COMPLEX FOR GENOME EDITING HAVING STABILITY AND FEW SIDE-EFFECTS, AND NUCLEIC ACID CODING SAME
20240254516 ยท 2024-08-01
Assignee
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/78
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N2800/80
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N15/90
CHEMISTRY; METALLURGY
International classification
C12N15/90
CHEMISTRY; METALLURGY
C12N9/78
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
Abstract
The present invention provides a complex containing a nucleic acid sequence-recognizing module and a proteolysis tag, wherein the module is linked to the proteolysis tag, the module specifically binds to a target nucleotide sequence in a double stranded DNA, and the tag consists of (i) a peptide containing 3 hydrophobic amino acid residues at the C-terminal, or (ii) a peptide containing 3 amino acid residues at the C-terminal wherein at least a part of the amino acid residues is substituted by serine
Claims
1. A complex comprising a nucleic acid sequence-recognizing module and a proteolysis tag, wherein the module is linked to the proteolysis tag, the module specifically binds to a target nucleotide sequence in a double stranded DNA, wherein the complex is further bound with a nucleic acid altering enzyme that converts one or more nucleotides in the target nucleotide sequence to a different nucleotide, deletes one or more nucleotides in the target nucleotide sequence, or inserts one or more nucleotides in the target nucleotide sequence, wherein the nucleic acid altering enzyme is a deaminase or a DNA glycosylase, and wherein the nucleic acid sequence-recognizing module is selected from the group consisting of CRISPR-mutant Cas, zinc finger motif, TAL effector and PPR motif.
2. A method for altering a targeted site of a double stranded DNA of a bacterium, or regulating an expression of a gene encoded by a double-stranded DNA near the site, comprising a step of bringing a complex comprising a nucleic acid sequence-recognizing module specifically binding to a target nucleotide sequence in a selected double stranded DNA and a proteolysis tag at the C-terminal of the module.
3. A method for efficient production of transformant with the replicating vector for expressing in a heterologous organism, wherein the method comprises the steps of: providing a vector which encodes the complex comprising a nucleic acid sequence-recognizing module specifically binding to a target nucleotide sequence in a selected double stranded DNA of the heterologous organism and a proteolysis tag at the C terminal of the module; introducing the vector into a host organism; and subjecting the host organism to a condition for proliferation.
4. The method according to claim 3, wherein the method further comprises selecting a transformant from the host organisms, which shows efficient proliferation.
5. The method according to claim 3, wherein the transformant is a bacterium.
6. The method according to claim 3, wherein the heterologous organism is eukaryotic.
7. A transformant with the replicating vector for expressing in a heterologous organism wherein the vector encodes the complex comprising a nucleic acid sequence-recognizing module specifically binding to a target nucleotide sequence in a selected double stranded DNA of the heterologous organism and a proteolysis tag at the C-terminal of the module.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
DESCRIPTION OF EMBODIMENTS
1. Complex for Genome Editing and Nucleic Acid Encoding Same
[0058] The present invention provides a complex for genome editing in which a nucleic acid sequence-recognizing module specifically binding to a target nucleotide sequence in a double stranded DNA and a proteolysis tag are linked, and a nucleic acid encoding the complex. In one embodiment of the complex for genome editing of the present invention, a complex wherein a nucleic acid altering enzyme is further linked (i.e., a complex in which a nucleic acid sequence-recognizing module, a nucleic acid altering enzyme and a proteolysis tag are linked), which can alter the nucleic acid in the targeted site is provided. In one embodiment, to improve the alteration efficiency of the double stranded DNA, a base excision repair inhibitor may be further linked to the complex. In another embodiment of the complex for genome editing of the present invention, a complex wherein at least a nucleic acid sequence-recognizing module and a proteolysis tag are linked, which can regulation the expression of a gene double stranded DNA in the vicinity of the targeted site, is provided. In one embodiment, a transcriptional regulatory factor may be further linked to the complex. In the following, a complex in which at least any of a nucleic acid altering enzyme, a base excision repair inhibitor and a transcriptional regulatory factor is linked and a complex in which none of them is linked are sometimes collectively referred to as the complex of the present invention or the complex for genome editing, and particularly, a complex in which a nucleic acid altering enzyme is linked is sometimes referred to as the nucleic acid altering enzyme complex. The nucleic acids encoding these complexes are sometimes collectively referred to as the nucleic acid of the present invention.
[0059] When the nucleic acid of the present invention is introduced into a host bacterium (e.g., Escherichia coli) and cultured for the purpose of replication, rather than alteration of DNA, and a complex is expressed unintendedly from the nucleic acid, the toxicity to host bacterium can be suppressed low because the complex is degraded rapidly by the proteolysis tag. In fact, when the nucleic acid of the present invention is introduced into a host bacterium for the purpose of replication of the nucleic acid, the transformation efficiency of the host bacterium is high as demonstrated in the Examples described below as compared to when one not containing a nucleic acid encoding proteolysis tag is introduced. Therefore, the nucleic acid of the present invention containing a sequence encoding proteolysis tag can be replicated stably in a bacterium as a nucleic acid for genome editing of a host other than bacteria (e.g., eukaryote). Therefore, it is useful to add a sequence encoding the proteolysis tag of the present invention to a vector aiming at genome editing in a host other than bacteria.
[0060] In the present invention, the alteration of a double stranded DNA means that a nucleotide (e.g., dC) on a DNA strand is converted to another nucleotide (e.g., dT, dA or dG), or deleted, or a nucleotide or a nucleotide sequence is inserted between certain nucleotides on a DNA strand. The double stranded DNA to be altered is not particularly limited as long as it is a DNA present in the cell, preferably a genomic DNA. The targeted site of a double stranded DNA means the whole or partial target nucleotide sequence, which a nucleic acid sequence-recognizing module specifically recognizes and binds to, or the vicinity of the target nucleotide sequence (one or both of 5 upstream and 3 downstream). The target nucleotide sequence means a sequence to which a nucleic acid sequence-recognizing module in the double stranded DNA binds. In the present invention, the term genome editing is used to mean not only altering a double stranded DNA but also promoting or suppressing the expression of a gene encoded by a double stranded DNA in the vicinity of the targeted site.
[0061] In the present invention, the nucleic acid sequence-recognizing module means a molecule or molecule complex having an ability to specifically recognize and bind to a particular nucleotide sequence (i.e., target nucleotide sequence) on a DNA strand. When a nucleic acid altering enzyme complex is used, binding of the nucleic acid sequence-recognizing module to a target nucleotide sequence enables a nucleic acid altering enzyme and/or a base excision repair inhibitor linked to the module to specifically act on a targeted site of a double stranded DNA.
[0062] In the present invention, the nucleic acid altering enzyme means an enzyme that modifies DNA, and the modification directly or indirectly causes alteration of DNA. The enzyme may be a peptide fragment thereof as long as it has a catalytic activity. Examples of such DNA modification reaction include a reaction to cleave DNA (hereinafter to be also referred to as DNA strand cleavage reaction) which is catalyzed by a nucleolytic enzyme, a reaction to convert a substituent on the purine or pyrimidine ring of a nucleic acid base to other group or atom, which is a reaction catalyzed by a nucleic acid base converting enzyme and not directly involving cleavage of DNA strand (hereinafter to be also referred to as nucleic acid base conversion reaction) (e.g., deamination reaction of base), a reaction to hydrolyze N-glycoside linkage of DNA (hereinafter to be also referred to as base excision reaction) which is catalyzed by DNA glycosylase and the like. As shown in the Examples described below, the toxicity of a nucleic acid altering enzyme complex containing a nucleic acid base converting enzyme to the host bacterium can be reduced by adding a proteolysis tag. Therefore, the technique of the present invention can be applied to genome editing using not only a nucleic acid base converting enzyme but also nucleolytic enzymes conventionally difficult for application to bacteria due to the strong toxicity thereof. Therefore, the nucleic acid altering enzyme to be used in the present invention includes a nucleolytic enzyme, a nucleic acid base converting enzyme, a DNA glycosylase and the like. From the aspect of reduction of cytotoxicity, nucleic acid base converting enzyme and DNA glycosylase are preferable, and the targeted site can be altered using these enzymes in the targeted site, without cleaving at least one the strands of the double stranded DNA.
[0063] In the present invention, the proteolysis tag mainly consists of a peptide containing not less than 3 hydrophobic amino acid residues, wherein the peptide shows a shortened half-life of protein when added to a complex for genome editing as compared to that without addition to the complex. As such amino acid, glycine, alanine, valine, leucine, isoleucine, methionine, proline, phenylalanine, and tryptophan can be mentioned. The proteolysis tag of the present invention only needs to contain any three of these amino acid residues at the C-terminal, and other constitution is not particularly limited. It may be a peptide consisting of the three amino acid residues. A peptide in which a part or all of the aforementioned hydrophobic amino acid residues is/are substituted by serine or threonine is also encompassed in the proteolysis tag of the present invention. While preferable aforementioned three amino acid residues are not particularly limited, leucine-valine-alanine (LVA), leucine-alanine-alanine (LAA), alanine-alanine-valine (AAV) and the like, whose high effects were acknowledged in Escherichia coli and Pseudomonas putida (Andersen J. B. et al., Apll. Environ. Microbiol., 64: 2240-2246 (1998)), can be mentioned and, as one containing serine, alanine-serine-valine (ASV) and the like can be mentioned. In addition, the data base of tm RNA tag peptide (e.g., tmRDB, ag.auburn.edu/mirror/tmRDB/peptide/peptidephylolist.html) and the like can be referred to for the proteolysis tag containing these three amino acid residues. Specifically, YAASV (SEQ ID NO: 324), YALAA (SEQ ID NO: 325), ANDENYALAA (SEQ ID NO: 181) and AANDENYALAA (SEQ ID NO: 182) known as tmRNA tag peptides of Escherichia coli, GKQNNLSLAA (SEQ ID NO: 183), GKSNNNFALAA (SEQ ID NO: 184), GKENNNFALAA (SEQ ID NO: 185), GKTNSFNONVALAA (SEQ ID NO: 186), GKSNONLALAA (SEQ ID NO: 187) and GKONYALAA (SEQ ID NO: 188) known as tmRNA tag peptides of genus Bacillus, ANDDNYALAA (SEQ ID NO: 189), ANDDQYGAALAA (SEQ ID NO: 190), ANDENYGQEFALAA (SEQ ID NO: 191), ANDETYGDYALAA (SEQ ID NO: 192), ANDETYGEYALAA (SEQ ID NO: 193), ANDETYGEETYALAA (SEQ ID NO: 194), ANDENYGAEYKLAA (SEQ ID NO: 195) and ANDENYGAQLAA (SEQ ID NO: 196) known as tmRNA tag peptides of genus Pseudomonas, AKNTNSYALAA (SEQ ID NO: 197), AKNTNSYAVAA (SEQ ID NO: 198), AKNNTTYALAA (SEQ ID NO: 199), AKNTNTYALAA (SEQ ID NO: 200) and AKNNTSYALAA (SEQ ID NO: 201) known as tmRNA tag peptides of genus Streptococcus and the like can be unlimitatively mentioned. The proteolysis tag typically consists of 3-15 amino acid residues, but is not limited to this range. In one embodiment, proteolysis tag consists of 3-5 amino acid residues. Those of ordinary skill in the art can appropriately select the proteolysis tag according to the kind of host bacterium and the like. In the present specification, unless otherwise specified, the capital letter of the alphabet indicates a one-letter code for the amino acid, and the amino acid sequence is indicated from left to right, from N-terminal to C-terminal.
