, indicated functionally by spheroid/organoid formation, limiting dilution tumorigenicity, and culture; by flow cytometric and IHC evidence of pluripotency (e.g. KLF4, OCT4, NANOG) and endodermal stem/progenitor markers (e.g., LGR5, SOX9, PDX1, CD44, SHH); and effects of differentiation media on these traits. Transcriptomic analyses revealed a global expression profile for human FL-HCCs indicating their derivation from biliary tree stem cells, stem cell precursors to liver and pancreas. A recurrent fusion gene unique to hFL-HCCs, DNAJB1-PRKACA, was confirmed. In vitro studies and phenotypic traits suggest hedgehog proteins and histone deacetylases to be therapeutic targets. Oikawa et al. (2015) Nature Communications 6:8070, incorporated by reference in its entirety.
Materials and Methods
[0218] 1.1. Paraffin sections of normal livers versus hFL-HCCs. Sections (5 ?m) prepared from the original paraffin blocks of 9 hFL-HCC tumors and ones from Tissue MicroArrays (TMAs) of 19 normal adult livers and 18 hFL-HCC patients were obtained from Memorial Sloan Kettering Cancer Center (MSKCC, New York City, NY) and used for IHC assays. They were obtained with approval of the IRB at MSKCC. Handling of all the samples fully met compliance and privacy requirements as per HIPAA laws.
[0219] 1.2. Original fibrolamellar hepatocellular carcinoma (hFL-HCC) used to establish the tumor line, TU-2010. A male patient, age 25, presented in August 2008 to Greenwich Hospital (Yale/New Haven Hospital, Greenwich, CT) with acute swelling of his right lower leg. During the initial evaluations, he was found to have an extensive venous thrombus extending from his right ankle into his inferior vena cava. A CT of his chest/abdomen/pelvis revealed multiple small pulmonary emboli and a large mass in his left liver with evidence of metastatic disease in the perihepatic lymph nodes, omentum and peritoneum. He had a venous filter inserted above the thrombus, was started on anticoagulation and transferred to MSKCC for further studies and therapy. The patient underwent a liver biopsy resulting in a pathologic diagnosis of hepatocellular carcinoma (HCC) and subsequently had an extensive debulking procedure which included a left hepatic lobectomy and debulking of periotoneal and omental nodules. Macroscopically, the peritoneal and omentum nodules proved to be tumors and histologically revealed tumor tissue consistent with a diagnosis of hFL-HCC. Surgical pathology revealed tumor cells positive for HepPar1 and cytokeratin 7 (CK7). Analyses of EMA (epithelial membrane antigen) and AFP (?-fetoprotein) were not conclusive and neither were tissues stained for reticulin, iron, or PAS-3.
[0220] A summary of the characterization of the original tumor by the pathologists at Memorial Sloan Kettering Cancer Center (MSKCC) is given in Table 1. A later round of biopsies resulted in similar pathology reports. These included cytology on pleural fluid found replete with tumor cells, which also had a pathology consistent with a diagnosis of FL-HCC.
TABLE-US-00001 TABLE 1 Summary of findings on the original hFL-HCC tumor used to establish the TU-2010 transplantable tumor line. (patient data from Memorial Sloan Kettering Cancer Center-MSKCC)** Staining Intensity (% cells Staining) or Gene Expression BIOMARKERS ASSAYS Change Comments Ribonucleotide IHC 2+ (80%) Certain drugs, such as reductase subunit M1 gemcitabine, are of little benefit (RRM1) due to high expression of RRM1 Breast Cancer IHC 2+ (75%) Obviates usefulness of cisplatin Resistant Protein and carboplatin (BCRP) Secreted Protein Acidic IHC 2+ (35%) Nab-paclitaxel and Rich in Cysteine (SPARC) SPARC Microarray Increased (3.51) Nab-paclitaxel Multidrug Resistance IHC 2+ (30%) Minimal effects expected with associated Protein 1 etoposide, vincristine (MRP1) ABCC1 Microarray Increased (3.03) Minimal benefit with Paclitaxel, Topotecan Her2/Neu IHC 2+ (10%) and 1+ FISH analyses were done, and 60 (30%) interphase nuclei were examined; the ratio of HER2/neu signals to chromosome 17 signals was 1.63 to 1 indicating no amplification of this gene HIF1A Microarray Increased (10.66) Agents associated with clinical benefits include sorafenib, sunitinib, bevacizumab PDGFRB Microarray Increased (2.3) Agents associated with clinical benefits include sorafenib, sunitinib, imatinib TOP2B Microarray Increased (4.55) Beneficial agents include doxorubicin, epirubicin, liposomal doxorubicin ADA Microarray Increased (4.05) Beneficial agents include pentostatin Estrogen receptor, Negative Classic hormone therapies are not progesterone receptor, logical for use with the tumor androgen receptor **Approval for the research studies on the tumor and on the patient was given by the IRB at MSKCC (New York City, NY), and compliance with HIPAA regulations was met.
[0221] The patient was subsequently treated with various oncoloytic agents including sorafenib, doxorubicin, gemcitabine, cisplatinum, 5-FU, bevacizumab, and thalidomide with limited or no response. In September of 2009 after showing progressive enlargement in the perihepatic and retroperitoneal nodes, recurrent disease in the liver, and increasing size of omental and peritoneal nodules, the patient returned to MSKCC to obtain further tissue for tumor sensitivity studies and debulking. Biopsies were taken, but his disease was too extensive for debulking. Paclitaxel and thalidomide were then started based on sensitivity studies but was poorly tolerated with continued disease progression, so treatment was stopped. After 4 months it was realized that he had widely disseminated disease especially in the ascites fluid. In early February 2010, a palliative paracentesis was done for massive ascites, and approximately 5 liters of fluid were removed and transferred to several researchers, including those in the UNC research lab, in hopes that studies on the tumor might identify alternate treatments. A week later the patient passed away peacefully.
[0222] 1.3. Ascites fluid. Four liters of ascites fluid were received at UNC within 10 hours of removal from the patient. The cells were centrifuged and pooled, yielding about 2?107 cells, and plated on plastic or other substrata (laminin, hyaluronans, types I, III or IV collagens) in serum-free Kubota's Medium (KM) prepared in either RPMI 1640 or in DMEM-F12 and presented as two-dimensional (2D) monolayers or three-dimensional (3D) hydrogels. Serum-free Kubota's Medium (KM) has been found to select for endodermal stem cells and progenitors and is not permissive for survival of mature cells. Culture selection for tumor cells with stem cell properties was done in monolayer (2D) cultures and did best on plastic and in KM in DMEM-F12. Those in 3-D hydrogels behaved similarly in KM prepared in either DMEM-F12 or RPMI 1640, grew more slowly, and, in parallel, caused dissolution of hydrogels by hFL-HCC's considerable enzyme secretions that degrade extracellular matrix. This culture selection process proved successful for establishment of the transplantable tumor line as clarified in further details below.
[0223] 1.4. Culture conditions. All media were sterile-filtered (0.22 ?m filter) and kept in the dark at 4? C. before use. Hyaluronans were obtained from Glycosan Biosciences (Salt Lake City, Utah; now part of Biotime, Alameda, CA). Type III and IV collagens and laminin were obtained from Becton Dickinson (Research Triangle Park, NC).
[0224] 1.5. Kubota's medium. (KM) is a serum-free medium designed originally for rodent hepatoblasts and then found effective also for human hepatoblasts, hepatic stem cells (hHpSCs), biliary tree stem cells (hBTSCs), and for pancreatic progenitors. It contains any basal medium (here being RPMI 1640) with no copper, low calcium (0.3 mM), 10-9 M selenium, 0.1% BSA, 4.5 mM nicotinamide, 0.1 nM zinc sulfate heptahydrate, 10-8 M hydrocortisone, 5 ?g/ml transferrin/Fe, 5 ?g/ml insulin, 10 ?g/ml high density lipoprotein, and a mixture of purified free fatty acids that are added after binding to purified human serum albumin. Kubota's Medium is available commercially from PhoenixSongs Biologicals (Branford, CT).
[0225] 1.6. Hormonally defined media (HDM). Supplements can be added to KM to generate a serum-free, hormonally defined medium (HDM) that will facilitate differentiation of the normal hepatic or biliary tree stem cells to specific adult fates. These include supplementation with calcium to achieve at or above 0.6 mM concentration, 1 nM tri-iodothyronine (T3), 10-12 M copper, 10 nM of hydrocortisone and 20 ng/ml of basic fibroblast growth factor (bFGF). The medium conditions over and above these needed to selectively yield hepatocytes (HDM-H) versus cholangiocytes (HDM-C) versus pancreatic islets (HDM-P) are:
[0226] (1) HDM-H: supplementation further with 7 ?g/L glucagon, 2 g/L galactose, 10 ng/ml epidermal growth factor (EGF) and 20 ng/ml hepatocyte growth factor (HGF).
