BACILLUS SUBTILIS GENETICALLY ENGINEERED BACTERIUM FOR PRODUCING TAGATOSE AND METHOD FOR PREPARING TAGATOSE

20240254527 ยท 2024-08-01

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided are a Bacillus subtilis genetically engineered bacterium for producing tagatose and a method for preparing tagatose. The genetically engineered bacterium comprises constructing thermostable ?-glucan phosphorylases, thermostable glucose phosphomutases, thermostable glucose phosphate isomerases, thermostable 6-tagatose phosphate epimerases, and thermostable 6-tagatose phosphate phosphatases which are independently expressed or co-expressed. The usage of the genetically engineered bacterium can effectively convert starch into tagatose. Compared with existing methods for producing tagatose, the method has advantages such as suitability for whole-cell recycling, high safety, high yield, simple production process, low cost, and easiness in large-scale preparation.

    Claims

    1. A Bacillus subtilis genetically engineered bacterium for producing tagatose, characterized in that said genetically engineered bacterium is a Bacillus subtilis genetically engineered bacterium co-expressing an ?-glucan phosphorylase gene, a glucose phosphomutase gene, a glucose phosphate isomerase gene, a 6-tagatose phosphate epimerase gene, and a 6-tagatose phosphate phosphatase gene, or a mixture of Bacillus subtilis genetically engineered bacteria respectively expressing an ?-glucan phosphorylase gene, a glucose phosphomutase gene, a glucose phosphate isomerase gene, a 6-tagatose phosphate epimerase gene, and a 6-tagatose phosphate phosphatase gene.

    2. The genetically engineered bacterium according to claim 1, characterized in that a starting strain of said Bacillus subtilis is a protease-knockout strain of Bacillus subtilis strain.

    3. The genetically engineered bacterium according to claim 1, characterized in that said genetically engineered bacterium comprises an expression vector co-expressing ?-glucan phosphorylase, glucose phosphomutase, glucose phosphate isomerase, 6-tagatose phosphate epimerase, and 6-tagatose phosphate phosphatase, or said genetically engineered bacterium is a mixture of a genetically engineered bacterium comprising an expression vector for ?-glucan phosphorylase, a genetically engineered bacterium comprising an expression vector for glucose phosphomutase, a genetically engineered bacterium comprising an expression vector for glucose phosphate isomerase, a genetically engineered bacterium comprising an expression vector for 6-tagatose phosphate epimerase and a genetically engineered bacterium comprising an expression vector for 6-tagatose phosphate phosphatase.

    4. The genetically engineered bacterium according to claim 1, characterized in that said ?-glucan phosphorylase, glucose phosphomutase, glucose phosphate isomerase, 6-tagatose phosphate epimerase, and 6-tagatose phosphate phosphatase are respectively thermostable ?-glucan phosphorylase, thermostable glucose phosphomutase, thermostable glucose phosphate isomerase, thermostable 6-tagatose phosphate epimerase, and thermostable 6-tagatose phosphate phosphatase.

    5. (canceled)

    6. The genetically engineered bacterium according to claim 1, characterized in that endogenous uracil phosphoribosyltransferase gene, ?-amylase gene, sporulating RNA polymerase of factor gene, and surface-active peptide synthase subunit 3 gene are all inactivated or knocked out in said genetically engineered bacterium.

    7. An expression vector, characterized in that it comprises an ?-glucan phosphorylase gene, a glucose phosphomutase gene, a glucose phosphate isomerase gene, a 6-tagatose phosphate epimerase gene, and a 6-tagatose phosphate phosphatase gene and is capable of co-expressing these genes.

    8. A method for producing tagatose by utilizing a whole cell of the genetically engineered bacterium according to claim 1, to catalyze starch, comprising the steps of (1) fermenting said Bacillus subtilis genetically engineered bacterium to obtain whole cells; (2) subjecting the whole cells of Bacillus subtilis obtained in step (1) to a cell membrane permeability treatment to obtain permeable whole cells; (3) catalyzing starch by utilizing the permeable whole cells obtained in step (2) to produce tagatose, wherein for co-expressing whole cells of Bacillus subtilis engineered bacterium, the whole cells are used directly for catalysis, and for whole cells of Bacillus subtilis engineered bacterium expressing various enzymes separately, the whole cells are mixed for catalysis.

    9. The method according to claim 8, characterized in further comprising immobilizing the Bacillus subtilis permeable whole cells obtained in step (2) to obtain immobilized whole cells, or a mixture of immobilized whole cells, which can then be used for catalysis.

    10. The method according to claim 8, characterized in that the preparation of whole cells of said step (1) is obtained by means of a fermentation method suitable for expression of exogenous protein.

    11. The method according to claim 8, characterized in that the cell membrane permeability treatment of said step (2) is obtained by heat treatment, addition of organic solvents and/or addition of surfactant treatment.

    12. The method according to claim 11, characterized in that said organic solvent is selected from acetone, acetonitrile; said surfactant is selected from cetyl trimethyl ammonium bromide, Tween-80.

    13. The method according to claim 11, characterized in that said heat treatment is carried out at a temperature of 45 to 100? C. and a heat treatment time of 10 to 100 min; and cell concentration at the time of treatment is OD.sub.600=10 to 300.

    14. The method according to claim 13, characterized in that said heat treatment is carried out at a temperature of 70 to 80? C. and a heat treatment time of 50 to 70 min; and cell concentration at the time of treatment is OD.sub.600=30 to 150.

    15. The method according to claim 11, characterized in that said heat treatment is carried out in a buffer selected from HEPES buffer, phosphate buffer, Tris buffer, and acetate buffer.

    16. The method according to claim 8, characterized in that concentration of the substrate starch in the reaction system catalyzed in step (3) is 50 to 300 g/L; reaction conditions are: 0.5 to 96 h at pH 5.0 to 8.0 and 40 to 80? C.

    17. The method according to claim 16, characterized in that concentration of the substrate starch in the reaction system catalyzed in step (3) is 100 to 200 g/L; reaction conditions are: 12 to 60 h at pH 6.5 to 7.5 and 45 to 75? C.

    18. The method according to claim 8, characterized in that the reaction catalyzed in said step (3) is carried out in a buffer selected from HEPES buffer, phosphate buffer, Tris buffer, and acetate buffer.