[0064] In the present invention, the complex for genome editing means a molecular complex having nucleic acid alteration activity or expression regulation activity and imparted with a particular nucleotide sequence recognition, which includes the above-mentioned complex in which a nucleic acid sequence-recognizing module and a proteolysis tag are linked. The nucleic acid altering enzyme complex means a molecular complex having a nucleic acid alteration activity and imparted with a particular nucleotide sequence recognition ability, which includes the above-mentioned complex in which a nucleic acid sequence-recognizing module, a nucleic acid altering enzyme, and a proteolysis tag are linked. The complex may be linked with a base excision repair inhibitor. The complex here encompasses not only one constituted of plural molecules but also one having, in a single molecule, a molecule constituting the above-mentioned complex of the present invention such as fusion proteins. Furthermore, a molecule or molecular complex that functions due to a nucleic acid sequence-recognizing module and a nucleic acid altering enzyme in integration such as restriction enzyme and CRISPR/Cas system, and is bound with a proteolysis tag is also encompassed in the complex of the present invention. In addition, encoding a complex encompasses both encoding respective molecules constituting the complex, and encoding a fusion protein having constituting molecules in a single molecule.
[0065] The nucleolytic enzyme used in the present invention is not particularly limited as long as it catalyzes the above-mentioned reaction, and, for example, nuclease (e.g., Cas effector protein (e.g., Cas9, Cpf1), endonuclease (e.g., restriction enzyme), exonuclease etc.), recombinase, DNA gyrase, DNA topoisomerase, transposase and the like can be mentioned.
[0066] The nucleic acid base converting enzyme to be used in the present invention is not particularly limited as long as it can catalyze the above-mentioned reaction, and examples thereof include deaminase belonging to the nucleic acid/nucleotide deaminase superfamily, which catalyzes a deamination reaction that converts an amino group to a carbonyl group. Preferable examples thereof include cytidine deaminase capable of converting cytosine or 5-methylcytosine to uracil or thymine, respectively, adenosine deaminase capable of converting adenine to hypoxanthine, guanosine deaminase capable of converting guanine to xanthine and the like. As cytidine deaminase, more preferred is activation-induced cytidine deaminase (hereinafter to be also referred to as AID) which is an enzyme that introduces a mutation into an immunoglobulin gene in the acquired immunity of vertebrata or the like.
[0067] While the derivation of nucleic acid base converting enzyme is not particularly limited, for example, PmCDA1 (Petromyzon marinus cytosine deaminase 1) derived from Petromyzon marinus, or AID (Activation-induced cytidine deaminase; AICDA) derived from mammal (e.g., human, swine, bovine, horse, monkey etc.) can be used. For example, GenBank accession Nos. EF094822 and ABO15149 can be referred to for the base sequence and amino acid sequence of cDNA of PmCDA1, GenBank accession No. NM 020661 and NP 065712 can be referred to for the base sequence and amino acid sequence of cDNA of human AID. From the aspect of enzyme activity, PmCDA1 is preferred.
[0068] The DNA glycosylase to be used in the present invention is not particularly limited as long as it can catalyze the above-mentioned reaction, and thymine DNA glycosylase, oxoguanine glycosylase, alkyladenine DNA glycosylase (e.g., yeast 3-methyladenine-DNA glycosylase (MAG1) etc.) and the like can be mentioned. The present inventor previously reported that use of a DNA glycosylase with sufficiently low reactivity with DNA having a double helix structure without distortion (unrelaxed DNA) as DNA glycosylase can reduce cytotoxicity and efficiently alter a target sequence (WO 2016/072399). Therefore, as DNA glycosylase, a DNA glycosylase with sufficiently low reactivity with DNA having a double helix structure without distortion is preferably used. Examples of such DNA glycosylase include a mutant of UNG having cytosine-DNA glycosylase (CDG) activity and/or thymine-DNA glycosylase (TDG) activity (uracil-DNA glycosylase), and UDG mutant from vaccinia virus, which are described in WO 2016/072399.
[0069] Specific examples of the aforementioned mutant of UNG include yeast UNG1 N222D/L304A double mutant, N222D/R308E double mutant, N222D/R308C double mutant, Y164A/L304A double mutant, Y164A/R308E double mutant, Y164A/R308C double mutant, Y164G/L304A double mutant, Y164G/R308E double mutant, Y164G/R308C double mutant, N222D/Y164A/L304A triple mutant, N222D/Y164A/R308E triple mutant, N222D/Y164A/R308C triple mutant, N222D/Y164G/L304A triple mutant, N222D/Y164G/R308E triple mutant, N222D/Y164G/R308C triple mutant and the like. When another UNG is used in place of the yeast UNG1, a mutant in which a similar mutation has been introduced into the amino acid corresponding to each mutant described above may be used. As UDG mutant from vaccinia virus, N120D mutant, Y70G mutant, Y70A mutant, N120D/Y70G double mutant, N120D/Y70A double mutant and the like can be mentioned. Alternatively, it may be a DNA glycosylase divided into two segments which is a split enzyme designed such that each segment is bound to either of two divided nucleic acid sequence-recognizing modules to form two complexes, the nucleic acid sequence-recognizing module can specifically bind to a target nucleotide sequence when both complexes are refolded, and the DNA glycosylase can catalyze a base excision reaction by the specific binding. The split enzyme can be designed and produced by referring to the descriptions of, for example, WO 2016/072399, Nat Biotechnol. 33 (2): 139-142 (2015), PNAS 112 (10): 2984-2989 (2015).
[0070] In the present invention, the base excision repair is one of the DNA repair mechanisms of living organisms, and means a mechanism for repairing damages of bases by cutting off damaged parts of the bases by enzymes and rejoining them. Excision of damaged bases is performed by DNA glycosylase, which is an enzyme that hydrolyzes the N-glycoside linkage of DNA. An abasic site (apurinic/apyrimidic (AP) site) resulting from the abasic reaction by the enzyme is treated by an enzyme at the downstream of the base excision repair (BER) pathway such as an AP endonuclease, DNA polymerase, DNA ligase and the like. Examples of such gene or protein involved in the BER pathway include, but are not limited to, UNG (NM_003362), SMUG1 (NM_014311), MBD4 (NM_003925), TDG (NM_003211), OGG1 (NM_002542), MYH (NM_012222), NTHL1 (NM_002528), MPG (NM_002434), NEIL1 (NM_024608), NEIL2 (NM_145043), NEIL3 (NM_018248), APE1 (NM_001641), APE2 (NM_014481), LIG3 (NM_013975), XRCC1 (NM_006297), ADPRT (PARP1) (NM_0016718), ADPRTL2 (PARP2) (NM_005484) and the like (parentheses indicate refseq number in which the base sequence information of each gene (cDNA) is registered).
[0071] In the present invention, the base excision repair inhibitor means a substance that inhibits any stage of the above-mentioned BER pathway, or a protein that eventually inhibits BER by inhibiting the expression of molecules mobilized in the BER pathway. While the base excision repair inhibitor to be used in the present invention is not particularly limited as long as it consequently inhibits BER, from the aspect of efficiency, an inhibitor of DNA glycosylase located at the upstream of the BER pathway is preferable. Examples of the inhibitor of DNA glycosylase to be used in the present invention include, but are not limited to, a thymine DNA glycosylase inhibitor, an uracil DNA glycosylase inhibitor, an oxoguanine DNA glycosylase inhibitor, an alkylguanine DNA glycosylase inhibitor and the like. For example, when cytidine deaminase is used as a nucleic acid altering enzyme, it is suitable to use a uracil DNA glycosylase inhibitor to inhibit repair of U:G or G: U mismatch of DNA generated by mutation.
[0072] Examples of such uracil DNA glycosylase inhibitor include, but are not limited to, a uracil DNA glycosylase inhibitor (Ugi) derived from Bacillus subtilis bacteriophage, PBS1, and a uracil DNA glycosylase inhibitor (Ugi) derived from Bacillus subtilis bacteriophage, PBS2 (Wang, Z., and Mosbaugh, D. W. (1988) J. Bacteriol. 170, 1082-1091). The above-mentioned inhibiter of the repair of DNA mismatch can be used in the present invention. Particularly, Ugi derived from PBS2 is also known to have an effect of making it difficult to cause mutation, cleavage and recombination other than T from C on DNA, and thus the use of Ugi derived from PBS2 is suitable.
[0073] As mentioned above, in the base excision repair (BER) mechanism, when a base is excised by DNA glycosylase, AP endonuclease puts a nick in the abasic site (AP site), and exonuclease completely excises the AP site. When the AP site is excised, DNA polymerase produces a new base by using the base of the opposing strand as a template, and DNA ligase finally seals the nick to complete the repair. Mutant AP endonuclease that has lost the enzyme activity but maintains the binding capacity to the AP site is known to competitively inhibit BER. Therefore, these mutation AP endonucleases can also be used as the base excision repair inhibitor in the present invention. While the derivation of the mutant AP endonuclease is not particularly limited, for example, AP endonucleases derived from Escherichia coli, yeast, mammal (e.g., human, mouse, swine, bovine, horse, monkey etc.) and the like can be used. For example, UniprotKB No. P27695 can be referred to for the amino acid sequence of human Apel. Examples of the mutant AP endonuclease that has lost the enzyme activity but maintains the binding capacity to the AP site include proteins having mutated activity site and mutated Mg (cofactor)-binding site. For example, E96Q, Y171A, Y171F, Y171H, D210N, D210A, N212A and the like can be mentioned for human Apel.
[0074] In the present invention, the transcriptional regulatory factor means a protein or a domain thereof which has an activity of promoting or suppressing target gene transcription. In the following, one having a transcription promoting activity is sometimes referred to as a transcription activation factor, and one having a transcription suppressing activity is sometimes referred to as a transcription inhibitory factor.
[0075] The transcription activation factor to be used in the present invention is not particularly limited as long as it can promote transcription of the target gene and, for example, an activated domain of HSV (Herpes simplex virus) VP16, p65 subunit of NF?B, VP64, VP160, HSF, P300 and EB virus (Epstein-Barr Virus) RTA, fusion proteins of these and the like can be mentioned. The transcription inhibitory factor to be used in the present invention is not particularly limited as long as it can suppress transcription of the target gene and, for example, KRAB, MBD2B, v-ErbA, SID (including SID concatemer (SID4X)), MBD2, MBD3, DNMT family (e.g., DNMT1, DNMT3A, DNMT3B), Rb, MeCP2, ROM2 and AtHD2A, fusion proteins of these and the like can be mentioned.
[0076] A target nucleotide sequence in a double-stranded DNA to be recognized by the nucleic acid sequence-recognizing module in the complex of the present invention is not particularly limited as long as the module specifically binds to, and may be any sequence in the double-stranded DNA. The length of the target nucleotide sequence only needs to be sufficient for specific binding of the nucleic acid sequence-recognizing module. For example, when mutation is introduced into a particular site in the genomic DNA of a mammal, it is not less than 12 nucleotides, preferably not less than 15 nucleotides, more preferably not less than 17 nucleotides, according to the genome size thereof. While the upper limit of the length is not particularly limited, it is preferably not more than 25 nucleotides.
[0077] As the nucleic acid sequence-recognizing module in the complex of the present invention, a CRISPR-Cas system wherein at least one DNA cleavage ability of the Cas effector protein is inactivated (hereinafter to be also referred to as CRISPR-mutant Cas), zinc finger motif, TAL effector and PPR motif and the like, as well as a fragment which contains a DNA binding domain of a protein that specifically binds to DNA, such as restriction enzyme, transcriptional regulatory factor, RNA polymerase and the like, and the like can be used, but the module is not limited thereto. When a nucleic acid altering enzyme is used, the CRISPR-Cas system in which a nucleic acid sequence-recognizing module and a nucleic acid altering enzyme are integrated (Cas effector protein of the system maintains both activities of the DNA cleavage ability) may also be used. Preferably, CRISPR-mutant Cas, zinc finger motif, TAL effector, PPR motif and the like can be mentioned.
[0078] A zinc finger motif is constituted by linkage of 3-6 different Cys2His2 type zinc finger units (1 finger recognizes about 3 bases), and can recognize a target nucleotide sequence of 9-18 bases. A zinc finger motif can be produced by a known method such as Modular assembly method (Nat Biotechnol (2002) 20: 135-141), OPEN method (Mol Cell (2008) 31: 294-301), CoDA method (Nat Methods (2011) 8: 67-69), Escherichia coli one-hybrid method (Nat Biotechnol (2008) 26:695-701) and the like. JP-B-4968498 can be referred to as for the detail of the zinc finger motif production.