[0227] (2) HDM-C: supplementation further with 20 ng/ml vascular endothelial cell growth factor (VEGF) 165 and 10 ng/ml HGF.
[0228] (3) HDM-P: prepared without glucocorticoids and further supplemented with 1% B27, 0.1 mM ascorbic acid, 0.25 ?M cyclopamine, 1 ?M retinoic acid, 20 ng/ml of FGF-7 for 4 days, then changed with one supplemented with 50 ng/ml exendin-4 and 20 ng/ml of HGF for 6 more days of induction.
[0229] 1.7. Tissue sourcing of normal tissue. Adult, normal, human biliary tissues were dissected from intact livers and pancreases obtained but not used for transplantation into a patient. They were obtained through organ donation programs via United Network for Organ Sharing (UNOS). Those used for these studies were considered normal with no evidence of disease processes. Informed consent was obtained from next of kin for use of the tissues for research purposes, protocols received Institutional Review Board approval, and processing was compliant with Good Manufacturing Practice. The research protocol was reviewed and approved by the Institutional Review Board for Human Research Studies at the University of North Carolina at Chapel Hill, NC, USA.
[0230] 1.8. Animals. In preliminary studies, immunocompromised mice of several species (e.g. athymic nudes, SCID/NODs, NSGs) were obtained from suppliers or were obtained from breeding colonies on the UNC campus and used as hosts for the human FL-HCC cells. The findings were most successful with NOD.Cg-Prkdc.sup.scid Il2rg.sup.tm1Wjl/SzJ. These are known commonly as NOD scid gamma or NSGs. These mice are devoid of T or B cells, lack functional NK cells and are deficient in cytokine signaling. The strain combines the features of the NOD/ShiLtJ (Stock Number 001976) background, the severe combined immune deficiency mutation (scid, which is caused by a spontaneous mutation in the Prkdc gene), and the IL2 receptor gamma chain deficiency. The animals were maintained in the quarters maintained by the Division of Laboratory Animals (DLAM). Procedures were performed according to protocols approved by the UNC School of Medicine at Chapel Hill IACUC. All species were inbred and housed in UNC's DLAM sterile facility in micro-isolated autoclaved cages with free access to autoclaved water and radiation sterilized food.
[0231] 1.9. Transplantation of the human FL-HCC cells. Efforts to establish a tumor line by transplanting the original ascites tumor cells immediately after removal from the patient were not successful. Rather, success was achieved with cells that survived and so were culture selected in serum-free Kubota's Medium (KM) and on culture plastic or on a substratum of hyaluronans. The culture-selected tumor cells were transplanted and yielded tumors after an initial passage of more than 6 months in the NSG mice. Thereafter, xenografted established tumors passaged by mincing tumor in KM supplemented with 1% hyaluronans (uncross-linked) and further supplemented with 50 ng/ml each of HGF and VEGF. The tumor mince (approximately 20 mgs) in the KM+1% hyaluronans+growth factors was injected subcutaneously into mice. The tumor mince form tumors in the absence of hyaluronans and growth factors but do so more slowly and will not yield tumors at all in some mice. Consistent, reproducible tumor formation occurred with the use of the supplements. If transplanted intraperitoneally, the tumor cells spread onto the serosal surfaces throughout the peritoneum and also onto the liver and pancreas.
[0232] Tissue processing of the human FL-HCC tumors to generate cell suspensions for ex vivo studies was conducted in RPMI 1640 supplemented with 0.1% bovine serum albumin, 1 nM selenium and antibiotics. Enzymatic processing buffer contained 600 U/ml type IV collagenase and 0.3 mg/ml deoxyribonuclease at 32? C. with frequent agitation for 15-20 min. Enriched suspensions were pressed through a 75 gauge mesh and spun at 1200 RPM for 5 min before re-suspension. Estimated cell viability by trypan blue exclusion was routinely higher than 95%.
[0233] 1.10. Magnetic immunoselection of cells. Human tumor cells were isolated from xenografted tumors. Negative sorting was done using EasySep magnetic bead immunoselection using the magnetic cups and beads (StemCell Technologies, Vancouver, Canada) and according to the manufacturer instructions. Briefly the dissociated cells were washed in phosphate-buffered saline (PBS) with 3% fetal bovine serum (FBS) (staining medium) were treated with FcR blocking antibody and incubated with a cocktail of biotin-conjugated anti-mouse antibody against lineage cells (Miltenyi Biotec Inc, Auburn, CA), and with biotin-conjugated anti-mouse-MHC class I (H-2K.sup.d) (clone; SF1-1.1) and ?CD31 (clone; MEC13.3) antibodies (BD Biosciences, San Jose, CA) at room temperature for 15 min.
[0234] Cells were incubated with biotin selection cocktail for 15 min, and then incubated with magnetic nanoparticles at room temperature for 10 min. The cups were magnetized, and cells or clumps of cells bound to the walls of the cup; those not bound (the human cells) were collected into a separate container. The cells bound to the cups were the mouse cells that were discarded. The human cells were suspended in KM and then plated.
[0235] The cells were plated onto culture plastic or on or in hyaluronan hydrogels (some of them supplemented with type III or IV collagen or laminin) and provided with serum-free KM. For the initial plating, the medium was supplemented with 2-5% FBS (HyClone, Waltham, MA). After a few hours, the medium was changed to the serum-free version, and this was used for all subsequent medium changes.
[0236] For the cultures of xenografted tumors, the human cells were sorted by immunoselection away from the murine (host) mesenchymal cells and then were plated in serum-free KM from the outset.
[0237] 1.11. Immunocytochemistry and immunohistochemistry. For immunofluorescent staining, 5 ?m frozen sections or cultured cells were fixed with 4% paraformaldehyde (PFA) for 20 min at room temperature, rinsed with PBS, blocked with 10% goat serum in PBS for 2 hours, and rinsed. Fixed cells were incubated with primary antibodies at 4? C. for 14 hours, washed, incubated for 1 hour with labeled isotype-specific secondary antibodies, washed, counterstained with 4,6-diamidino-2-phenylindole (DAPI) for visualization of cell nuclei and viewed using Leica DMIRB inverted microscope (Leica, Houston, TX) or a Zeiss ApoTome Axiovert 200M (Carl Zeiss Inc, Thornwood, NY).
[0238] For immunohistochemistry (IHC), the tissues were fixed in 4% PFA overnight and stored in 70% ethanol. They were embedded in paraffin and cut into 5 ?m sections. After deparaffinization, antigen retrieval was performed with sodium citrate buffer (pH 6.0) or ethylenediaminetetraacetic acid (EDTA) buffer (pH 8.0) in a steamer for 20 min. Endogenous peroxidases were blocked by incubation for 15 min in 3% H.sub.2O.sub.2. After blocking, primary antibodies reacted against human but not mouse cells and were applied at 4? C. overnight. M.O.M immunodetection kit (Vector Laboratories, Burlingame, CA) was used for detecting primary mouse anti-human antibodies on mouse xenotransplant FL-HCC tumor to avoid the inability of the anti-mouse secondary antibody to endogenous mouse immunoglobulins in the tissue. Sections were incubated for 30 min at room temperature with ImmPRESS peroxidase-micropolymer staining kits and 3,3-diaminobenzidine substrate (Vector Laboratories). Sections were lightly counterstained with hematoxylin. Antibodies used are listed in Table 2. Control images are given in
TABLE-US-00002 TABLE 2 Antibodies for Immunohistochemistry Antibody Species Isotype Manufacture Reactivity Retrieval ABCG2 Mouse IgG2a Millipore H CB AFP Mouse IgG2a SIGMA H, D, P CB but, not M BMI1 Rabbit IgG Abcam H CB CD44 Mouse IgG2a Abcam H CB CD68 Mouse IgG3 DAKO H CB CK7 Mouse IgG1 DAKO H CB CK18 Mouse IgG1 DAKO H CB CK19 Mouse IgG2a Abcam H CB E-cadherin Mouse IgG2b Abcam H CB EpCAM Mouse IgG1 Cell H CB Signaling HepPar-1 Mouse IgG1 DAKO H CB KLF4 Rabbit IgG NOVUS H CB LGR5 Rabbit IgG NOVUS H CB MDR-1 Mouse IgG2a Abcam H EDTA MUC6 Mouse IgG1 Santa Cruz H CB NANOG Mouse IgG1 Cell H EDTA Signaling NCAM Mouse IgG1 DAKO H CB NGN3 Rabbit IgG NOVUS H EDTA OCT4 Rabbit IgG Cell H EDTA Signaling PDX1 Rabbit IgG NOVUS H CB SALL4 Mouse IgG1 Abcam H EDTA SHH Rabbit IgG Millipore H CB SOX2 Rabbit IgG Cell H CB Signaling SOX9 Rabbit IgG1 SIGMA H CB SOX17 Mouse IgG1 Abcam H CB SYNDECAN- Goat IgG R&D H CB 1 (HS-PG-1) VCAM-1 Mouse IgG1 Santa Cruz H CB H = human, D = dog, M = mouse, P = pig, R = rat.