    19. The method according to claim 8, characterized in that for Bacillus subtilis engineered bacterium permeable whole cells expressing various enzymes separately, the mixture is made by mixing permeable whole cells expressing ?-glucan phosphorylase, permeable whole cells expressing glucose phosphomutase, permeable whole cells expressing glucose phosphate isomerase, permeable whole cells expressing 6-tagatose phosphate epimerase, and permeable whole cells expressing 6-tagatose phosphate phosphatase in a ratio of (0.1-10):(0.1-10):(0.1-10):(0.1-10):(0.1-10).

    20. The method according to claim 8, characterized in that said permeable whole cells are immobilized by resuspending said permeable whole cells with sodium phosphate or potassium phosphate buffer, adding inorganic clay and stirring well; subsequently adding polyethyleneimine aqueous solution for flocculation, then adding cross-linking agent for cross-linking; then filtering to obtain a filter cake layer which is washed with deionized water and squeezed to prepare into pellets, dried to obtain the immobilized whole cells.

    21. The method according to claim 20, characterized in that said inorganic clay is selected from montmorillonite, diatomaceous earth, kaolin and bentonite; said crosslinker is selected from glutaraldehyde, trihydroxymethylphosphine, N,N-methylenebisacrylamide, epichlorohydrin and genipin.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0043] FIG. 1 shows a schematic diagram of the production of tagatose by utilizing whole cells to catalyze starch.

    [0044] FIG. 2 shows a map of the recombinant expression vector pMA5-Py1b-aGP.

    [0045] FIG. 3 shows a map of the recombinant expression vector pMA5-Py1b-PGM.

    [0046] FIG. 4 shows a map of the recombinant expression vector pMA5-Py1b-PGI.

    [0047] FIG. 5 shows a map of the recombinant expression vector pMA5-Py1b-TPE.

    [0048] FIG. 6 shows a map of the recombinant expression vector pMA5-Py1b-TPP.

    [0049] FIG. 7 shows a map of the recombinant expression vector pMA5-Py1b-aGP-PGM-PGI-TPE-TPP.

    [0050] FIG. 8 shows the profile of the yield of tagatose with the reaction time.

    [0051] FIG. 9 shows the trend of tagatose production by immobilized co-expressing engineered strain.

    [0052] FIG. 10 shows the trend of tagatose production by immobilization of separately expressing engineered strains.

    DETAILED DESCRIPTION OF THE INVENTION

    [0053] In order to further illustrate the technical means adopted in the present invention and its effects, the technical solutions of the invention are further described below by means of specific embodiments. It should be understood, however, that the embodiments described are exemplary and preferred embodiments only, but do not constitute any limitation on the scope of the invention. It should be understood by those skilled in the art that modifications or substitutions may be made to the details and form of the technical solutions of the invention without departing from the spirit and scope of the invention, but that such modifications or substitutions fall within the scope of protection of the invention.

    Example 1 Construction of Bacillus subtilis Recombinant Strain SCK8

    [0054] (1) Construction of Recombinant Integration Vector pSS-Upp-FR

    [0055] According to the gene sequence of uracil phosphoribosyltransferase coding gene upp derived from Bacillus subtilis 168 (NCBI-ProteinID: NP_391570) in the KEGG database, primers were designed. The upstream 500 bp homologous fragment and the downstream 500 bp homologous fragment of the upp coding gene were amplified by PCR, and constructed into integration vector pSS by simple cloning connection method (You, C., Zhang, X. Z., & Zhang, Y. H. (2012). Simple cloning via direct transformation of PCR product (DNA Multimer) to Escherichia coli and Bacillus subtilis. Appl. Environ. Microbiol., 78(5), 1593-1595. doi: 10.1128/AEM.07105-11) to obtain a recombinant integration vector pSS-upp-FR.

    (2) Construction of Bacillus subtilis Recombinant Strain SCK8

    [0056] Bacillus subtilis strain SCK6 super competent cells (200 ?L) were prepared (Zhang, X. Z., & Zhang, Y. H. P. (2011). Simple, fast and high-efficiency transformation system for directed evolution of cellulase in Bacillus subtilis. Microb. Biotechnol., 4(1), 98-105. doi: 10.1111/j.1751-7915.2010.00230.x), and the recombinant integration vector pSS-upp-FR (1 ?g) was evenly mixed with Bacillus subtilis strain SCK6 super competent cells (200 ?L), and then placed in a shaker at 37? C. for 90 min to recover. The bacterial solution was coated on solid medium LB (yeast extract 5 g/L, peptone 10 g/L, sodium chloride 10 g/L) containing chloramphenicol (5 ?g/mL), and then placed in a 37? C. incubator for 14 to 16 h.

    [0057] The positive single-crossover transformant colony grown on the chloramphenicol-resistant plate was picked for colony PCR verification, and those with the two bands of 1000 bp DNA fragment and 2000 bp DNA fragment obtained by PCR amplification (where, the size of the 1000 bp DNA fragment was the fragment size of the upstream and downstream homology arms of the upp coding gene in the vector pSS-upp-FR, the size of the 2000 bp DNA fragment was the size of the fragment on the genome comprising the upstream homology arm of the upp conding gene, the upp conding gene, and the downstream homology arm of the upp conding gene) were positive clones.

    [0058] Positive clones were picked and transferred to LB medium without adding antibiotics for 8 to 12 h, then 200 ?L of the bacterial solution was centrifuged to remove the supernatant, then resuspended in sterile water and coated on a solid plate of 5-FU basic salt medium (40% glucose 20.0 ml/L, 4% glutamine 50.0 mL/L, 0.5% histidine 10.0 mL/L, 1% vitamin B1 1.0 mL/L, 20 mM 5-FU 500 ?L/L, 10?spizizen 100.0 mL/L, 1000?trace elements 1.0 mL/L), and placed in a 37? C. incubator for 24 h. The purpose of this step was to promote the intramolecular homologous recombination of positive transformants by culturing in LB medium without adding antibiotics, and then to obtain upp knockout target transformants by screening and culturing in 5-FU basic salt medium.

    [0059] Several colonies were picked from the solid plate of 5-FU basic salt medium, and verified by colony PCR again, and the transformants with only 1000 bp DNA fragment obtained by PCR amplification were positive clones. The transformant PCR was subjected to sequencing verification and the correct strain was saved, that is, the recombinant engineered strain of Bacillus subtilis with the upp gene knocked out, i.e., the recombinant engineered strain of Bacillus subtilis without uracil phosphoribosyltransferase activity, named SCK8.