[0079] A TAL effector has a module repeat structure with about 34 amino acids as a unit, and the 12th and 13th amino acid residues (called RVD) of one module determine the binding stability and base specificity. Since each module is highly independent, TAL effector specific to a target nucleotide sequence can be produced by simply connecting the module. For TAL effector, a production method utilizing an open resource (REAL method (Curr Protoc Mol Biol (2012) Chapter 12: Unit 12.15), FLASH method (Nat Biotechnol (2012) 30: 460-465), and Golden Gate method (Nucleic Acids Res (2011) 39: e82) etc.) have been established, and a TAL effector for a target nucleotide sequence can be designed comparatively conveniently. National Publication of International Patent Application No. 2013-513389 can be referred to as for the detail of the production of a TAL effector.
[0080] PPR motif is constituted such that a particular nucleotide sequence is recognized by a continuation of PPR motifs each consisting of 35 amino acids and recognizing one nucleic acid base, and recognizes a target base only by 1, 4 and ii (-2) amino acids of each motif. Motif constitution has no dependency, and is free of interference of motifs on both sides. Therefore, like TAL effector, a PPR protein specific to the target nucleotide sequence can be produced by simply connecting PPR motifs. JP-A-2013-128413 can be referred to as for the detail of the production of a PPR motif.
[0081] When a fragment of restriction enzyme, transcriptional regulatory factor, RNA polymerase and the like is used, since the DNA binding domains of these proteins are well known, a fragment which contains the domain and does not have a DNA double strand cleavage ability, can be easily designed and constructed.
[0082] When a nucleic acid altering enzyme is used, any of the above-mentioned nucleic acid sequence-recognizing modules can be provided as a fusion protein with the above-mentioned nucleic acid altering enzyme and/or a base excision repair inhibitor, or a protein binding domain such as SH3 domain, PDZ domain, GK domain, GB domain and the like and a binding partner thereof may be fused with a nucleic acid sequence-recognizing module and/or a base excision repair inhibitor, respectively, and provided as a protein complex via an interaction of the domain and a binding partner thereof. Alternatively, a nucleic acid sequence-recognizing module and/or a base excision repair inhibitor may be each fused with intein, and they can be linked by ligation after protein synthesis. The proteolysis tag may be bound with any of the constituent molecules of a nucleic acid altering enzyme complex (nucleic acid sequence-recognizing module, nucleic acid altering enzyme and base excision repair inhibitor), and may be bound with plural constituent molecules. Also, when a transcriptional regulatory factor is used, the transcriptional regulatory factor may be provided as a fusion protein with a nucleic acid sequence-recognizing module in the same manner as described above, or may be bound with a nucleic acid recognition module via the above-mentioned protein binding domain and a binding partner thereof. In the same manner as described above, the proteolysis tag may be bound as a fusion protein, or may be bound with a complex for genome editing or a constituent molecule thereof via the above-mentioned protein binding domain and a binding partner thereof. The proteolysis tag is preferably bound with the C-terminal of a complex for genome editing or a constituent molecule thereof.
[0083] In the nucleic acid of the present invention, a nucleic acid sequence-recognizing module, a proteolysis tag, a nucleic acid altering enzyme and/or a base excision repair inhibitor as necessary, or a transcriptional regulatory factor can be prepared as a nucleic acid encoding a fusion protein thereof, or in a form capable of forming a complex in a host cell after translation into a protein by utilizing a binding domain, intein and the like, or as a nucleic acid encoding each of them. The nucleic acid here may be a DNA or an RNA. When it is a DNA, it is preferably a double stranded DNA, and provided in the form of an expression vector placed under regulation of a functional promoter in a host cell. When it is an RNA, it is preferably a single strand RNA.
[0084] A DNA encoding a nucleic acid sequence-recognizing module such as zinc finger motif, TAL effector, PPR motif and the like can be obtained by any method mentioned above for each module. A DNA encoding a sequence-recognizing module of restriction enzyme, transcriptional regulatory factor, RNA polymerase and the like can be cloned by, for example, synthesizing an oligoDNA primer covering a region encoding a desired part of the protein (part containing DNA binding domain) based on the cDNA sequence information thereof, and amplifying by the RT-PCR method using, as a template, the total RNA or mRNA fraction prepared from the protein-producing cells.
[0085] A DNA encoding a nucleic acid altering enzyme and base excision repair inhibitor can also be cloned similarly by synthesizing an oligoDNA primer based on the cDNA sequence information thereof, and amplifying by the RT-PCR method using, as a template, the total RNA or mRNA fraction prepared from the enzyme-producing cells. For example, a DNA encoding PBS2-derived UGI can be cloned by designing suitable primers for the upstream and downstream of CDS based on the cDNA sequence (accession No. J04434) registered in the NCBI/GenBank database, and cloning from PBS2-derived mRNA by the RT-PCR method.
[0086] The cloned DNA may be directly, or after digestion with a restriction enzyme when desired, or after addition of a suitable linker (e.g., GS linker, GGGAR linker etc.), spacer (e.g., FLAG sequence etc.) and/or a nuclear localization signal (NLS) (each organelle transfer signal when the double-stranded DNA of interest is mitochondria or chloroplast DNA), to prepare a DNA encoding a fusion protein. In addition, a DNA encoding a fusion protein can be prepared by ligating with a DNA encoding a nucleic acid sequence-recognizing module.
[0087] A DNA encoding the complex for genome editing of the present invention can be obtained by chemically synthesizing the DNA strand, or by connecting synthesized partly overlapping oligoDNA short strands by utilizing the PCR method and the Gibson Assembly method to construct a DNA encoding the full length thereof. The advantage of constructing a full-length DNA by chemical synthesis or a combination of PCR method or Gibson Assembly method is that the codon to be used can be designed in CDS full-length according to the host into which the DNA is introduced. In the expression of a heterologous DNA, the protein expression level is expected to increase by converting the DNA sequence thereof to a codon highly frequently used in the host organism. As the data of codon use frequency in host to be used, for example, the genetic code use frequency database disclosed in the home page of Kazusa DNA Research Institute (kazusa.or.jp/codon/index.html) can be used, or documents showing the codon use frequency in each host may be referred to. By reference to the obtained data and the DNA sequence to be introduced, codons showing low use frequency in the host from among those used for the DNA sequence may be converted to a codon coding the same amino acid and showing high use frequency.
[0088] An expression vector containing a DNA encoding the complex for genome editing of the present invention can be produced, for example, by linking the DNA to the downstream of a promoter in a suitable expression vector.
[0089] As the expression vector, plasmids from Escherichia coli (e.g., pBR322, pBR325, pUC12, pUC13); plasmids from Bacillus subtilis (e.g., pUB110, pTP5, pC194); plasmids from yeast (e.g., pSH19, pSH15); insect cell expression plasmids (e.g., pFast-Bac); animal cell expression plasmids (e.g., pA1-11, pXT1, pRc/CMV, pRc/RSV, pcDNAI/Neo); bacteriophages such as ?phage and the like; insect virus vectors such as baculovirus and the like (e.g., BmNPV, AcNPV); animal virus vectors such as retrovirus, vaccinia virus, adenovirus and the like, and the like are used.
[0090] As the promoter, any promoter appropriate for a host used for gene expression can be used. When a nucleolytic enzyme is used as a nucleic acid altering enzyme, since the survival rate of the host cell sometimes decreases markedly due to the toxicity, it is desirable to increase the number of cells by the start of the induction by using an inductive promoter. On the other hand, when a nucleic acid base converting enzyme and DNA glycosylase are used as a nucleic acid altering enzyme, or when a nucleic acid altering enzyme is not used, since sufficient cell proliferation can also be achieved by expressing the nucleic acid-altering enzyme complex of the present invention, a constitutive promoter can also be used without limitation.
[0091] For example, when the host is an animal cell, SR? promoter, SV40 promoter, LTR promoter, CMV (cytomegalovirus) promoter, RSV (Rous sarcoma virus) promoter, MoMuLV (Moloney mouse leukemia virus) LTR, HSV-TK (simple herpes virus thymidine kinase) promoter and the like are used. Of these, CMV promoter, SRa promoter and the like are preferable.
[0092] When the host is Escherichia coli, J23 series promoters (e.g., J23119 promoter), trp promoter, lac promoter, recA promoter, ?P.sub.L promoter, lpp promoter, T7 promoter and the like are preferable.
[0093] When the host is genus Bacillus, SPO1 promoter, SPO2 promoter, penP promoter and the like are preferable.
[0094] When the host is a yeast, the Gal1/10 promoter, PHO5 promoter, PGK promoter, GAP promoter, ADH promoter and the like are preferable.
[0095] When the host is an insect cell, a polyhedrin promoter, P10 promoter and the like are preferable.
[0096] When the host is a plant cell, CaMV35S promoter, CaMV19S promoter, NOS promoter and the like are preferable.
[0097] As the expression vector, besides those mentioned above, one containing an enhancer, a splicing signal, a terminator, a polyA addition signal, a selection marker such as drug resistance gene, an auxotrophic complementary gene and the like, a replication origin and the like on demand can be used.
[0098] An RNA encoding the complex of the present invention can be prepared by, for example, transcription to mRNA an in vitro transcription system known per se by using the above-mentioned expression vector containing a DNA encoding each protein as a template.
[0099] The host bacterium used for replication of the nucleic acid of the present invention is not particularly limited as long as it is a bacterium having a proteolysis system using tmRNA (ssrA). For example, genus Escherichia, genus Bacillus, genus Pseudomonas (e.g., Pseudomonas putida), genus Streptococcus (e.g., Streptococcus), genus Streptomyces, genus Staphylococcus, genus Yersinia, genus Acinetobacter, genus Klebsiella, genus Bordetella, genus Lactococcus, genus Neisseria, genus Aeromonas, gnus Francisella, genus Corynebacterium, genus Citrobacter, genus Chlamydiae, genus Haemophilus, genus Brucella, genus Mycobacterium, genus Legionella, genus Rhodococcus, genus Pseudomonas, genus Helicobacter, genus Salmonella, genus Staphylococcus, genus Vibrio, and genus Erysipelothrix and the like are used.
[0100] As the genus Escherichia, Escherichia coli K12.Math.DH1 [Proc. Natl. Acad. Sci. USA, 60, 160 (1968)], Escherichia coli JM103 [Nucleic Acids Research, 9, 309 (1981)], Escherichia coli JA221 [Journal of Molecular Biology, 120, 517 (1978)], Escherichia coli HB101 [Journal of Molecular Biology, 41, 459 (1969)], Escherichia coli C600 [Genetics, 39, 440 (1954)], Escherichia coli DH5?, Escherichia coli BW25113 and the like are used.
[0101] As the genus Bacillus, Bacillus subtilis MI114 [Gene, 24, 255 (1983)], Bacillus subtilis 207-21 [Journal of Biochemistry, 95, 87 (1984)] and the like are used.
[0102] When a nucleic acid base converting enzyme or DNA glycosylase is used as a nucleic acid altering enzyme, the nucleic acid altering enzyme and/or a base excision repair inhibitor are/is provided as a complex with mutant Cas by a method similar to the coupling scheme with the above-mentioned zinc finger and the like. Alternatively, a nucleic acid base converting enzyme and/or a base excision repair inhibitor, and mutant Cas can also be bound by utilizing RNA aptamers MS2F6, PP7 and the like and RNA scaffold by binding proteins thereto.
[0103] The guide RNA forms a complementary strand with the target nucleotide sequence, mutant Cas is recruited by the tracrRNA attached and mutant Cas recognizes DNA cleavage site recognition sequence PAM (protospacer adjacent motif) (when SpCas9 is used, PAM has 3 bases of NGG (N is any base), and theoretically can target any site on the genome). One or both DNAs cannot be cleaved and, due to the action of the nucleic acid base converting enzyme or DNA glycosylase linked to the mutant Cas, nucleic acid base conversion or base excision occurs in the targeted site (appropriately adjusted within several hundred bases including whole or partial target nucleotide sequence) and a mismatch (e.g., when cytidine deaminase such as PmCDA1, AID or the like is used as the nucleic acid base converting enzyme, cytosine on the sense strand or antisense strand at the targeted site is converted to uracil to cause U:G or G: U mismatch), or apurinic/apyrimidinic site (AP site) occurs in the double stranded DNA. Various mutations are introduced due to an error in the BER system of the cell attempting to repair this. For example, the mismatch or AP site is not correctly repaired, and when repaired such that a base of the opposite strand forms a pair with a base of the converted strand (T-A or A-T in the above-mentioned example), or when other nucleotide is further substituted (e.g., U.fwdarw.A, G) or when one to several dozen bases are deleted or inserted during repair, various mutations are introduced. By using a base excision repair inhibitor in combination, the intracellular BER mechanism is inhibited, the frequency of repair mis increases, and the mutation introduction efficiency can be improved.