[0239] 1.13. Flow cytometric analyses. The dissociated cells were incubated at 4? C. for 30 min with fluorescein isothiocyanate (FITC)- or biotin-conjugated anti-mouse-MHC class I (against H-2K.sup.d) (clone; 34-1-2S) (eBioscience, San Diego, CA) and anti-human antibodies (see Table 3) for cell surface markers. For biotinylated antibody, allophycocyanin (APC)-streptavidin (BD Biosciences, San Jose, CA) was used for visualization. The cells were washed with staining medium before analysis. For the intracellular staining of LGR5, the cells were incubated with antibodies against the cell surface antigens as usual, and then, were fixed with 4% PFA/PBS at 4? C. for 20 min. After washing with staining medium, the cells were resuspended in permeabilization buffer (PBS with 1% FCS, 0.1% sodium azide, and 0.1% saponin) with PE-conjugated anti-LGR5 antibody at 4? C. for 30 min. Antibodies used are listed in Table 3. The labeled cells were washed with permeabilization buffer and then analyzed by FACSCalibur?. (BD Biosciences, San Jose, CA).
TABLE-US-00003 TABLE 3 Antibodies for Flow Cytometric Analyses Name Clone Host/isotype Manufacture APC-CD13 WM15 Mouse IgG1 eBioscience PE-CD24 ML5 Mouse IgG2a BD Biosciences FITC-CD29 (Integrin ?1) TS2/16 Mouse IgG1 eBioscience APC-CD44 BJ18 Mouse IgG1 BioLegend FITC-CD49f GoH3 Rat IgG2a BD Biosciences (Integrin ?6) FITC-CD54 (ICAM) HA54 Mouse IgG1 BioLegend APC-CD56 (NCAM) MEM-188 Mouse IgG2a Abcam FITC-CD90 (THY-1) 5E10 Mouse IgG1 eBioscience APC-CD117 (c-KIT) YB5.B8 Mouse IgG1 BD Biosciences APC-CD133/1 AC133 Mouse IgG1 Miltenyi Biotec APC-CD184 (CXCR4) 12G5 Mouse IgG2a eBioscience APC-CD324 67A4 Mouse IgG1 Miltenyi Biotec (E-cadherin) FITC-CD326 (EpCAM) VU-1D9 Mouse IgG1 Stem Cell Technologies PE-TROP-2 77220 Mouse IgG2a R&D PE-LGR5 2A2 Mouse IgG1 Origene APC, allophycocyanin; PE, R-phycoerythrin; FITC, fluorescein isothiocyanate.
[0240] 1.14. Differentiation assays. 1?105 hFL-HCC cells, depleted of host mesenchymal cells by magnetic sorting, were seeded into each well of a 12-well plate coated with 5 ?g/cm2 hyaluronan and cultured with KM+2% FBS for overnight. After 16-20 hours, the cells were incubated for 7 days with either serum-free KM (as the undifferentiated control) or with serum-free HDM-H, HDM-C or HDM-P. After a total of 7 days culture, cells were harvested for analyses of gene expression.
[0241] 1.15. Invasion assay. Invasion activity of the cells was analyzed using CultreCoat 96 Well BME-Coated Cell Invasion Optimization Assay Kit (TREVIGEN, Gaithersburg, MD) according to manufacturer's protocol. The hFL-HCC, depleted of host mesenchymal cells by magnetic sorting, or the human hepatocellular carcinoma cell line, Huh7 cells, were cultured with serum-free medium for starvation. After 20 hours of serum starvation, cells were collected. Then 2.5?10.sup.4 cells were resuspended in 25 ?l of serum-free Kubota's Medium (hFL-HCC) or serum-free DMEM (HuH7), and seeded into each well of a 96-well culture plates (top chambers). A total of 150 ?l of each culture medium+10% FBS were added to the bottom chambers, and cells were cultured for 24 hours. After washing, cells were dissociated and fluorescently labeled with Cell Dissociation Solution/Calcein AM. After incubation at 37? C. for 1 hour, top chambers were removed and the absorbance at 485 nm excitation, 520 nm emission was measured.
[0242] 1.16. Quantitative reverse transcription and polymerase chain reactions (qRT-PCR). Total RNA was extracted from the cells using RNeasy Micro Kit or RNeasy Mini Kit (Qiagen GmbH, Valencia, CA). First-strand cDNA synthesized using the Primescript 1st strand cDNA synthesis kit (Takara, Otsu, Japan) was used as a template for PCR amplification. Quantitative analyses of mRNA levels were performed using Power SYBR Green PCR Master Mix with Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA). The primers were annealed at 50? C. for 2 min and 95? C. for 10 min, followed by 40 cycles of 95? C. (15 s) and 60? C. (1 min). Expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a control standard. Primer sequences are listed in Table 4.
TABLE-US-00004 TABLE4 PrimersforqRT-PCR Product GenBank Name F/R PrimerSequence length Accession CD44 F TGCCGCTTTGCAGGTGTAT 66 NM_000610.3 R GGCCTCCGTCCGAGAGA CDH1 F TCACAGTCACTGACACCAACGA 67 NM_004360 R GGCACCTGACCCTTGTACGT CFTR F AAAAGGCCAGCGTTGTCTCC 170 NM_000492.3 R TGAAGCCAGCTCTCTATCCCA KRT7 F TGCTGCCTACATGAGCAAGGT 99 NM_005556.3 R TCTGTCAACTCCGTCTCATTGAG KRT18 F GCCCGCTACGCCCTACA 57 NM_000224.2 R TGACTCAAGGTGCAGCAGGAT KRT19 F CCGCGACTACAGCCACTACT 97 NM_002276.4 R GTCGATCTGCAGGACAATCC LGR5 F GAGGATCTGGTGAGCCTGAGAA 151 NM_001277227.1 R CATAAGTGATGCTGGAGCTGGTAA NANOG F AAATCTAAGAGGTGGCAGAAAAACA 60 NM_024865.2 R CTTCTGCGTCACACCATTGC PDX1 F CCCATGGATGAAGTCTACC 262 NM_000209.3 R GTCCTCCTCCTTTTTCCAC POU5F1 F GAGAGGCAACCTGGAGAATTTG 58 NM_001173531.1 R GATCTGCTGCAGTGTGGGTTT PROM1 F TCCACAGAAATTTACCTACATTGG 77 NM_001145851.1 R CAGCAGAGAGCAGATGACCA SOX2 F AAATGGGAGGGGTGCAAAAGAGGAG 112 NM_003106.3 R CAGCTGTCATTTGCTGTGGGTGATG TACSTD1 F GACTTTTGCCGCAGCTCAGGAAG 135 NM_002354.1 R GCCAGCTTTGAGCAAATGACAGTATTTTG GAPDH F AAGGTGAAGGTCGGAGTCAA 108 NM_002046.3 R AATGAAGGGGTCATTGATGG
[0243] 1.17. Cell proliferation and chemo-resistance assays. For cell proliferation assays, 3?10.sup.4 hFL-HCC cells of TU-2010 were depleted of host mesenchymal cells by magnetic sorting of xenotransplantable tumor cell suspension and then were seeded into each well of a 96-well plate and cultured overnight with Kubota's Medium+5% FBS. After 16-20 hours, the specific hedgehog inhibitor Vismodegib (GDC-0449) (Selleckchem Bio, Houston, TX) or the histone deacetylase (HDAC) inhibitors, suberic bis-hydroxamic acid (SBHA) or suberoylanilide hydroxamic acid (SAHA) (SIGMA, St. Louis, MO) were added for 3 days. Cell proliferation was evaluated using the Cell Proliferation Reagent WST-1 (Roche Applied Science, Mannheim, Germany). After incubation at 37? C. for 2 hours, the absorbance at 450 nm was measured.