    Example 2 Construction of Bacillus subtilis Recombinant Strain SCK8-ST1

    [0060] (1) Construction of Recombinant Integration Vector pSS-amyE-FR

    [0061] According to the gene sequence of ?-amylase coding gene amyG derived from Bacillus subtilis 168 (NCBI-ProteinID: NP_388186) in the KEGG database, primers were designed. The upstream 500 bp homologous fragment and the downstream 500 bp homologous fragment of amyG coding gene were amplified by PCR, and constructed into integration vector pSS by simple cloning connection method (You, C., Zhang, X. Z., & Zhang, Y. H. (2012). Simple cloning via direct transformation of PCR product (DNA Multimer) to Escherichia coli and Bacillus subtilis. Appl. Environ. Microbiol., 78(5), 1593-1595. doi: 10.1128/AEM.07105-11) to obtain a recombinant integration vector pSS-amyE-FR.

    (2) Construction of Bacillus subtilis Recombinant Strain SCK8-ST1

    [0062] Bacillus subtilis strain SCK8 super competent cells (200 ?L) were prepared, and the recombinant integration pSS-amyE-FR (1 ?g) was evenly mixed with Bacillus subtilis strain SCK8 super competent cells (200 ?L), and then placed in a shaker at 37? C. for 90 min to recover. The bacterial solution was coated on solid medium LB (yeast extract 5 g/L, peptone 10 g/L, sodium chloride 10 g/L) containing chloramphenicol (5 ?g/mL), and then placed in a 37? C. incubator for 14 to 16 h.

    [0063] The positive single-crossover transformant colony grown on the chloramphenicol-resistant plate was picked for colony PCR verification, and those with the two bands of 1000 bp DNA fragment and 2000 bp DNA fragment obtained by PCR amplification (where, the size of the 1000 bp DNA fragment was the fragment size of the upstream and downstream homology arms of the amyE coding gene in the vector pSS-amyE-FR, the size of the 2000 bp DNA fragment was the size of the fragment on the genome comprising the upstream homology arm of the amyl conding gene, the amyl conding gene, and the downstream homology arm of the amyE conding gene) were positive clones.

    [0064] Positive clones were picked and transferred to LB medium without adding antibiotics for 8 to 12 h, then 200 ?L of the bacterial solution was centrifuged to remove the supernatant, then resuspended in sterile water and coated on a solid plate of 5-FU basic salt medium (40% glucose 20.0 ml/L, 4% glutamine 50.0 mL/L, 0.5% histidine 10.0 mL/L, 1% vitamin B1 1.0 mL/L, 20 mM 5-FU 500 ?L/L, 10?spizizen 100.0 mL/L, 1000?trace elements 1.0 mL/L), and placed in a 37? C. incubator for 24 h. The purpose of this step was to promote the intramolecular homologous recombination of positive transformants by culturing in LB medium without adding antibiotics, and then to obtain amyE knockout target transformants by screening and culturing in 5-FU basic salt medium.

    [0065] Several colonies were picked from the solid plate of 5-FU basic salt medium, and verified by colony PCR again, and the transformants with only 1000 bp DNA fragment obtained by PCR amplification were positive clones. The transformant PCR was subjected to sequencing verification and the correct strain was saved, that is, the recombinant engineered strain of Bacillus subtilis with the amyG gene knocked out, i.e., the recombinant engineered strain of Bacillus subtilis without ?-amylase activity, named SCK8-ST1.

    Example 3 Construction of Bacillus subtilis Recombinant Strain SCK8-ST2

    [0066] (1) Construction of Recombinant Integration Vector pSS-spoIIAC-FR

    [0067] According to the gene sequence of sporulating RNA polymerase of factor coding gene spoIIAC derived from Bacillus subtilis 168 (NCBI-ProteinID: NP_390226) in the KEGG database, primers were designed. The upstream 500 bp homologous fragment and the downstream 500 bp homologous fragment of spoIIAC coding gene were amplified by PCR, and constructed into integration vector pSS by simple cloning connection method (You, C., Zhang, X. Z., & Zhang, Y. H. (2012). Simple cloning via direct transformation of PCR product (DNA Multimer) to Escherichia coli and Bacillus subtilis. Appl. Environ. Microbiol., 78(5), 1593-1595. doi: 10.1128/AEM.07105-11) to obtain a recombinant integration vector pSS-spoIIAC-FR.

    (2) Construction of Bacillus subtilis Recombinant Strain SCK8-ST2

    [0068] Bacillus subtilis strain SCK8-ST1 super competent cells (200 ?L) were prepared, and the recombinant integration pSS-spoIIAC-FR (1 ?g) was evenly mixed with Bacillus subtilis strain SCK8-ST1 super competent cells (200 ?L), and then placed in a shaker at 37? C. for 90 min to recover. The bacterial solution was coated on solid medium LB (yeast extract 5 g/L, peptone 10 g/L, sodium chloride 10 g/L) containing chloramphenicol (5 ?g/mL), and then placed in a 37? C. incubator for 14 to 16 h.

    [0069] The positive single-crossover transformant colony grown on the chloramphenicol-resistant plate was picked for colony PCR verification, and those with the two bands of 1000 bp DNA fragment and 2000 bp DNA fragment obtained by PCR amplification (where, the size of the 1000 bp DNA fragment was the fragment size of the upstream and downstream homology arms of the spoIIAC coding gene in the vector pSS-spoIIAC-FR, the size of the 2000 bp DNA fragment was the size of the fragment on the genome comprising the upstream homology arm of the spoIIAC conding gene, the spoIIAC conding gene, and the downstream homology arm of the spoIIAC conding gene) were positive clones.

    [0070] Positive clones were picked and transferred to LB medium without adding antibiotics for 8 to 12 h, then 200 ?L of the bacterial solution was centrifuged to remove the supernatant, then resuspended in sterile water and coated on a solid plate of 5-FU basic salt medium (40% glucose 20.0 ml/L, 4% glutamine 50.0 mL/L, 0.5% histidine 10.0 mL/L, 1% vitamin B1 1.0 mL/L, 20 mM 5-FU 500 ?L/L, 10?spizizen 100.0 mL/L, 1000?trace elements 1.0 mL/L), and placed in a 37? C. incubator for 24 h. The purpose of this step was to promote the intramolecular homologous recombination of positive transformants by culturing in LB medium without adding antibiotics, and then to obtain spoIIAC knockout target transformants by screening and culturing in 5-FU basic salt medium.