[0104] As for zinc finger motifs, production of many actually functionable zinc finger motifs is not easy, since production efficiency of a zinc finger that specifically binds to a target nucleotide sequence is not high and selection of a zinc finger having high binding specificity is complicated. While TAL effectors and PPR motifs have a high degree of freedom of target nucleic acid sequence recognition as compared to zinc finger motifs, a problem remains in the efficiency since a large protein needs to be designed and constructed every time according to the target nucleotide sequence.
[0105] In contrast, since the CRISPR-Cas system recognizes the double-stranded DNA sequence of interest with a guide RNA complementary to the target nucleotide sequence, any sequence can be targeted by simply synthesizing an oligoDNA capable of specifically hybridizing with the target nucleotide sequence.
[0106] Therefore, in a more preferable embodiment of the present invention, a CRISPR-Cas system maintaining both activities of the DNA cleavage ability, or a CRISPR-Cas system wherein DNA cleavage ability of only one or both of the Cas is inactivated (CRISPR-mutant Cas) is used as a nucleic acid sequence-recognizing module.
[0107] The nucleic acid sequence-recognizing module of the present invention using CRISPR-mutant Cas is provided as a complex of a CRISPR-RNA (crRNA) containing a sequence complementary to the target nucleotide sequence and, where necessary, trans-activating RNA (tracrRNA) necessary for recruiting mutant Cas effector protein (when tracrRNA is necessary, possibly provided as chimeric RNA with crRNA) and mutant Cas effector protein. An RNA molecule consisting of crRNA alone or a chimeric RNA of crRNA and tracrRNA that constitutes a nucleic acid sequence-recognizing module in combination with a mutant Cas effector protein is collectively referred to as a guide RNA. The same also applies when a CRISPR/Cas system without introduction of mutation is used.
[0108] While the Cas effector protein to be used in the present invention is not particularly limited as long as it can form a complex with guide RNA and recognize and bind to the target nucleotide sequence in the gene of interest and a protospacer adjacent motif (PAM) adjacent thereto, it is preferably Cas9 or Cpf1. Examples of Cas9 include, but are not limited to, Cas9 derived from Streptococcus pyogenes (SpCas9; PAM sequence NGG (N is A, G, T or C, hereinafter the same)), Cas9 derived from Streptococcus thermophilus (StCas9; PAM sequence NNAGAAW), Cas9 derived from Neisseria meningitidis (NmCas9; PAM sequence NNNNGATT) and the like. Preferred is SpCas9 with less restriction by PAM (substantially 2 bases, and can target theoretically any site in the genome). Examples of the Cpf1 include, but are not limited to, Cpf1 derived from Francisella novicida (FnCpf1; PAM sequence NTT), Cpf1 derived from Acidaminococcus sp. (AsCpf1; PAM sequence NTTT), Cpf1 derived from Lachnospiraceae bacterium (LbCpf1; PAM sequence NTTT) and the like. As a mutant Cas effector protein (sometimes to be abbreviated as mutant Cas) to be used in the present invention, any of Cas effector protein wherein the cleavage ability of the both strands of the double-stranded DNA is inactivated and one having nickase activity wherein at least one cleavage ability of one strand alone is inactivated can be used. For example, in the case of SpCas9, a D10A mutant in which the 10th Asp residue is converted to an Ala residue and lacking cleavage ability of a strand opposite to the strand forming a complementary strand with a guide RNA (thus having nickase activity for a strand forming complementary strand with guide RNA), or H840A mutant in which the 840th His residue is converted to an Ala residue and lacking cleavage ability of a strand forming a complementary strand to guide RNA (thus having nickase activity for a strand forming complementary strand with guide RNA, or a double mutant thereof (dCas9) can be used. In the case of FnCpf1, a mutant in which the 917th Asp residue is converted to an Ala residue (D917A) or the 1006th Glu residue is converted to an Ala residue (E1006A), and lacking cleavage ability of both strands can be used. As long as at least one of the strands of double-stranded DNA lacks cleavage ability, other mutant Cas can also be used similarly.
[0109] A DNA encoding Cas effector protein (including mutant Cas, hereinafter the same) can be cloned by a method similar to the above-mentioned method for a DNA encoding a base excision repair inhibitor, from a cell producing the enzyme. A mutant Cas can be obtained by introducing a mutation to convert an amino acid residue of the site important for the DNA cleavage activity (e.g., 10th Asp residue and 840th His residue for SpCas9, 917th Asp residue and 1006th Glu residue for FnCpf1 and the like, though not limited thereto) to other amino acids, into a DNA encoding cloned Cas, by a site specific mutation induction method known per se.
[0110] Alternatively, a DNA encoding Cas effector protein can also be constructed as a DNA with codon usage suitable for expression in a host cell to be used, by a method similar to those mentioned above for a DNA encoding a nucleic acid sequence-recognizing module and a DNA encoding DNA glycosylase, and in a combination of chemical synthesis or PCR method or Gibson Assembly method.
[0111] The obtained DNA encoding a Cas effector protein, nucleic acid altering enzyme, base excision repair inhibitor, and/or transcriptional regulatory factor can be inserted into the downstream of a promoter of an expression vector similar to the one mentioned above, according to the target cell.
[0112] On the other hand, a DNA encoding guide RNA can be obtained by designing an oligoDNA sequence linking a coding sequence of crRNA sequence containing a nucleotide sequence complementary to the target nucleotide sequence (to be also referred to as targeting sequence in the present specification) (e.g., when FnCpf1 is recruited as Cas effector protein, crRNA containing SEQ ID NO: 19; AAUUUCUACUGUUGUAGAU at the 5-side of the targeting sequence can be used, and the underlined sequences form base pairs to form a stem-loop structure), or a crRNA coding sequence and, where necessary, a known tracrRNA coding sequence (e.g., as tracrRNA coding sequence when Cas is recruited as Cas9 effector protein, gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggca ccgagtcggtgcttttttt; SEQ ID NO: 18) and chemically synthesizing using a DNA/RNA synthesizer.
[0113] The targeted strand here means a strand forming a hybrid with crRNA of the target nucleotide sequence, and the opposite strand, which becomes single-stranded after hybridization of the targeted strand and crRNA, is referred to as a non-targeted strand. Since a nucleic acid base conversion reaction is generally assumed to frequently occur on a single stranded non-targeted strand, when the target nucleotide sequence is to be expressed by one of the strands (e.g., when PAM sequence is indicated, when positional relationship of target nucleotide sequence and PAM is shown etc.), it is represented by a sequence of the non-targeted strand.
[0114] While the length of the targeting sequence is not particularly limited as long as it can specifically bind to a target nucleotide sequence, for example, it is 15-30 nucleotides, preferably 18-25 nucleotides. The selection of the target nucleotide sequence is restricted by the presence of an adjacent PAM on the 3-side (in the case of Cas9) or 5-side (in the case of Cpf1) of the sequence. According to the finding verified in the below-mentioned Examples, in the system of the present invention in which CRISPR-mutated Cas and cytidine deaminase are combined, the regularity exists that easily substituted C shifts toward the 5-end as the target nucleotide sequence becomes longer. Therefore, by appropriately determining the length of the target nucleotide sequence (targeting sequence as a complementary strand thereof), the site of a base into which a mutation can be introduced can be shifted. As a result, restriction by PAM (NGG in SpCas9) can be removed at least partially, and the degree of freedom of mutation introduction is expected to be still higher.
[0115] When Cas9 is used as a Cas effector protein, a targeting sequence can be designed, for example, using a guide RNA design website open to public (CRISPR Design Tool, CRISPRdirect etc.) by listing up 20 mer sequences having PAM (e.g., NGG in the case of SpCas9) adjacent to the 3-side from the CDS sequences of the gene of interest, and selecting a sequence that causes an amino acid change in the protein encoded by the target gene when C within 7 nucleotides from the 5 end thereof toward 3 direction is converted to T. An appropriate sequence can be selected even when a targeting sequence with a length other than 20 mer is used. A candidate sequence having a small number of off-target sites in the host genome of interest can be used as a targeting sequence. When the guide RNA design software to be used does not have a function to search off-target sites in the genome of the host, for example, off-target sites can be searched by applying a Blast search against the genome of the host, for example, 8-12 nucleotides on the 3-side of the candidate sequence (seed sequence with high discrimination ability of target nucleotide sequence).
[0116] While a DNA encoding guide RNA can also be inserted into an expression vector similar to the one mentioned above. As the promoter, pol III system promoter (e.g., SNR6, SNR52, SCR1, RPR1, U3, U6, H1 promoter etc.) and terminator (e.g., polyT sequence (T6 sequence etc.)) are preferably used.
[0117] A DNA encoding guide RNA (crRNA or crRNA-tracrRNA chimera) can be obtained by designing an oligoRNA sequence linking a sequence complementary to the target strand of the target nucleotide sequence and a known tracrRNA sequence (when Cas9 is recruited) or a direct repeat sequence of crRNA (when Cpf1 is recruited) and chemically synthesizing using a DNA/RNA synthesizer.
2. Alteration Method of Targeted Site of Double Stranded DNA of Host Bacterium
[0118] The targeted site of the double stranded DNA of the host can be altered, or the expression of a gene encoded by the double stranded DNA in the vicinity of the targeted site can be regulated by introducing the complex and the nucleic acid of the present invention described in 1. into a host, particularly a bacterium, and culturing the host. Therefore, in another embodiment, a method for altering a targeted site of a double stranded DNA of a bacterium, including a step of bringing the nucleic acid altering enzyme complex into contact with the double stranded DNA of the host bacterium to convert one or more nucleotides in the targeted site to other one or more nucleotides or delete one or more nucleotides, or insert one or more nucleotides into said targeted site (hereinafter to be also referred to as the alteration method of the present invention) is provided. Using a nucleic acid base converting enzyme or DNA glycosylase as a nucleic acid altering enzyme, the targeted site can be altered without cleaving at least one of the strands of the double stranded DNA in the targeted site. In still another embodiment, a method including contacting the complex of the present invention with a double stranded DNA of the host bacterium and regulating transcription of a gene in the vicinity of the targeted site is provided.
[0119] The complex of the present invention is contacted with the double stranded DNA by introducing the complex or a nucleic acid encoding same into a bacterium having the desired double stranded DNA (e.g., genomic DNA). In consideration of the introduction and expression efficiency, it is desirable to introduce the complex for genome editing into the bacterium in the form of a nucleic acid encoding the complex, rather than as the complex itself, and express the complex in the bacterium.
[0120] Examples of the bacterium used for the alteration method of the present invention include those similar to the bacteria used for nucleic acid replication in 1.
[0121] An expression vector can be introduced by a known method (e.g., lysozyme method, competent method, PEG method, CaCl.sub.2) coprecipitation method, electroporation method, the microinjection method, the particle gun method, lipofection method, Agrobacterium method and the like) according to the kind of the bacterium.
[0122] Escherichia coli can be transformed according to the methods described in, for example, Proc. Natl. Acad. Sci. USA, 69, 2110 (1972), Gene, 17, 107 (1982) and the like.
[0123] The genus Bacillus can be introduced into a vector according to the methods described in, for example, Molecular & General Genetics, 168, 111 (1979) and the like.
[0124] A bacterium introduced with a vector can be cultured according to a known method according to the kind of the bacterium.