[0244] 1.18. Spheroid formation assays. For spheroid formation assays, 1?104 hFL-HCC cells of TU-2010, depleted of host mesenchymal cells by magnetic sorting, were seeded into each well of a 6-well plate coated with Ultra-Low Attachment surface (Corning, Lowell, MA) and cultured with serum-free Kubota's Medium in the presence (or absence) of the specific hedgehog inhibitor Vismodegib (GDC-0449) or the HDAC inhibitors, SBHA or SAHA. For secondary spheroid formation assays, the 1st spheroids were collected, subsequently dissociated with NeuroCult Chemical Dissociation Kit (STEMCELL Technologies). Cell suspension was centrifuged at 700 rpm 10 min and resuspended with KM. After 2 weeks, the number of spheroids (100 ?m>) were counted.
[0245] 1.19. Transmission electron microscopy. The hFL-HCC spheroids of Tu-210 were fixed with 3% glutaraldehyde in 0.15M sodium phosphate buffer, pH 7.4, for 1 hour at room temperature and stored at 4? C. until processed. Following three rinses with 0.15 M sodium phosphate buffer, pH 7.4, the samples were post-fixed for 1 hour with 1% osmium tetroxide/1.25% potassium ferrocyanide/0.15M sodium phosphate buffer, pH 7.4, followed by rinses in deionized water. The spheroids were dehydrated using increasing concentrations of ethanol (30%, 50%, 75%, 100%, 100%, 10 min each) and 2 changes of propylene oxide (15 min each). Following infiltration overnight in a 1:1 mixture of propylene oxide/Polybed 812 epoxy resin (Polysciences, Inc.) and 24 hours in 100% resin for 24 hours, the spheroids were embedded in fresh Polybed 812 epoxy resin. The spheroids were sectioned transversely at 70 nm using a diamond knife and a Leica Ultracut UCT microtome (Leica Microsystems, Wetzlar, Germany). Ultrathin sections were mounted on 200 mesh copper grids and stained with 4% aqueous uranyl acetate and Reynolds' lead citrate. The grids were observed at 80 kV using a LEO EM910 transmission electron microscope (Carl Zeiss SMT, LLC). Digital images were taken using a Gatan Orius SC 1000 CCD Camera with DigitalMicrograph 3.11.0 software (Gatan, Inc., Pleasantan, CA.).
[0246] 1.20. RNA-sequencing and gene expression analysis. RNA was purified using Qiagen RNeasy Kit from human adult hepatocytes, hepatoblasts, hepatic stem cells, and biliary tree stem cells, each from three different donors, as well as four FL-HCC tumor samples of passaged TU-2010. In addition, RNA was purified from three cancer stem cell populations of the liver from tumors that are presumptive transformants of: (1) HpSCs, giving rise to hepatocellular carcinoma (HCC); (2) late stage (EpCAM+) BTSCs, giving rise to cholangiocarcinoma (CCA); and (3) primitive BTSCs (EpCAM?, CD44+), giving rise to fibrolamellar carcinoma (FLC). RNA integrity (RIN) analysis was performed using an Agilent 2000 Bioanalyzer. cDNA libraries were generated using the Illumina TruSeq Stranded mRNA preparation kit and sequenced on the Illumina HiSeq 2500 platform. Two samples were sequenced per lane, occupying a total of 8 lanes for all of the samples (one flow cell). Quality control analysis was completed using FastQC, mapping of sequence reads to the human genome (hg19) was performed with MapSplice2 using default parameters, transcript quantification was carried out by RSEM analysis, and DESeq was used to normalize gene expression and identify differentially expressed genes. MapSplice2 was also used to detect candidate fusion transcripts. Fusion calls were based on the depth and complexity of reads spanning candidate fusion junctions. Gene expression profiles were compared using Pearson's correlation analysis and hierarchical clustering was performed in R. Pathway enrichment analysis was performed with the Ingenuity Pathway Analysis (IPA) software.
[0247] Genes were determined to be differentially expressed between cancer types if they had >50 average normalized counts in at least one tumor type, exhibited >2-fold change, and had an adjusted p-value<0.05. Within the 163 genes found to be significantly differentially expressed in FLC compared to HCC or CCA, 16 genes were further identified for which the expression level in all FLC samples was greater than the expression level in 95% of HCC and 95% of CCA samples. The expression of these 16 genes was compared between a FLC patient-derived xenograft (PDX) model and normal biliary tree stem cells that were previously sequenced as described above. For RNA-seq analysis across 24 different tumor types, pre-processed RNA-seq data were downloaded from TCGA and plotted in R.
[0248] 1.21. Normal human biliary tree stem cells (hBTSCs). The biliary tree contains stem cell niches, peribiliary glands (PBGs), mucinous glands scattered as intramural PBGs within the walls of the bile ducts and also found as extramural PBGs that are tethered to the bile ducts. The phenotypes of the cells within the PBGs can be relatively homogeneous in some sites (e.g. hepato-pancreatic common duct and intrahepatic, large bile ducts) and quite heterogeneous in other sites (e.g. cystic duct, common duct, hepatic duct). The pattern of phenotypic traits of the PBG cells was found to implicate maturational lineages in a radial axis from the fibromuscular layer within the duct walls to the lumen of the bile ducts and in a proximal (duodenum)-to-distal axis from the duodenum to either liver or pancreas.
[0249] The PBGs deepest within the bile ducts and near the fibromuscular layer contain the most primitive stem cells, those that co-express transcription factors for both liver and pancreas (e.g. SOX 17, PDX1) and that also co-express multiple pluripotency genes (e.g. OCT4, SOX2, KLF4, NANOG). These cells do not express epithelial cell adhesion molecule (EpCAM) or even LGR5. These are referred to as stage 1 biliary tree stem cells (hBTSCs) They transition to PBGs with cells expressing LGR5 (stage 2 hBTSCs) and then to ones positive for both LGR5 and EpCAM (stage 3 hBTSCs) found at levels that are intermediate within the bile ducts. With transition to the luminal surface of the ducts, there is acquisition of cells with mature phenotypic markers. If the ducts are near or within the liver, the mature markers are those for liver; if they are within the hepato-pancreatic common duct, the mature markers are pancreatic.
[0250] 1.22. Cultures of normal hBTSCs. The stage 1 hBTSCs have not yet been successfully cultured under the conditions tested. These have yet to be observed in culture under the conditions used. Two stages of hBTSCs that have been observed under the conditions used are stage 2 and 3 hBTSCs. See
[0251] A summary of phenotypic traits of biliary tree stem cells versus hepatic stem cells is given in Table 5. They indicate that the lineages of biliary tree stem cells are precursors of hepatic and pancreatic stem cells and are assumed to contribute to organogenesis of liver versus pancreas. A chart of the lineage stages identified is given in
TABLE-US-00005 TABLE 5 Phenotypic Profile of Normal Stem Cells in Liver and Biliary Tree and of Pancreatic Committed Progenitors Versus Human Fibrolamellar Hepatocellular Carcinoma Cells (hFL-HCC) of the TU-2010 tumor line Liver Pancreas Committed hHpSCs Progenitors (in Canals hBTSC Subpopulations (in Pancreatic hFL-HCC Cells Property of Hering) (in peribiliary glands) Duct Glands) of TU-2010 Endodermal SOX 9, SOX 9, SOX 9, SOX 9, PDX1, LGR5 SOX 9, SOX17, markers LGR5, SOX17 SOX17, PDX1 PDX1, LGR5, HNF4A, LGR5 PDX1 LGR5 FOXL1, HNF4A FOXL1 FOXL1 FOXL1 FOXL1 HNF4A HNF4A HNF4A Markers of CK 8 and 18, CK 7 and 19, E-cadherin Epithelia Cell NCAM, NCAM, NCAM NCAM, EpCAM+ NCAM, VCAM, Adhesion EpCAM+ EpCAM+ EpCAM? EpCAM+ EpCAM? Molecules ITGB1 (negligible) (CD29) ITGA6 (CD49f), ITGB4, ITGA6 (CD49f), ITGB1 (CD29) ITGB4, ITGB1 (CD29) Pluri- OCT4, KLF4/KLF5, NANOG, None KLF4/KLF5, potency SALL4, OCT4, SALL4, TROP-2, OCT4, Genes NANOG BMI1 NANOG, SALL4, BMI1 Other Stem CXCR4, CXCR4, CD133; and None CD133, Sonic Cell CD133, Hedgehog proteins (Indian Hedghog, ALDH Markers Hedgehog and Sonic), ALDH proteins (Indian, Sonic), ALDH Protein Laminin, Laminin, Oncostatin M Fetal islets: Laminin, Matrix type III receptor collagens IV, V, Oncostatin M components collagen, VI, Laminin, receptor, CD68 Receptors Oncostatin Nidogen, elastin, M receptor fetal acinar cells: fibrillar collagens, fibronectin GAGs/PGs Minimally Hyaluronans, CD44. Hyaluronans, Hyaluronans, sulfated CD44, fetal islets CD44, CS-PGs, have syndecans Syndecan-1 (HS- Hyaluronans (HS-PG-1 and 3), PG-1) glypicans, fetal acinar cells have CS-PGs Liver-specific Albumin+/?, KRT7, HNF4A None AFP?, HNF4A traits AFP?, HepPar-1+; HNF4A, KRT7 HepPar1+, KRT7, DLK1 Pancreatic- PDX1 PDX1 PDX1, PDX1, NGN3, PDX1, KRT20, specific ISL1, MAFA, MUC6, NGN3 traits NGN3 Nkx6, PTF1a, GLUT2 Multidrug MDR-1, ABCG2 None MDR-1 resistance ABCG2 genes
Experimental Results.