    [0071] Several colonies were picked from the solid plate of 5-FU basic salt medium, and verified by colony PCR again, and the transformants with only 1000 bp DNA fragment obtained by PCR amplification were positive clones. The transformant PCR was subjected to sequencing verification and the correct strain was saved, that is, the recombinant engineered strain of Bacillus subtilis with the sporulating spoIIAC gene knocked out, i.e., the recombinant engineered strain of Bacillus subtilis without sporulating RNA polymerase of factor activity, named SCK8-ST2.

    Example 4 Construction of Bacillus subtilis Recombinant Strain SCK8-ST3

    [0072] (1) Construction of Recombinant Integration Vector pSS-srfAC-FR

    [0073] According to the gene sequence of surface-active peptide synthase subunit 3 coding gene srfAC derived from Bacillus subtilis 168 (NCBI-ProteinID: NP_388233) in the KEGG database, primers were designed. The upstream 500 bp homologous fragment and the downstream 500 bp homologous fragment of srfAC coding gene were amplified by PCR, and constructed into integration vector pSS by simple cloning connection method (You, C., Zhang, X. Z., & Zhang, Y. H. (2012). Simple cloning via direct transformation of PCR product (DNA Multimer) to Escherichia coli and Bacillus subtilis. Appl. Environ. Microbiol., 78(5), 1593-1595. doi: 10.1128/AEM.07105-11) to obtain a recombinant integration vector pSS-srfAC-FR.

    (2) Construction of Bacillus subtilis Recombinant Strain SCK8-ST3

    [0074] Bacillus subtilis strain SCK8-ST2 super competent cells (200 ?L) were prepared, and the recombinant integration pSS-srfAC-FR (1 ?g) was evenly mixed with Bacillus subtilis strain SCK8-ST2 super competent cells (200 ?L), and then placed in a shaker at 37? C. for 90 min to recover. The bacterial solution was coated on solid medium LB (yeast extract 5 g/L, peptone 10 g/L, sodium chloride 10 g/L) containing chloramphenicol (5 ?g/mL), and then placed in a 37? C. incubator for 14 to 16 h.

    [0075] The positive single-crossover transformant colony grown on the chloramphenicol-resistant plate was picked for colony PCR verification, and those with the two bands of 1000 bp DNA fragment and 2000 bp DNA fragment obtained by PCR amplification (where, the size of the 1000 bp DNA fragment was the fragment size of the upstream and downstream homology arms of the srfAC coding gene in the vector pSS-srfAC-FR, the size of the 2000 bp DNA fragment was the size of the fragment on the genome comprising the upstream homology arm of the srfAC conding gene, the srfAC conding gene, and the downstream homology arm of the srfAC conding gene) were positive clones.

    [0076] Positive clones were picked and transferred to LB medium without adding antibiotics for 8 to 12 h, then 200 ?L of the bacterial solution was centrifuged to remove the supernatant, then resuspended in sterile water and coated on a solid plate of 5-FU basic salt medium (40% glucose 20.0 ml/L, 4% glutamine 50.0 mL/L, 0.5% histidine 10.0 mL/L, 1% vitamin B1 1.0 mL/L, 20 mM 5-FU 500 ?L/L, 10?spizizen 100.0 mL/L, 1000?trace elements 1.0 mL/L), and placed in a 37? C. incubator for 24 h. The purpose of this step was to promote the intramolecular homologous recombination of positive transformants by culturing in LB medium without adding antibiotics, and then to obtain srfAC knockout target transformants by screening and culturing in 5-FU basic salt medium.

    [0077] Several colonies were picked from the solid plate of 5-FU basic salt medium, and verified by colony PCR again, and the transformants with only 1000 bp DNA fragment obtained by PCR amplification were positive clones. The transformant PCR was subjected to sequencing verification and the correct strain was saved, that is, the recombinant engineered strain of Bacillus subtilis with the srfAC gene knocked out, i.e., the recombinant engineered strain of Bacillus subtilis without surface-active peptide synthase subunit 3 activity, named SCK8-ST3.

    Example 5: Construction of Recombinant Vector

    [0078] (1) Construction of pMA5-Py1b-aGP

    [0079] The thermalstable ?-glucan phosphorylase in the Example is from Thermococcus kodakarensis. The thermalstable ?-glucan phosphorylase coding gene agp sequence (NCBI-ProteinID: BAD85595) was synthesized and ligated to a common plasmid by Genewiz Suzhou. The agp gene, encoding thermalstable ?-glucan phosphorylase, was obtained by PCR using a pair of primers. Using primers 299-F: 5-AGAAACAACAAAGGGGGAGATTTGTatggtgaacgtttccaatgccgttg-3 and 300-R: 5-gcttgagctcgactctagaggatcctcagtcaagtcccttccacttgacca-3; The pMA5-Py1b linear backbone was obtained by PCR using a pair of primers. Using primers 301-F: 5-tggtcaagtggaagggacttgactgaggatcctagagagtcgagctcaagc-3 and 302-R: 5-caacggcattggaaacgttcaccatACAAATCTCCCCCCCTTTGTTGTTTCT-3;

    [0080] All primers were synthesized by Genewiz Suzhou. The PCR conditions for the gene were denaturation at 94? C. for 5 min, 30 cycles according to the following parameters: denaturation at 94? C. for 15 s, annealing at 58? C. for 15 s, extension at 72? C. for 1 min and a final extension at 72? C. for 10 min. The products obtained from the PCR reactions were analysed separately by 0.8% agarose gel electrophoresis of the results. After imaging by gel imaging system to confirm the correct fragment size, the target fragment was recovered by DNA purification and recovery kit (TIANGEN Biotech (Beijing) Co., Ltd., China) for the construction of recombinant expression vector.

    [0081] The thermalstable ?-glucan phosphorylase gene fragment and the pMA5-Py1b vector backbone were then assembled using POE-PCR. The POE-PCR system was as follows: purified pMA5-Py1b linear backbone, 200 ng; purified thermalstable ?-glucan phosphorylase gene fragment, 131 ng; 2? PrimeSTAR MAX DNA Polymerase (TaKaRa Bio (Dalian), China), 25 ?L, supplemented with water to 50 ?L. The POE-PCR conditions were denaturation at 98? C. for 2 min, 30 cycles according to the following parameters: denaturation at 98? C. for 15 s, annealing at 58? C. for 15 s, extension at 72? C. for 3.5 min and a final extension at 72? C. for 5 min. The ligated product was transformed into competent E. coli Top 10 by calcium chloride method, and the transformants were selected for colony PCR and double enzyme digestion identification, and 2-3 positive transformants were selected for further verification by sequencing. The sequencing results showed that the pMA5-Py1b-aGP recombinant co-expression vector was successfully obtained, and the plasmid map is shown in FIG. 2.