[0125] For example, when Escherichia coli or genus Bacillus is cultured, a liquid medium is preferable as a medium to be used for the culture. The medium preferably contains a carbon source, nitrogen source, inorganic substance and the like necessary for the growth of the transformant. Examples of the carbon source include glucose, dextrin, soluble starch, sucrose and the like; examples of the nitrogen source include inorganic or organic substances such as ammonium salts, nitrate salts, corn steep liquor, peptone, casein, meat extract, soybean cake, potato extract and the like; and examples of the inorganic substance include calcium chloride, sodium dihydrogen phosphate, magnesium chloride and the like. The medium may contain yeast extract, vitamins, growth promoting factor and the like. The pH of the medium is preferably about 5 to about 8.
[0126] As a medium for culturing Escherichia coli, for example, M9 medium containing glucose, casamino acid [Journal of Experiments in Molecular Genetics, 431-433, Cold Spring Harbor Laboratory, New York 1972] is preferable. Where necessary, for example, agents such as 3?-indolylacrylic acid may be added to the medium to ensure an efficient function of a promoter. Escherichia coli is cultured at generally about 15 to about 43? C. Where necessary, aeration and stirring may be performed.
[0127] The genus Bacillus is cultured at generally about 30 to about 40? C. Where necessary, aeration and stirring may be performed.
[0128] The present inventors confirmed that when PmCDA1 is used as the nucleic acid altering enzyme, the mutation introduction efficiency is increased by culturing animal cells and plant cells at a temperature lower (e.g., 20 to 26? C., preferably, about 25? C.) than usual. When a bacterium is cultured, it is also preferable to culture at the above-mentioned low temperature.
[0129] An RNA encoding the complex of the present invention can be introduced into a host cell by microinjection method, lipofection method and the like. RNA introduction can be performed once or repeated multiple times (e.g., 2-5 times) at suitable intervals.
[0130] The present inventors also confirmed using a budding yeast that when sequence-recognizing modules are produced corresponding to the adjacent multiple target nucleotide sequences, and simultaneously used, the mutation introduction efficiency drastically increases than using a single nucleotide sequence as a target, and similar effects can also be expected in the bacterium. The effect can occur both when the nucleotide sequences are in the same direction (targeted strands are the same), and when they are opposed (both strands of double stranded DNA are targeted strands).
[0131] In a preferable embodiment, it was demonstrated that mutation can be simultaneously introduced into 6 sites of the genomic DNA of a bacterium by the method of the present invention (
[0132] To express the complex of the present invention in a host bacterium, as mentioned above, an expression vector containing a DNA encoding the complex is introduced into the host bacterium. For efficient introduction of mutation or sufficient regulation of the expression of a target gene, it is desirable to maintain an expression of the complex for genome editing at a given level or above for not less than a given period. From such viewpoint, it is certain that the expression vector is incorporated into the host genome. Since continuous expression of the complex for genome editing increases the risk of off-target cleavage, it is preferably removed immediately after achieving mutation introduction. Examples of the means for removing DNA incorporated into the host genome include a method using a Cre-loxP system, a method using transposon and the like.
[0133] Alternatively, editing of host genome can be efficiently realized while avoiding the risk of off-target cleavage by causing a nucleic acid reaction in a desired stage, and transiently expressing the complex of the present invention in a host bacterium for a period necessary for stabilizing the alteration of the targeted site. While a period necessary for the nucleic acid alteration reaction and stabilizing the alteration of the targeted site varies depending on the kind of the host bacterium, culture conditions and the like, about 2 to 3 days are considered to be necessary since at least several generations of cell division are generally necessary. Those of ordinary skill in the art can appropriately determine a preferable expression induction period based on the culture conditions and the like to be used. The expression induction period of a nucleic acid encoding the complex of the present invention may be extended beyond the above-mentioned period necessary for stabilizing the alteration of the targeted site as long as the host bacterium is free of side effects.
[0134] As a means for transiently expressing the complex of the present invention at a desired stage for a desired period, a method including producing a construct (expression vector) containing a DNA encoding the complex (in mutant CRISPR-Cas system, a DNA encoding a guide RNA, a DNA encoding a Cas effector protein, and, as necessary, a DNA encoding a nucleic acid altering enzyme and/or a base excision repair inhibitor, or a transcriptional regulatory factor) in a form permitting regulation of the expression period of the complex and introducing same into the host cell can be mentioned. The form capable of regulating the expression period is specifically, for example, a nucleic acid encoding the complex of the present invention placed under regulation of an inducible regulatory region. While the inducible regulatory region is not particularly limited, it is, for example, an operon of a temperature sensitive (ts) mutation repressor and an operator regulated thereby. Examples of the ts mutation repressor include, but are not limited to, ts mutation of cI repressor from ?phage. In the case of ?phage cI repressor (ts), it is linked to an operator to suppress expression of gene in the downstream at not more than 30? C. (e.g., 28? C.). At a high temperature of not less than 37? C. (e.g., 42? C.), it is dissociated from the operator to allow for induction of gene expression. Therefore, the period when the expression of the target gene is suppressed can be minimized by culturing a host bacterium introduced with a nucleic acid encoding the complex of the present invention generally at not more than 30? C., raising the temperature to not less than 37? C. at an appropriate stage, performing culture for a given period to carry out nucleic acid conversion reaction and, after introduction of mutation into the target gene, rapidly lowering the temperature to not more than 30? C. Thus, even when an essential gene for the host cell is targeted, it can be efficiently edited while suppressing the side effects.
[0135] When temperature sensitive mutation is utilized, for example, a temperature sensitive mutant of a protein necessary for autonomous replication of a vector is included in a vector containing a DNA encoding the complex of the present invention. As a result, autonomous replication becomes impossible rapidly after expression of the complex, and the vector naturally falls off during the cell division. Examples of the temperature sensitive mutant protein include, but are not limited to, a temperature sensitive mutant of Rep101 ori necessary for the replication of pSC101 ori. Rep101 ori (ts) acts on pSC101 ori to enable autonomous replication of plasmid at not more than 30? C. (e.g., 28? C.), but loses function at not less than 37? C. (e.g., 42? C.), and plasmid cannot replicate autonomously. Therefore, a combined use with cI repressor (ts) of the above-mentioned ?phage simultaneously enables transient expression of the complex of the present invention, and removal of the plasmid.
[0136] In addition, a DNA encoding the complex of the present invention is introduced into a host bacterium under regulation of inducible promoter (e.g., lac promoter (induced by IPTG), cspA promoter (induced by cold shock), araBAD promoter (induced by arabinose) etc.), the inducing substance is added to the medium (or removed from the medium) at an appropriate stage to induce expression of the complex, culture is performed for a given period to carry out a nucleic acid alteration reaction and, introduction of mutation into the target gene, expression induction discontinuation, whereby transient expression of the complex can be realized.
[0137] The present invention is explained in the following by referring to Examples, which are not to be construed as limitative.
EXAMPLE
[0138] In the below-mentioned Examples, experiments were performed as follows.
<Design of Strain, Plasmid, Primer and Targeted gRNA>
[0139] Escherichia coli DH5? ((F.sup.? endA1 supE44 thi-1 recA1 relA1 gyrA96 deoR phoA ?80dlacZ ?M15 ? (lacZYA-argF) U169, hsdR17 (rK.sup.?, mK.sup.+), ?.sup.?) (TaKaRa-Bio), BW25113 (lacI.sup.+ rrnB.sub.T14 ?lacZ.sub.WJ16hsdR514 ?araBAD.sub.AH33 ?rhaBAD.sub.LD78 rph-1 ? (araB-D) 567 ? (rhaD-B) 568?lacZ4787 (::rrnB-3) hsdR514 rph-1) and Top10 (F-mcrA ? (mrr-hsdRMS-mcrBC) ?80 lacZ?M15 ?lacX74 nupG recA1 araD139 ? (ara-leu) 7697 galE15 galK16 rpsL (Str.sup.R) endA1 ?.sup.?) (Invitrogen) were used. The plasmids and primers used in the Examples are respectively shown in Table 1 and Table 2. An oligo DNA pair for constructing the targeted gRNA vector was designed as follows: 5-tagc- (target sequence)-3 and 5-aaac- (reverse complementary sequence of target sequence)-3.