[0252] Endodermal Stem/Progenitor Markers were Expressed in hFL-HCCs.
[0253] Sections from original blocks of 9 hFL-HCC tumors from Memorial Sloan Kettering Cancer Center (MSKCC) were subjected to IHC assays (
[0254] Tissue microarrays (
[0255] A transplantable hFL-HCC tumor line, TU-2010, was established successfully by use of culture-selected endodermal stem/progenitors. A young, male patient was diagnosed with FL-HCC and was subjected to liver surgery and chemotherapies, all of which proved unsuccessful (Table 1). Within 2 years, the tumor had metastasized and generated ascites tumor cells. Approximately 5 liters of ascites fluid were removed from the patient. Cells from one liter were immediately transplanted into immune-compromised mice, but no tumors formed. Cells from the remaining 4 liters were subjected to culture selection in Kubota's Medium (KM) for endodermal stem/progenitors, and 2?10.sup.7 cells were transplanted into nod scid gamma (NSG) mice. Tumor formation occurred after >6 months.
[0256] Passaging of hFL-HCC of TU-2010 was stabilized by supplements and occurred with different kinetics in subcutaneous versus intraperitoneal sites. Tumors were passaged every 3-5 months and stabilized at about 3 months with transplantation of about 10.sup.6 cells in KM supplemented with 1 mg/ml hyaluronans and with 50 ng/ml each of hepatocyte growth factor (HGF) and vascular endothelial cell growth factor (VEGF) (
[0257] Histology of xenografted tumor cells of TU-2010 matched that of the original tumor. The histology of the original tumor (
[0258] The FL-HCC tumors of TU-2010 were comprised primarily of host cells. Mesenchymal cells within tumors were a mix of precursors to stellate cells (desmin+, alpha? smooth muscle actin.sup.+) and endothelia (CD31.sup.+) and comprised, on average, 55-70% of cell suspensions from subcutaneous tumors and >95% of those from intraperitoneal tumors (
[0259] Expression of stem/progenitor markers in TU-2010 cells was confirmed by flow cytometry. Immunoselected hFL-HCCs, depleted of murine cells, were characterized by multiparametric flow cytometry (
[0260] The hFL-HCCs of TU-2010 were rich in cancer stem cells (CSCs) as indicated functionally by limiting dilution tumorigenicity assays. Cell suspensions were depleted of murine cells and transplanted subcutaneously into NSG mice in tumorigenicity assays from 100 to 10.sup.6 cells and monitored for up to 8 months for tumors. Transplantation of 10.sup.5 or more cells resulted in 100% of the mice developing tumors within about 3 months; 10.sup.3-10.sup.4 cells within 5-6 months; and 100 cells in all mice but requiring up to 9 months (
[0261] Xenografted hFL-HCCs of TU-2010 expressed endodermal stem/progenitor markers that collectively suggest derivation from biliary tree stem cells (hBTSCs). Sections of xenografted hFL-HCCs were subjected to IHC assays (
[0262] Other markers (
[0263] The hFL-HCC cells of TU-2010 in culture behaved similarly to normal hBTSCs. That hFL-HCC cells derive from stage-2-hBTSCs was supported further by their behavior in monolayer (
[0264] If plated overnight with 2-5% fetal bovine serum (FBS) and then switched to serum-free KM (
[0265] Colony morphologies of hFL-HCCs of TU-2010 were similar to those of stage-2-hBTSCs (
[0266] Assays for drug effects on monolayer cultures (
[0267] TU-2010 Spheroids, indicative of self-replicative ability and, therefore, of CSCs, formed in KM. Spheroid formation required that serum-free KM be used throughout, including for plating of cells; spheroids proved able to be passaged for months (
[0268] Differentiation media, used to lineage restrict normal hBTSCs to adult fates, caused hFL-HCCs of TU-2010 to lose stemness traits. Serum-free, hormonally defined media (HDM), established previously for lineage restriction of hBTSCs to hepatocytes (HDM-H), cholangiocytes (HDM-C) or pancreatic islets (HDM-P), were used to differentiate hFL-HCCs. Cells were monitored for morphological (
[0269] Transcriptomic analyses revealed that hFL-HCCs of TU-2010 most closely resemble hBTSCs. Paired-end high-throughput RNA sequencing was conducted in purified populations of adult human hepatocytes (hAHEPs), hHBs, hHpSCs, and hBTSCs, each from three different donors, as well as four hFL-HCCs from different passaged lines of the transplantable tumor (
[0270] Unique features of hFL-HCCs of TU-2010 (
[0271] Expression data are shown for representative stem/progenitor, hepatocytic, biliary, and pancreatic genes (
[0272] Finally, RNA-seq data were further analyzed using MapSplice2 and detected with high confidence a recurrent fusion transcript unique to hFL-HCCs, DNAJB1-PRKACA, for which Sashimi plots are shown in
[0273] Transcriptomic analyses revealed unique molecular signature of hFL-HCCs and candidate therapeutic targets. To further examine the molecular characteristics of hFL-HCCs, the The Cancer Genome Atlas (TCGA) liver cancer database was mined for hFL-HCCs. Based on the presence of DNAJB1-PRKACA and/or classic histological features, 7 hFL-HCC samples were identified, four of which were incorrectly annotated by TCGA as HCCs. The gene expression profiles of these 7 hFL-HCCs clustered most closely with each other and were clearly distinct from HCCs (n=262) and CCAs (n=36). Expression levels of previously suggested RNA markers of hFL-HCC were analyzed (e.g. AGR2, KRT7, and NTS), and it was found that, with the exception of PCSK1 and DNAJB1-PRKACA, none appear to uniquely mark hFL-HCC relative to HCCs, CCAs, normal livers (n=50), or normal cholangiocytes (n=9) and thus may not be clinically actionable (Data not shown).
[0274] Therefore, a comprehensive transcriptomic analysis was performed and identified a suite of 165 genes that were significantly altered in hFL-HCCs relative to HCCs and CCAs (
Gene Ontology Molecular Function Analysis to Identify Network Hub Proteins for Targeted hFL-HCC Therapeutics
[0275] Identifying the protein networks involved in the molecular signature of hFL-HCCs could not only help it providing potential mechanisms of action but could also help to identify additional candidate therapeutic targets. It is contemplated that by controlling upstream or downstream targets of the genes of the hFL-HCC signature, one may be able to better treat hFL-HCC.
[0276] Gene ontology molecular function analyses were performed and revealed that the 165 hFL-HCC specific genes are enriched in kinase activity, growth factor binding, and cAMP (cyclic adenosine monophosphate) binding, suggesting potential mechanisms of action.
[0277] Protein-Protein Interaction (PPI) Hub Protein analysis showed PRKACA and sarcoma (SRC) gene may function as network hubs in hFL-HCCs. Additional proteins in these hubs include, for example, tyrosine kinase with immunoglobulin-like and EGF-like domains 1 (TIE1); G protein-coupled receptor kinase 1 (GRK1); catenin beta-1 (CTNNB1); caveolin-1 (CAV1); protein kinase c alpha (PRKCA); protein tyrosine phosphotase, non-receptor type 11 (PTPN11); Src homology 2 domain containing transforming protein 1 (SHC1); phospholipase C, gamma 1 (PLCG1); V-crk avian sarcoma virus CT10 oncogene homolog (CRK); and phosphoinositide-3-kinase, regulatory subunit 1 (PIK3R1).
DISCUSSION
[0278] Phenotypic properties of hFL-HCCs, rare liver cancers, derive in part from their richness in CSCs (over 60% in the transplantable tumor line) and their origins from hBTSCs, precursors to liver and pancreas. These findings provide clarifications for hFL-HCCs' hepatic, cholangiocytic, and endocrine markers, as well as intestinal traits, and for why the 5-year survival is only 45%, the overall mortality is 60%, and half the patients have metastases at the point of diagnosis.