    (2) Construction of pMA5-Py1b-PGM

    [0082] The thermostable glucose phosphomutase in the Example is from Thermococcus kodakarensis. The thermostable glucose phosphomutase coding gene pgm sequence (NCBI-ProteinID: BAD85297) was synthesized and ligated to a common plasmid by Genewiz Suzhou. The thermostable glucose phosphomutase coding gene pgm was obtained from genomic DNA by PCR using a pair of primers. Using primers 327-F: 5-AGAAACAACAAAGGGGGAGATTTGTatgggcaaactgtttggtaccttcg-3 and 328-R: 5-agcttgagctcgactctagaggatccTTAacctttcagtgcttcttccagc-3; The pMA5-Py1b linear backbone was obtained by PCR using a pair of primers. Using primers 329-F: 5-gctggaagaagagcactgaaaggtTAAggatcctctagagagtcgagctcaagct-3 and 330-R: 5-cgaaggtaccaaacagtttgcccatACAAATCTCCCCCCCTTTGTTGTTTCT-3;

    [0083] All primers were synthesized by Genewiz Suzhou. The PCR conditions for the gene were denaturation at 94? C. for 5 min, 30 cycles according to the following parameters: denaturation at 94? C. for 15 s, annealing at 58? C. for 15 s, extension at 72? C. for 1 min and a final extension at 72? C. for 10 min. The products obtained from the PCR reactions were analysed separately by 0.8% agarose gel electrophoresis of the results. After imaging by gel imaging system to confirm the correct fragment size, the target fragment was recovered by DNA purification and recovery kit (TIANGEN Biotech (Beijing) Co., Ltd., China) for the construction of recombinant expression vector.

    [0084] The thermostable glucose phosphomutase gene fragment and the pMA5-Py1b vector backbone were then assembled using POE-PCR. The POE-PCR system was as follows: purified pMA5-Py1b linear backbone, 200 ng; purified thermostable glucose phosphomutase gene fragment, 131 ng; 2? PrimeSTAR MAX DNA Polymerase (TaKaRa Bio (Dalian), China), 25 ?L, supplemented with water to 50 ?L. The POE-PCR conditions were denaturation at 98? C. for 2 min, 30 cycles according to the following parameters: denaturation at 98? C. for 15 s, annealing at 58? C. for 15 s, extension at 72? C. for 3.5 min and a final extension at 72? C. for 5 min. The ligated product was transformed into competent E. coli Top10 by calcium chloride method, and the transformants were selected for colony PCR and double enzyme digestion identification, and 2-3 positive transformants were selected for further verification by sequencing. The sequencing results showed that the pMA5-Py1b-PGM recombinant co-expression vector was successfully obtained, and the plasmid map is shown in FIG. 3.

    (3) Construction of pMA5-Py1b-PGI

    [0085] The thermalstable glucose phosphate isomerase in the Example is from Thermus thermophilus. The thermalstable glucose phosphate isomerase coding gene pgi sequence (NCBI-ProteinID: AAS82052) was synthesized and ligated to a common plasmid by Genewiz Suzhou. The thermalstable glucose phosphate isomerase coding gene pgi was obtained from genomic DNA by PCR using a pair of primers. Using primers 331-F: 5-AGAAACAACAAAGGGGGAGATTTGTATGCTGCGTCTGGATACTCGCTTTC-3 and 332-R: 5-agcttgagctcgactctagaggatccTTAACCAGCCAGGCGTTTACGAGTC-3; The pMA5-Py1b linear backbone was obtained by PCR using a pair of primers. Using primers 333-F: 5-GACTCGTAAACGCCTGGCTGGTTAAggatcctagagagcttcgagctcaagct-3 and 334-R: 5-GAAAGCGAGTATCCAGACGCAGCATACAAATCTCCCCCCCTTTGTTGTTTCT-3;

    [0086] All primers were synthesized by Genewiz Suzhou. The PCR conditions for the gene were denaturation at 94? C. for 5 min, 30 cycles according to the following parameters: denaturation at 94? C. for 15 s, annealing at 58? C. for 15 s, extension at 72? C. for 1 min and a final extension at 72? C. for 10 min. The products obtained from the PCR reactions were analysed separately by 0.8% agarose gel electrophoresis of the results. After imaging by gel imaging system to confirm the correct fragment size, the target fragment was recovered by DNA purification and recovery kit (TIANGEN Biotech (Beijing) Co., Ltd., China) for the construction of recombinant expression vector.

    [0087] The thermalstable glucose phosphate isomerase gene fragment and the pMA5-Py1b vector backbone were then assembled using POE-PCR. The POE-PCR system was as follows: purified pMA5-Py1b linear backbone, 200 ng; purified thermalstable glucose phosphate isomerase gene fragment, 131 ng; 2? PrimeSTAR MAX DNA Polymerase (TaKaRa Bio (Dalian), China), 25 ?L, supplemented with water to 50 ?L. The POE-PCR conditions were denaturation at 98? C. for 2 min, 30 cycles according to the following parameters: denaturation at 98? C. for 15 s, annealing at 58? C. for 15 s, extension at 72? C. for 3.5 min and a final extension at 72? C. for 5 min. The ligated product was transformed into competent E. coli Top 10 by calcium chloride method, and the transformants were selected for colony PCR and double enzyme digestion identification, and 2-3 positive transformants were selected for further verification by sequencing. The sequencing results showed that the pMA5-Py1b-PGI recombinant co-expression vector was successfully obtained, and the plasmid map is shown in FIG. 4.