TABLE-US-00001 TABLE 1 Plasmids used in Example Editing target is shown in italics. Plasmids Characteristics Reference General plasmids pSC101 Tc.sup.r, repA 101(Ts), Lab stock pWY121 Amp.sup.r, Erm.sup.r, B. subtilis recombination vector Wang, 2012 (23) encoding ? cI857, ? ?, ? % exo and cre recombinase genes pTAKN2 Kan.sup.r, pMB1 ori, cloning vector Lab stock Cas/CRISPR plasmids pCas9 Cm.sup.r, p15A ori, cas9, tracrRNA, repeat-BsaI_spacer-repeat Jiang, 2013 (13) pCRISPR Kan.sup.r, repeat-BsaI_spacer-repeat Jiang, 2013 (13) pScI_dCas9-PmCDA1.sub. Cm.sup.r, repA 101(Ts), ? cI857.dCas9-PmCDA1, This study J23119-sgRNA J23119-sgRNA-unit pSBP307 pScI_dCas9-PmCDA1_J23119-galK.sub.9 This study pSBP304 pScI_dCas9-PmCDA1_J23119-rpoB.sub.1 This study pScI Cm.sup.r, repA 101(Ts), ? cI857, This study pScI_dCas Cm.sup.r, repA 101(Ts), ? cI857, dCas9 This study pScI_dCas9-PmCDA1 Cm.sup.r, repA 101(Ts), ? c1857, dCas9-PmCDA1 This study pScI_dCas9-PmCDA1-LVA Cm.sup.r, repA 101(Ts), ? cI857, dCas9-PmCDA1-LVA This study pScI_dCas9-PmCDA1-UGI-LVA Cm.sup.r, repA 101(Ts), ? c1857, dCas9-PmCDA1-UGI-LVA This study pTAKN2_J23119-sgRNA Kan.sup.r, pTAKN2, J23119-sgRNA-units This study pSBP804 pTAKN2_J23119-galK.sub.10-galK.sub.11-galK.sub.13 This study pSBP806 pTAKN2_J23119-galK.sub.2-xylB.sub.1-manA.sub.1 This study pSBP808 pTAKN2_J23119-pta.sub.1-adhE.sub.3-tpiA.sub.2 This study pSBP80608 pTAKN2_J23119-galK.sub.2-xylB.sub.1-manA.sub.1-pta.sub.1adhE.sub.3-tptA.sub.2 This study pTAKN-IS1235 pTAKN2_J23119-IS1-IS2-IS3-IS5 This study pSBP8001 Kan.sup.r, pTAKN2_J23119-galK.sub.1 This study pSBP8003 pTAKN2_J23119-galK.sub.2 This study pSBP8004 pTAKN2_J23119-galK.sub.3 This study pSBP8005 pTAKN2_J23119-galk.sub.4 This study pSBP8006 pTAKN2_J23119-galK.sub.5 This study pSBP8007 pTAKN2_J23119-galK.sub.6 This study pSBP8008 pTAKN2_J23119-galK.sub.7 This study pSBP8009 pTAKN2_J23119-galK.sub.8 [20 nt] This study pSBP8010 pTAKN2_J23119-galk.sub.8 [21 nt] This study pSBP8011 pTAKN2_J23119-galK.sub.9 [20 nt] This study pSBP8012 pTAKN2_J23119-galk.sub.9 [21 nt] This study pSBP8013 pTAKN2_J23119-galK.sub.10 This study pSBP8014 pTAKN2_J23119-galK.sub.11 [20 nt] This study pSBP8015 pTAKN2_J23119-galK.sub.11 [23 nt] This study pSBP8016 pTAKN2_J23119-galK.sub.12 This study pSBP8017 pTAKN2_J23119-galk.sub.13 [20 nt] This study pSBP8018 pTAKN2_J23119-galK.sub.13 [21 nt] This study pSBP8019 pTAKN2_J23119-galK.sub.14 This study pSBP8025 pTAKN2_J23119-gsiA [A18 nt] This study pSBP8021 pTAKN2_J23119-gsiA [A20 nt] This study pSBP8022 pTAKN2_J23119-gsiA [A22 nt] This study pSBP8023 pTAKN2_J23119-gsiA [A24 nt] This study pSBP8029 pTAKN2_J23119-gsiA [B18 nt] This study pSBP8027 pTAKN2_J23119-gsiA [B20 nt] This study pSBP8040 pTAKN2_J23119-gsiA [B22 nt] This study pSBP8042 pTAKN2_J23119-gsiA [B24 nt] This study pSBP8043 pTAKN2_J23119-gsiA [C18 nt] This study pSBP8030 pTAKN2_J23119-gsiA [C20 nt] This study pSBP8045 pTAKN2_J23119-gsiA [C22 nt] This study pSBP8047 pTAKN2_J23119-gsiA [C24 nt] This study pSBP8048 pTAKN2_J23119-ycbF [18 nt] This study pSBP8050 pTAKN2_J23119-ycbF [20 nt] This study pSBP8052 pTAKN2_J23119-ycbF [22 nt] This study pSBP8037 pTAKN2_J23119-yfiH [18 nt] This study pSBP8035 pTAKN2_J23119-yfiH [20 nt] This study pSBP8056 pTAKN2_J23119-yfiH [22 nt] This study
TABLE-US-00002 TABLE2-1 PrimersusedinExample SEQID Name Sequence(5->3) NO Purpose p346 GCTACTCTAGAAAAAAAAACCCCGC 20 Xba1-rhoTer-chmrUnitR CCTGTCAGGGGCGGGGTTTTTTTTT CGGGGTTTAGCAAGATGGCAGCGC p426 GCCTGATCGATGCATCAGAAAATTA 21 Cla1-upE-P3-chmrUnitF2 TTTTAAATTTCCTCTTGACAGCTAG CTCAGTCCTAGGTATAATGCTAGCA GAGACCCGGGATGGTC p597 GATCCTTTTTGATAATCTCGTCGAC 22 Sal1-gRNArepeat_F ATAACAATTGAGCAAGAATCTTCAT CG p598 CTCACGTTAAGGGATTTIGGTCATC 23 Pst1gRNArepeatR TGCAGTGTATGCGTATTTGCGCGCT G p599 GAAGATTCTTGCTCAATTGTTATGT 24 Sal1-pTAKN2-Kan-down CGACGAGATTATCAAAAAGGATCTT CACCTAG p600 CAGCGCGCAAATACGCATACACTGC 25 Pst1-pTAKN2-colE1-up AGATGACCAAAATCCCTTAACGTGA G p669 CTGCACGCGCACTTTTATCC 26 galK_up150_F p260 CTCTGTTTGCCAACGCATTTG 27 galK50F p259 CAATGGTGACATCACGCAGG 28 galK600R p141 CCTGGGCGATAACGTAGTIGC 29 rpoB2KR p143 CCTCGGCAACCGTCGTATCC 30 rpoB1.5KF p490 CCGGTTATCGGTAGCGATAC 31 xy1BupF p491 GCCTGGGGATTATTGTGTGG 32 xy1B_1K_R p470 GCGGCTCCAGGTTACTTCC 33 manA_up50_F p471 GCCATCACTTCCAGCGC 34 manA_0.9K_R p496 GCCAAATCGGCGGTAACG 35 pta_up_F p497 CCATTTCGTAACCGCCAGTC 36 pta_0.9K_R p502 CTCTCGTATTCGAGCAGATG 37 adhE_up_F p503 CCGCCCATAGCAACCAG 38 adhE_1K_R p508 GGGGCGGCCATCTTCC 39 tpiA_up_F p509 CAGCCGAGGAAATTCAGG 40 tpiA_down_R p685 TCTTTCCCTACACGACGCTCTTCCG 41 NGSadaptor-galK_F1 ATCTCCGCAGAACAGGCAGCAGAG p686 GTGACTGGAGTTCAGACGTGTGCTC 42 NGSadaptor-galK_R1 TTCCGATCTGACAATGGGCGCATCG AGGG p687 TCTTTCCCTACACGACGCTCTTCCG 43 NGSadaptor-galK_F2 ATCTCACACCGACTACAACGACGG p688 GTGACTGGAGTTCAGACGTGTGCTC 44 NGSadaptor-galK_R2 TTCCGATCTGCTGCTGCAATACGGT TCCG p689 TCTTTCCCTACACGACGCTCTTCCG 45 NGSadaptor-galK_F3 ATCTCTTCGGCGGCGTGGACATGG p690 GTGACTGGAGTTCAGACGTGTGCTC 46 NGSadaptor-galKR3 TTCCGATCTACGACAGCCACACCTT IGGGC p691 TCTTTCCCTACACGACGCTCTTCCG 47 NGSadaptor-gisA_F ATCTGGCGGTGGAAACGGGTACCGT CG p692 GTGACTGGAGTTCAGACGTGTGCTC 48 NGSadaptor-gsiA_R TTCCGATCTCGCCCACCAGCGATAG CGTT p693 TCTTTCCCTACACGACGCTCTTCCG 49 NGSadaptor-ycbF_F ATCTGGCGCTCTTGATTTTCGCCG p694 GTGACTGGAGTTCAGACGTGTGCTC 50 NGSadaptor-ycbF_R TTCCGATCTGGATGGCACGCTGGCA ATGC p695 TCTTTCCCTACACGACGCTCTTCCG 51 NGSadaptor-yfiH_F ATCTGCCTCCCTGTGCTGTTTTGC p696 GTGACTGGAGTTCAGACGTGTGCTC 52 NGSadaptor-yfiHR TTCCGATCTGCTCAACACCCACGTT CGCC
TABLE-US-00003 TABLE2-2 SEQ SEQ Name Sequence(5'->3') IDNO Purpose Name Sequence(5'->3') IDNO Purpose 1631 GCTCATTATTTGCCCGCTTG 53 IS1-1F 716 CGGAGGAAACAGAATCAGTGTG 97 IS2-11F 1632 TGCCGGTTGCCAGATAGTC 54 IS1-1R 722 GAGATGGTGGAGATCCTCTCG 98 IS2-11R 1683 GGTCTTCAGGAAATCACCG 55 IS1-2F 717 GATAGTTAGCGATGCCGGG 99 IS2-12F 1684 CGTTCAACCACTTCAGTGTC 56 IS1-2_R 723 GGAGAATCCCCAGGTTATCTGG 100 IS2-12R 1639 CACAAAGCTGTAAATCAGCG 57 IS1-3F 718 TGAAACGTGCGGGTCTCAAC 101 IS2-13F 1640 GTCAATGCAACACCCCTTTC 58 IS1-3_R 724 GGATAGTGGTTAATGGTGGCGTC 102 IS2-13R 1635 CTACAACCAGGTCGAGTCAG 59 IS1-4F 1641 CGTGCTGAGGGCTATTTACC 103 IS3-1F 1636 GTAATCCTGCACCTCCATCAC 60 IS1-4R 1642 GACGTCATCATTTAGCCAGATG 104 IS3-1R 1628 GCCAGTAGTACCCGTCGTTG 61 IS1-5F 1643 GGTTCTCAGGTTAATGTTTCGG 105 IS3-2F 1627 CACAAGTCGTATTTCCAGAGG 62 IS1-5_R 1644 CACCAGATACTACGTTACCG 106 IS3-2R 1637 CTGCAATAAGCAGAACCACC 63 IS1-6F 1645 TTCGGACTGAAAGGAGCAAG 107 IS3-3F 1638 TGTTGTGCGGTAAGTGTCTG 64 IS1-6_R 1646 AGATTCGTGCTCACCTTTCC 108 IS3-3R 1629 GAGCAATGGATGGATTCGAAG 65 IS1-7F 1647 GATTAGTATTGGCGCTGTTGTG 109 IS3-4F 1630 TGAACAACTGTCCATGATTTCG 66 IS1-7R 1648 CAGTCCATTTCACCGTATGAG 110 IS3-4R 703 GGTACTTTCCGGGCAACCG 67 IS1-8F 1649 ACAGACGACCAGAGTAATGTC 111 IS3-5F 708 CTGCCATTAGCGCAGCCA 68 IS1-8R 1650 TGGTTACGCGCTTTCATGG 112 IS3-5R 704 CATAGCTCTACACGCCAGG 69 IS1-9F 1651 CAGGCTGAACATGGATAAGAC 113 IS5-1F 709 ATCATGGGCTCCTTTTAGTTGC 70 IS1-9R 1652 ACGTATGGACATCTAAACATCC 114 IS5-1R 705 GATATTGCCCGCCGGACAC 71 IS1-10F 1653 GCAAGGTTGTGCTTCTAAAGG 115 IS5-2F 710 CGATCTAAAGCGCGCAGC 72 IS1-10_R 1654 CCTGCAATCTAAAGGTAAGGATC 116 IS5-2R 706 GACGTTGTTGAAAATGTAGGGT 73 IS1-11F 1655 GATTGCTGTGGCAGGTTTAC 117 IS5-3F 711 GCCTAACGCCTTTAATTCAGG 74 IS1-11R 1656 CAGTACAACCTAGTTGCACC 118 IS5-3R 707 TGTTGTGGAGCCTGAACGG 75 IS1-12F 1657 TGAAGATTCCGTGCGTAACC 119 IS5-4F 712 GCAACTGTTCCGGCAGATG 76 IS1-12R 1658 CACGATGAAACCGTCAGTG 120 IS5-4_R 1556 CGGATTAATGATAAGTGGATCAG 77 IS2-1F 1659 ATGCTACTGCCGGAACAAC 121 IS5-5F 1563 CTTAGTGAATATTTGCCGACG 78 IS2-1R 1660 TGATGTCAGCGAGAAGATGG 122 IS5-5R 1557 GCTGATAAGTTACCTCCTGACC 79 IS2-2F 1661 AGCACAGGTCAATATCTTCAC 123 IS5-6F 1564 GCGACTATACAGGTTATTGACC 80 IS2-2R 1662 AATATAGACCCGCAGATGATG 124 IS5-6R 1685 ACATTACAGAGAAGCCGATG 81 IS2-3_F 1663 TCCGCCAGGATTGATTTTCG 125 IS5-7F 1686 GTGATAGTTAGCGATGCCG 82 IS2-3R 1664 CTCCGGGTATGGAGCTATG 126 IS5-7R 1559 GGACGAATAAACGCATAATTAC 83 IS2-4F 1665 GATCAGGACGCTCATATTCG 127 IS5-8F 1566 TCCCAACCTTCTGTCACAG 84 IS2-4R 1666 CTGTCATGTCGGTTAGTTCC 128 IS5-8R 1560 CAATTTTCGCACCGGAATC 85 IS2-5F 1667 ACAGGATGAAAGTCTTTGCC 129 IS5-9F 1567 ATGGAGATACGACAATCAGC 86 IS2-5R 1668 GCAATTTCCGCTTTTGCTCG 130 IS5-9_R 1561 CAATTCCTGGAACATTATCCG 87 IS2-6F 1681 AACTGCTTCTCCTCACCATC 131 IS5-10_F 1568 TGAGTGATGTTTTGGCGAC 88 IS2-6R 1682 AGAATCGTCTGGCGGTTG 132 IS5-10R 1562 CTGTACTCACAGGGTGATG 89 IS2-7F 1671 CATCAGAATCAATGCTGCG 133 IS5-11F 1569 GGCAGACAGTTTGAAACC 90 IS2-7R 1672 TCGCTGACTTCAGTTTCGC 134 IS5-11_R 713 CGCCACGAACGTAGTTAGC 91 IS2-8F 1673 GCCTGCCAGATGATATGGTC 135 IS5-12F 719 GATTGGTGAACACACCGACTAC 92 IS2-8R 1674 ACCAGACCGTGGTTGTTAG 136 IS5-12R 714 GGTCAGGTGGTTTGGAAAGC 93 IS2-9F 725 TTTGTTATCCAGCCATGATGTTTTC 137 IS5-13F 720 AAGTGGACACGCTATACCTGC 94 IS2-9R 728 TTCCTGTATACCTGAAACGACAATG 138 IS5-13R 715 CACTCAACACATACCGTGCC 95 IS2-10F 726 CACGCACATACAACGGAGGG 139 IS5-14F 721 CAACACCAAACTGGAACACGG 96 IS2-10R 729 TTGACTGTGCGCAACATCCC 140 IS5-14R 727 CCTATTCCGCCCATGACC 141 IS5-15F 730 CAAAGGTCCAGGCTTTTGGG 142 IS5-15R
<Plasmid Construction>
[0140] pCas9 and pCRISPR plasmids were obtained from the Marraffini lab (non-patent literature 8) via Addgene. Nickase Cas9:nCas9 (D10A or H840A) and nuclease lack Cas9: dCas9 (D10A and H840A) (SEQ ID NO: 1 and 2) (Jinek, M. et al., Science 337, 816-822 (2012).) were produced by the PCR method. PmCDA1 (SEQ ID NO: 3 and 4) was fused to the C-terminus of nCas9 or dCas9 with 121 amino acid peptide linkers (SEQ ID NO: 5 and 6) (
[0141] A plasmid pScI_dCas9-PmCDA1 J23119-sgRNA carries sgRNA unit (SEQ ID NO: 15) driven by synthetic constitutive promoter J23119 (BBa_J23119 in the registry for standard biological parts) (parts.igem.org/Part: BBa_J23119) (SEQ ID NO: 16) amplified by PCR using p346/p426. sgRNA-expression unit contains two BsaI restriction sites for insertion target sequence. A pair of oligo DNA that contains target sgRNA sequence was annealed and ligated into BsaI-digested pScI_dCas9-PmCDA1_sgRNA.