[0279] The hFL-HCCs have increased in frequency from an unrecognized liver cancer in the 1970s to about 5% of all liver cancers today. As yet, there is no explanation for this increase. Nor is it understood why patients are primarily children to young adults, and more rarely, middle-aged adults, with no prior history of liver disease. The findings of remarkably high levels of AHR receptors in hFL-HCCs and in hBTSCs, in combination with prior report that dioxins preferentially affect stem cells, provides clues about the possible aetiological factors of hFL-HCCs. AHR agonists emerged as environmental factors from the plastic industries since World War II, correlating with increased incidence of hFL-HCCs.
[0280] The properties of hFL-HCCs implicate origins from biliary tree stem cells, precursors to liver and pancreas and located in peribiliary glands (PBGs) and in crypts at the base of villi within gallbladders. Lineage tracing studies in mammals and zebra fish indicate that the biliary tree is a major reservoir of stem/progenitors contributing to liver organogenesis and, as determined recently, pancreatic organogenesis.
[0281] Early stages of malignant transformation of hBTSCs within PBGs have been described. PBGs replete with EpCAM-negative hBTSCs are found in PBGs near the fibromuscular layers throughout the biliary tree, including in the large intrahepatic bile ducts.
[0282] IHCs and histology provided evidence for the relationship of hFL-HCCs to endodermal stem/progenitors. Histology demonstrated the typical bands of stroma surrounding clumps of large tumor cells having prominent nuclei and aberrations in mitochondria. Co-expression was found for stem/progenitor markers (NANOG, OCT4, SALL4, SHH) and endodermal transcription factors (SOX9, SOX17). The hFL-HCCs expressed some hepatic traits (e.g., HNF4, HepPar-1), and the remainder expressed pancreatic traits (e.g., PDX1, PCSK1) or both.
[0283] More extensive analyses were made possible by establishment of the first-ever model of hFL-HCCs, TU-2010, a transplantable tumor line maintained in NSG mice. Prior efforts to produce hFL-HCC tumor lines (or cell lines) failed, including those with the ascites tumor cells able to generate a tumor line for these studies. Success proved dependent on culture selection in Kubota's Medium, a serum-free medium designed for endodermal stem/progenitors and not permissive for survival of later maturational lineage stages. The speed of passaging was enhanced with supplements, particularly hyaluronans, HGF and VEGF.
[0284] Striking features of the transplantable tumor line, TU-2010, were its desmoplastic traits. Although high levels of tumor stroma occur in HCCs and in CCAs, the transplantable hFL-HCC line, TU-2010 generated subcutaneous tumors comprised of 55-70% host stroma and intraperitoneal ones with more than 95% host stroma. Immunoselection to remove host cells resulted in tumor cells readily cultured as spheroids and with phenotypic traits consistently expressed even after years of passaging in NSG mice (
[0285] Phenotypic analyses of hFL-HCCs from TU-2010, after removal of host cells, were consistent with those from primary tumors and indicated a relationship to hBTSCs. The tumor line, TU-2010, is strikingly rich in cancer stem cells (CSCs; >65% CSCs based on proportion of LGR5+ cells), a unique finding given that the average percentage of CSCs in HCCs is about 0.5-3%, and that in CCAs is about 10-20%. The richness of CSCs in hFL-HCCs was demonstrated functionally by their ability to form tumors in 100% of the mice with as few as 100 cells and by the relative ease with which they formed spheroids or organoids in culture.
[0286] The TEM studies on the spheroids from TU-2010 revealed many noteworthy features, but perhaps the most striking were the electron-dense granules and the extraordinary numbers of mitochondria with abnormal cristae, a condition typical of certain cancers. This suggests that the mitochondria generated ATP by oxidative phosphorylation and made the cells tolerant of hypoxia. An oncocytic condition with such pleomorphic mitochondria is not known to be associated with HCCs but with pancreatic cancers. The secretory granules could contain factors responsible for the ability of hFL-HCCs to dissolve every type of matrix tested as substratum.
[0287] The strongest evidence of hBTSCs as the origins of hFL-HCCs derives from RNA-seq studies, which includes analyses of genes across successive lineage stages from hBTSCs to hHpSCs to hHBs to adult hepatocytes. The global transcriptome-wide analyses indicate that hFL-HCCs from TU-2010 much more closely resemble hBTSCs than the other lineage stages analyzed. Also, the RNA-seq analyses independently confirmed that hFL-HCCs uniquely express the DNAJB1-PRKACA chimera, a fusion gene coupling the catalytic site of protein kinase A (PKA) and a heat shock protein, resulting in stable activation of PKA.
[0288] Genetic analyses have identified unique patterns of claudins, tricellin, CD68, and other biomarkers, ones distinct from those in other liver cancers. Earlier studies also indicated that hFL-HCCs have Mosaic G-protein alpha-subunit (GNAS)-activating mutations, characterized by STAT3 activation, EGF receptor levels higher than in other types of hepatic tumors, and no K-RAS mutations.
[0289] The resistance of hFL-HCCs to chemotherapies is predictable, given the cells' expression of multidrug resistance genes. Their renowned aggressiveness in patients and in immune-compromised hosts correlates with expression of multiple genes, including adhesion molecules (E-cadherin, VCAM-1), matrix receptors (CD44), and syndecan-1 (HS-PG), known for binding FGFs, VEGFs, and other growth factors and presenting them as potent mitogens.
[0290] The findings that HDAC and hedgehog inhibitors are potent suppressors of growth and survival of hFL-HCCs from TU-2010 indicate new therapeutic options. Similar effects were previously observed with hedgehog inhibitors on normal stem cells, a finding complemented by parallels in expression of hedgehog genes in hFL-HCC versus hBTSCs. By contrast, expression patterns of HDAC genes are distinct in hFL-HCCs versus other parenchymal lineage stages. An intriguing finding is the complete loss of HDAC9 in hFL-HCC.
[0291] The TU-2010 tumor's richness in CSCs, the probable origins from biliary tree stem cells, the finding that AHR agonists could be etiological factors in the cancer, and the transplantable tumor line described herein offer novel diagnostic and therapeutic options, ones much needed for this devastating liver cancer.
[0292] The discovery of unique molecular signatures for hFL-HCCs will aid in early detection and identification of appropriate therapeutic regimens. In addition to conventional treatment options, these findings suggest several novel candidate therapeutic options. In particular, small molecule inhibitors of CA12 may be used to suppress cancer growth and are currently in preclinical development. In addition, because aberrant miR-10b regulatory activity may contribute to hFL-HCCs pathogenesis, miR-10b and its target genes may be candidate therapeutic targets. Locked nucleic acids (LNAs) may also be useful for potent inhibition of miRNAs and other genes. LNAs have been developed for both research and therapeutic use. Finally, immunotherapies may be novel candidate therapeutics for treating hFL-HCCs.
[0293] In the foregoing description, it will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. The invention illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations, which is not specifically disclosed herein. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention. Thus, it should be understood that although the present invention has been illustrated by specific embodiments and optional features, modification and/or variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scopes of this invention.
[0294] Para. A. A transplantable tumor line of human fibrolamellar hepatocellular carcinoma (hFL-HCC) cells maintained in a non-human animal.
[0295] Para. B. The transplantable tumor line of Para A, wherein the non-human animal is immunocompromised.
[0296] Para. C. The transplantable tumor line of Paras. A or B, wherein the non-human animal is a mouse.
[0297] Para. D. The transplantable tumor line of any one Paras. A-C, wherein the non-human animal is a NOD scid gamma (NSG) mouse.
[0298] Para. E. The transplantable tumor line any one Paras. A-D, wherein the hFL-HCC cells are derived from a tumor removed from the liver, from the biliary tree, from a subcutaneous tumor or from an intraperitoneal (ascites) tumor.
[0299] Para. F. The transplantable tumor line of any one of Paras A-E, wherein the tumor line comprises hFL-HCC cells and mesenchymal cells of the non-human animal.
[0300] Para. G. The transplantable tumor line of any one Paras. A-F, wherein at least 50% of the hFL-HCC cells in the transplantable tumor are cancer stem cells.
[0301] Para. H. The transplantable tumor line of any one of Paras. A-G, where the mesenchymal cells are derived from the non-human animal.
[0302] Para. I. The transplantable tumor line of any one of Paras. A-H, wherein the human FL-HCC cells express the fusion transcript DNAJB1-PRKACA.
[0303] Para. J. The transplantable tumor of any one of Paras. A-I, wherein the hFL-HCC cells substantially do not express HDAC9 or express a lower level of HDAC9 as compared to a human non-FL-HCC cell control sample.