    (4) Construction of pMA5-Py1b-TPE

    [0088] The thermalstable 6-tagatose phosphate epimerase in the Example is from Thermoanaerobacter indiensis. The thermalstable 6-tagatose phosphate epimerase coding gene tpe sequence (NCBI-ProteinID: B044 RS0101530) was synthesized and ligated to a common plasmid by Genewiz Suzhou. The thermalstable 6-tagatose phosphate epimerase coding gene tpe was obtained from genomic DNA by PCR using a pair of primers. Using primers 335-F: 5-AGAAACAACAAAGGGGGAGATTTGTatgaaagtttggctggttggtgcct-3 and 324-R: 5-agcttgagctcgactctagaggatccTTAtttcaggttgctataccattct-3; The pMA5-Py1b linear backbone was obtained by PCR using a pair of primers. Using primers 325-F: 5-agaatggtatagcaacctgaaaTAAggatcctagagagtcgagctcaagct-3 and 326-R: 5-aggcaccaaccagccaaactttcatACAAATCTCCCCCCCTTTGTTGTTTCT-3;

    [0089] All primers were synthesized by Genewiz Suzhou. The PCR conditions for the gene were denaturation at 94? C. for 5 min, 30 cycles according to the following parameters: denaturation at 94? C. for 15 s, annealing at 58? C. for 15 s, extension at 72? C. for 1 min and a final extension at 72? C. for 10 min. The products obtained from the PCR reactions were analysed separately by 0.8% agarose gel electrophoresis of the results. After imaging by gel imaging system to confirm the correct fragment size, the target fragment was recovered by DNA purification and recovery kit (TIANGEN Biotech (Beijing) Co., Ltd., China) for the construction of recombinant expression vector.

    [0090] The thermostable 6-tagatose phosphate epimerase gene fragment and the pMA5-Py1b vector backbone were then assembled using POE-PCR. The POE-PCR system was as follows: purified pMA5-Py1b linear backbone, 200 ng; purified thermostable 6-tagatose phosphate epimerase gene fragment, 131 ng; 2? PrimeSTAR MAX DNA Polymerase (TaKaRa Bio (Dalian), China), 25 ?L, supplemented with water to 50 ?L. The POE-PCR conditions were denaturation at 98? C. for 2 min, 30 cycles according to the following parameters: denaturation at 98? C. for 15 s, annealing at 58? C. for 15 s, extension at 72? C. for 3.5 min and a final extension at 72? C. for 5 min. The ligated product was transformed into competent E. coli Top 10 by calcium chloride method, and the transformants were selected for colony PCR and double enzyme digestion identification, and 2-3 positive transformants were selected for further verification by sequencing. The sequencing results showed that the pMA5-Py1b-TPE recombinant co-expression vector was successfully obtained, and the plasmid map is shown in FIG. 5.

    (5) Construction of pMA5-Py1b-TPP

    [0091] The thermalstable 6-tagatose phosphate phosphatase in the Example is from Archaeoglobus fulgidus. The thermalstable 6-tagatose phosphate phosphatase coding gene tpp sequence (NCBI-ProteinID: AAB90791) was synthesized and ligated to a common plasmid by Genewiz Suzhou. The thermalstable 6-tagatose phosphate phosphatase coding gene tpp was obtained from genomic DNA by PCR using a pair of primers. Using primers 339-F: 5-AGAAACAACAAAGGGGGAGATTTGTATGTTCAAGCCGAAAGCGATCGCGG-3 and 340-R: 5-agcttgagctcgactctagaggatccTTAACGCAGCAGGCCCAGAAACTG-3; The pMA5-Py1b linear backbone was obtained by PCR using a pair of primers. Using primers 341-F: 5-CAGTTTCTGGGCCTGCTGCGTTAAggatcctagagagagtcgagctcaagct-3 and 342-R: 5-CCGCGATCGCTTTCGGCTTGAACATACAAATCTCCCCCTTTGTTGTTTCT-3;

    [0092] All primers were synthesized by Genewiz Suzhou. The PCR conditions for the gene were denaturation at 94? C. for 5 min, 30 cycles according to the following parameters: denaturation at 94? C. for 15 s, annealing at 58? C. for 15 s, extension at 72? C. for 1 min and a final extension at 72? C. for 10 min. The products obtained from the PCR reactions were analysed separately by 0.8% agarose gel electrophoresis of the results. After imaging by gel imaging system to confirm the correct fragment size, the target fragment was recovered by DNA purification and recovery kit (TIANGEN Biotech (Beijing) Co., Ltd., China) for the construction of recombinant expression vector.

    [0093] The thermostable 6-tagatose phosphate phosphatase gene fragment and the pMA5-Py1b vector backbone were then assembled using POE-PCR. The POE-PCR system was as follows: purified pMA5-Py1b linear backbone, 200 ng; purified thermostable 6-tagatose phosphate phosphatase gene fragment, 131 ng; 2? PrimeSTAR MAX DNA Polymerase (TaKaRa Bio (Dalian), China), 25 ?L, supplemented with water to 50 ?L. The POE-PCR conditions were denaturation at 98? C. for 2 min, 30 cycles according to the following parameters: denaturation at 98? C. for 15 s, annealing at 58? C. for 15 s, extension at 72? C. for 3.5 min and a final extension at 72? C. for 5 min. The ligated product was transformed into competent E. coli Top 10 by calcium chloride method, and the transformants were selected for colony PCR and double enzyme digestion identification, and 2-3 positive transformants were selected for further verification by sequencing. The sequencing results showed that the pMA5-Py1b-TPP recombinant co-expression vector was successfully obtained, and the plasmid map is shown in FIG. 6.

    (6) Construction of pMA5-Py1b-aGP-PGM-PGI-TPE-TPP

    [0094] In the example the thermostable ?-glucan phosphorylase is from Thermococcus kodakarensis; the thermostable glucose phosphomutase is from Thermococcus kodakarensis; the thermostable glucose phosphate isomerase is from Thermus thermophilus; the thermostable 6-tagatose phosphate epimerase is from Thermoanaerobacter indiensis; and the thermostable 6-tagatose phosphate phosphatase is from Archaeoglobus fulgidus. The thermostable ?-glucan phosphorylase coding gene agp (NCBI-ProteinID: BAD85595) was obtained by PCR using primers 350-F: 5-AGAAACAACAAAGGGGGAGTTGTatggtgaacgtttccaatgccgttg-3 and 351-R: 5-cgaaggtaccaaacagtttgcccatTTTGAATTCCTCCTTTtcagtcaagtcccttccacttgacc-3; The thermostable glucose phosphomutase coding gene pgm (NCBI-ProteinID: BAD85297) was obtained by PCR using primers 352-F: 5-ggtcaagtggaagggacttgactgaAAAGGAGGAATTCAAAatgggcaaactgtttggtaccttcg-3 and 353-R: 5-GAAAGCGAGTATCCAGACGCAGCATTTTGAATTCCTCCTTTTTAacctttcagtgcttcttccagc-3; The thermostable glucose phosphate isomerase coding gene pgi (NCBI-ProteinID: AAS82052) was obtained by PCR using primers 354-F: 5-gctggaagaagcactgaaaggtTAAAAAGGAGGAATTCAAAATGCTGCGTCTGGATACTCGCTT TC-3 and 355-R: 5-TTTTCAGCGGATGTTCGGTGTTCATTTTGAATTCCTCCTTTTCAACCAGCCAGGCGTT TACGAGTC-3; The thermostable 6-tagatose phosphate epimerase coding gene tpe (NCBI-ProteinID: B044_RS0101530) was obtained by PCR using primers 356-F: 5-GACTCGTAAACGCCTGGCTGGTTGAAAAGGAGGAATTCAAAATGAACACCGAACA TCCGCTGAAAA-3 and 357-R: 5-ACCGCGATCGCTTTCGGCTTGAACATTTTGAATTCCTCCTTTttaAATCAGTTTGAATT CACCGCTG-3; The thermostable 6-tagatose phosphate phosphatase coding gene tpp (NCBI-ProteinID: AAB90791) was obtained by PCR using primers 358-F: 5-CAGCGGTGAATTCAAACTGATTtaaAAAGGAGGAATTCAAAATGTTCAAGCCGAAAG CGATCGCGGT-3 and 359-R: 5-gcttgagctcgactctagaggatccTTAACGCAGCAGGCCCAGAAACTGCA-3; The pMA5-Py1b linear backbone was obtained by PCR using the primers; 360-F: 5-TGCAGTTTCTGGGCCTGCTGCGTTAAggatcctagagagtcgagctcaagc-3 and 361-R: 5-caacggcattggaaacgttcaccatACAAATCTCCCCCTTTGTTGTTTCT-3.