[0142] pScI and pScI_dCas9 are carrying only A operator and operator-dCas9, respectively. pScI_dCas9-PmCDA1 is carrying dCas9-PmCDA1 gene. The degradation tag (LVA tag) and UGI gene are added to the C-terminus of the dCas9-PmCDA1 gene, resulting plasmid pScI_dCas9-PmCDA1-LVA and pScI dCas9-PmCDA1-UGI-LVA, respectively.
[0143] The vector plasmid pTAKN-2 has pMB1 origin compatible with pSC101. sgRNA-unit with the promoter J23119 was digested from synthetic oligonucleotide by EcoRI-HindIII, followed by ligation to the cloning vector pTAKN2. The plasmid harboring tandem three target sequences (pSBP804, galK_10-galK_11-gal_13; pSBP806, galK_2-xylB_1-manA_1; pSBP808, pta_1-adhE_3-tpiA_2) were constructed using Golden Gate assembly of the PCR product using BsaI digestion-ligation (Engler, C. et al., PLOS One 4, (2009).). The plasmid harboring different six target sequences (pSBP80608) was constructed using Gibson Assembly of the PCR products amplified from pSBP808 (pta_1-adhE_3-tpiA_2 tandem-sequence) by primers p597/598 and from pSBP806 (vector and galK_2-xylB_1-manA_1 tandem-sequence) by primers p599/p600. For IS-editing plasmid, sgRNA-expressing units were tandemly aligned in the order of IS1, IS2, IS3 and IS5.
<Mutagenesis Assay>
[0144] DH5? or BW25113 cells chemically transformed with objective plasmid (s) were pre-cultured with 1 mL SOC medium (2% Bacto Tryptone, 0.5% Yeast Extract, 10 mM NaCl, 2.5 mM KCl, 1 mM MgSO.sub.4 and 20 mM glucose). After incubation for 2-3 hr at 28? C., cell cultures were diluted 1:10 into 1 ml of Luria-Bertani (LB) broth or terrific broth (TB), supplemented with the following antibiotics as needed: chloramphenicol (25 ?g/ml) and/or kanamycin (30 ?g/ml), and grown overnight at 28? C. in 100K rpm using maximizer (TAITEC, Saitama, Japan). Next day, cell cultures were diluted 1:10 into 1 ml media again and cultured for 6 hr at 37? C. for induction, followed by overnight incubation at 28? C. The cell cultures were then spotted in serial dilution onto LB or TB agar plates supplemented with appropriate antibiotics, incubated overnight at 28? C. to form single colonies.
[0145] For positive-selection for galK gene disruption, cells were grown in M63 minimal medium (2 g/L (NH.sub.4).sub.2SO.sub.4, 13.6 g/L KH.sub.2PO.sub.4, 0.5 mg/L FeSO.sub.4-7H.sub.2O, 1 mM MgSO.sub.4, 0.1 mM CaCl.sub.2) and 10 ?g/ml thiamine) containing 0.2% glycerol and 0.2% 2-deoxy-galctose (2-DOG) (Warming, S. et al., Nucleic Acids Res. 33, 1-12 (2005).). For selection for rifampicin-resistant mutation of rpoB gene, cells were grown in LB broth containing 50 ?g/ml rifampicin. For the sequencing analysis, colonies were randomly collected and directly amplified using appropriate primers by PCR and were analyzed by Sanger sequencing using a 3130XL Genetic Analyzer (Applied Biosystems). The t-test statistical analysis was done using Excel software (Microsoft).
<Whole Genome Sequencing>
[0146] BW25113 cells harboring each expression construct (dCas9, dCas9-PmCDA1, dCas9-PmCDA1-LVA-UGI and dCas9-PmCDA1 with rpoB_1 target) were pre-incubated overnight, diluted 1:10 into 1 mL LB media and grown for 6 hr at 37? C. for induction, followed by overnight incubation at 28? C. Cells were spread onto rifampicin-containing plate medium to isolate single colonies. Each three independent colonies were inoculated into TB medium. Genomic DNA was extracted using Wizard Genomic DNA Purification Kit (Promega) and then fragmented by sonication using Bioruptor UCD-200 TS Sonication System (Diagenote) to obtain fragments with size distribution at 500-1000 bp. Genomic DNA library was prepared by using NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs) and labeled by Dual Index Primers. Size selection of the library was done using Agencourt AMPure XP (Beckman Coulter) to obtain tagged fragments with length ranging from 600 to 800 bp. Size distribution was evaluated by the Agilent 2100 Bioanalyzer system (Agilent Technologies). DNA was quantified using Qibit HS dsDNA HS Assay Kit and fluorometer (Thermo Fisher Scientific). Sequencing was performed using MiSeq sequencing system (Illumina) and Miseq Reagent Kit v3 to obtain 2?300 bp read length, expecting approximately 20-fold coverage for the genome size. Data analysis was done by using CLC Genomic Workbench 9.0. (CLC bio). The sequence reads were paired and overlapping reads within a read pair were merged then trimmed based on a quality limit of 0.01 with a maximum of 2 ambiguities. Reads were mapped to Escherichia coli BW25113 reference genome by the following setting (Masking mode=no masking, Mismatch cost=2, Insertion cost=3, Deletion cost=3, Length fraction=0.5, Similarity fraction=0.8, Global alignment=No, Auto-detect paired distances=Yes, Nonspecific match handling=ignore). Local realignment was done with defaults settings (Realign unaligned ends=Yes, Multi-pass realignment=2). The variant calling was performed with the following settings (Ignore positions with coverage=1,000,000, Ignore broken pairs=Yes, Ignore Nonspecific matches=Reads, Minimum coverage=5, Minimum count=2, Minimum frequency=50%, Base quality filter=No, Read detection filter=No, Relative read direction filter=Yes, Significance=1%, Read position filter=No, Remove pyro-error variants=No). Output file was arranged using Excel (Microsoft).
<Deep Sequencing of Target Regions>
[0147] DH5? cells expressed dCas9-PmCDA1 or dCas9-PmCDA1-UGI-LVA with gRNA targeting galK, gsiA, ycbF or yfiH genes were incubated overnight, diluted 1:10 into 1 mL LB media and grown for 6 hr at 37? C. for induction. Cell cultures were collected and genomic DNA was extracted. Target region-containing fragment (?0.3 kb) was directly amplified using primer pairs (p685-p696) from the extracted genomic DNA. The amplicon was labeled by Dual Index Primers. More than 30,000 reads per sample on average were analyzed by MiSeq sequencing system. The sequence reads were paired and trimmed based on a quality limit of 0.01 with a maximum of 2 ambiguities and then overlapping reads within a read pair were merged. Reads were mapped to each reference sequence by the following settings (Masking mode=no masking, Mismatch cost=2, Insertion cost=3, Deletion cost=3, Length fraction=0.5, Similarity fraction=0.8, Global alignment=No, Auto-detect paired distances=Yes, Nonspecific match handling=Map randomly). Output file was arranged using Excel.
Example 1 Deaminase-Mediated Target Mutagenesis in Escherichia Coli
[0148] To assess whether the deaminase-mediated targeted mutagenesis is applicable in bacteria, a bacterial Target-AID vector was constructed that expresses catalytically inactivated Cas9 (dCas: D10A and H840A mutations) fused to the cytosine deaminase PmCDA1 from P. marinus (sea lamprey) (non-patent literature 11) (CDA) under temperature-inducible ? operator system (Wang, Y. et al., Nucleic Acids Res. 40, (2012).) and 20-nucleotides (nt) target sequence-gRNA scaffold hybrid (sgRNA) under a synthetic constitutive promoter J23119 (
[0149] To assess the efficacy of targeted mutagenesis quantitatively, galK gene was used as a target whose loss of function can be positively selected by a galactose analog 2-deoxi-D-galactose (2-DOG), which is catalyzed by the galK gene product galactokinase to form a toxic compound (Warming, S. et al., Nucleic Acids Res. 33, 1-12 (2005).). As Target-AID is known to induce mutations at cytosine nucleotides (C) located around 15-20 bases with core region of 16-19 bases upstream of the protospacer adjacent motif (PAM) sequence (non-patent literature 11) (
[0150] Next, an essential gene rpoB was targeted that encodes the ?-subunit of RNA polymerase. While disturbing gene function of rpoB would cause cell growth suppression or cell death, specific point mutations in rpoB gene are known to confer rifampicin resistance (Jin, D. J. et al., J. Mol. Biol. 202, 245-253 (1988).). A targeting sequence was designed to induce a point mutation that confers rifampicin resistance (
Example 2 Effect of sgRNA Length and Uracil DNA Glycosylase Inhibitor on the Mutational Frequency and Positions
[0151] To comprehensively analyze mutational efficiency and position, deep sequencing analysis was performed using 18 targeting sequences at galK gene (
[0152] To improve mutational efficiency, uracil DNA glycosylase inhibitor (UGI) from bacteriophage PBS2 (Zhigang, W. et al., Gene 99, 31-37 (1991).) and protein degradation tag (LVA-tag) (Andersen, J. B. et al., Appl. Environ. Microbiol. 64, 2240-2246 (1998).) were introduced by fusing at the C-terminus of dCas-CDA. UGI boosts the mutagenesis by cytidine deamination because it inhibits removal of uracil (immediate product of cytosine deamination) from DNA (non-patent literatures 10, 11). Use of the LVA-tag is expected to protect cells from injury and suppress the occurrence of escaper cells by decreasing the half-life of the dCas-CDA-UGI protein, which could be potentially harmful when expressed in excess. To assess the non-specific mutagenesis effect, whole genome sequencing analysis was performed on the cells expressing dCas, dCas-CDA and dCas-CDA-UGI-LVA. While dCas-CDA induced 0 to 2 SNV mutations, dCas-CDA-UGI-LVA induced 21-30 mutations with no positional bias in the entire genome (Table 3 and Table 4).
TABLE-US-00004 TABLE 3 Whole genome sequencing analysis of rifampicin resistance variant Number C:G rpoB mutation of to Sequence Amino other T:A Strain Clone coverage Position acid variants SNV dCas 1 22.8 4172707 S512F 0 0 dCas-CDA 1 34.7 4172764 S531F 2 1 2 28.1 4172718 D516N 0 0 3 20.5 4172718 D516N 0 0 dCas-CDA- 1 17.3 4172737 S522F 21 21 UGI-LVA 2 23.3 4172737 S522F 30 29 3 24.0 4172863 P564L 29 29
[0153] Rifampicin selected clones expressing each constructs (dCas, dCas-CDA or dCas-CDA-LVA-UGI) without sgRNA were subjected to whole genome sequencing. Biological triplicate was shown for dCas-CDA and dCas-CDA-LVA-UGI. Sequence coverage was calculated as sum base pair of mapped sequence over 4,631 Mopof Escherichia coli BW25113 genome sequence. List of unique mutation is shown in Table 4.