[0304] Para. K. The transplantable tumor line of any one of Paras. A-J, wherein the hFL-HCC cells express one or more markers of endodermal transcription factors selected from the group consisting of SOX9, SOX17, PDX1, FOXA1, and NGN3.
[0305] Para. L. The transplantable tumor line of any one of Paras. A-K, wherein the hFL-HCC cells express one or more markers of pluripotency genes selected from the group consisting of OCT4, SOX2, NANOG, SALL4, KLF4, and KLF5.
[0306] Para. M. The transplantable tumor of any one of Paras. A-L, wherein the hFL-HCC cells express one or more markers of other stem cell genes selected from the group consisting of CD44, SALL4, TROP-2, BMI-1, sonic hedgehog (SHH), LGR5, NCAM, and KRT20.
[0307] Para. N. The transplantable tumor line of any one of Paras. A-M, wherein the hFL-HCC cells express one or more hepatic markers selected from the group consisting of CK8, CK18, CK19, DCLK1, HepPar-1, albumin, alpha-fetoprotein, and CD68.
[0308] Para. O. The transplantable tumor line of any one of Paras. A-N, wherein the hFL-HCC cells express one or more pancreatic markers selected from PDX1, PCSK1, NGN3, insulin, glucagon, amylase, and mucin (MUC).
[0309] Para. P. The transplantable tumor line of any one of Paras. A-O, wherein the hFL-HCC cells express high levels of aryl hydrocarbon receptors (AHR).
[0310] Para. Q. The transplantable tumor line of any one of Paras. A-P, wherein the hFL-HCC cells express biomarkers of malignancy such as AGR2 and/or high levels of extracellular matrix-degrading enzymes and/or aberrations in the regulation of p53.
[0311] Para. R. The transplantable tumor line of any one of Paras. A-Q, wherein the hFL-HCC cells have aberrant or lack of expression of one or more histone deacetylase (HDAC) genes.
[0312] Para. S. A transplantable tumor line comprising human FL-HCC (hFL-HCC) cells and mesenchymal cells from a non-human host.
[0313] Para. T. The tumor line of Para. S, wherein the non-human host is an immunocompromised mouse.
[0314] Para. U. The tumor line of Para. S or T, wherein the non-human host is a NOD scid gamma mouse
[0315] Para. V. The tumor line of Para. S, which is a xenotransplanted, subcutaneous or intraperitoneal tumor.
[0316] Para. W. The tumor line of Para. S, wherein at least 30% of the hFL-HCC cells are cancer stem cells
[0317] Para. X. The tumor line of Para. S, wherein at least 50% of the hFL-HCC cells are cancer stem cells.
[0318] Para. Y. The tumor line of Para. S, wherein at least 65% of the hFL-HCC cells are cancer stem cells.
[0319] Para. Z. The tumor line of any one of Paras. S-Y, wherein the hFL-HCC cells express the fusion transcript DNAJB1-PRKACA.
[0320] Para. AA. The tumor line of any one of Paras. S-Z, wherein the hFL-HCC cells substantially do not express or express low levels of HDAC9 or express a lower level of HDAC9 as compared to a human non-FL-HCC cell control sample.
[0321] Para. AB. The tumor line of any one of Paras. S-AA, wherein the hFL-HCC cells express one or more markers of endodermal transcription factors selected from the group consisting of SOX9, SOX17, PDX1, FOXA1, and NGN3.
[0322] Para. AC. The tumor line of any one of Paras. S-AB, wherein the hFL-HCC cells express one or more markers of pluripotency genes selected from the group consisting of OCT4, SOX2, NANOG, SALL4, KLF4, and KLF5.
[0323] Para. AD. The tumor line of any one of Paras. S-AC, wherein the hFL-HCC cells express one or more markers of other stem cell genes selected from the group consisting of CD44, SALL4, TROP-2, BMI-1, sonic hedgehog (SHH), LGR5, NCAM, and KRT20.
[0324] Para. AE. The tumor line of any one of Paras. S-AD, wherein the human FL-HCC cells express one or more hepatic markers selected from the group consisting of CK7, CK8, CK18, CK19, DCLK1, HepPar-1, albumin, alpha-fetoprotein, and CD68.
[0325] Para. AF. The tumor line of any one of Paras. S-AE, wherein the hFL-HCC cells express one or more pancreatic markers selected from the group consisting of PDX1, PCSK1, NGN3, insulin, glucagon, amylase, and mucin (MUC).
[0326] Para. AG. The tumor line of any one of Paras. S-AF, wherein the hFL-HCC cells express high levels of aryl hydrocarbon receptors (AHR).
[0327] Para. AH. The tumor line of any one of Paras. S-AG, wherein the hFL-HCC cells express biomarkers of malignancy such as AGR2 and/or high levels of extracellular matrix-degrading enzymes.
[0328] Para. AI. The tumor line of any one of Paras. S-AH, wherein the human FL-HCC cells have aberrant or lack of expression of one or more histone deacetylase (HDAC) genes.
[0329] Para. AJ. A tissue sample obtained from the tumor line of any one of Paras. R-AI.
[0330] Para. AK. A cell culture comprising hFL-HCC cells in a serum-free medium.
[0331] Para. AL. The cell culture of Para. AK, wherein the serum-free medium is Kubota's Medium.
[0332] Para. AM. The cell culture of Para. AK or AL, wherein the serum-free medium contains hyaluronans, HGF and/or VEGF.
[0333] Para. AN. The cell culture of any one of Paras. AK-AM, wherein at least 51% of the cells in the cell culture are hFL-HCC cells.
[0334] Para. AO. The cell culture of any one of Paras. AK-AN, wherein at least 50% of the hFL-HCC cells in the cell culture are cancer stem cells.
[0335] Para. AP. The cell culture of any one of Paras. AK-AO, wherein at least a portion of the hFL-HCC cells are in aggregates of hFL-HCC cells.
[0336] Para. AQ. The cell culture of any one of Paras. AK-AP, wherein the hFL-HCC cells express fusion transcript DNAJB1-PRKACA.
[0337] Para. AR. The cell culture of any one of Paras. AK-AQ, wherein the hFL-HCC cells substantially do not express HDAC9 or express a lower level of HDAC9 as compared to a human non-FL-HCC cell control sample.
[0338] Para. AS. The cell culture of any one of Paras. AK-AR, wherein the hFL-HCC cells express one or more endodermal transcription factors selected from the group consisting of SOX9, SOX17, PDX1, and NGN3.
[0339] Para. AT. The cell culture of any one of Paras. AK-AS, wherein the hFL-HCC cells express one or more pluripotency genes selected from the group consisting of SOX2, NANOG, SALL4, OCT4, KLF4, and KLF5.
[0340] Para. AU. The cell culture of any one of Paras. AK-AT, wherein the hFL-HCC cells express one or more stem cell genes selected from TROP-2, SALL4, BMI-1, LGR5, sonic hedgehog (SHH), NCAM.
[0341] Para. AV. The cell culture of any one of Paras. AK-AU, wherein the hFL-HCC cells express one or more hepatic markers selected from the group consisting of CK7, CK8, CK18 CK19, HepPar-1, albumin, alpha-fetoprotein, LGR5, and CD68.
[0342] Para. AW. The cell culture of any one of Paras. AK-AV, wherein the hFL-HCC cells express one or more pancreatic markers selected from the group consisting of PDX1, NGN3, PCSK1, insulin, glucagon, amylase, and mucin (MUC).
[0343] Para. AX. A method for establishing a hFL-HCC tumor line comprising: (a) obtaining a human FL-HCC tumor from a patient with hFL-HCC; (b) preparing a tumor cell suspension from the hFL-HCC tumor; (c) culturing the tumor cell suspension under restrictive conditions that select for cancer stem cells to obtain a population of culture-selected cancer stem cells; and (d) transplanting culture-selected cells into an immunocompromised, non-human animal
[0344] Para. AY. The method of Para. AX, in which the hFL-HCC tumor is obtained as an ascites fluid or as a solid tumor from the subject.
[0345] Para. AZ. The method of Para. AX or AY, wherein the tumor cell suspension from the hFL-HCC tumor are cultured on tissue culture plastic or on or in hyaluronans.
[0346] Para. BA. The method of any one of Paras. AX-AZ, wherein the tumor cell suspension from the hFL-HCC tumor are cultured in serum-free Kubota's Medium.
[0347] Para. BB. The method of any one of Paras. AX-BA, comprising at step (d) transplanting subcutaneously or intraperitoneally the culture-selected cancer stem cells from the hFL-HCC cells into the immunocompromised non-human animal.
[0348] Para. BC. The method of any one of Paras. AX-BB, comprising at step (d) transplanting about 10.sup.2 to about 10.sup.7 culture-selected cancer stem cells from the hFL-HCC tumor into the immunocompromised, non-human animal.