    [0095] All primers were synthesized by Genewiz Suzhou. The PCR conditions for the gene were denaturation at 94? C. for 5 min, 30 cycles according to the following parameters: denaturation at 94? C. for 15 s, annealing at 58? C. for 15 s, extension at 72? C. for 1 min and a final extension at 72? C. for 10 min. The products obtained from the PCR reactions were analysed separately by 0.8% agarose gel electrophoresis of the results. After imaging by gel imaging system to confirm the correct fragment size, the target fragment was recovered by DNA purification and recovery kit (TIANGEN Biotech (Beijing) Co., Ltd., China) for the construction of recombinant expression vector.

    [0096] The thermalstable ?-glucan phosphorylase gene fragment, the thermalstable glucose phosphomutase gene fragment, the thermalstable glucose phosphate isomerase gene fragment, the thermalstable 6-tagatose phosphate epimerase gene fragment, the thermalstable 6-tagatose phosphate phosphatase gene fragment, and the pMA5-Py1b vector backbone were then assembled using POE-PCR. The POE-PCR system was as follows: purified pMA5-Py1b linear backbone, 200 ng; purified thermalstable ?-glucan phosphorylase gene fragment, 131 ng; purified thermalstable glucose phosphomutase gene fragment, 131 ng; purified thermalstable glucose phosphate isomerase gene fragment, 131 ng; purified thermalstable 6-tagatose phosphate epimerase gene fragment, 131 ng; purified thermalstable 6-tagatose phosphate phosphatase gene fragment, 131 ng; 2? PrimeSTAR MAX DNA Polymerase (TaKaRa Bio (Dalian), China), 25 ?L, supplemented with water to 50 ?L. The POE-PCR conditions were denaturation at 98? C. for 2 min, 30 cycles according to the following parameters: denaturation at 98? C. for 15 s, annealing at 58? C. for 15 s, extension at 72? C. for 3.5 min and a final extension at 72? C. for 5 min. The ligated product was transformed into competent E. coli Top 10 by calcium chloride method, and the transformants were selected for colony PCR and double enzyme digestion identification, and 2-3 positive transformants were selected for further verification by sequencing. The sequencing results showed that the pMA5-Py1b-aGP-PGM-PGI-TPE-TPP recombinant co-expression vector was successfully obtained, and the plasmid map is shown in FIG. 7.

    Example 6 Construction of Recombinant Engineered Bacteria

    [0097] The constructed recombinant expression vectors pMA5-Py1b-aGP, pMA5-Py1b-PGM, pMA5-Py1b-PGI, pMA5-Py1b-TPE, pMA5-Py1b-TPP, and pMA5-Py1b-aGP-PGM-PGI-TPE-TPP were separately transformed into Bacillus subtilis engineering bacterium SCK8-ST3, incubated overnight in LB test tubes, and the plasmids were extracted by the Plasmid Extraction Kit, and the correct clones SCK8-ST3/pMA5-Py1b-aGP, SCK8-ST3/pMA5-Py1b-PGM, SCK8-ST3/pMA5-Py1b-PGI, SCK8-ST3/pMA5-Py1b-TPE, SCK8-ST3/pMA5-Py1b-TPP and SCK8-ST3/pMA5-Py1b-aGP-PGM-PGI-TPE-TPP were stored.

    Example 7 Preparation of Whole Cells of Recombinantly Engineered Bacteria

    [0098] Recombinant engineered bacteria SCK8-ST3/pMA5-Py1b-aGP, SCK8-ST3/pMA5-Py1b-PGM, SCK8-ST3/pMA5-Py1b-PGI, SCK8-ST3/pMA5-Py1b-TPE, SCK8-ST3/pMA5-Py1b-TPP and SCK8-ST3/pMA5-Py1b-aGP-PGM-PGI-TPE-TPP were respectively picked and inoculated in LB medium containing chlortetracycline and incubated overnight at 37? C. with shaking. Cultures were transferred at 1% inoculum to fresh LB medium containing chimaericin, incubated overnight at 37? C. with shaking, centrifuged at 5500 rpm for 10 min and the supernatant discarded to obtain whole cells expressing thermalstable ?-glucan phosphorylase, whole cells expressing thermalstable glucose phosphomutase, whole cells expressing thermalstable glucose phosphate isomerase, whole cells expressing thermalstable 6-tagatose phosphate epimerase, whole cells expressing thermalstable 6-tagatose phosphate phosphatase, and whole cells co-expressing thermalstable ?-glucan phosphorylase, thermalstable glucose phosphomutase, thermalstable glucose phosphate isomerase, thermalstable 6-tagatose phosphate epimerase, and thermalstable 6-tagatose phosphate phosphatase.