TABLE-US-00005 TABLE 4 List of unique SNV mutations The detail of SNV detected by whole genome sequencing is shown in Table 3. Strain_Clone Region Gene Reference Allele dCas-CDA_1 883372 rcdA C T 1371764 ycjS T A dCas-CDA-- 31518 carB C T UGI-LVA_1 97137 marG C T 290595 intergenic C T 652855 espE C T 689724 miaB C T 896435 artM C T 1267335 intergenic C T 2054913 nac G A 2062420 yoaA G A 2072468 intergenic G A 2110764 wcaK G A 2550667 intergenic C T 3322221 intergenic G A 3681689 yhjK G C 3692110 bcsG G A 3983269 hemC C T 4110323 intergenic G A 4335067 yjdF C T 4480068 idnR C T 4596191 tRNA-Leu G A 4596193 tRNA-Leu G A dCas-CDA-- 800029 ybhJ C T UGI-LVA_2 1024591 23S rRNA C T 1050689 torS G A 1199523 ymfM C T 1644392 ydfE G A 1723279 intergenic G A 1728672 intergenic C T 1761805 ydiJ G A 2063321 IS2 transposase G A 2072468 intergenic G A 2208318 mlrA C T 2245059 nfo C T 2249454 yeiL G A 2261905 yeiR G A 2416291 yfcI A C 2438584 yfcA G A 2563453 eutJ G A 2668799 yphC G A 2957527 ppdA G A 3168170 parE G A 3365636 nanT G A 3374392 degQ C T 3441395 50S rRNA G A 3521736 yrfF G A 3787020 yibB G A 3921738 viaA C T 4233085 malG C T 4291989 mdrO C T 4357531 aspA C T 4486193 intergenic C T dCas-CDA-- 124371 intergenic C T UGI-LVA_3 268728 ykfC C T 701013 nagE C T 1094697 ycdX C T 1253681 pth C T 1356138 puuD C T 1513742 curA G A 1552442 ddpD G A 1771594 ydtO G A 1950273 torZ G A 2025444 dcm G A 2221782 mdtQ G A 2298519 intergenic G A 2312704 resC G A 2730338 intergenic C T 2769113 ypjI G A 2811281 intergenic G A 3009344 ygfK G A 3055007 scpA G A 3542313 malQ G A 3572324 yhhW G A 3574775 yhhY G A 3601990 zniA G A 4111319 hslU G A 4133803 frwB C T 4347276 codA C T 4384586 unr C T 4386604 omiB C T 4492813 IS4 transposase C T
[0154] dCas-CDA-UGI-LVA showed robust mutagenesis at the all targeted sites regardless of the length and position of the target sequence (
Example 3 Multiplex Mutagenesis
[0155] For multiplex editing, tandem repeat of sgRNA expression units was assembled onto a separate plasmid from the plasmid for alteration. A plasmid targeting three sites in the galK gene (galK_10, galK_11 and galK_13) was constructed and co-introduced into cells with the vector for alteration expressing dCas, dCas-CDA, dCas-CDA-LVA or dCas-CDA1-UGI-LVA. First, non-specific mutagenesis effect was assessed by analyzing occurrence of rifampicin resistance mutation (
[0156] Six different genes; galK, xylB (xylulokinase), manA (mannose-6-phosphate isomerase), pta (Phosphate acetyltransferase), adhE (Aldehyde-alcohol dehydrogenase), and tpiA (Triosephosphate isomerase) were then targeted to introduce stop codons (
Example 4 Multiple-Copy Gene Editing by Target-AID
[0157] Multi-copy elements occupy a substantial amount of genome sequence. Unlike other methods that involves recombination or genomic cleavages, Target-AID may edit multiple loci at once using the same sgRNA sequence without inducing genomic instability. For a proof of concept, the four major transposable elements (TEs: IS1, 2, 3, and 5) in Escherichia coli genome were targeted simultaneously by using four sgRNAs. Ten, twelve, five and fourteen loci for IS1, 2, 3, and 5, respectively, were able to be amplified specifically by unique PCR primers for each locus. The sgRNAs were designed to contain the common sequences of the transposase genes of each TE to introduce stop codons (
TABLE-US-00006 TABLE5 ListofISoff-targetcandidatesitesassessedbywholegenome sequencing. Mis- SEQ ID Frequency(%) Target Region Strand match Sequence NO PAM gene Clone_1 Clone_2 IS1 0 CATCCATATCACCACGTCAA 143 AGG insA IS1off-1 459398-459420 ? 10 GGTGGCATCGCCCACGTCAA 144 TGG ybbA <0.1 <0.1 IS1off-2 2084230-2084252 + 6 GTCCATTAGCACCACGTCAA 145 CGG uvrY 100 100 IS1off-3 2617074-2617096 + 11 TGCAATCGCCTTCACGTCAA 146 TGG yfeH <0.1 <0.1 IS1off-4 2965681-2965703 + 10 ATAGCGGTAGGCCACGTCAA 147 TGG cysN <0.1 <0.1 IS1off-5 3677105-3677127 ? 11 TGGGCGCTGTTGCACGTCAA 148 TGG rimL <0.1 <0.1 IS1off-6 4615816-4615838 + 9 ACCACCGCGTACCACGTCAA 149 TGG fecA <0.1 <0.1 IS2 0 AGCCACTCCACTGGAGACGA 150 CGG insD1 IS2off-1 2664330-2664352 ? 9 GATCTTGTGACCGGAGACGA 151 CGG eutQ <0.1 <0.1 IS2off-2 2797547-2797569 + 9 CCCGTTTTGCCAGGAGACGA 152 CGG rseC <0.1 <0.1 IS2off-3 3478902-3478924 6 CATCTCTGCTCTGGAGACGA 153 TGG degs <0.1 <0.1 IS3 0 ACCACGTATACCAGCCGCTG 154 CGG insE1 IS3off-1 229782-229804 ? 10 AATTATCTCCACAGCCGCTG 155 TGG pepD <0.1 <0.1 IS3off-2 297081-297103 + 9 GAAGTGTTGATGAGCCGCTG 156 AGG ykgE <0.1 <0.1 IS3off-3 828708-828730 + 9 AAAAGCCGAGGCAGCCGCTG 157 CGG tolA <0.1 <0.1 IS3off-4 992936-992958 + 8 AACGTTGAAGTCAGCCGCTG 158 GGG sers <0.1 <0.1 IS3off-5 1031011-1031033 + 10 CAGAGCAGGTTCAGCCGCTG 159 CGG mukB <0.1 <0.1 IS3off-6 2009292-2009314 + 7 CATGCCAATATCAGCCGCTG 160 TGG rsmL 100 100 IS3off-7 2236079-2236101 + 7 TCTGCTGCTGCCAGCCGCTG 161 AGG alkA <0.1 <0.1 IS3off-8 2381447-2381469 ? 8 AAGAAGAGATCAAGCCGCTG 162 TGG ccmH <0.1 <0.1 IS3off-9 2417471-2417493 ? 9 GACAACAGTCTTAGCCGCTG 163 GGG yfaQ <0.1 <0.1 IS3off-10 2484639-2484661 ? 9 AGACATACAGCCAGCCGCTG 164 TGG nuoL <0.1 <0.1 IS3off-11 2495424-2495446 + 10 TTACTAAAAAAAAGCCGCTG 165 GGG inter- <0.1 <0.1 genic IS3off-12 2495435-2495457 ? 9 GTGTAAAAAACGAGCCGCTG 166 GGG inter- <0.1 <0.1 genic IS3off-13 2517513-2517535 + 9 CGCATAGCTGGAAGCCGCTG 167 TGG argT <0.1 <0.1 IS3off-14 2629660-2629682 ? 8 AATTAGTGGTGCAGCCGCTG 168 GGG cysA <0.1 <0.1 IS3off-15 3232817-3232839 ? 8 TGCTGGTCTTTGAGCCGCTG 169 TGG gss <0.1 <0.1 IS3off-16 3251435-3251457 ? 10 TTCCGGATAGTTAGCCGCTG 170 CGG yqhD <0.1 <0.1 IS3off-17 3382350-3382372 + 7 AGCATATCGTGCAGCCGCTG 171 GGG agaI <0.1 <0.1 IS3off-18 3393244-3393266 I 8 GGCGGGTTTTTTAGCCGCTG 172 GGG yraQ <0.1 <0.1 IS3off-19 4109690-4109712 I 10 CGGCTCGCTCGCAGCCGCTG 173 CGG yigM <0.1 <0.1 IS3off-20 4378317-4378339 + 10 CTGCGATTCCTCAGCCGCTG 174 GGG yjcE <0.1 <0.1 IS3off-21 4418352-4418374 + 10 ACACGTCGATATAGCCGCTG 175 CGG phnI <0.1 <0.1 IS5 0 GTGCCACTGATTGCCTTTCT 176 TGG insH1 IS5off-1 1632093-1632115 ? 5 GTACCTGTATTTGCCTTTCT 177 CGG narU <0.1 <0.1 IS5off-2 3273904-3273926 + 10 TTATCGGCCTGAGCCTTTCT 178 GGG tolC <0.1 <0.1 IS5off-3 3775233-3775255 ? 10 CTTAACGTCCGCGCCTTTCT 179 CGG kdgK <0.1 <0.1 IS5off-4 4553528-4553550 + 7 CTGACCGATAATGCCTTTCT 180 TGG ytfT 1.2 <0.1
[0158] Region indicates the target sites in DH10B database. Strand indicates orientation of the target sites. Probable off-target sequences were determined as described in the present specification. Mismatch indicates number of mismatches between on-target and off-target sequences. Mismatch nucleotides are highlighted in bold. Frequencies of C-to-T mutations at each sequence highlighted in italics are shown.
Example 5 Comparison of Transformation Efficiency of Escherichia Coli by Vector for Yeast Expression
[0159] Vectors for yeast expression encoding LbCpf1 (SEQ ID NO: 326 and 327) as Cas effector protein, YAASV or YALAA as proteolysis tag (vector 3685: Cpf1-NLS-3xFlag-YAASV (SEQ ID NO: 328), vector 3687: Cpf1-NLS-3xFlag-YALAA (SEQ ID NO: 329)), and a control vector free of nucleic acid encoding proteolysis tag (vector 3687: Cpf1-NLS-3xFlag (SEQ ID NO: 330)) were generated using pRS315 vector as the base. Using these vectors, the transformation efficiency of Escherichia coli was verified. Schematic drawing of each vector is shown in
TABLE-US-00007 TABLE 6 3685 3686 3687 Plasmid conc (ng/ul) 13 13.5 17 Dilution(to 2 ng/ul) 3.1 + 16.9 3.0 + 17 2.4 + 17.6 Colony in 10 ul 39 96 28 Colony in 1 ul 3 4 1
[0160] It was shown that the transformation efficiency of Escherichia coli was high when vector 3685 and vector 3686 having a nucleic acid encoding a proteolysis tag were used, as compared to the use of the control vector 3687. Therefore, use of a proteolysis tag is expected to improve replication efficiency when replicating vectors in bacteria such as Escherichia coli and the like even if the vector is for expressing a heterologous organism.
[0161] This application is based on Japanese patent application No. 2017-225221 filed in Japan (filing date: Nov. 22, 2017), the contents of which are encompassed in full herein.
INDUSTRIAL APPLICABILITY
[0162] According to the present invention, a vector which is stable and amplifiable even in a host bacterium and has low toxicity, and a complex for genome editing which is encoded by the vector are provided. According to the method for genome editing using the nucleic acid and nucleic acid altering enzyme of the present invention, it is possible to alter the gene of a host bacterium while suppressing non-specific mutation and the like. Since this method does not rely on host dependent factors such as RecA, it can be applied to a wide range of bacteria, and is extremely useful.