[0349] Para. BD. The method of any one of Paras. AX-BC, further comprising after step (d) monitoring the immunocompromised, non-human animal for tumor formation for about 2 to about 9 months.
[0350] Para. BE. A method for maintaining a hFL-HCC transplantable tumor line comprising: (a) obtaining hFL-HCC cells from a xenografted tumor of a maintained in an immunocompromised non-human animal, (b) dispersing the hFL-HCC cells into a cell suspension by enzymatic and/or mechanical methods, and (c) transplanting dispersed hFL-HCC cells into a second immunocompromised, non-human animal.
[0351] Para. BF. The method of Para. BE, comprising culturing the hFL-HCC cells in serum-free medium.
[0352] Para. BG. The method of Para. BF, wherein the serum-free medium is Kubota's Medium.
[0353] Para. BH. The method of Para. BE, wherein the serum-free medium further contains hyaluronans, HGF and/or VEGF.
[0354] Para. BI. The method of any one of Paras. BE-BH comprising, at step (c) transplanting subcutaneously or intraperitoneally the hFL-HCC tumor into the second immunocompromised, non-human animal.
[0355] Para. BJ. A method for culturing hFL-HCC cells comprising: (a) separating hFL-HCC cells of a xenografted tumor from non-human cells; (b) suspending the separated hFL-HCC cells in a serum-free medium, and (c) plating the hFL-HCC cells as monolayers onto or into a culture substratum to obtain plated hFL-HCC cells or allowing the cells to form floating aggregates.
[0356] Para. BK. The method of Para. BJ, comprising at step (c) separating hFL-HCC cells from non-human cells by magnetic immunoselection.
[0357] Para. BL. The method of Para. BJ, wherein the culture substratum is a tissue culture plastic, a surface coated with a purified extracellular matrix component or with an extract enriched in extracellular matrix, a 3D hydrogel of a purified extracellular matrix component, or a suspension.
[0358] Para. BM. The method of Para. BL, wherein the purified extracellular matrix component is selected from the group consisting of hyaluronan, a collagen, an adhesion molecule, and an extract enriched in extracellular matrix.
[0359] Para. BN. The method of Para. BM, wherein the adhesion molecule is laminin.
[0360] Para. BO. The method of Para. BM, wherein the extract enriched in extracellular matrix is a matrix scaffold, a biomatrix scaffold, or Matrigel.
[0361] Para. BP. The method of Para. BJ, wherein the plated hFL-HCC cells are kept in suspension and allowed to form aggregates.
[0362] Para. BQ. A method for drug screening, comprising (a) introducing a candidate drug to cultured hFL-HCC cells that are in the form of monolayers, hydrogels, spheroids or organoids, and (b) monitoring the effect of the candidate drug on the cultured hFL-HCC cells.
[0363] Para. BR. A method for drug testing, comprising (a) administering a candidate drug to a non-human animal carrying a transplanted hFL-HCC tumor and (b) monitoring the effect of the candidate drug on the xenotransplanted hFL-HCC tumor.
[0364] Para. BS. A method for suppressing the growth of hFL-HCC cells, comprising treating the hFL-HCC cells with a hedgehog signaling inhibitor, a histone deacetylase inhibitor, a protein kinase inhibitor, and/or an inhibitor of a gene overexpressed in hFL-HCC cells.
[0365] Para. BT. The method of Para. BS, wherein the hedgehog signaling pathway inhibitor comprises GDC-0449.
[0366] Para. BU. The method of Para. BS, wherein the histone deacetylase inhibitor comprises suberoylanilide hydroxamic acid (SAHA) and/or suberic bis-hydroxamic acid (SBHA)
[0367] Para. BV. A method for treating hFL-HCC in a patient in need thereof, comprising administering to the patient an effective amount of a hedgehog signaling pathway inhibitor, a histone deacetylase inhibitor, a protein kinase inhibitor, and/or an inhibitor of a gene overexpressed in hFL-HCC cells.
[0368] Para. BW. The method of Para. BV, wherein the hedgehog signaling pathway inhibitor comprises GDC-0449
[0369] Para. BX. The method of Para. BX, wherein the histone deacetylase inhibitor comprises SAHA and/or SBHA.
[0370] Para. BY. A method of determining whether a patient has fibrolamellar hepatocellular carcinoma (FL-HCC), comprising: (a) measuring gene expression levels of at least one of C10orf128, CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3, PCSK1, PHACTR2, RPS6KA2, SLC16A14, TMEM163, and TNRC6C; and (b) comparing the gene expression profile to one or more control samples.
[0371] Para. BZ. The method of Para. BY, wherein overexpression of C10orf128, CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3, PCSK1, PHACTR2, RPS6KA2, SLC16A14, TMEM163 or TNRC6C relative to the control sample is associated with presence of FL-HCC.
[0372] Para. CA. The method of Para. BZ, wherein overexpression of PCSK1, CA12, NOVA1, SLC16A14, TNRC6C, TMEM163, and RPS6KA2 relative to the control sample is associated with presence of FL-HCC.
[0373] Para. CB. The method of Para. BZ, wherein overexpression of C10orf128, OAT, PAK3, PCSK1, PHACTR2, SLC16A14, TMEM163, and TNRC6C relative to the control sample is associated with presence of FL-HCC.
[0374] Para. CC. The method of any one of Paras. BZ-CB, wherein the control sample is selected from the tumor cells from hepatocellular carcinomas (HCCs), hepatoblastomas, cholangiocarcinomas (CCAs) and/or pancreatic cancers or selected from normal cells consisting of biliary tree stem cells, hepatic stem cells, hepatoblasts, pancreatic stem cells, hepatic or pancreatic committed progenitors, and normal mature hepatic or pancreatic cells.
[0375] Para. CD. A method of treating a patient determined to have hFL-HCC by administering to the patient an effective amount of at least one therapeutic that decreases expression of at least one of C10orf128, CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3, PCSK1, PHACTR2, RPS6KA2, SLC16A14, TMEM163, or TNRC6C.
[0376] Para. CE. The method of Para. CD, wherein the at least one therapeutic is selected from the group consisting of a small molecule, RNA interference, and a locked nucleic acid (LNA).
[0377] Para. CF. A method of treating a patient determined to have hFL-HCC by administering to the patient an effective amount of an immunotherapy.
[0378] Para. CG. A method of treating a patient determined to have hFL-HCC by administering to the patient an effective amount of at least one therapeutic that regulates PRKACA or SRC network hubs.
[0379] Para. CH. A method of treating a patient determined to have hFL-HCC by administering to the patient an effective amount of at least one therapeutic that regulates substrate targets of the kinase PRKACA (Protein kinase A catalytic subunit alpha).
[0380] Para. CI. An isolated hFL-HCC cell wherein the hFL-HCC cell expresses a marker selected from the group consisting of C10orf128, CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3, PCSK1, PHACTR2, RPS6KA2, SLC16A14, TMEM163, and TNRC6C.
[0381] Para. CJ. A population of isolated hFL-HCC cells of Para. CI.
[0382] Para. CK. A composition comprising an isolated hFL-HCC cell of Para. CI or CJ and a carrier.
[0383] Para. CL. The composition of any one of Paras. CI-CK, wherein the hFL-HCC cells are obtained from ascites fluid or a solid tumor.
[0384] Para. CM. The composition of any one of Paras. CI-CL, wherein the hFL-HCC cells are cultured on tissue culture plastic or on or in hyaluronans.
[0385] Para. CN. The composition of any one of Paras. CI-CM, wherein the hFL-HCC cells are cultured in cells in serum-free medium.
[0386] Para. CO. The composition of any one of Paras. CI-CN, wherein the serum-free medium is Kubota's Medium.
[0387] Para. CP. The composition of Paras. CI-CO, wherein the serum-free medium further contains hyaluronans, HGF and/or VEGF.
[0388] Para. CQ. The composition of any one of Paras. CI-CP, further comprising purified extracellular matrix component.
[0389] Para. CR. The composition of Para. CQ, wherein the purified extracellular matrix component is selected from the group consisting of hyaluronan, a collagen, an adhesion molecule, and an extract enriched in extracellular matrix.
[0390] Para. CS. The composition of Para. CR, wherein the adhesion molecule is laminin.
[0391] Para. CT. The composition of Para. CR, wherein the extract enriched in extracellular matrix is a matrix scaffold, a biomatrix scaffold, or Matrigel.
[0392] Para. CU. A transplantable tumor cell line comprising human fibrolamellar hepatocellular carcinoma (hFL-HCC) cells, which can be maintained in a non-human animal.