    Example 8 Preparation of Tagatose by Co-Expression of Whole Cell to Catalyze Starch

    [0099] The whole cells co-expressing thermalstable ?-glucan phosphorylase, thermalstable glucose phosphomutase, thermalstable glucose phosphate isomerase, thermalstable 6-tagatose phosphate epimerase, and thermalstable 6-tagatose phosphate phosphatase prepared in Example 7 were washed once with 50 mM Tris-HCl buffer (pH 7.5), centrifuged at 5500 rpm for 10 min, the supernatant was discarded, 50 mM Tris-HCl (pH 7.5) buffer was added to the precipitate and the bacteria were resuspended to make OD.sub.600=about 300. The resuspended bacteria were heat treated at 75? C. for 90 min.

    [0100] To a 1 L reaction system, a final concentration of 100 g/L starch, 50 mM sodium phosphate buffer (pH 7.5) and heat-treated whole cells were added to make OD.sub.600=about 20. The reaction was carried out in a water bath shaker at 70? C. for 46 h and samples were taken for high performance liquid chromatography (HPLC) analysis. The HPLC conditions were as follows: the column was Bio-Rad HPX-87H; the flow rate was 0.6 mL/min; the column temperature was 60? C.; the detector was a differential refractive index detector; and the injection volume was 20 ?L.

    [0101] In total, three parallel replicate tests were carried out and FIG. 8 shows a graph of the course of the tagatose yield with reaction time. After 46 h of reaction in a water bath shaker at 70? C., the HPLC test results showed that the tagatose yield reached 50 g/L with a yield of up to 50%.

    Example 9 Preparation of Tagatose by Using Whole Cell Mixture to Catalyze Starch

    [0102] The whole cells expressing thermalstable ?-glucan phosphorylase, whole cells expressing thermalstable glucose phosphomutase, whole cells expressing thermalstable glucose phosphate isomerase, whole cells expressing thermalstable 6-tagatose phosphate epimerase, whole cells expressing thermalstable 6-tagatose phosphate phosphatase prepared in Example 7 were separately washed once with 50 mM Tris-HCl buffer (pH 7.5), centrifuged at 5500 rpm for 10 min, the supernatant was discarded, 50 mM Tris-HCl (pH 7.5) buffer was respectively added to the precipitates and the bacteria were resuspended to about OD.sub.600=300. The resuspended bacteria were heat treated at 75? C. for 90 min.

    [0103] To a 1 L reaction system, a final concentration of 100 g/L starch, 50 mM sodium phosphate buffer (pH 7.5) and the above four heat-treated whole cells were added to make OD.sub.600=about 20. The whole cells expressing thermalstable ?-glucan phosphorylase, whole cells expressing thermalstable glucose phosphomutase, whole cells expressing thermalstable glucose phosphate isomerase, whole cells expressing thermalstable 6-tagatose phosphate epimerase, whole cells expressing thermalstable 6-tagatose phosphate phosphatase were added in a 1:1:1:1:1 ratio. The reaction was carried out in a water bath shaker at 70? C. for 46 h and samples were taken for HPLC analysis. In total, three parallel replicate tests were carried out and the HPLC conditions were the same as in Example 8. After 46 h of reaction in a water bath shaker at 70? C., the HPLC test results showed that the yield of tagatose reached 73 g/L with a yield of 73%.

    Example 10 Production of Tagatose by Using Immobilized Whole Cell to Catalyze Starch

    [0104] Permeable whole cells co-expressing thermalstable ?-glucan phosphorylase, thermalstable glucose phosphomutase, thermalstable glucose phosphate isomerase, thermalstable 6-tagatose phosphate epimerase, and thermalstable 6-tagatose phosphate phosphatase were resuspeded with 1 L sodium phosphate buffer (pH 7.0) to make OD.sub.600=about 400, 1 g montmorillonite was added and mix well. 40 mL of 5% (w/v) aqueous polyethyleneimine was added and flocculated at room temperature, and 20 mL of 50% aqueous glutaraldehyde was added and crosslinked at room temperature for 3 h. Then, the filter cake layer was obtained by suction filtration, and the filter cake was washed with deionized water, extruded to prepare pellets, and dried to obtain immobilized whole cells.

    [0105] To a 1 L reaction system, a final concentration of 100 g/L starch, 50 mM sodium phosphate buffer (pH 7.5) and immobilized whole cells were added to make OD.sub.600=about 20 and the reaction was carried out in a water bath shaker at 70? C. for 46 h. At the end of the reaction the reaction solution was centrifuged at 4? C. and subjected to high performance liquid chromatography (HPLC) to analyse the tagatose content; the immobilized pellets were collected and washed in buffer for the next batch of reaction. The experimental results are shown in FIG. 9. The results showed that in the production process of tagatose by using immobilized whole cells to continuously catalyze starch, the initial product yield was up to 50%, which decreases with increasing batches of the continuous catalytic reaction and remains around 36% after 50 consecutive batches.

    Example 11 Production of Tagatose by Using Immobilized Whole Cell Mixture to Catalyze Starch

    [0106] The permeable whole cells expressing thermalstable ?-glucan phosphorylase, permeable whole cells expressing thermalstable glucose phosphomutase, permeable whole cells expressing thermalstable glucose phosphate isomerase, permeable whole cells expressing thermalstable 6-tagatose phosphate epimerase, permeable whole cells expressing thermalstable 6-tagatose phosphate phosphatase in a ratio of 1:1:1:1:1 were resuspended with 1 L of sodium phosphate buffer (pH 7.0) to make OD.sub.600=about 300, 0.8 g of montmorillonite was added and mixed well. 35 mL of 5% (w/v) aqueous polyethyleneimine was added and flocculated at room temperature, and 18 mL of 50% aqueous glutaraldehyde was added and crosslinked at room temperature for 3 h. Then, the filter cake layer was obtained by suction filtration, and the filter cake was washed with deionized water, extruded to prepare pellets, and dried to obtain immobilized whole cell mixture.

    [0107] To a 1 L reaction system, a final concentration of 100 g/L starch, 50 mM sodium phosphate buffer (pH 7.5) and immobilized whole cells were added to make OD.sub.600=about 20 and the reaction was carried out in a water bath shaker at 70? C. for 46 h. At the end of the reaction the reaction solution was centrifuged at 4? C. and subjected to high performance liquid chromatography (HPLC) to analyse the tagatose content; the immobilized pellets were collected and washed in buffer for the next batch of reaction. The experimental results are shown in FIG. 10. The results showed that the product yields were greater than 50% and up to 73% in 60 consecutive batches of catalysis. The experimental results are shown in FIG. 10. The results showed that during the reaction continuously catalyzed by the immobilized whole cells, the initial product yield was up to 73%, which decreases with increasing batches of the continuous catalytic reaction and remains around 52% after 60 consecutive batches.